Cytosolic galectin-3 and -8 regulate antibacterial autophagy through differential recognition of host glycans on damaged phagosomes

Cytosolic galectin-3 and -8 regulate antibacterial autophagy through differential recognition of... Abstract While glycans are generally displayed on the cell surface or confined within the lumen of organelles, they can become exposed to the cytosolic milieu upon disruption of organelle membrane by various stresses or pathogens. Galectins are a family of β-galactoside-binding animal lectins synthesized and predominantly localized in the cytosol. Recent research indicates that some galectins may act as “danger signal sensors” by detecting unusual exposure of glycans to the cytosol. Galectin-8 was shown to promote antibacterial autophagy by recognizing host glycans on ruptured vacuolar membranes and interacting with the autophagy adaptor protein NDP52. Galectin-3 also accumulates at damaged phagosomes containing bacteria; however, its functional consequence remains obscure. By studying mouse macrophages infected with Listeria monocytogenes (LM), we showed that endogenous galectin-3 protects intracellular LM by suppressing the autophagic response through a host N-glycan-dependent mechanism. Knock out of the galectin-3 gene resulted in enhanced LC3 recruitment to LM and decreased bacterial replication, a phenotype recapitulated when Galectin-8-deficient macrophages were depleted of N-glycans. Moreover, we explored the concept that alterations in cell surface glycosylation by extracellular factors can be deciphered by cytosolic galectins during the process of phagocytosis/endocytosis, followed by rupture of phagosomal/endosomal membrane. Notably, treatment of cells with sialidase, which removes sialic acid from glycans, resulted in increased galectin-3 accumulation and decreased galectin-8 recruitment at damaged phagosomes, and led to a stronger anti-autophagic response. Our findings demonstrate that cytosolic galectins may sense changes in glycosylation at the cell surface and modulate cellular response through differential recognition of glycans on ruptured phagosomal membranes. autophagy, galectin, Listeria, macrophage, sialidase Introduction Multicellular organisms are equipped with an array of defense systems that provide protection from pathogens and other cellular insults. Phagocytic cells such as macrophages are among the first lines of defense, killing pathogens in part by engulfing and delivering them to lysosomes for degradation. To evade lysosomal degradation and gain access to the nutrient-rich host cell cytoplasm, many intracellular bacterial pathogens, including Listeria monocytogenes (LM), have evolved strategies to lyse the phagosomal membrane (Portnoy et al. 2002; Ashida et al. 2011). The mammalian cell cytosol contains several antimicrobial surveillance systems that either recognize microbial components directly or detect invasion-associated signals, such as the generation of reactive oxygen species (ROS) and phagosomal membrane damage (Tschopp and Schroder 2010). Subsequently, invading bacteria are targeted for lysosomal degradation via an essential mechanism referred to as selective autophagy (Deretic et al. 2013). Recent studies have identified multiple mechanisms that induce antibacterial autophagy. Typically, bacterial pathogens are tagged with ubiquitin and then targeted by adaptor proteins [e.g., p62, nuclear dot protein 52 (NDP52), Tank-binding kinase 1 (TBK1) and optineurin], which bind to microtubule-associated protein light chain 3 (LC3) on newly formed isolation membranes and allow ubiquitin-tagged cargos to be delivered to autophagosomes (Collins and Brown 2010; Thurston et al. 2009; Wild et al. 2011; Zheng et al. 2009). Galectins are β-galactoside-binding animal lectins that have been reported to participate in various physiological and pathological processes, including immunity, inflammation and cancer progression (Liu and Rabinovich 2005; Liu et al. 2012; Rabinovich and Toscano 2009). Each member of the galectin family contains a consensus amino acid sequence in the carbohydrate-recognition domain (CRD). These molecules are sub-categorized based on their protein structures into one-CRD type (galectin-1, -2, -5, -7, -10, -11, -13, -14 and -15), two-CRD type (galectin-4, -6, -8, -9 and -12), and a chimera type (galectin-3) (Barondes et al. 1994; Yang et al. 2008). While galectins are primarily located in the cytoplasm, under certain circumstances they localize to the nucleus or associate with intracellular vesicles, and are detected in the extracellular space (Liu et al. 2012). A number of studies have demonstrated that galectins recognize microbial glycans [reviewed in Chen et al. (2014); Vasta (2009); Vasta et al. (2012)]; however, the majority of these interactions were demonstrated by binding of recombinant galectins to isolated microorganisms, and thus may not reflect natural infectious condition in vivo (Fowler et al. 2006; John et al. 2002; Kohatsu et al. 2006; Quattroni et al. 2012). Galectin-3, -8, and -9 