Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/ou_press/dietary-supplementation-with-a-bacillus-superoxide-dismutase-protects-o2oJ63voOw
- Publisher
- Oxford University Press
- Copyright
- Copyright © 2018 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
- ISSN
- 1873-9946
- eISSN
- 1876-4479
- DOI
- 10.1093/ecco-jcc/jjy034
- pmid
- 29547907
- Publisher site
- See Article on Publisher Site
Abstract
Abstract Background and Aims Commercial superoxide dismutase [SOD] is derived from melon extract and has a potential as a dietary supplement due to its beneficial antioxidative effects. We aimed to improve the productivity of SOD compared with plant SOD by using a generally regarded as safe [GRAS] microorganism, Bacillus amyloliquefaciens, and assess its antioxidative effect using γ-radiation- and dextransulphate sodium [DSS]-induced oxidative models in mice. Methods We identified the sodA gene encoding manganese-containing SODs [Mn-SOD] in B. amyloliquefaciens, constructed a Mn-SOD deficient mutant, and screened a high-SOD-producing strain. We compared the antioxidative effect of orally administered enteric-coated SOD protein partially purified from B. amyloliquefaciens with wild-type and high-SOD-producing strain spores. The effect of SOD on DSS-induced colitis was also investigated. Colonic inflammation was assessed using disease activity index, macroscopic and histological damage scores, antioxidant enzyme activities, and inflammatory cytokines. Results The SOD activity of B. amyloliquefaciens is derived from secreted Mn-SOD encoded by the sodA gene, as shown by comparing sodA knock-out mutant spores with wild-type and high-SOD-producing spores. Enteric-coated SOD of B. amyloliquefaciens appears to be effective in reducing oxidative stress in γ-radiation- and DSS-induced mouse models. Co-administration of SOD with wild-type B. amyloliquefaciens or high-SOD-producer strain spores showed a synergistic effect. SOD enzyme and B. amyloliquefaciens spores contribute to the reduction of oxidative stress and inflammatory response in DSS-induced colitis. Conclusions Mn-SOD of B. amyloliquefaciens could be another source of SOD supplement and may be useful to prevent and treat ulcerative colitis. Inflammatory bowel diseases, superoxide dismutase, Bacillus amyloliquefaciens 1. Introduction Oxidative stress, involved in many diseases, is defined as an impaired balance between reactive oxygen species [ROS] production and antioxidant defences. Antioxidant enzymes, such as superoxide dismutase [SOD], play a key role in diminishing oxidative stress.1,2 Thus, the removal of ROS by exogenous SODs has been suggested as an effective preventive strategy against various diseases, and oral supplementation with melon-derived SOD has been shown to have a therapeutic value in both animal and clinical trials.1,3 SODs are widely distributed in prokaryotic and eukaryotic cells, and have been classified into four families based on their different types of metal centres [copper/zinc, nickel, manganese, and iron].4 Manganese-containing SODs [Mn-SODs] are widely present in many bacteria, chloroplasts, mitochondria, and cytosol of eukaryotic cells. Mn-SODs in the mitochondria have been suggested to function as tumour suppressors, and cancer cells generally have diminished Mn-SOD activity.5 Aerobic organisms generate ROS, and environmental stresses induced by a wide range of environmental factors, including heavy metals, can lead to overproduction of ROS and alter intracellular redox status, ultimately leading to cell death.6 It has been reported that the heavy metal resistance of several Bacillus strains is related to oxidative enzyme activities.6,7 The effect of probiotic Bacillus coagulans in alleviating mercury toxicity has also been reported in rats.8 Ionising radiation exposure causes direct ionisation of cellular atoms and secondary activation, in which energy is transferred to atomic particles, such as electrons, that may lead to changes in cellular function and most commonly activation of cells. Exogenous SOD has been shown to have the ability to repair vegetative B. subtilis cell damage and improve cell survival rate and internal SOD activity in cells irradiated by gamma radiation.9 A diet containing B. subtilis strain increased the SOD level of serum or tissues significantly in several fish strains.10–13B. subtilis has been found to increase the level of antioxidant enzymes, including SOD, in broiler chickens.14 These findings led us to develop Bacillus SOD as an alternative antioxidative enzyme for oral supplementation. The microbial fermentation could be extended in capacity relatively easily, and productivity could be maximised through the breeding of the strain and optimisation of fermentation. B. amyloliquefaciens, recently determined to be a separate species from B. subtilis, produces spores with strong resistance to adverse conditions, making it well-suited for commercial use.15 In 1999, the Food and Drug Administration [FDA] published a final rule in the Federal Register affirming that carbohydrase and protease enzyme preparations from B. subtilis or B. amyloliquefaciens are generally regarded as safe [GRAS] for use as direct food ingredients.16 The species traditionally included in the B. subtilis group [B. subtilis, B. licheniformis, B. amyloliquefaciens, and B. pumilus] have also been given a ‘Qualified Presumption of Safety’ by the European Food Safety Authority.17 Many studies have reported on the properties of B. amyloliquefaciens, including its antioxidant effects and probiotic potential.18–25B. amyloliquefaciens has also been reported to be useful in the management of inflammatory bowel disease [IBD].26 However, there are no studies to date regarding the use of any SOD enzyme from Bacillus strains, including B. amyloliquefaciens. Therefore, we tested B. amyloliquefaciens strain GF423 as a SOD producer. B. amyloliquefaciens strain GF423, formerly classified as B. polyfermenticus, belongs to the species B. amyloliquefaciens according to molecular taxonomy. It is more closely related to B. amyloliquefaciens FZB42, the type strain of B. amyloliquefaciens subspecies plantarum, than to B. amyloliquefaciens DSM7, the type strain of B. amyloliquefaciens subspecies amyloliquefaciens. Its ability to produce more SOD than wild-type B. amyloliquefaciens renders it an excellent candidate for SOD production for the treatment of inflammatory bowel disease [IBD]. IBD is a chronic inflammatory disorder of the gastrointestinal tract. Crohn’s disease and ulcerative colitis, the two most common clinical forms of IBD, affect millions of patients around the world.27,28 Oxidative stress plays a pivotal role in the initiation and progression of IBD.29 Decreased levels of SOD activity are associated with increased inflammatory processes, indicating that inflammation may be caused by insufficient antioxidant activity in patients with IBD.30,31 Since the local colonic delivery of SOD by bacteria is effective in reducing experimental colitis, and lactic acid bacteria [LAB] have been used as vehicles to deliver therapeutic agents in the gut, engineering LAB to produce SOD has been investigated as a supplement to traditional IBD treatments.32–36 However, the use of genetically modified bacteria in humans remains difficult to date; therefore, the use of wild-type bacteria selected for their production of SOD, and/or other enzymes that neutralise ROS, may be a more promising means of IBD treatment.37 Until now, no research regarding oral administration of SOD for IBD treatment has been tried, due to the assumption of its inefficient delivery because of the enzyme’s short half-life. However, enteric coatings may make the oral delivery of SOD feasible. In this work, we identified the Mn-SOD gene of B. amyloliquefaciens, purified the SOD enzyme, and screened a high-SOD-producing strain for the production of SOD on an industrial scale. We also assessed the possibility of enteric-coated SOD as a dietary supplement using γ-radiation- and DSS-induced ulcerative colitis mouse models. 