Detection of antibiotic resistance toxigenic Clostridium difficile in processed retail lettuce

Detection of antibiotic resistance toxigenic Clostridium difficile in processed retail lettuce Objectives: Clostridium difficile is the major cause of infectious diarrhoea in humans after antimicrobial treatment. Clostridium difficile has been isolated from food animals and meat. The main purpose of this study was to characterize C.  difficile isolated from retail lettuce and determine the antibiotic resistance using five common clinical-selected antibiotics (metronidazole, vancomycin, clindamycin, erythromycin, and cefotaxime). Materials and Methods: Lettuce samples (grown in California, Arkansas, and Louisiana) were purchased from retail stores. Results: Toxigenic C.  difficile was isolated from 13.8 per cent (41/297) of the lettuce samples. Among the toxigenic isolates, only 82.9 per cent (34/41) produced toxin B, 17.1 per cent (7/41) produced both toxin A and toxin B, and two of the Louisiana C.  difficile isolates were identified as ribotype 027. Under the treatment of the five antibiotics, the virulence C. difficile isolates were identified as having antibiotic resistance to metronidazole, vancomycin, and erythromycin. Conclusion: The present study reports the highest prevalence of toxigenic C. difficile in US retail lettuce. The antibiotic resistance to metronidazole, vancomycin, and erythromycin of the isolated C. difficile from retail lettuces could lead to public health concerns. Keywords: Clostridium difficile; lettuce; toxigenic; toxin A; toxin B; antibiotic. did not cause disease (Anonymous, 1994; Pothoulakis et al., 1986; Introduction Voth and Ballard, 2005). As a result, the mechanism of toxin B in Clostridium difficile, a species of Gram-positive, spore-forming, disease is not well studied, whereas the role of toxin A  has been and anaerobic bacteria, is the causative reason of C. difficile–asso- − + studied. With the discovery of some toxinA toxinB strains (King ciated diarrhoea (CDAD) and can lead to more serious disease such et al., 2015), toxin B was reported to contribute to the C. difficile– as pseudomembranous colitis, toxic megacolon, and even death associated diseases, and it was regarded as the essential virulence in humans (Monaghan et  al., 2013). Pathogenic C.  difficile pro- contributor (Lyras, 2009). duces two protein exotoxins, toxin A, comprised of 2710 residues CDI has essentially occurred in a clinic environment; however, (308.0 kDa), and toxin B, comprised of 2366 residues (269.6 kDa) community-associated CDI is increasingly regarded as a potential (Kelly and LaMont, 1998). Toxins A and B (also called T cdA and foodborne disease, especially in food animals (Rodriguez et  al., T cdB), the primary makers of C.  difficile infection (CDI), belong 2014). Although infection with retail meat is most compelling but to the large clostridial cytotoxins (LCTs). In addition to toxins has not been proved (Rodriguez et al., 2013), infection with other A and B, C.  difficile strains produce a binary toxin, called C.  dif- food products may equally be fatal, particularly for those that are ficile toxin (CDT). However, only about 6 per cent of C.  difficile not cooked before eating (Weese, 2010). Pathogenic C.  difficile isolates produce the binary toxin, and these are toxinotype variants isolated from vegetables has been reported in Europe (al Saif and (Geric et al., 2004). Brazier, 1996), whereas in USA, there is limited research focusing In earlier studies, toxin A was regarded as the predominant viru- on ready-to-eat vegetable such as lettuce. Modified atmosphere lence factor, and toxin B alone, without the presence of toxin A, © The Author(s) 2018. Published by Oxford University Press on behalf of Zhejiang University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 38 Y. Han et al., 2018, Vol. 2, No. 1 packing and storage condition of lettuce could promote the growth used with two plates per filter bag. The plates were reduced anaer - of anaerobic bacteria such as C. difficile ( Doulgeraki et al., 2011). obically under room temperature for 24 hours before use. Then, Furthermore, there are various possible sources of lettuce contam- 0.1 ml of the collected supernatant was streaked onto the selective ination with C.  difficile, all of which are likely to be ultimately plates under a certified bacteria safety hood and the inverted plates human or animal, such as soil, fertilizer (manure), water, process- were incubated anaerobically, with the anaerobe pouch system men- ing environments, and human hands (Simango, 2006; Weese, 2010; tioned above, at 37°C for 48 hours. Clostridium difficile colonies Rodriguez et al., 2013). were identified by their morphological and fluorescence properties People are more likely to become infected with C. difficile with under long wavelength UV (380 nm) within 1 hour in the presence the use of antibiotics, not only because antibiotics disrupt the nor- of oxygen. The positive C. difficile colonies emitted a yellow fluor - mal intestinal flora, resulting in C. difficile colonization (Kyne et al., escence. For further research, the C. difficile colonies of each lettuce 2002), but also C. difficile has been found to be resistant to several sample isolated from the C.  difficile selective plates were collected antibiotics (Gerding, 2004; Owens et al., 2008). Antibiotics are used and stored in −80°C freezer. to treat bacterial infections, but some antibiotics are found to be ineffective in treating the infection of anaerobic bacteria including DNA extraction C.  difficile (Lyerly et  al., 1988). Clindamycin is an effective treat- Right after the colonies of C. difficile were observed on the plates, DNA ment for serious anaerobic bacterial infections, but has been used so extraction was conducted according to the instructions of a commercial widely that it is now gradually losing its efficiency (Kabins and Spira, ® DNA extraction kit (MO-BIO UltraClean Microbial DNA Isolation 1975). To date, when diarrhoea and colitis caused by C. difficile are Kit). Three colonies from each plate were collected into a sterile 2 ml severe, the common effective treatments are oral metronidazole and centrifuge tube. Then, the microbial cells were resuspended in the pro- vancomycin (Kelly and LaMont, 1998). vided bead solution, and they were added to a tube containing beads, In this study, we determined the prevalence and antibiotic resist- followed by lysis solution. With a combination of heat, detergent, and ance of C. difficile in processed retail lettuce. mechanical force against specialized beads, the cellular components were lysed. Clostridium difficile DNA was released from the lysed cells and bound to silica spin filter. After washing