were shown to be recruited to vesicles that initially contained intracellular bacteria such as Salmonella typhimurium, Shigella flexneri and LM, but were subsequently ruptured by the bacteria as the latter escaped from the vesicles (Dupont et al. 2009; Thurston et al. 2012). Recruitment and accumulation of galectins on these ruptured vesicles is dependent on binding of galectins to host glycans that are normally confined to the luminal side of the vesicle, but exposed to the cytosol upon lysis (Paz et al. 2010; Thurston et al. 2012). Recently, Thurston et al. reported that after binding to host N-glycans on ruptured Salmonella-containing vesicles, galectin-8 recruits the adaptor protein NDP52, which triggers autophagic activation resulting in the confinement of both the bacteria and damaged vesicles within autophagosomes (Thurston et al. 2012). Meanwhile, Feeley et al. demonstrated that galectin-3 promotes the recruitment of guanylate binding proteins (GBPs) to Legionella- and Yersinia-containing vacuoles in IFN-γ-primed mouse bone marrow-derived macrophages in a host glycan-dependent manner (Feeley et al. 2017). Aside from these reports, however, the functional consequence of recruitment of galectins to ruptured bacteria-containing vesicles remains largely unexplored. During infection by microbial pathogens, glycans displayed on the host cell surface may be modified by endogenous or exogenous glycosidase, thereby affecting host–pathogen interaction and downstream cellular defense mechanisms (Nita-Lazar et al. 2015; Ohtsubo and Marth 2006). Sialic acids are a family of nine-carbon monosaccharides commonly present at the terminal position of eukaryotic cell glycans. They are highly expressed on the outer cell membrane, at the interior of lysosomal membranes, and on secreted glycoproteins, and are involved in the stabilization of molecules and modulation of interactions with the environment (Varki et al. 2009). Because of their outermost position, sialic acids are vulnerable to the action of microbial esterases, sialidases and lyases (Ideo et al. 2003). Various microorganisms, including viruses, bacteria, protozoa and fungi, produce sialidases, and degradation of human sialic acids by pathogen-produced sialidases is associated with diseases such as periodontitis, cystic fibrosis, pneumonia, and influenza infection (Lewis and Lewis 2012; Vande Velde 2013). Many microbial sialidases are powerful virulence factors that assist in invasion, unmask potential binding sites, and provide nutrients for the bacteria (Vande Velde 2013). Several studies have shown that α2-6 sialylation blocks binding of β-galactosides to most galectins, including galectin-1, -3, -8, and -9 (Hirabayashi et al. 2002; Stowell et al. 2008; Zhuo and Bellis 2011), whereas α2–3 sialylation substantially enhances the affinity of the N-terminal CRD of galectin-8 (Gal-8N) but not the C-terminal CRD of galectin-8 (Gal8-C) or galectin-3 (Hirabayashi et al. 2002). Thus, we proposed that changes in cell surface glycosylation, such as the sialylation status of cell surface glycans, can impact galectin-mediated intracellular responses resulting from the interaction of cytosolic galectins with these glycans following endocytosis and vacuole damage. In this study, we utilized macrophages from homozygous wild-type (gal3+/+) and homozygous Lgals3 gene knockout (gal3–/–) mice as a model to delineate the function of endogenous galectin-3 during intracellular LM infection. We report that, unlike galectin-8, galectin-3 promotes bacterial survival by suppressing the activation of antibacterial autophagy. This anti-autophagic activity of galectin-3 is dependent on the presence of host N-glycans on damaged phagosomal membranes, which induce galectin-3 accumulation near damaged phagosomes containing bacteria. By studying galectin-3 and galectin-8 double-knock-out macrophages, we further demonstrate that galectin-3 does not inhibit autophagy simply by blocking galectin-8 binding to glycan ligands, but is an active player in down-regulating autophagy. Importantly, we show that changes in cell surface glycosylation may impact the outcome of infections through the antagonistic interaction of galectin-3 and galectin-8 in regulating antibacterial autophagy. This study provides significant insight into the role of intracellular galectins in bacterial pathogenesis and the innate immune function of macrophages. Results Galectin-3 accumulates at damaged LM-containing phagosomes and exerts a protective effect on LM in macrophages Given that galectin-3 was shown to accumulate at damaged bacteria-containing vacuoles (Dupont et al. 2009; Paz et al. 2010; Thurston et al. 2012), we examined the distribution pattern of this protein in mouse macrophages during LM infection via immunofluorescence staining. While significant accumulation of galectin-3 was observed adjacent to wild-type (WT) LM at 1 h post-infection in mouse J774 macrophages (Figure 1A), this effect was not observed in J774 cells infected with the LM ∆hly strain, which is deficient in the