2. Materials and Methods 2.1. Chemical compounds used Dextran sulphate sodium [DSS] was obtained from MP Biochemicals Korea [Songpa-gu, Seoul, Korea]. The enzyme assay kit, for measuring superoxide dismutase [SOD], catalase [CAT] ,and glutathione peroxidase [GPx] levels, was purchased from Cayman Chemical Company [Ann Arbor, MI, USA]. Enzyme-linked immunosorbent assay [ELISA] kits, for measuring inflammatory cytokines tumour necrosis factor alpha [TNF-α], interleukin 1 beta [IL1-β], and interleukin 6 [IL-6], were obtained from R&D systems [Minneapolis, MN, USA]. 2.2. Bacterial strains and DNA manipulation B. amyloliquefaciens GF423 was obtained from the Korean Collection for Type Cultures. The sodA gene was cloned by polymerase chain reaction [PCR] from the genome of B. amyloliquefaciens GF423 using the following primers based on DNA sequence of B. amyloliquefaciens FZB42: 5′ gggatgaacacaagtgagag 3′ and 5′ aagctcatgaccacagcaag 3′. The PCR product of about 2 kb was cloned using Mighty TA-cloning Kit [Takara] and its nucleotide sequence was determined by ABI3730XL DNA analyser [Applied Biosystems]. The strain with deletion of sodA function, B. amyloliquefaciens ΔsodA, was constructed by a double-crossover recombination as follows. A pair of DNA fragments flanking the sodA gene of B. amyloliquefaciens GF423 for homologous recombination was amplified using PCR with the following primers: 5′ aaacagctgggatgaacacaagtgagag 3′ and 5′ cacactcttaagtttgcttccaattctggaagtttgtaag 3′ for the upstream fragment; and 5′ ctactgacagcttccaaggatacctgaactaccaaaaccg 3′ and 5′ aaacagctgaagctcatgaccacagcaag 3′ for the downstream fragment. The erythromycin-resistant [EmR] gene was amplified using PCR from pDG166438 with the following primers: 5′ gaagcaaacttaagagtgtg 3′ and 5′ tccttggaagctgtcagtag 3′. The upstream fragment, the EmR gene, and downstream fragment were assembled in order and cloned into the PvuII site of plasmid pUori-ts containing the temperature-sensitive replication origin working in B. subtilis.39 The resulting plasmid was transformed into B. amyloliquefaciens GF423 by electroporation.40 The sodA knock-out mutant was selected from the transformants resistant to Em [5 μg/mL] at 42 °C and then plasmid-cured at 30 °C. The genomic status around the sodA region was confirmed by PCR and DNA sequencing of the PCR product. The sodA overproducing strain, B. amyloliquefaciens GF424, was selected from a mutant library, which was prepared using ultraviolet [UV] irradiation.41 The sodA gene of B. amyloliquefaciens GF424 was confirmed to be identical with that of the wild type by DNA sequencing. B. amyloliquefaciens strains were cultivated in tryptic soy broth at 37°C [BD]. PCR was performed using standard methods with Takara Advantage 2 Polymerase. Restriction enzymes and DNA-modifying enzymes were purchased from New England Biolabs [NEB]. All other reagents were purchased from Sigma unless otherwise mentioned. 2.3. Preparation of test materials The test materials for oral administration were prepared as follows. For preparation of SOD powder, B. amyloliquefaciens GF424 was grown in tryptic soy broth at 37°C for 24 h. The culture supernatant was collected by centrifugation at 7500 rpm for 10 min at 4°C. The collected supernatant was filtered through 0.25-μM pore-size membrane [Sartorius] and then concentrated 10-fold by ultrafiltration using a polyethersulphone membrane [Sartorius] with a molecular weight cut-off of 10 kDa. Enteric coating was conducted as follows: UF concentrate was mixed with the same volume of 0.1% [w/v] shellac solution dissolved in distilled water and 5% ethanol, and the mixture was lyophilised. For the preparation of the endospore, B. amyloliquefaciens strains were grown in tryptic soy broth at 37°C for about 48 h. The precipitate obtained by centrifugation at 7500 rpm for 10 min at 4°C was washed with phosphare-buffered saline [PBS] solution [Sigma], and the endospores were purified from the precipitate using the method described by Tavares et al.42 2.4. Purification and protein analysis An 800-ml culture supernatant of B. amyloliquefaciens GF423 was collected by centrifugation, and filtered and concentrated as described above. Protamine sulphate was added to the concentrate to reach 0.2% [w/v], followed by centrifugation at 12000 rpm for 45 min at 4°C. The supernatant obtained after centrifugation was precipitated by adding ammonium sulphate up to 60% [w/v] and stirring for 30 min on ice. The supernatant obtained from ammonium sulphate precipitation was applied onto a Phenyl Sepharose HP column [16 × 10 cm] [GE Healthcare Life Sciences, USA] equilibrated with 50-mM potassium phosphate buffer [pH 7.5]. Proteins were eluted with a linear gradient of 2 to 0 M ammonium sulphate equilibrated in 50-mM potassium phosphate buffer. The fractions containing SOD activity were pooled and concentrated with Centricon [Merck, USA] with molecular weight cut-off [MWCO] of 10 kd. The concentrate was dialysed against 50 mM-potassium phosphate buffer [pH 7.5]. Enzyme purity was determined by SDS-PAGE analysis. Protein was quantitated using Bradford protein assay kit [BioRad, USA]. The N-terminal sequence was determined with a model 492 protein sequencer [Applied Biosystems, USA]. 2.5. Experimental animals and diet Six-week-old female Balb/c mice weighing 16–20 g were purchased from Orient Bio [Seongnam, Korea]. All mice were housed in individual cages under pathogen-free and constant conditions [temperature 25 ± 2 °C; humidity 70-75%, lighting regimen 12-h light/12-h dark]. Mice were fed pellet diet and tapwater. The study was approved by the Korea Research Institute of Bioscience and Biotechnology Review Board for the care of animals. 2.6. Oxidative stress model and SOD treatment The mice were randomly separated into nine groups [n = 7]. The duration of administration was 28 days in all cases. All spores were administered at a rate of 107/day and all BA SOD at a rate of 10 U/day in 100 µl PBS. The groups included: the control group, which was orally supplemented with 100 µl phosphate-buffered solution [PBS]; the B. amyloliquefaciens SOD [BA SOD] group, which was administered wild-type BASOD; the oxidative stress [OS] control group, supplemented with 100 µl PBS and irradiated with γ-ray 2Gy every 7days; the OS BASOD group, which was administered wild-type BASOD and irradiated with γ-rays at a dose of 2Gy every 7 days; the wild-type B. amyloliquefaciens [BA WT] spore group; the B. amyloliquefaciens sodA knock-out mutant [BA ΔSODA] spore group; the B. amyloliquefaciens high-SOD-producing [BA HPSOD] spore group; the BA WT spore+ BA SOD group, administered full doses of BA WT spore and BA SOD; and the BA HP SOD spore + BA SOD group, administered full doses of BA HP SOD spore and BA SOD. Blood was collected on the first and last days, incubated for 30 min at 25°C, and centrifuged at 1300 rpm for 30 min at 4°C. Supernatants were transferred to a new e-tube and stored at -80°C deep freezer. 