the filter several times, the Materials and methods DNA was recovered in the provided DNA-free Tris buffer. Extracted Sample preparation DNA was stored at –20°C until real-time polymerase chain reaction Lettuces, harvested in California, Arkansas, and Louisiana, were pur- (PCR) was performed. chased from September 2014 to March 2015 from retail stores. The lettuce samples were processed in Salinas, California; Bentonville, Real-time PCR assays for toxin A and toxin B Arkansas; and Baton Rouge, Louisiana. The types of lettuce purchased detection from California, Arkansas, and Louisiana were iceberg lettuce, butter Non-repeat regions on toxin A  and toxin B genes are commonly lettuce, and romaine lettuce, respectively. In all, 297 lettuce samples chosen as amplifying segments in real-time PCR assays. For toxin were tested, and for each state, 99 samples were tested: 8 lettuce sam- A detection assay, the primers and the probe described by Luna et al. ples per month in September, October, and November 2014; 10 lettuce (2011) were utilized; for toxin B detection, the real-time PCR method samples in December 2014; 15 lettuce samples in January 2015; 20 was performed with the primers and the probe specific to determine lettuce samples in February 2015; 30 lettuce samples in March 2015. the virulence of C.  difficile isolates in lettuce, as described by van Brain heart infusion (BHI) broth (BD) supplemented with 0.1 den Berg et  al. (2005) (Table  1). The total volume of each reaction per cent sodium taurocolic acid and C. difficile selective supplement mixture for the real-time PCR was 25 µl. For the toxin A assay, each (Sigma-Aldrich), containing cefoxitin (8  µg/ml) and D-cycloserine TM amplification mixture consisted of 12.5  µl Bio-Rad iQ Supermix (250  µg/ml), was used to enrich C.  difficile isolates, for isolation (2×), 0.6 µM forward primer (tcdAF), 0.6 µM reverse primer (tcdAR), from the lettuce samples. For each lettuce sample, 60 ml sterile BHI 0.1 µM hydrolysis probe (tcdATM), PCR grade water, and 6.25 µl supplemented broth and 40 g lettuce were blended together in a filter DNA sample. For the toxin B assay, each final reaction mixture bag; the collection from each sample was done in duplicate. Every TM included 12.5 µl Bio-Rad iQ Supermix (2×), 10 µM forward pri- TM filter bag was incubated anaerobically by GasPak EZ Anaerobe mer (398CLDs), 10 µM reverse primer (399CLDs), 10 µM 551CLD- Pouch System at 37°C for 10 days. tq-FAM probe, 0.1 M MgCl , PCR water, and 2.5 µl DNA template. Amplification was performed using a Cepheid SmartCycler II system Isolation of C. difficile (Sunnyvale). For toxin B assay, after the reaction mixtures were ini- After the samples were incubated for 10 days, the sample broth in tially heated for 3 minutes at 95°C, they went through 45 cycles. Each the filter bag was transferred into sterile test tubes. To detect the pres- cycle possessed a 30 second denaturation step at 94°C, a 30 second ence of C. difficile, BBL™ C. difficile Selective Agar (BD) plates were annealing step at 57°C, and a 30 second extension step at 72°C. The Table 1. Primers and probes used for real-time PCR detection of C. difficile toxins A and B. Primers and probe Nucleotide sequence (5’-3’) References Toxin A tcdAF GGTAATAATTCAAAAGCGGCT van den Berg et al., 2005 tcdAR AGCATCCGTATTAGCAGGTG tcdATM FAM-AGCCTAATACAGCTATGGGTGCGAA-AMRA Toxin B 398CLDs GAAAGTCCAAGTTTACGCTCAAT Luna et al., 2011 399CLDas GCTGCACCTAAACTTACACCA 551CLD-tq-FAM FAM-ACAGATGCAGCCAAAGTTGTTGAATT-TAMRA Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Clostridium difficile in lettuce, 2018, Vol. 2, No. 1 39 cycling program of the toxin A assay was as follows: 1 cycle of 95°C CFU/0.1  ml well. Results for antibiotic resistance were recorded for 10 minutes, 45 cycles of 95°C for 10 minutes, 57°C for 20 sec- after 20 to 24 hour incubation, and NCCLS interpretive criteria onds, and 72°C for 10 seconds. Positive and negative controls were were used to interpret the results: clindamycin, susceptible, ≤2 μg/ + + run in each trial. The extracted DNA (2.5 µl) from a toxin A toxin B ml, resistant, ≥ 8 μg/ml; vancomycin, susceptible, ≤2 μg/ml, resistant, C. difficile strain (ATCC 43255) was employed as the positive con- >2 μg/ml; metronidazole, susceptible, ≤8 μg/ml, resistant, ≥ 32 μg/ trol, and the PCR grade water (2.5 µl) served as the negative control. ml; erythromycin, susceptible, ≤0.5 μg/ml, resistant, ≥ 8 μg/ml; cefo- taxime, susceptible, ≤8 μg/ml, resistant, ≥ 64 μg/ml. PCR ribotyping Statistical analysis The method described by Bidet et  al. (1999) was followed; the primers 16S (5’-GTGCGGCTGGATCACCTCCT-3’) and 23S Percentage of total positive toxigenic C.  difficile isolated from (5’-CCCTGCACCCTTAATAACTT-GACC-3’) (IDT) were used for lettuce samples was calculated for each state by dividing the amplification. Briefly, a final volume of 50  µl reaction mixture con- total positive toxigenic C. difficile into 99 lettuce samples tested tained 5 µl 10× PCR buffer (invitrogen), 1.5 µl MgCl (50 mM), 1 µl for each state × 100. Percentage for all three states was cal- − + 10 mM dNTP mix (invitrogen), 1 µl 10mM of each primer, 1 µl DNA culated by dividing the positive toxigenic CDT A toxin B or ® + + template, 0.2  µl Platinum Taq DNA Polymerase (invitrogen), and toxin A toxin B for all states into the total 297 lettuce samples 39.3 µl PCR water. Samples were amplified in a PCR machine (Bio- tested × 100. Rad C1000 Thermal Cycle), beginning with 2 minutes at 94°C, and followed by 35 cycles of 30 second denaturation step at 94°C, 30 sec- Results ond annealing step at 57°C, and 45 second extension step at 72°C. The amplified products were separated electrophoretically on 1.5 per Prevalence of toxigenic C. difficile in lettuce samples cent agarose gels at 85 V for 2 hours. A  100–1000  bp DNA ladder The lettuce samples were purchased from three states and the preva- (BioLabs) was used as a size standard, and C. difficile ribotype 027 and lence of toxigenic C.  difficile was tested from September 2014 to 078 strains (University of Pittsburgh) were used as reference strains. March 2015 (Figure 1). During the 7 months of testing for toxigenic C. difficile in lettuce, California had 6 months with positive lettuce Antibiotic resistance detection samples, followed by Arkansas with 5 months with positive lettuce The standard NCCLS (National Committee for Clinical Laboratory samples and Louisiana with 4 months with positive lettuce samples Standards) broth microdilution MIC (minimal inhibitory concen- (Figure  1). Louisiana lettuce samples had the highest percentage tration) test was performed for the toxigenic isolates to determine of positive toxigenic C.  difficile isolates in February at 55 per cent the effect of the following antibiotics: clindamycin, vancomycin, (11/20) (Figure 1). metronidazole, erythromycin, and cefotaxime. For each toxigenic Of the 297 lettuce samples tested from three states (99 sam- isolate, the broth microdilution MIC test was conducted in dupli- ples per state): 15 toxigenic C. difficile isolates were detected in 99 cate. The Mueller–Hinton broth (BD) was used, and the pH was samples from California (15.1%); 10 toxigenic C.  difficile isolates adjusted between 7.2 and 7.4. Within 15 minutes of adjusting the were detected in 99 samples from Arkansas (10.1%); and 16 C. dif- inoculum broth to the turbidity of a 0.5 McFarland standard, the ficile toxigenic isolates were detected in 99 samples from Louisiana inoculum suspension was diluted to a final concentration of 5 × 10 (16.2%) (Table 2). Among the 41 toxigenic isolates, there were seven Figure 1. Prevalence of toxigenic C. difficile isolates in California, Arkansas, and Louisiana between September 2014 and March 2015. Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 40 Y. Han et al., 2018, Vol. 2, No. 1 − + toxin A toxin B C. difficile isolates (Table 2). The total percentage Antibiotic resistance of C. difficile of the toxigenic C. difficile isolates found in lettuce samples was 13.8 Five antibiotics, metronidazole, vancomycin, clindamycin, erythro- per cent. mycin, and cefotaxime, were tested against the toxigenic C.  dif- PCR ribotyping showed among all the 41 toxigenic C.  difficile ficile isolates (Table 3). Among the antibiotics we tested, all the 41 isolates, only two of the Louisiana C. difficile isolates were identified toxigenic C. difficile isolates were either resistant or intermediately as ribotype 027 strains when compared with the reference strains resistant. For clindamycin and cefotaxime, 37 and 26 toxigenic PCR ribotype 027 (Figure 2) and 078, and none of them had PCR C.  difficile isolates had intermediate resistance to the antibiotics, ribotype 078 (data not shown). respectively, which included the two ribotype 027 isolates from Louisiana. Discussion Table  2. Detection of toxigenic C.  difficile isolates in lettuce sam- ples from three states.* In this study, the total percentage of the toxigenic C.  difficile iso- − + lates found in lettuce samples was 13.8 per cent; this was higher State tested Toxin A Toxin A Total positive + + than other reported results (al Saif and Brazier, 1996; Bakri et  al., Toxin B Toxin B samples (%) 2009; Metcalf et al., 2010; Rodriguez-Palacios et al., 2014). Previous California, n = 99 3 12 15 (15.1%) scientific studies have concentrated on testing several types of veg- Arkansas, n = 99 2 8 10 (10.1%) etables including lettuce for toxigenic C.  difficile. In 2014, a study Louisiana, n = 99 2 14 16 (16.2%) conducted in Ohio tested 125 different vegetables that included 41 Total 7/297 (2.4%) 34/297 (11.4%) 41/297 (13.8%) lettuce samples for toxigenic C. difficile. The vegetable samples were from several retail stores located in Ohio and had originated from *Percentage was calculated for each state (horizontal columns) by dividing several states in the USA and Mexico. The results of their study found the total positive toxigenic C. difficile lettuce samples into 99 lettuce samples 1 positive toxigenic C.  difficile isolate in 41 lettuce samples tested tested for each state × 100. (2.4% positive) (Rodriguez-Palacios, 2014). In another study which Percentage for all three states (vertical columns) was calculated by dividing − + + + reported 7.5 per cent C. difficile prevalence in ready-to-eat salad in the positive toxigenic C. difficile Toxin A Toxin B or Toxin A Toxin B lettuce Scotland, they collected 40 packaged lettuce samples over 1 month samples for all states divided into the total 297 lettuce samples tested × 100. from seven different supermarkets (Bakri et al., 2009). These previ- ous studies detected lower C. difficile prevalence in lettuce than this study, possibly due to a small sample size, purchase location, and collecting samples over a short period of time (al Saif and Brazier, 1996; Bakri et  al., 2009; Metcalf et  al., 2010; Rodriguez-Palacios et al., 2014). In addition, contamination of lettuce with C.  difficile spores would not only be due to attachment on the leaves from contami- nated water or soil (Simango, 2006), but also would widely exist in the downstream production chain including storage, transportation, and handling environments (Rodriguez et  al., 2013). The lettuce samples that the toxigenic C. difficile were isolated from came from the same processors located in California, Arkansas, and Louisiana, if the processing environments were contaminated with toxigenic C. difficile spores; it could increase the prevalence of the C. difficile spores on the lettuce samples. The resistance and intermediately resistance properties of the toxigenic C difficile isolates for clindamycin and cefotaxime were Figure  2. PCR ribotying of lettuce sample isolates and reference strain similar to the findings from other C. difficile vegetable isolates (Bakri + + 027. Among all the seven toxin A toxin B C.  difficile isolates from lettuce et  al., 2009). All the toxigenic C.  difficile strains isolated from let- samples, only two isolates LA3 and LA4 from Louisiana lettuce were PCR ribotype 027 (lanes 5, 6, and 7, respectively). tuce were multi-drug resistant to metronidazole, vancomycin, and Table 3. Susceptibility of the C. difficile isolates to commonly used antibiotics. Agent MIC (μg/ml) No. (%) of isolates Range 50%* 90%** Susceptible Intermediate Resistant Metronidazole 0.125–80 >80 >80 0 (0) 0 (0) 41 (100) Vancomycin 0.25–4 4 >4 0 (0) 0 (0) 41 (100) Clindamycin 1–16 4 8 0 (0) 37 (90.2) 4 (9.8) Erythromycin 1–16 16 >16 0 (0) 0 (0) 41 (100) Cefotaxime 6–64 12 24 0 (0) 26 (63.4) 15 (36.6) *MIC , the antibiotic concentration when 50% growth of the tested C. difficile isolate inhibited. , the antibiotic concentration when 90% growth of the tested C. difficile isolate inhibited. **MIC Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Clostridium difficile in lettuce, 2018, Vol. 2, No. 1 41 Kelly, C. P., LaMont, J. T. (1998). Clostridium difficile infection. Annual erythromycin; these results differ from previously reported studies Review of Medicine, 49: 375–390. (Bakri et al., 2009; Metcalf et al., 2010). In both studies conducted in King, A. M., Mackin, K. E., Lyras, D. (2015). Emergence of toxin A-negative, Ohio and Scotland, the C. difficile isolates from lettuce were sensitive toxin B-positive Clostridium difficile strains: epidemiological and clinical to metronidazole and vancomycin, whereas the C.  difficile isolate considerations. Future Microbiology, 10: 1–4. from the Scotland lettuce sample was also resistant to erythromycin Kyne, L., Hamel, M. B., Polavaram, R., Kelly, C. P. (2002). Health care costs (Bakri et  al., 2009; Metcalf et  al., 2010). One study conducted in and mortality associated with nosocomial diarrhea due to clostridium dif- Canada isolated two toxin type C. difficile strains from ginger that ficile. Clinical Infectious Diseases: An Official Publication of the Infectious had different antimicrobial reaction to levofloxacin and clindamycin Diseases Society of America, 34: 346–353. (Metcalf et al., 2010). Because antibiotic resistance patterns are not Luna, R. A., et  al. (2011). Rapid stool-based diagnosis of Clostridium diffi- consistent enough to be used to identify C. difficile strains (Tenover cile infection by real-time PCR in a children’s hospital. Journal of Clinical Microbiology, 49: 851–857. et  al., 2012), the different antimicrobial effects of the antibiotics Lyerly, D. M., Krivan, H. C., Wilkins, T. D. (1988). Clostridium difficile: its against C. difficile isolates in this study would be understandable. disease and toxins. Clinical Microbiology Reviews, 1: 1–18. Lyras, D., et  al. (2009). Toxin B is essential for virulence of Clostridium dif- ficile. Nature, 458: 1176–1179. Conclusion Metcalf, D. S., Costa, M. C., Dew, W. M., Weese, J. S. (2010). Clostridium diffi- Clostridium difficile isolated from retail lettuce has a high possibility cile in vegetables, Canada. Letters in Applied Microbiology, 51: 600–602. to be toxigenic. Although the public health relevance is still unclear, Monaghan, T. M., Robins, A., Knox, A., Sewell, H. F., Mahida, Y. R. (2013). consuming retail vegetables such as lettuce raw or without high-tem- Circulating antibody and memory B-cell responses to C. difficile toxins perature processed might be a source of CDI. The C. difficile isolates A and B in patients with C.  difficile-associated diarrhoea, inflammatory from lettuce samples expressed strong resistance to metronidazole, bowel disease and cystic fibrosis. Plos One, 8: e74452. Owens, R. C. Jr, Donskey, C. J., Gaynes, R. P., Loo, V. G., Muto, C. A. (2008). vancomycin, and erythromycin. This present research contributes to Antimicrobial-associated risk factors for Clostridium difficile infection. revealing a possible source of community-associated CDI. Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America, 46 Suppl 1: S19–S31. Funding Pothoulakis, C., Triadafilopoulos, G., Clark, M., Franzblau, C., LaMont, J. T. (1986). Clostridium difficile cytotoxin inhibits protein syn- This work was supported by the US Department of Agriculture National Institute thesis in fibroblasts and intestinal mucosa. Gastroenterology, 91: of Food and Agriculture Multi-state Hatch project accession number 1000600. 1147–1153. Rodriguez, C., Avesani, V., Van Broeck, J., Taminiau, B., Delmée, M., Daube, References G. (2013). Presence of Clostridium difficile in pigs and cattle intestinal contents and carcass contamination at the slaughterhouse in Belgium. Anonymous. (1994). Treatment of Clostridium difficile associated diarrhea International Journal of Food Microbiology, 166: 256–262. and colitis with an oral preparation of teicoplanin; a dose finding study. Rodriguez-Palacios, A., Ilic, S., LeJeune, J. T. (2014). Clostridium difficile with The Swedish CDAD Study Group. Scandinavian Journal of Infectious moxifloxacin/clindamycin resistance in vegetables in Ohio, USA , and prev- Diseases, 26: 309–316. alence meta-analysis. Journal of Pathogens, 2014: 158601. al Saif, N., Brazier, J. S. (1996). The distribution of Clostridium difficile in the Rodriguez, C., Taminiau, B., Avesani, V., Van Broeck, J., Delmée, M., Daube, environment of south wales. Journal of Medical Microbiology, 45: 133–137. G. (2014). Multilocus sequence typing analysis and antibiotic resistance Bakri, M. M., Brown, D. J., Butcher, J. P., Sutherland, A. D. (2009). Clostridium of Clostridium difficile strains isolated from retail meat and humans in difficile in ready-to-eat salads, Scotland. Emerging Infectious Diseases, 15: Belgium. Food Microbiology, 42: 166–171. 817–818. Simango, C. (2006). Prevalence of Clostridium difficile in the environment Bidet, P., Barbut, F., Lalande, V., Burghoffer, B., Petit, J. C. (1999). Development in a rural community in Zimbabwe. Transactions of the Royal Society of of a new PCR-ribotyping method for Clostridium difficile based on ribo- Tropical Medicine and Hygiene, 100: 1146–1150. somal RNA gene sequencing. FEMS Microbiology Letters, 175: 261–266. Tenover, F. C., Tickler, I. A., Persing, D. H. (2012). Antimicrobial-resistant Doulgeraki, A. I., Paramithiotis, S., Nychas, G. J. (2011). Characterization strains of Clostridium difficile from North America. Antimicrobial Agents of the enterobacteriaceae community that developed during storage of and Chemotherapy, 56: 2929–2932. minced beef under aerobic or modified atmosphere packaging conditions. van den Berg, R. J., Bruijnesteijn van Coppenraet, L. S., Gerritsen, H. J., Endtz, International Journal of Food Microbiology, 145: 77–83. H. P., van der Vorm, E. R., Kuijper, E. J. (2005). Prospective multicenter Gerding, D. N. (2004). Clindamycin, cephalosporins, fluoroquinolones, and evaluation of a new immunoassay and real-time PCR for rapid diagno- Clostridium difficile-associated diarrhea: this is an antimicrobial resist- sis of Clostridium difficile-associated diarrhea in hospitalized patients. ance problem. Clinical Infectious Diseases: An Official Publication of the Journal of Clinical Microbiology, 43: 5338–5340. Infectious Diseases Society of America, 38: 646–648. Voth, D. E., Ballard, J. D. (2005). Clostridium difficile toxins: mechanism of Geric, B., Rupnik, M., Gerding, D. N., Grabnar, M., Johnson, S. (2004). action and role in disease. Clinical Microbiology Reviews, 18: 247–263. Distribution of Clostridium difficile variant toxinotypes and strains with Weese, J. S. (2010). Clostridium difficile in food–innocent bystander or serious binary toxin genes among clinical isolates in an American hospital. Journal threat? Clinical Microbiology and Infection: the Official Publication of of Medical Microbiology, 53: 887–894. the European Society of Clinical Microbiology and Infectious Diseases, Kabins, S. A., Spira, T. J. (1975). Outbreak of clindamycin-associated colitis. 16: 3–10. Annals of Internal Medicine, 83: 830–831. Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Food Quality and Safety Oxford University Press

Detection of antibiotic resistance toxigenic Clostridium difficile in processed retail lettuce

Free
5 pages

Loading next page...
 
/lp/ou_press/detection-of-antibiotic-resistance-toxigenic-clostridium-difficile-in-1ZcMrJA3bz
Publisher
Zhejiang University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of Zhejiang University Press.