2.7. DSS-induced IBD and treatment The mice were divided into eight groups [n = 7]. All spores were administered at a rate of 107/day in 100 µl PBS for 3 weeks, and all DSS was provided as 3% DSS in drinking water for the last 2 weeks. Groups included: the control group, which was administered 100 µl PBS for 3 weeks; the DSS group, administered 100 µl PBS for 3 weeks and provided DSS; the BA WT spore group, administered BA WT spore and provided DSS; the BA ΔSOD spore group, administered BA ΔSOD spore and provided DSS; the BA HP SOD spore group, administered BA HP SOD spore and provided DSS; the BA WT spore + BA SOD group, administered full doses BA WT SOD spore and BA SOD and provided DSS; the BA HP SOD spore + BA SOD group, administered full doses of BA HP SOD spore and BA SOD 10 and provided DSS; and the BA SOD group, administered BA SOD and provided DSS. Blood was collected and tested as described above. 2.8. Measurement of the activity index of IBD The activity index of IBD was evaluated by an independent observer. IBD activity indexes included weight loss, stool consistency, mean score of rectal bleeding, and length of colon. Each score was determined as follows: consistency of stools [score: 0, well-formed pellet; 1, smooth, semi-moulded but not attached to the anus; 2, semi-muolded but attached to the anus; 3, liquid and liquid faeces], rectal bleeding [score: 0, normal; 1, blood traces in rectum; 2, blood in whole rectum; 3, blood traces in both rectum and stool; 4, total rectal bleeding], and weight loss rate calculated as a percentage of baseline body weight [body weight at Day 0]. 2.9. Measurement of SOD, CAT, and GPx activities The SOD, CAT, and GPx activities in serum samples were measured according to the manual provided by suppliers of the kits [Cayman Chemical Company, Ann Arbor, MI, USA]. 2.10. Histology The colon tissues were fixed in 4% formaldehyde, paraffin-embedded, cleared with xylene, hydrated, and stained with haematoxylin and eosin [H&E]. H&E-stained colonic tissue sections were scored by a blinded observer using a previously published system, for the following measures to grade the extent of inflammatory infiltrate [0–5], crypt damage [0–4], and ulceration [0–3], and the presence or absence ofo edema [0 or 1]. The scores represented the histological damage associated with DSS treatment in the mid-colon [from the distal end of the plicae to the two-thirds from the anus], where inflammation was the most severe.43 2.11. Measurement of inflammatory cytokines using ELISA The levels of inflammatory cytokines IL-1β, TNF-α, and IL-6, were determined using commercial immunoassay kits in accordance with the manufacturer’s instructions [R&D systems, Minneapolis, MN, USA]. 2.12. Statistical analysis Analyses were performed using Microsoft Excel 2010 for Windows. Quantitative data are shown as mean ± SD. Significance was determined using a two-tailed, unpaired Student’s t-test; p-values < 0.05 were considered significant. 3. Results 3.1. Identification of the sodA gene encoding Mn-SOD in B. amyloliquefaciens SOD activity was found in the culture supernatant of B. amyloliquefaciens GF423, which was expected to be attributable to a gene homologous with B. subtilis sodA encoding an extracellular SOD. We determined the N-terminal amino acid sequence of a protein with a molecular weight [MW] of about 22000 Da based on SDS PAGE observed in the culture supernatant of the strain. The N-terminal sequence, AYKLPE, was searched against the National Center for Biotechnology Information [NCBI] database using BLASTP, and found to match exactly with the N-terminal sequence of SOD derived from various B. amyloliquefaciens strains, which strongly suggests that the protein with an MW of 22000 Da was responsible for the SOD activity in the culture supernatant. We cloned the gene from B. amyloliquefaciens GF423 using PCR with primers corresponding to the flaking sequences of the sodA gene of B. amyloliquefaciens FZB42 [NC_009725], and determined its nucleotide sequence. The sodA gene of B. amyloliquefaciens GF423 encodes a protein of 201 amino acids with an MW of 22488 Da, which have the same N-terminal sequence as the protein in the culture supernatant. The amino acid sequence of SodA of B. amyloliquefaciens GF423 is completely identical with that of B. amyloliquefaciens FZB42, and shares 92% identity and 97% similarity with those of B. subtilis 168 [Figure 1]. Figure 1. View largeDownload slide Comparison of the amino acid sequence of SodA derived from B. amyloliquefaciens GF423 with those from B. amyloliquefaciens FZB42 and B. subtilis 168. BA_GF423 indicates B. amyloliquefaciens GF423, BA_FZB42; B. amyloliquefaciens FZB42; and BS_168, B. subtilis 168. Active sites of B. subtilis SodA5 are indicated by dots under the sequence. Figure 1. View largeDownload slide Comparison of the amino acid sequence of SodA derived from B. amyloliquefaciens GF423 with those from B. amyloliquefaciens FZB42 and B. subtilis 168. BA_GF423 indicates B. amyloliquefaciens GF423, BA_FZB42; B. amyloliquefaciens FZB42; and BS_168, B. subtilis 168. Active sites of B. subtilis SodA5 are indicated by dots under the sequence. In B. subtilis, the sodA gene encodes an extracellular Mn-SOD; together with a functional domain analysis by InterPro,44 this indicates that SodA of B. amyloliquefaciens GF423 is an extracellular Mn-SOD. Bacteria of the B. subtilis group, including B. amyloliquefaciens, have multiple sodA genes. For example, in B. subtilis and B. amyloliquefaciens, there are three types of genes encoding SOD: sodA, sodC, and sodF. Thus, to determine whether the SodA of B. amyloliquefaciens GF423 is a major determinant of extracellular SOD activity, the sodA gene was knocked out from its genome as described in the Materials and Methods section, and SOD activity was measured in the culture supernatant of the resulting knock-out mutant. SOD activity was not detected in the sodA knock-out mutant, which suggests that SodA is a major extracellular SOD in B. amyloliquefaciens GF423. This finding corroborates with previous reports that SodA was the only SOD identified in the extracellular fraction in B. subtilis.45,46 In addition, we purified the protein into homogeneity from the culture supernatant of B. amyloliquefaciens GF423. The specific activity of the purified SodA was 2360 U/mg. SodA activity was maintained in a pH range of 4.0 to 8.0. The enzyme was stable up to 40°C, and around 60% of activity was retained at 50°C. To improve expression of the sodA gene, B. amyloliquefaciens GF423 was mutagenised by UV irradiation. From the UV mutant library, we selected B. amyloliquefaciens GF424, a strain with 4.5-fold higher SOD activity than that of the wild type. 3.2. SOD activity of enteric-coated SOD from