ISSN
2399-1399
eISSN
2399-1402
D.O.I.
10.1093/fqsafe/fyx032
Publisher site
See Article on Publisher Site

Abstract

Objectives: Clostridium difficile is the major cause of infectious diarrhoea in humans after antimicrobial treatment. Clostridium difficile has been isolated from food animals and meat. The main purpose of this study was to characterize C.  difficile isolated from retail lettuce and determine the antibiotic resistance using five common clinical-selected antibiotics (metronidazole, vancomycin, clindamycin, erythromycin, and cefotaxime). Materials and Methods: Lettuce samples (grown in California, Arkansas, and Louisiana) were purchased from retail stores. Results: Toxigenic C.  difficile was isolated from 13.8 per cent (41/297) of the lettuce samples. Among the toxigenic isolates, only 82.9 per cent (34/41) produced toxin B, 17.1 per cent (7/41) produced both toxin A and toxin B, and two of the Louisiana C.  difficile isolates were identified as ribotype 027. Under the treatment of the five antibiotics, the virulence C. difficile isolates were identified as having antibiotic resistance to metronidazole, vancomycin, and erythromycin. Conclusion: The present study reports the highest prevalence of toxigenic C. difficile in US retail lettuce. The antibiotic resistance to metronidazole, vancomycin, and erythromycin of the isolated C. difficile from retail lettuces could lead to public health concerns. Keywords: Clostridium difficile; lettuce; toxigenic; toxin A; toxin B; antibiotic. did not cause disease (Anonymous, 1994; Pothoulakis et al., 1986; Introduction Voth and Ballard, 2005). As a result, the mechanism of toxin B in Clostridium difficile, a species of Gram-positive, spore-forming, disease is not well studied, whereas the role of toxin A  has been and anaerobic bacteria, is the causative reason of C. difficile–asso- − + studied. With the discovery of some toxinA toxinB strains (King ciated diarrhoea (CDAD) and can lead to more serious disease such et al., 2015), toxin B was reported to contribute to the C. difficile– as pseudomembranous colitis, toxic megacolon, and even death associated diseases, and it was regarded as the essential virulence in humans (Monaghan et  al., 2013). Pathogenic C.  difficile pro- contributor (Lyras, 2009). duces two protein exotoxins, toxin A, comprised of 2710 residues CDI has essentially occurred in a clinic environment; however, (308.0 kDa), and toxin B, comprised of 2366 residues (269.6 kDa) community-associated CDI is increasingly regarded as a potential (Kelly and LaMont, 1998). Toxins A and B (also called T cdA and foodborne disease, especially in food animals (Rodriguez et  al., T cdB), the primary makers of C.  difficile infection (CDI), belong 2014). Although infection with retail meat is most compelling but to the large clostridial cytotoxins (LCTs). In addition to toxins has not been proved (Rodriguez et al., 2013), infection with other A and B, C.  difficile strains produce a binary toxin, called C.  dif- food products may equally be fatal, particularly for those that are ficile toxin (CDT). However, only about 6 per cent of C.  difficile not cooked before eating (Weese, 2010). Pathogenic C.  difficile isolates produce the binary toxin, and these are toxinotype variants isolated from vegetables has been reported in Europe (al Saif and (Geric et al., 2004). Brazier, 1996), whereas in USA, there is limited research focusing In earlier studies, toxin A was regarded as the predominant viru- on ready-to-eat vegetable such as lettuce. Modified atmosphere lence factor, and toxin B alone, without the presence of toxin A, © The Author(s) 2018. Published by Oxford University Press on behalf of Zhejiang University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 38 Y. Han et al., 2018, Vol. 2, No. 1 packing and storage condition of lettuce could promote the growth used with two plates per filter bag. The plates were reduced anaer - of anaerobic bacteria such as C. difficile ( Doulgeraki et al., 2011). obically under room temperature for 24 hours before use. Then, Furthermore, there are various possible sources of lettuce contam- 0.1 ml of the collected supernatant was streaked onto the selective ination with C.  difficile, all of which are likely to be ultimately plates under a certified bacteria safety hood and the inverted plates human or animal, such as soil, fertilizer (manure), water, process- were incubated anaerobically, with the anaerobe pouch system men- ing environments, and human hands (Simango, 2006; Weese, 2010; tioned above, at 37°C for 48 hours. Clostridium difficile colonies Rodriguez et al., 2013). were identified by their morphological and fluorescence properties People are more likely to become infected with C. difficile with under long wavelength UV (380 nm) within 1 hour in the presence the use of antibiotics, not only because antibiotics disrupt the nor- of oxygen. The positive C. difficile colonies emitted a yellow fluor - mal intestinal flora, resulting in C. difficile colonization (Kyne et al., escence. For further research, the C. difficile colonies of each lettuce 2002), but also C. difficile has been found to be resistant to several sample isolated from the C.  difficile selective plates were collected antibiotics (Gerding, 2004; Owens et al., 2008). Antibiotics are used and stored in −80°C freezer. to treat bacterial infections, but some antibiotics are found to be ineffective in treating the infection of anaerobic bacteria including DNA extraction C.  difficile (Lyerly et  al., 1988). Clindamycin is an effective treat- Right after the colonies of C. difficile were observed on the plates, DNA ment for serious anaerobic bacterial infections, but has been used so extraction was conducted according to the instructions of a commercial widely that it is now gradually losing its efficiency (Kabins and Spira, ® DNA extraction kit (MO-BIO UltraClean Microbial DNA Isolation 1975). To date, when diarrhoea and colitis caused by C. difficile are Kit). Three colonies from each plate were collected into a sterile 2 ml severe, the common effective treatments are oral metronidazole and centrifuge tube. Then, the microbial cells were resuspended in the pro- vancomycin (Kelly and LaMont, 1998). vided bead solution, and they were added to a tube containing beads, In this study, we determined the prevalence and antibiotic resist- followed by lysis solution. With a combination of heat, detergent, and ance of C. difficile in processed retail lettuce. mechanical force against specialized beads, the cellular components were lysed. Clostridium difficile DNA was released from the lysed cells and bound to silica spin filter. After washing the filter several times, the Materials and methods DNA was recovered in the provided DNA-free Tris buffer. Extracted Sample preparation DNA was stored at –20°C until real-time polymerase chain reaction Lettuces, harvested in California, Arkansas, and Louisiana, were pur- (PCR) was performed. chased from September 2014 to March 2015 from retail stores. The lettuce samples were processed in Salinas, California; Bentonville, Real-time PCR assays for toxin A and toxin B Arkansas; and Baton Rouge, Louisiana. The types of lettuce purchased detection from California, Arkansas, and Louisiana were iceberg lettuce, butter Non-repeat regions on toxin A  and toxin B genes are commonly lettuce, and romaine lettuce, respectively. In all, 297 lettuce samples chosen as amplifying segments in real-time PCR assays. For toxin were tested, and for each state, 99 samples were tested: 8 lettuce sam- A detection assay, the primers and the probe described by Luna et al. ples per month in September, October, and November 2014; 10 lettuce (2011) were utilized; for toxin B detection, the real-time PCR method samples in December 2014; 15 lettuce samples in January 2015; 20 was performed with the primers and the probe specific to determine lettuce samples in February 2015; 30 lettuce samples in March 2015. the virulence of C.  difficile isolates in lettuce, as described by van Brain heart infusion (BHI) broth (BD) supplemented with 0.1 den Berg et  al. (2005) (Table  1). The total volume of each reaction per cent sodium taurocolic acid and C. difficile selective supplement mixture for the real-time PCR was 25 µl. For the toxin A assay, each (Sigma-Aldrich), containing cefoxitin (8  µg/ml) and D-cycloserine TM amplification mixture consisted of 12.5  µl Bio-Rad iQ Supermix (250  µg/ml), was used to enrich C.  difficile isolates, for isolation (2×), 0.6 µM forward primer (tcdAF), 0.6 µM reverse primer (tcdAR), from the lettuce samples. For each lettuce sample, 60 ml sterile BHI 0.1 µM hydrolysis probe (tcdATM), PCR grade water, and 6.25 µl supplemented broth and 40 g lettuce were blended together in a filter DNA sample. For the toxin B assay, each final reaction mixture bag; the collection from each sample was done in duplicate. Every TM included 12.5 µl Bio-Rad iQ Supermix (2×), 10 µM forward pri- TM filter bag was incubated anaerobically by GasPak EZ Anaerobe mer (398CLDs), 10 µM reverse primer (399CLDs), 10 µM 551CLD- Pouch System at 37°C for 10 days. tq-FAM probe, 0.1 M MgCl , PCR water, and 2.5 µl DNA template. Amplification was performed using a Cepheid SmartCycler II system Isolation of C. difficile (Sunnyvale). For toxin B assay, after the reaction mixtures were ini- After the samples were incubated for 10 days, the sample broth in tially heated for 3 minutes at 95°C, they went through 45 cycles. Each the filter bag was transferred into sterile test tubes. To detect the pres- cycle possessed a 30 second denaturation step at 94°C, a 30 second ence of C. difficile, BBL™ C. difficile Selective Agar (BD) plates were annealing step at 57°C, and a 30 second extension step at 72°C. The Table 1. Primers and probes used for real-time PCR detection of C. difficile toxins A and B. Primers and probe Nucleotide sequence (5’-3’) References Toxin A tcdAF GGTAATAATTCAAAAGCGGCT van den Berg et al., 2005 tcdAR AGCATCCGTATTAGCAGGTG tcdATM FAM-AGCCTAATACAGCTATGGGTGCGAA-AMRA Toxin B 398CLDs GAAAGTCCAAGTTTACGCTCAAT Luna et al., 2011 399CLDas GCTGCACCTAAACTTACACCA 551CLD-tq-FAM FAM-ACAGATGCAGCCAAAGTTGTTGAATT-TAMRA Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Clostridium difficile in lettuce, 2018, Vol. 2, No. 1 39 cycling program of the toxin A assay was as follows: 1 cycle of 95°C CFU/0.1  ml well. Results for antibiotic resistance were recorded for 10 minutes, 45 cycles of 95°C for 10 minutes, 57°C for 20 sec- after 20 to 24 hour incubation, and NCCLS interpretive criteria onds, and 72°C for 10 seconds. Positive and negative controls were were used to interpret the results: clindamycin, susceptible, ≤2 μg/ + + run in each trial. The extracted DNA (2.5 µl) from a toxin A toxin B ml, resistant, ≥ 8 μg/ml; vancomycin, susceptible, ≤2 μg/ml, resistant, C. difficile strain (ATCC 43255) was employed as the positive con- >2 μg/ml; metronidazole, susceptible, ≤8 μg/ml, resistant, ≥ 32 μg/ trol, and the PCR grade water (2.5 µl) served as the negative control. ml; erythromycin, susceptible, ≤0.5 μg/ml, resistant, ≥ 8 μg/ml; cefo- taxime, susceptible, ≤8 μg/ml, resistant, ≥ 64 μg/ml. PCR ribotyping Statistical analysis The method described by Bidet et  al. (1999) was followed; the primers 16S (5’-GTGCGGCTGGATCACCTCCT-3’) and 23S Percentage of total positive toxigenic C.  difficile isolated from (5’-CCCTGCACCCTTAATAACTT-GACC-3’) (IDT) were used for lettuce samples was calculated for each state by dividing the amplification. Briefly, a final volume of 50  µl reaction mixture con- total positive toxigenic C. difficile into 99 lettuce samples tested tained 5 µl 10× PCR buffer (invitrogen), 1.5 µl MgCl (50 mM), 1 µl for each state × 100. Percentage for all three states was cal- − + 10 mM dNTP mix (invitrogen), 1 µl 10mM of each primer, 1 µl DNA culated by dividing the positive toxigenic CDT A toxin B or ® + + template, 0.2  µl Platinum Taq DNA Polymerase (invitrogen), and toxin A toxin B for all states into the total 297 lettuce samples 39.3 µl PCR water. Samples were amplified in a PCR machine (Bio- tested × 100. Rad C1000 Thermal Cycle), beginning with 2 minutes at 94°C, and followed by 35 cycles of 30 second denaturation step at 94°C, 30 sec- Results ond annealing step at 57°C, and 45 second extension step at 72°C. The amplified products were separated electrophoretically on 1.5 per Prevalence of toxigenic C. difficile in lettuce samples cent agarose gels at 85 V for 2 hours. A  100–1000  bp DNA ladder The lettuce samples were purchased from three states and the preva- (BioLabs) was used as a size standard, and C. difficile ribotype 027 and lence of toxigenic C.  difficile was tested from September 2014 to 078 strains (University of Pittsburgh) were used as reference strains. March 2015 (Figure 1). During the 7 months of testing for toxigenic C. difficile in lettuce, California had 6 months with positive lettuce Antibiotic resistance detection samples, followed by Arkansas with 5 months with positive lettuce The standard NCCLS (National Committee for Clinical Laboratory samples and Louisiana with 4 months with positive lettuce samples Standards) broth microdilution MIC (minimal inhibitory concen- (Figure  1). Louisiana lettuce samples had the highest percentage tration) test was performed for the toxigenic isolates to determine of positive