B. amyloliquefaciens The enzyme activity of SOD partially purified by ultrafiltration was measured using a commercial kit, and the SOD activity value was 20.24 U/mg [non-coated SOD]. Enteric-coated SOD activity was 3.64 U/mg. 3.3. Antioxidant effect of BASOD in mice To examine the antioxidative effect of BASOD, shellac-coated BASOD was administered to the irradiated mice, and the degree of change of antioxidant enzymes in the blood was measured. The levels of antioxidant enzymes, superoxide dismutase [SOD], catalase [CAT], and glutathione peroxidase [GPx], were higher in the blood of the BA SOD group than in the control. SOD, CAT, and GPx were also higher in the BA WT spore, BA HPSOD spore, BA WT spore + BA SOD, and BA HPSOD spore + BA SOD groups; levels in the BA ΔSODA spore group were not affected. Contrastingly, antioxidant enzymes of the group irradiated with γ-rays were decreased. In the BA SOD + irradiation group, antioxidant enzymes in the blood recovered to a level similar to that of the control group [Table 1]. These data show that BASOD has an antioxidative effect and can ameliorate oxidative stress. Table 1. Measurement of antioxidant enzymes in the irradiated group of mice. Supplementation and condition Activity SOD [unit/mL] Catalase [nmol/min/mL] GPx [nmol/min/mL] 0 28 0 28 0 28 Control 16.8 ± 0.03 19.7 ± 0.03 274.06 ± 0.1 243.3 ± 0.5 3170.4 ± 0.01 3146.9 ± 0.07 BASOD 15.5 ± 0.05 24.9 ± 0.07* 382.3 ± 0.09 555.7 ± 0.1 2329.6 ± 0.02 2738.2 ± 0.05* γ-irradiation [control] 14.8 ± 0.1 10.8 ± 0.2 283.5 ± 0.02 141.1 ± 0.03 2207.8 ± 0.01 117.9 ± 0.05* γ-irradiation + BASOD 14.0 ± 0.07 18.2 ± 0.2 357.9 ± 0.01 316.3 ± 0.04* 1964.0 ± 0.01 150.8 ± 0.05 BA WT spore 14.2 ± 0.33 19.9 ± 0.2 300.3 ± 0.8 447.5 ± 0.69 3217.8 ± 0.34 3809.9 ± 0.37 BA ΔSODA spore 14.8 ± 0.13 14.7 ± 0.12 300. ±0.24 305.2 ± 0.28 2821.8 ± 0.11 2839.2 ± 0.05 BA HP SOD spore 14.6 ± 0.14 22.5 ± 0.11* 307.2 ± 0.62 550.1 ± 0.14* 2844.1 ± 0.45 3578.4 ± 0.29 BA WT spore +BASOD 14.5 ± 0.05 26.1 ± 0.14* 291.2 ± 0.89 557.8 ± 0.78* 3103.1 ± 0.28 4132.2 ± 0.13* BA HP SOD spore + BASOD 14.8 ± 0.08 26.5 ± 0.02* 320.4 ± 0.72 580.2 ± 0.99* 3905.2 ± 0.22 5033.4 ± 0.2* Supplementation and condition Activity SOD [unit/mL] Catalase [nmol/min/mL] GPx [nmol/min/mL] 0 28 0 28 0 28 Control 16.8 ± 0.03 19.7 ± 0.03 274.06 ± 0.1 243.3 ± 0.5 3170.4 ± 0.01 3146.9 ± 0.07 BASOD 15.5 ± 0.05 24.9 ± 0.07* 382.3 ± 0.09 555.7 ± 0.1 2329.6 ± 0.02 2738.2 ± 0.05* γ-irradiation [control] 14.8 ± 0.1 10.8 ± 0.2 283.5 ± 0.02 141.1 ± 0.03 2207.8 ± 0.01 117.9 ± 0.05* γ-irradiation + BASOD 14.0 ± 0.07 18.2 ± 0.2 357.9 ± 0.01 316.3 ± 0.04* 1964.0 ± 0.01 150.8 ± 0.05 BA WT spore 14.2 ± 0.33 19.9 ± 0.2 300.3 ± 0.8 447.5 ± 0.69 3217.8 ± 0.34 3809.9 ± 0.37 BA ΔSODA spore 14.8 ± 0.13 14.7 ± 0.12 300. ±0.24 305.2 ± 0.28 2821.8 ± 0.11 2839.2 ± 0.05 BA HP SOD spore 14.6 ± 0.14 22.5 ± 0.11* 307.2 ± 0.62 550.1 ± 0.14* 2844.1 ± 0.45 3578.4 ± 0.29 BA WT spore +BASOD 14.5 ± 0.05 26.1 ± 0.14* 291.2 ± 0.89 557.8 ± 0.78* 3103.1 ± 0.28 4132.2 ± 0.13* BA HP SOD spore + BASOD 14.8 ± 0.08 26.5 ± 0.02* 320.4 ± 0.72 580.2 ± 0.99* 3905.2 ± 0.22 5033.4 ± 0.2* Two-point check on the first and last days. Values are mean ± SD [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. *Significant differences [p <0.05] compared with Day 0 of each group. BA WT spore, wild-type B. amyloliquefaciens GF423; BA ΔSOD A spore, SOD knock-out mutant B. amyloliquefaciens; BA HP SOD spore, high-SOD-producing strain B. amyloliquefaciens GF424; SOD, superoxide dismutase. View Large Table 1. Measurement of antioxidant enzymes in the irradiated group of mice. Supplementation and condition Activity SOD [unit/mL] Catalase [nmol/min/mL] GPx [nmol/min/mL] 0 28 0 28 0 28 Control 16.8 ± 0.03 19.7 ± 0.03 274.06 ± 0.1 243.3 ± 0.5 3170.4 ± 0.01 3146.9 ± 0.07 BASOD 15.5 ± 0.05 24.9 ± 0.07* 382.3 ± 0.09 555.7 ± 0.1 2329.6 ± 0.02 2738.2 ± 0.05* γ-irradiation [control] 14.8 ± 0.1 10.8 ± 0.2 283.5 ± 0.02 141.1 ± 0.03 2207.8 ± 0.01 117.9 ± 0.05* γ-irradiation + BASOD 14.0 ± 0.07 18.2 ± 0.2 357.9 ± 0.01 316.3 ± 0.04* 1964.0 ± 0.01 150.8 ± 0.05 BA WT spore 14.2 ± 0.33 19.9 ± 0.2 300.3 ± 0.8 447.5 ± 0.69 3217.8 ± 0.34 3809.9 ± 0.37 BA ΔSODA spore 14.8 ± 0.13 14.7 ± 0.12 300. ±0.24 305.2 ± 0.28 2821.8 ± 0.11 2839.2 ± 0.05 BA HP SOD spore 14.6 ± 0.14 22.5 ± 0.11* 307.2 ± 0.62 550.1 ± 0.14* 2844.1 ± 0.45 3578.4 ± 0.29 BA WT spore +BASOD 14.5 ± 0.05 26.1 ± 0.14* 291.2 ± 0.89 557.8 ± 0.78* 3103.1 ± 0.28 4132.2 ± 0.13* BA HP SOD spore + BASOD 14.8 ± 0.08 26.5 ± 0.02* 320.4 ± 0.72 580.2 ± 0.99* 3905.2 ± 0.22 5033.4 ± 0.2* Supplementation and condition Activity SOD [unit/mL] Catalase [nmol/min/mL] GPx [nmol/min/mL] 0 28 0 28 0 28 Control 16.8 ± 0.03 19.7 ± 0.03 274.06 ± 0.1 243.3 ± 0.5 3170.4 ± 0.01 3146.9 ± 0.07 BASOD 15.5 ± 0.05 24.9 ± 0.07* 382.3 ± 0.09 555.7 ± 0.1 2329.6 ± 0.02 2738.2 ± 0.05* γ-irradiation [control] 14.8 ± 0.1 10.8 ± 0.2 283.5 ± 0.02 141.1 ± 0.03 2207.8 ± 0.01 117.9 ± 0.05* γ-irradiation + BASOD 14.0 ± 0.07 18.2 ± 0.2 357.9 ± 0.01 316.3 ± 0.04* 1964.0 ± 0.01 150.8 ± 0.05 BA WT spore 14.2 ± 0.33 19.9 ± 0.2 300.3 ± 0.8 447.5 ± 0.69 3217.8 ± 0.34 3809.9 ± 0.37 BA ΔSODA spore 14.8 ± 0.13 14.7 ± 0.12 300. ±0.24 305.2 ± 0.28 2821.8 ± 0.11 2839.2 ± 0.05 BA HP SOD spore 14.6 ± 0.14 22.5 ± 0.11* 307.2 ± 0.62 550.1 ± 0.14* 2844.1 ± 0.45 3578.4 ± 0.29 BA WT spore +BASOD 14.5 ± 0.05 26.1 ± 0.14* 291.2 ± 0.89 557.8 ± 0.78* 3103.1 ± 0.28 4132.2 ± 0.13* BA HP SOD spore + BASOD 14.8 ± 0.08 26.5 ± 0.02* 320.4 ± 0.72 580.2 ± 0.99* 3905.2 ± 0.22 5033.4 ± 0.2* Two-point check on the first and last days. Values are mean ± SD [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. *Significant differences [p <0.05] compared with Day 0 of each group. BA WT spore, wild-type B. amyloliquefaciens GF423; BA ΔSOD A spore, SOD knock-out mutant B. amyloliquefaciens; BA HP SOD spore, high-SOD-producing strain B. amyloliquefaciens GF424; SOD, superoxide dismutase. View Large 3.4. Effect of BA SOD on DSS-induced IBD in mice In mouse-modelled DSS-induced ulcerative colitis, BASOD, BA WT spores, and BA HP SOD spores reduced mortality, and BA ΔSODA spores had no effect. Figure 2 shows the outcomes in DSS-treated mice. Survival was the highest in the group treated with both wild-type and high-producing spores [>85%]; survival was greater than 65%, 55%, and 40% of mice treated with only oral SOD, high-producing spore, or wild-type spore, respectively. Mice fed only DSS or DSS + BA ΔSODA spore survived at a rate of 30% [Figure 2A, B]. Weight loss also differed; the loss rates of the group fed DSS only and DSS + BA ΔSODA spore were greater than those of the control group. Other groups also had greater weight loss than the control group, but loss was less severe [Figure 2C, D]. Figure 2. View largeDownload slide Protective effect of superoxide dismutase from B. amyloliquefaciens [BA SOD] and BA spores on [A and B] survival rate and [C and D] weight change of the dextran sulphate sodium [DSS]-treated mice. Data are presented as mean ± standard deviation [SD] [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. Significant differences [*p <0.05, **p <0.01, ***p <0.005] are compared with the control group. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant of B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. Figure 2. View largeDownload slide Protective effect of superoxide dismutase from B. amyloliquefaciens [BA SOD] and BA spores on [A and B] survival rate and [C and D] weight change of the dextran sulphate sodium [DSS]-treated mice. Data are presented as mean ± standard deviation [SD] [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. Significant differences [*p <0.05, **p <0.01, ***p <0.005] are compared with the control group. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant of B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. BA SOD and SOD-producing BA spore markedly improved clinical signs of DSS-induced colitis, including rectal bleeding [Figure 3A, B] and diarrhoea [Figure 3C, D]. The colon length of the group fed only DSS was shorter than that of groups fed DSS + BASOD, DSS + BA spore, and DSS + BASOD + BA spore [Figure 3E]. These data show that BASOD and SOD-producing BA spores ameliorate the development of DSS-induced colitis. Figure 3. View largeDownload slide Protective effect of superoxide dismutase from B. amyloliquefaciens [BASOD] and BA spores on [A and B] diarrhea, [C and D] rectal bleeding, and [E] colon length of the dextran sulphate sodium [DSS]-induced mice. Data are presented as means ± standard deviation [SD]: [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. Significant differences [*p <0.05, **p <0.01, ***p <0.005] of [A], [B], [C], and [D] are compared twith the control group, and that of [E] is compared with the DSS group. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. Figure 3. View largeDownload slide Protective effect of superoxide dismutase from B. amyloliquefaciens [BASOD] and BA spores on [A and B] diarrhea, [C and D] rectal bleeding, and [E] colon length of the dextran sulphate sodium [DSS]-induced mice. Data are presented as means ± standard deviation [SD]: [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. Significant differences [*p <0.05, **p <0.01, ***p <0.005] of [A], [B], [C], and [D] are compared twith the control group, and that of [E] is compared with the DSS group. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. 3.5. Histology of colon tissue The control group showed histologically normal colonic mucosa. In mice treated with DSS only, the colonic mucosa was severely damaged and a highly inflamed mucosa was observed. A damaged colonic mucosa was also observed in mice treated with DSS and BA ΔSODA spore. In mice treated with DSS and BA SOD, BA WT spore, and/or BA HPSOD spore, some damaged colonic mucosa was observed, but the level was much lower than that of mice treated with DSS alone [Figure 4A]. In the mice treated with DSS, inflammation was observed in mucosal and submucosal layers, and the mucous membrane adjacent to the site of ulceration had increased oedema with extensive cell depletion, as compared with the control mice [Figure 4B]. After the dietary treatment of BASOD, BA WT spore, and/or BA HPSOD spore, histological analysis revealed a reduction of morphological signs of cell damage. These data indicate that BA SOD and BA spores producing SOD reduce mucosal damage in DSS-induced colitis. Figure 4. View largeDownload slide Effect of B. amyloliquefaciens superoxide dismutase [BA SOD] and BA spores on mucosal damage in colitis mice. [A] Representative photographs of haematoxylin and eosin-stained colonic tissues from control, dextran sulphate sodium [DSS], DSS + BA WT spore, DSS + BA ΔSODA spore, DSS + BA HPSOD spore, DSS + BA WT spore + BA SOD, DSS + BA HPSOD pore + BA SOD, and DSS + BA SOD groups. [B] Change in histological score according to the criteria defined in the ‘Materials and Methods.’ Data are presented as mean ± standard deviation [SD] [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. Significant differences [*p <0.05, #p <0.01] are compared with the DSS group. Figure 4. View largeDownload slide Effect of B. amyloliquefaciens superoxide dismutase [BA SOD] and BA spores on mucosal damage in colitis mice. [A] Representative photographs of haematoxylin and eosin-stained colonic tissues from control, dextran sulphate sodium [DSS], DSS + BA WT spore, DSS + BA ΔSODA spore, DSS + BA HPSOD spore, DSS + BA WT spore + BA SOD, DSS + BA HPSOD pore + BA SOD, and DSS + BA SOD groups. [B] Change in histological score according to the criteria defined in the ‘Materials and Methods.’ Data are presented as mean ± standard deviation [SD] [n = 7 for each group]. Statistical analysis was performed using two-tailed, unpaired Student’s t-test. Significant differences [*p <0.05, #p <0.01] are compared with the DSS group. 3.6. Effect of BA SOD on antioxidant enzymes in serum samples of DSS-induced colitis The serum SOD level of mice fed only DSS was decreased compared with that of the control group, and the SOD level of mice fed DSS with BA spore or BASOD was higher than that in mice fed only DSS [Figure 5A]. CAT and GPx levels of mice fed only DSS were lower than those in the control group, whereas the levels in mice fed DSS with BA spores or BASOD were higher than those in DSS-only mice [Figure 5B, C]. These data show that BASOD most likely helps to improve colitis by affecting the body’s antioxidant enzymes. Figure 5. View largeDownload slide Effect of B. amyloliquefaciens superoxide dismutase [BA SOD] and BA spores on the antioxidant enzymes in mice with dextran sulphate sodium [DSS]-induced colitis. [A] SOD activity in serum of mice. [B] Catalase [CAT] activity in serum of mice. [C] Glutathione peroxidase [GPx] activity in serum of mice. Statistical analysis was performed using two-tailed, unpaired Student’s t-test: significant differences [*p <0.05, #p <0.01] compared with the DSS group. Values are mean ± standard deviation [SD] [n = 7 for each group]. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. Figure 5. View largeDownload slide Effect of B. amyloliquefaciens superoxide dismutase [BA SOD] and BA spores on the antioxidant enzymes in mice with dextran sulphate sodium [DSS]-induced colitis. [A] SOD activity in serum of mice. [B] Catalase [CAT] activity in serum of mice. [C] Glutathione peroxidase [GPx] activity in serum of mice. Statistical analysis was performed using two-tailed, unpaired Student’s t-test: significant differences [*p <0.05, #p <0.01] compared with the DSS group. Values are mean ± standard deviation [SD] [n = 7 for each group]. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. 3.7. Effect of BA SOD on inflammatory cytokines in DSS-induced colitis Levels of pro-inflammatory cytokines TNFα and IL1β were higher in mice fed only DSS and lower in mice fed DSS with BA SOD or BA spores [Figure 6A, B]. Levels of IL6, an anti-inflammatory cytokine, decreased in mice fed only DSS and increased in mice fed DSS with BA SOD or BA spores [Figure 6C]. These data indicate that BASOD modulates inflammatory cytokines and may thereby improve IBD symptoms. Figure 6. View largeDownload slide Effect of B. amyloliquefaciens superoxide dismutase [BA SOD] and BA spores on inflammatory cytokines in mice with dextran sulphate sodium [DSS]-induced colitis. [A] Pro-inflammatory cytokine tumour necrosis factor [TNF]-α in serum of mice. [B] Pro-inflammatory cytokine IL-1β in serum of mice. [C] Anti-inflammatory cytokine IL6 in serum of mice. Statistical analysis was performed using two-tailed, unpaired Student’s t-test: significant differences [*p <0.05, #p <0.01] compared with the DSS group. Values are mean ± standard deviation [SD] [n = 7 for each group]. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. Figure 6. View largeDownload slide Effect of B. amyloliquefaciens superoxide dismutase [BA SOD] and BA spores on inflammatory cytokines in mice with dextran sulphate sodium [DSS]-induced colitis. [A] Pro-inflammatory cytokine tumour necrosis factor [TNF]-α in serum of mice. [B] Pro-inflammatory cytokine IL-1β in serum of mice. [C] Anti-inflammatory cytokine IL6 in serum of mice. Statistical analysis was performed using two-tailed, unpaired Student’s t-test: significant differences [*p <0.05, #p <0.01] compared with the DSS group. Values are mean ± standard deviation [SD] [n = 7 for each group]. DSS, only DSS; BA WT spore, B. amyloliquefaciens GF423; BA ΔSODA spore, SOD knock-out mutant B. amyloliquefaciens; BA HPSOD spore, B. amyloliquefaciens GF424. 4. Discussion ROS have been implicated in a range of pathologies, such as cancer, cardiovascular diseases [CVDs], degenerative diseases, and infectious diseases. For many scientists studying ROS-related disorders, the manipulation of antioxidant levels offers the possibility to ameliorate particular conditions.3 Most antioxidants externally provided from dietary sources are quickly saturated and exhausted, whereas SOD keeps eliminating ROS. Therefore, the therapeutic value of oral administration of a combination of melon SOD and a vegetable polymer [gliadin] has been evaluated in many studies.3 To further clarify the importance of dietary SOD–gliadin administration, additional large-scale clinical trials are proceeding. The use of bacillus SODs could make supplementation with SODs more economical and effective. Bacillus SODs have been studied from a biochemical and physiological perspective. Mn-SOD [encoded by sodA gene] is essential for resistance to oxidative stress in growing and sporulating cells of B. subtilis.5 Although many beneficial effects related to increasing SOD levels in animals and humans have been found after administration of bacillus cells, no research has been conducted using bacillus SOD itself, which might be due to its low production level. Although Mn-SOD is classified as an intracellular protein, it is also consistently found in extracellular protein samples of many bacilli.5B. amyloliquefaciens has three sod genes: sodA, sodC, and sodF. The negligible activity of the sodA knock-out mutant demonstrates that that the SOD activity of B. amyloliquefaciens was derived from secreted Mn-SOD encoded by the sodA gene. We therefore isolated a high-SOD-producing strain using UV mutagenesis and developed the downstream process of SOD production. Gliadin has been shown to interact with intestinal epithelial cells and cross the intestinal epithelial barrier.47,48 Thus, we chose shellac as an enteric coating material to prolong the half-life of SOD. The specific activity of partially purified SOD using ultrafiltration was 20.24 U/mg before enteric coating with shellac and 3.64 U/mg after coating; these specific activities are sufficient for commercial use. The reduced mortality and morbidity of mice treated with purified SOD and SOD spores, especially combinations thereof, demonstrate the clinical benefits of this level of SOD activity. Our results indicated that SOD supplementation not only promoted antioxidant defences [increased SOD, catalase, and GPx activities] but also improved cell resistance to the oxidative stress of γ-irradiation. This result indicates that B. amyloliquefaciens SOD could be an alternative ingredient for dietary supplementation for anti-ageing and well-being in addition to ulcerative colitis. However, the mechanism by which exogenous bacillus SOD promotes antioxidant defences in the body will need to be investigated in further studies. The scientific community has sought novel therapeutic alternatives to fight IBD and mucositis. As dysbiosis plays a key role in the pathogenesis of both diseases, the modulation of the patient microbiota via the administration of probiotic bacteria has been proposed. Experiments with lactic acid bacteria [LAB] strains engineered to express anti-inflammatory proteins have shown promise. Mouse transforming growth factor β, human interleukin-10, human trefoil factor I, human elafin, mouse cathelicidin, mouse leukocyte protease inhibitor, and human 15-lipoxygenase-1 including SODs from Lactococcus lactis and B. subtilis, have been produced in different strains of lactic acid bacteria and tested in several inflammatory conditions.49 The ability of SOD to control the ROS level within cells renders it a highly effective therapeutic protein for the treatment of IBD.50 Intestinal inflammation is accompanied by massive ROS production by activated macrophages and neutrophils, which contributes to inflammation-associated tissue destruction. Many studies have documented that exogenous SOD can attenuate inflammation by exerting antioxidative effects on a variety of experimental models,33 and using GRAS strains as vehicles to deliver bioactive molecules to the gastrointestinal tract has been considered a promising approach for the treatment of many diseases, including IBD.32 Although bacillus strains have been considered soil organisms for which endospore formation provides a means to ensure long-term survival in the environment, bacillus spores are not transient passengers of the gastrointestinal tract but have adapted to carry out their entire life cycle within this environment.51 Therefore, the bacillus cytoplasmic protein, which includes SOD, could be released into the gastrointestinal tract through the sporulation life cycle. Moreover, as mentioned above, B. amyloliquefaciens SOD is found extracellularly in liquid culture. Even if the role of SOD in B. polyfermenticus has not been elucidated, the probiotic effect of B. polyfermenticus in intestinal inflammation by suppressing apoptosis and promoting epithelial cell proliferation and migration has been reported.52 Our results are consistent with these reports. As expected, wild-type B. amyloliquefaciens had a beneficial effect in DSS-induced mouse model, and the effect of the SOD high-producer strain [GF424] was proportional to its SOD productivity. Moreover, co-administration of SOD protein with B. amyloliquefaciens spore showed a synergistic therapeutic effect. Our results are an important step in increasing the accessibility of SOD to IBD patients. Microbial suspension culture is a more convenient mode of mass cultivation of cells, large-scale production, and recovery of enzyme, than plant cultivation. The production of bacillus SOD could be more economical than melon-derived SOD. Moreover, the entire production could take place under highly controlled conditions. Our findings suggest that the co-administration of enteric-coated SOD with the wild-type strain or the high-SOD-producing strain spores of B. amyloliquefaciens is a promising candidate to alleviate oxidative stress and inflammation response in humans, without the issues regarding the use of genetically modified bacteria as a delivery vehicle of therapeutic protein. However, the acute DSS colitis model is generally considered as a model for acute intestinal inflammation rather than an IBD model. The chronic DSS colitis or IL-10 knock-out model would need to be tested. Funding No funding was provided for this work. Conflict of Interest The authors declare that they have no competing interests. Author Contributions JEK: acquisition of data; analysis and interpretation of data; drafting of the manuscript; statistical analysis. HDK: acquisition of data. SYP: acquisition of data; analysis and interpretation of data. JGP: study concept; critical revision of the manuscript for important intellectual content. JHK: analysis and interpretation of data; critical revision of the manuscript for important intellectual content. DYY: study concept and design; analysis and interpretation of data; critical revision of the manuscript for important intellectual content; study supervision. All authors had full access to all the data in the study and had final responsibility for the decision to submit for publication. Acknowledgments The authors would like to thank Dr Hee-Gu Lee of the Korea Research Institute of Bioscience and Biotechnology [KRIBB] for his excellent technical assistance during this study. References 1. Carillon J , Rouanet JM , Cristol JP , Brion R . Superoxide dismutase administration, a potential therapy against oxidative stress related diseases: several routes of supplementation and proposal of an original mechanism of action . Pharm Res 2013 ; 30 : 2718 – 28 . Google Scholar CrossRef Search ADS PubMed 2. Fukai T , Ushio-Fukai M . Superoxide dismutases: role in redox signaling, vascular function, and diseases . Antioxid Redox Signal 2011 ; 15 : 1583 – 606 . Google Scholar CrossRef Search ADS PubMed 3. Romao S . Therapeutic value of oral supplementation with melon superoxide dismutase and wheat gliadin combination . Nutrition 2015 ; 31 : 430 – 6 . Google Scholar CrossRef Search ADS PubMed 4. Abreu IA , Cabelli DE . Superoxide dismutases - a review of the metal-associated mechanistic variations . Biochim Biophys Acta 2010 ; 1804 : 263 – 74 . Google Scholar CrossRef Search ADS PubMed 5. Liu P , Ewis HE , Huang YJ , Lu CD , Tai PC , Weber IT . Structure of Bacillus subtilis superoxide dismutase . Acta Crystallogr Sect F Struct Biol Cryst Commun 2007 ; 63 : 1003 – 7 . Google Scholar CrossRef Search ADS PubMed 6. Behera M , Dandapat J , Rath CC . Effect of heavy metals on growth response and antioxidant defense protection in Bacillus cereus . J Basic Microbiol 2014 ; 54 : 1201 – 9 . Google Scholar CrossRef Search ADS PubMed 7. Pandey S , Barai PK , Maiti TK . Influence of heavy metals on the activity of antioxidant enzymes in the metal resistant strains of Ochrobactrum and Bacillus sp . J Environ Biol 2013 ; 34 : 1033 – 7 . Google Scholar PubMed 8. Majlesi M , Shekarforoush SS , Ghaisari HR , Nazifi S , Sajedianfard J , Eskandari MH . Erratum to: effect of probiotic Bacillus coagulans and Lactobacillus plantarum on alleviation of mercury toxicity in rat . Probiotics Antimicrob Proteins 2017 ; 9 : 214 . Google Scholar CrossRef Search ADS PubMed 9. Chen X , Zhang E , Fang L et al. Repair effects of exogenous SOD on Bacillus subtilis against gamma radiation exposure . J Environ Radioact 2013 ; 126 : 259 – 63 . Google Scholar CrossRef Search ADS PubMed 10. Liu H , Wang S , Cai Y et al. Dietary administration of Bacillus subtilis HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, Oreochromis niloticus . Fish Shellfish Immunol 2017 ; 60 : 326 – 33 . Google Scholar CrossRef Search ADS PubMed 11. Lee S , Katya K , Park Y et al. Comparative evaluation of dietary probiotics Bacillus subtilis WB60 and Lactobacillus plantarum KCTC3928 on the growth performance, immunological parameters, gut morphology and disease resistance in Japanese eel, Anguilla japonica . Fish Shellfish Immunol 2017 ; 61 : 201 – 10 . Google Scholar CrossRef Search ADS PubMed 12. Zhang CN , Li XF , Xu WN et al. Combined effects of dietary fructooligosaccharide and Bacillus licheniformis on innate immunity, antioxidant capability and disease resistance of triangular bream [Megalobrama terminalis] . Fish Shellfish Immunol 2013 ; 35 : 1380 – 6 . Google Scholar CrossRef Search ADS PubMed 13. Liu CH , Chiu CH , Wang SW , Cheng W . Dietary administration of the probiotic, Bacillus subtilis E20, enhances the growth, innate immune responses, and disease resistance of the grouper, Epinephelus coioides . Fish Shellfish Immunol 2012 ; 33 : 699 – 706 . Google Scholar CrossRef Search ADS PubMed 14. Bai K , Huang Q , Zhang J , He J , Zhang L , Wang T . Supplemental effects of probiotic Bacillus subtilis fmbJ on growth performance, antioxidant capacity, and meat quality of broiler chickens . Poult Sci 2017 ; 96 : 74 – 82 . Google Scholar CrossRef Search ADS PubMed 15. Li Y , Gu Y , Li J , Xu M , Wei Q , Wang Y . Biocontrol agent Bacillus amyloliquefaciens LJ02 induces systemic resistance against cucurbits powdery mildew . Front Microbiol 2015 ; 6 : 883 . Google Scholar PubMed 16. US Food and Drug Administration . Carbohydrase and Protease Enzyme Preparations Derived From Bacillus Subtilis or Bacillus Amyloliquefaciens; Affirmation of Gras Status as Direct Food Ingredients . 1999. https://federalregister.Gov/a/99-10011 Accessed May 2016 . 17. EFSA . Opinion of the scientific committee on a request from EFSA related to a generic approach to the safety assessment by EFSA of microorganisms used in food/feed and the production of food/feed additives . EFSA J 2005 ; 226 : 1 – 12 . 18. Truong Thy HT , Tri NN , Quy OM , et al. Effects of the dietary supplementation of mixed probiotic spores of Bacillus amyloliquefaciens 54a, and Bacillus pumilus 47b on growth, innate immunity and stress responses of striped catfish [Pangasianodon hypophthalmus] . Fish Shellfish Immunol 2017 ; 60 : 391 – 9 . Google Scholar CrossRef Search ADS PubMed 19. Singh ST , Kamilya D , Kheti B , Bordoloi B , Parhi J . Paraprobiotic preparation from Bacillus amyloliquefaciens FPTB16 modulates immune response and immune relevant gene expression in Catla catla [Hamilton, 1822] . Fish Shellfish Immunol 2017 ; 66 : 35 – 42 . Google Scholar CrossRef Search ADS PubMed 20. Yang H , Deng J , Yuan Y et al. Two novel exopolysaccharides from Bacillus amyloliquefaciens c-1: Antioxidation and effect on oxidative stress . Curr Microbiol 2015 ; 70 : 298 – 306 . Google Scholar CrossRef Search ADS PubMed 21. Li Y , Zhang H , Chen YP et al. Bacillus amyloliquefaciens supplementation alleviates immunological stress in lipopolysaccharide-challenged broilers at early age . Poult Sci 2015 ; 94 : 1504 – 11 . Google Scholar CrossRef Search ADS PubMed 22. Lei X , Piao X , Ru Y , Zhang H , Péron A , Zhang H . Effect of Bacillus amyloliquefaciens-based direct-fed microbial on performance, nutrient utilization, intestinal morphology and cecal microflora in broiler chickens . Asian-Australas J Anim Sci 2015 ; 28 : 239 – 46 . Google Scholar CrossRef Search ADS PubMed 23. Ahmed ST , Islam M , Mun HS , Sim HJ , Kim YJ , Yang CJ . Effects of Bacillus amyloliquefaciens as a probiotic strain on growth performance, cecal microflora, and fecal noxious gas emissions of broiler chickens . Poult Sci 2014 ; 93 : 1963 – 71 . Google Scholar CrossRef Search ADS PubMed 24. González-Ortiz G , Castillejos L , Mallo