toxigenic C.  difficile isolates in February at 55 per cent the effect of the following antibiotics: clindamycin, vancomycin, (11/20) (Figure 1). metronidazole, erythromycin, and cefotaxime. For each toxigenic Of the 297 lettuce samples tested from three states (99 sam- isolate, the broth microdilution MIC test was conducted in dupli- ples per state): 15 toxigenic C. difficile isolates were detected in 99 cate. The Mueller–Hinton broth (BD) was used, and the pH was samples from California (15.1%); 10 toxigenic C.  difficile isolates adjusted between 7.2 and 7.4. Within 15 minutes of adjusting the were detected in 99 samples from Arkansas (10.1%); and 16 C. dif- inoculum broth to the turbidity of a 0.5 McFarland standard, the ficile toxigenic isolates were detected in 99 samples from Louisiana inoculum suspension was diluted to a final concentration of 5 × 10 (16.2%) (Table 2). Among the 41 toxigenic isolates, there were seven Figure 1. Prevalence of toxigenic C. difficile isolates in California, Arkansas, and Louisiana between September 2014 and March 2015. Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 40 Y. Han et al., 2018, Vol. 2, No. 1 − + toxin A toxin B C. difficile isolates (Table 2). The total percentage Antibiotic resistance of C. difficile of the toxigenic C. difficile isolates found in lettuce samples was 13.8 Five antibiotics, metronidazole, vancomycin, clindamycin, erythro- per cent. mycin, and cefotaxime, were tested against the toxigenic C.  dif- PCR ribotyping showed among all the 41 toxigenic C.  difficile ficile isolates (Table 3). Among the antibiotics we tested, all the 41 isolates, only two of the Louisiana C. difficile isolates were identified toxigenic C. difficile isolates were either resistant or intermediately as ribotype 027 strains when compared with the reference strains resistant. For clindamycin and cefotaxime, 37 and 26 toxigenic PCR ribotype 027 (Figure 2) and 078, and none of them had PCR C.  difficile isolates had intermediate resistance to the antibiotics, ribotype 078 (data not shown). respectively, which included the two ribotype 027 isolates from Louisiana. Discussion Table  2. Detection of toxigenic C.  difficile isolates in lettuce sam- ples from three states.* In this study, the total percentage of the toxigenic C.  difficile iso- − + lates found in lettuce samples was 13.8 per cent; this was higher State tested Toxin A Toxin A Total positive + + than other reported results (al Saif and Brazier, 1996; Bakri et  al., Toxin B Toxin B samples (%) 2009; Metcalf et al., 2010; Rodriguez-Palacios et al., 2014). Previous California, n = 99 3 12 15 (15.1%) scientific studies have concentrated on testing several types of veg- Arkansas, n = 99 2 8 10 (10.1%) etables including lettuce for toxigenic C.  difficile. In 2014, a study Louisiana, n = 99 2 14 16 (16.2%) conducted in Ohio tested 125 different vegetables that included 41 Total 7/297 (2.4%) 34/297 (11.4%) 41/297 (13.8%) lettuce samples for toxigenic C. difficile. The vegetable samples were from several retail stores located in Ohio and had originated from *Percentage was calculated for each state (horizontal columns) by dividing several states in the USA and Mexico. The results of their study found the total positive toxigenic C. difficile lettuce samples into 99 lettuce samples 1 positive toxigenic C.  difficile isolate in 41 lettuce samples tested tested for each state × 100. (2.4% positive) (Rodriguez-Palacios, 2014). In another study which Percentage for all three states (vertical columns) was calculated by dividing − + + + reported 7.5 per cent C. difficile prevalence in ready-to-eat salad in the positive toxigenic C. difficile Toxin A Toxin B or Toxin A Toxin B lettuce Scotland, they collected 40 packaged lettuce samples over 1 month samples for all states divided into the total 297 lettuce samples tested × 100. from seven different supermarkets (Bakri et al., 2009). These previ- ous studies detected lower C. difficile prevalence in lettuce than this study, possibly due to a small sample size, purchase location, and collecting samples over a short period of time (al Saif and Brazier, 1996; Bakri et  al., 2009; Metcalf et  al., 2010; Rodriguez-Palacios et al., 2014). In addition, contamination of lettuce with C.  difficile spores would not only be due to attachment on the leaves from contami- nated water or soil (Simango, 2006), but also would widely exist in the downstream production chain including storage, transportation, and handling environments (Rodriguez et  al., 2013). The lettuce samples that the toxigenic C. difficile were isolated from came from the same processors located in California, Arkansas, and Louisiana, if the processing environments were contaminated with toxigenic C. difficile spores; it could increase the prevalence of the C. difficile spores on the lettuce samples. The resistance and intermediately resistance properties of the toxigenic C difficile isolates for clindamycin and cefotaxime were Figure  2. PCR ribotying of lettuce sample isolates and reference strain similar to the findings from other C. difficile vegetable isolates (Bakri + + 027. Among all the seven toxin A toxin B C.  difficile isolates from lettuce et  al., 2009). All the toxigenic C.  difficile strains isolated from let- samples, only two isolates LA3 and LA4 from Louisiana lettuce were PCR ribotype 027 (lanes 5, 6, and 7, respectively). tuce were multi-drug resistant to metronidazole, vancomycin, and Table 3. Susceptibility of the C. difficile isolates to commonly used antibiotics. Agent MIC (μg/ml) No. (%) of isolates Range 50%* 90%** Susceptible Intermediate Resistant Metronidazole 0.125–80 >80 >80 0 (0) 0 (0) 41 (100) Vancomycin 0.25–4 4 >4 0 (0) 0 (0) 41 (100) Clindamycin 1–16 4 8 0 (0) 37 (90.2) 4 (9.8) Erythromycin 1–16 16 >16 0 (0) 0 (0) 41 (100) Cefotaxime 6–64 12 24 0 (0) 26 (63.4) 15 (36.6) *MIC , the antibiotic concentration when 50% growth of the tested C. difficile isolate inhibited. , the antibiotic concentration when 90% growth of the tested C. difficile isolate inhibited. **MIC Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Clostridium difficile in lettuce, 2018, Vol. 2, No. 1 41 Kelly, C. P., LaMont, J. T. (1998). Clostridium difficile infection. Annual erythromycin; these results differ from previously reported studies Review of Medicine, 49: 375–390. (Bakri et al., 2009; Metcalf et al., 2010). In both studies conducted in King, A. M., Mackin, K. E., Lyras, D. (2015). Emergence of toxin A-negative, Ohio and Scotland, the C. difficile isolates from lettuce were sensitive toxin B-positive Clostridium difficile strains: epidemiological and clinical to metronidazole and