JJ , Àngels Calvo-Torras M , Dolores Baucells M . Effects of dietary supplementation of Bacillus amyloliquefaciens CECT 5940 and Enterococcus faecium CECT 4515 in adult healthy dogs . Arch Anim Nutr 2013 ; 67 : 406 – 15 . Google Scholar CrossRef Search ADS PubMed 25. Das A , Nakhro K , Chowdhury S , Kamilya D . Effects of potential probiotic Bacillus amyloliquefaciens [corrected] FPTB16 on systemic and cutaneous mucosal immune responses and disease resistance of catla [Catla catla] . Fish Shellfish Immunol 2013 ; 35 : 1547 – 53 . Google Scholar CrossRef Search ADS PubMed 26. Hairul Islam VI , Prakash Babu N , Pandikumar P , Ignacimuthu S . Isolation and characterization of putative probiotic bacterial strain, Bacillus amyloliquefaciens, from North East Himalayan soil based on in vitro and in vivo functional properties . Probiotics Antimicrob Proteins 2011 ; 3 : 175 – 85 . Google Scholar CrossRef Search ADS PubMed 27. Melmed GY , Targan SR . Future biologic targets for IBD: potentials and pitfalls . Nat Rev Gastroenterol Hepatol 2010 ; 7 : 110 – 7 . Google Scholar CrossRef Search ADS PubMed 28. Zhang Q , Tao H , Lin Y et al. A superoxide dismutase/catalase mimetic nanomedicine for targeted therapy of inflammatory bowel disease . Biomaterials 2016 ; 105 : 206 – 21 . Google Scholar CrossRef Search ADS PubMed 29. Khor B , Gardet A , Xavier RJ . Genetics and pathogenesis of inflammatory bowel disease . Nature 2011 ; 474 : 307 – 17 . Google Scholar CrossRef Search ADS PubMed 30. Lih-Brody L , Powell SR , Collier KP et al. Increased oxidative stress and decreased antioxidant defenses in mucosa of inflammatory bowel disease . Dig Dis Sci 1996 ; 41 : 2078 – 86 . Google Scholar CrossRef Search ADS PubMed 31. Mohammadi E , Qujeq D , Taheri H , Hajian-Tilaki K . Evaluation of serum trace element levels and superoxide dismutase activity in patients with inflammatory bowel disease: translating basic research into clinical application . Biol Trace Elem Res 2017 ; 177 : 235 – 40 . Google Scholar CrossRef Search ADS PubMed 32. Ballal SA , Veiga P , Fenn K et al. Host lysozyme-mediated lysis of Lactococcus lactis facilitates delivery of colitis-attenuating superoxide dismutase to inflamed colons . Proc Natl Acad Sci U S A 2015 ; 112 : 7803 – 8 . Google Scholar CrossRef Search ADS PubMed 33. Hou CL , Zhang J , Liu XT , Liu H , Zeng XF , Qiao SY . Superoxide dismutase recombinant Lactobacillus fermentum ameliorates intestinal oxidative stress through inhibiting NF-κB activation in a trinitrobenzene sulphonic acid-induced colitis mouse model . J Appl Microbiol 2014 ; 116 : 1621 – 31 . Google Scholar CrossRef Search ADS PubMed 34. LeBlanc JG , del Carmen S , Miyoshi A et al. Use of superoxide dismutase and catalase producing lactic acid bacteria in TNBS induced Crohn’s disease in mice . J Biotechnol 2011 ; 151 : 287 – 93 . Google Scholar CrossRef Search ADS PubMed 35. Carroll IM , Andrus JM , Bruno-Bárcena JM , Klaenhammer TR , Hassan HM , Threadgill DS . Anti-inflammatory properties of Lactobacillus gasseri expressing manganese superoxide dismutase using the interleukin 10-deficient mouse model of colitis . Am J Physiol Gastrointest Liver Physiol 2007 ; 293 : G729 – 38 . Google Scholar CrossRef Search ADS PubMed 36. Han W , Mercenier A , Ait-Belgnaoui A et al. Improvement of an experimental colitis in rats by lactic acid bacteria producing superoxide dismutase . Inflamm Bowel Dis 2006 ; 12 : 1044 – 52 . Google Scholar CrossRef Search ADS PubMed 37. Han W , Fioramonti J . Anti-inflammatory properties of lactic acid bacteria producing superoxide dismutase . Am J Physiol Gastrointest Liver Physiol 2008 ; 294 : G353; author reply G354 . Google Scholar CrossRef Search ADS PubMed 38. Guérout-Fleury AM , Frandsen N , Stragier P . Plasmids for ectopic integration in Bacillus subtilis . Gene 1996 ; 180 : 57 – 61 . Google Scholar CrossRef Search ADS PubMed 39. Steinmetz M , Richter R . Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome . J Bacteriol 1994 ; 176 : 1761 – 3 . Google Scholar CrossRef Search ADS PubMed 40. Zhang GQ , Bao P , Zhang Y , Deng AH , Chen N , Wen TY . Enhancing electro-transformation competency of recalcitrant Bacillus amyloliquefaciens by combining cell-wall weakening and cell-membrane fluidity disturbing . Anal Biochem 2011 ; 409 : 130 – 7 . Google Scholar CrossRef Search ADS PubMed 41. Filippov VD , El-Halfawy KA . UV-induced mutation fixation in Bacillus subtilis . Mutat Res 1981 ; 82 : 251 – 61 . Google Scholar CrossRef Search ADS PubMed 42. Tavares MB , Souza RD , Luiz WB et al. Bacillus subtilis endospores at high purity and recovery yields: optimization of growth conditions and purification method . Curr Microbiol 2013 ; 66 : 279 – 85 . Google Scholar CrossRef Search ADS PubMed 43. Stillie R , Stadnyk AW . Role of TNF receptors, TNFR1 and TNFR2, in dextran sodium sulfate-induced colitis . Inflamm Bowel Dis 2009 ; 15 : 1515 – 25 . Google Scholar CrossRef Search ADS PubMed 44. Finn RD , Attwood TK , Babbitt PC et al. InterPro in 2017-beyond protein family and domain annotations . Nucleic Acids Res 2017 ; 45 : D190 – 9 . Google Scholar CrossRef Search ADS PubMed 45. Kouwen TR , Antelmann H , van der Ploeg R , Denham EL , Hecker M , van Dijl JM . MscL of Bacillus subtilis prevents selective release of cytoplasmic proteins in a hypotonic environment . Proteomics 2009 ; 9 : 1033 – 43 . Google Scholar CrossRef Search ADS PubMed 46. Antelmann H , Van Dijl JM , Bron S , Hecker M . Proteomic survey through secretome of Bacillus subtilis . Methods Biochem Anal 2006 ; 49 : 179 – 208 . Google Scholar PubMed 47. Hollon J , Puppa EL , Greenwald B , Goldberg E , Guerrerio A , Fasano A . Effect of gliadin on permeability of intestinal biopsy explants from celiac disease patients and patients with non-celiac gluten sensitivity . Nutrients 2015 ; 7 : 1565 – 76 . Google Scholar CrossRef Search ADS PubMed 48. Drago S , El Asmar R , Di Pierro M et al. Gliadin, zonulin and gut permeability: Effects on celiac and non-celiac intestinal mucosa and intestinal cell lines . Scand J Gastroenterol 2006 ; 41 : 408 – 19 . Google Scholar CrossRef Search ADS PubMed 49. Carvalho RDO , do Carmo FLR , de Oliveira Junior A et al. Use of wild type or recombinant lactic acid bacteria as an alternative treatment for gastrointestinal inflammatory diseases: a focus on inflammatory bowel diseases and mucositis . Front Microbiol 2017 ; 8 : 800 . Google Scholar CrossRef Search ADS PubMed 50. Piechota-Polanczyk A , Fichna J . Review article: the role of oxidative stress in pathogenesis and treatment of inflammatory bowel diseases . Naunyn Schmiedebergs Arch Pharmacol 2014 ; 387 : 605 – 20 . Google Scholar CrossRef Search ADS PubMed 51. Tam NK , Uyen NQ , Hong HA et al. The intestinal life cycle of Bacillus subtilis and close relatives . J Bacteriol 2006 ; 188 : 2692 – 700 . Google Scholar CrossRef Search ADS PubMed 52. Im E , Choi YJ , Pothoulakis C , Rhee SH . Bacillus polyfermenticus ameliorates colonic inflammation by promoting cytoprotective effects in colitic mice . J Nutr 2009 ; 139 : 1848 – 54 . Google Scholar CrossRef Search ADS PubMed Copyright © 2018 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)
Journal
Journal of Crohn's and Colitis – Oxford University Press
Published: Mar 14, 2018