vancomycin, whereas the C.  difficile isolate considerations. Future Microbiology, 10: 1–4. from the Scotland lettuce sample was also resistant to erythromycin Kyne, L., Hamel, M. B., Polavaram, R., Kelly, C. P. (2002). Health care costs (Bakri et  al., 2009; Metcalf et  al., 2010). One study conducted in and mortality associated with nosocomial diarrhea due to clostridium dif- Canada isolated two toxin type C. difficile strains from ginger that ficile. Clinical Infectious Diseases: An Official Publication of the Infectious had different antimicrobial reaction to levofloxacin and clindamycin Diseases Society of America, 34: 346–353. (Metcalf et al., 2010). Because antibiotic resistance patterns are not Luna, R. A., et  al. (2011). Rapid stool-based diagnosis of Clostridium diffi- consistent enough to be used to identify C. difficile strains (Tenover cile infection by real-time PCR in a children’s hospital. Journal of Clinical Microbiology, 49: 851–857. et  al., 2012), the different antimicrobial effects of the antibiotics Lyerly, D. M., Krivan, H. C., Wilkins, T. D. (1988). Clostridium difficile: its against C. difficile isolates in this study would be understandable. disease and toxins. Clinical Microbiology Reviews, 1: 1–18. Lyras, D., et  al. (2009). Toxin B is essential for virulence of Clostridium dif- ficile. Nature, 458: 1176–1179. Conclusion Metcalf, D. S., Costa, M. C., Dew, W. M., Weese, J. S. (2010). Clostridium diffi- Clostridium difficile isolated from retail lettuce has a high possibility cile in vegetables, Canada. Letters in Applied Microbiology, 51: 600–602. to be toxigenic. Although the public health relevance is still unclear, Monaghan, T. M., Robins, A., Knox, A., Sewell, H. F., Mahida, Y. R. (2013). consuming retail vegetables such as lettuce raw or without high-tem- Circulating antibody and memory B-cell responses to C. difficile toxins perature processed might be a source of CDI. The C. difficile isolates A and B in patients with C.  difficile-associated diarrhoea, inflammatory from lettuce samples expressed strong resistance to metronidazole, bowel disease and cystic fibrosis. Plos One, 8: e74452. Owens, R. C. Jr, Donskey, C. J., Gaynes, R. P., Loo, V. G., Muto, C. A. (2008). vancomycin, and erythromycin. This present research contributes to Antimicrobial-associated risk factors for Clostridium difficile infection. revealing a possible source of community-associated CDI. Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America, 46 Suppl 1: S19–S31. Funding Pothoulakis, C., Triadafilopoulos, G., Clark, M., Franzblau, C., LaMont, J. T. (1986). Clostridium difficile cytotoxin inhibits protein syn- This work was supported by the US Department of Agriculture National Institute thesis in fibroblasts and intestinal mucosa. Gastroenterology, 91: of Food and Agriculture Multi-state Hatch project accession number 1000600. 1147–1153. Rodriguez, C., Avesani, V., Van Broeck, J., Taminiau, B., Delmée, M., Daube, References G. (2013). Presence of Clostridium difficile in pigs and cattle intestinal contents and carcass contamination at the slaughterhouse in Belgium. Anonymous. (1994). Treatment of Clostridium difficile associated diarrhea International Journal of Food Microbiology, 166: 256–262. and colitis with an oral preparation of teicoplanin; a dose finding study. Rodriguez-Palacios, A., Ilic, S., LeJeune, J. T. (2014). Clostridium difficile with The Swedish CDAD Study Group. Scandinavian Journal of Infectious moxifloxacin/clindamycin resistance in vegetables in Ohio, USA , and prev- Diseases, 26: 309–316. alence meta-analysis. Journal of Pathogens, 2014: 158601. al Saif, N., Brazier, J. S. (1996). The distribution of Clostridium difficile in the Rodriguez, C., Taminiau, B., Avesani, V., Van Broeck, J., Delmée, M., Daube, environment of south wales. Journal of Medical Microbiology, 45: 133–137. G. (2014). Multilocus sequence typing analysis and antibiotic resistance Bakri, M. M., Brown, D. J., Butcher, J. P., Sutherland, A. D. (2009). Clostridium of Clostridium difficile strains isolated from retail meat and humans in difficile in ready-to-eat salads, Scotland. Emerging Infectious Diseases, 15: Belgium. Food Microbiology, 42: 166–171. 817–818. Simango, C. (2006). Prevalence of Clostridium difficile in the environment Bidet, P., Barbut, F., Lalande, V., Burghoffer, B., Petit, J. C. (1999). Development in a rural community in Zimbabwe. Transactions of the Royal Society of of a new PCR-ribotyping method for Clostridium difficile based on ribo- Tropical Medicine and Hygiene, 100: 1146–1150. somal RNA gene sequencing. FEMS Microbiology Letters, 175: 261–266. Tenover, F. C., Tickler, I. A., Persing, D. H. (2012). Antimicrobial-resistant Doulgeraki, A. I., Paramithiotis, S., Nychas, G. J. (2011). Characterization strains of Clostridium difficile from North America. Antimicrobial Agents of the enterobacteriaceae community that developed during storage of and Chemotherapy, 56: 2929–2932. minced beef under aerobic or modified atmosphere packaging conditions. van den Berg, R. J., Bruijnesteijn van Coppenraet, L. S., Gerritsen, H. J., Endtz, International Journal of Food Microbiology, 145: 77–83. H. P., van der Vorm, E. R., Kuijper, E. J. (2005). Prospective multicenter Gerding, D. N. (2004). Clindamycin, cephalosporins, fluoroquinolones, and evaluation of a new immunoassay and real-time PCR for rapid diagno- Clostridium difficile-associated diarrhea: this is an antimicrobial resist- sis of Clostridium difficile-associated diarrhea in hospitalized patients. ance problem. Clinical Infectious Diseases: An Official Publication of the Journal of Clinical Microbiology, 43: 5338–5340. Infectious Diseases Society of America, 38: 646–648. Voth, D. E., Ballard, J. D. (2005). Clostridium difficile toxins: mechanism of Geric, B., Rupnik, M., Gerding, D. N., Grabnar, M., Johnson, S. (2004). action and role in disease. Clinical Microbiology Reviews, 18: 247–263. Distribution of Clostridium difficile variant toxinotypes and strains with Weese, J. S. (2010). Clostridium difficile in food–innocent bystander or serious binary toxin genes among clinical isolates in an American hospital. Journal threat? Clinical Microbiology and Infection: the Official Publication of of Medical Microbiology, 53: 887–894. the European Society of Clinical Microbiology and Infectious Diseases, Kabins, S. A., Spira, T. J. (1975). Outbreak of clindamycin-associated colitis. 16: 3–10. Annals of Internal Medicine, 83: 830–831. Downloaded from https://academic.oup.com/fqs/article-abstract/2/1/37/4823834 by Ed 'DeepDyve' Gillespie user on 16 March 2018

Journal

Food Quality and SafetyOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off