pore-forming cytolysin listeriolysin O (LLO) and is unable to escape from host cell vacuoles (Figure 1A) (Jones and Portnoy 1994). These data indicate that recruitment of galectin-3 to the LM-containing phagosome occurs after phagosomal integrity is compromised by the bacterium. Fig. 1. View largeDownload slide Galectin-3 accumulates at damaged phagosomes containing LM and provides a protective effect for LM within macrophages. (A) J774 cells were infected with wild-type LM 10,403 S (LM WT) or LM DP-L2161 (LM ∆hly) at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained using galectin-3 and LM-specific antibodies. (B and C) gal3+/+ BMMs were infected with LM WT (B) or LM ∆hly (C) at an MOI of 5 for 30 min. Cells were fixed, prepared for cryosectioning, and labeled using a galectin-3-specific antibody conjugated to 10-nm gold particles. Scale bars represent 100 nm. (D) Time-lapse images of rapid recruitment of cytosolic galectin-3 to escaping LM. J774 cells stably expressing galectin-3-EGFP were loaded with LysoTracker Red DND-99 and infected with BacLight Red-stained LM WT at an approximate MOI of 100. Cells were monitored by confocal microscopy and live images were taken at 1-min intervals. Galectin-3 is shown in green, LM is shown in red, and LysoTracker is shown in blue. Arrows point to specific bacteria followed over the time course. Magnified pictures of the boxed regions are shown in the bottom. (E) gal3+/+ (●) or gal3–/– (○) BMMs were infected with LM WT at an MOI of 0.25. At various time points post-infection, cells were lysed, and diluted lysates were plated on BHI agar for enumeration of CFUs. (F) gal3+/+ (■) or gal3–/– (□) BMMs were infected with LM WT or the mutant strains LM ∆hly or LM ∆actA at an MOI of 0.25. At 24 h post-infection, cells were lysed, and diluted lysates were plated for enumeration of CFUs. Data points represent the means ± standard deviations (SD) of the results obtained from triplicate wells. Results are representative of at least three independent experiments. *P < 0.05; **P < 0.01; gal3–/– compared to gal3+/+ by Student’s t-test. (G) gal3+/+ or gal3–/– BMMs were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM and nuclei. The number of LM per cell was quantified using an ImageXpress Micro XLS Widefield High-Content Analysis System. Typically, for each sample, nine randomly-chosen image fields containing a total of at least 100 cells were analyzed. Data shown are representative of three independent experiments. Fig. 1. View largeDownload slide Galectin-3 accumulates at damaged phagosomes containing LM and provides a protective effect for LM within macrophages. (A) J774 cells were infected with wild-type LM 10,403 S (LM WT) or LM DP-L2161 (LM ∆hly) at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained using galectin-3 and LM-specific antibodies. (B and C) gal3+/+ BMMs were infected with LM WT (B) or LM ∆hly (C) at an MOI of 5 for 30 min. Cells were fixed, prepared for cryosectioning, and labeled using a galectin-3-specific antibody conjugated to 10-nm gold particles. Scale bars represent 100 nm. (D) Time-lapse images of rapid recruitment of cytosolic galectin-3 to escaping LM. J774 cells stably expressing galectin-3-EGFP were loaded with LysoTracker Red DND-99 and infected with BacLight Red-stained LM WT at an approximate MOI of 100. Cells were monitored by confocal microscopy and live images were taken at 1-min intervals. Galectin-3 is shown in green, LM is shown in red, and LysoTracker is shown in blue. Arrows point to specific bacteria followed over the time course. Magnified pictures of the boxed regions are shown in the bottom. (E) gal3+/+ (●) or gal3–/– (○) BMMs were infected with LM WT at an MOI of 0.25. At various time points post-infection, cells were lysed, and diluted lysates were plated on BHI agar for enumeration of CFUs. (F) gal3+/+ (■) or gal3–/– (□) BMMs were infected with LM WT or the mutant strains LM ∆hly or LM ∆actA at an MOI of 0.25. At 24 h post-infection, cells were lysed, and diluted lysates were plated for enumeration of CFUs. Data points represent the means ± standard deviations (SD) of the results obtained from triplicate wells. Results are representative of at least three independent experiments. *P < 0.05; **P < 0.01; gal3–/– compared to gal3+/+ by Student’s t-test. (G) gal3+/+ or gal3–/– BMMs were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM and nuclei. The number of LM per cell was quantified using an ImageXpress Micro XLS Widefield High-Content Analysis System. Typically, for each sample, nine randomly-chosen image fields containing a total of at least 100 cells were analyzed. Data shown are representative of three independent experiments. To clarify the topological localization of galectin-3 with regard to LM-containing phagosomes, we performed immuno-transmission electron microscopy (immuno-TEM). As expected, sparse intracellular labeling of galectin-3 was detected throughout the cytoplasm of uninfected bone marrow-derived macrophages (BMMs), with no evident accumulation at any compartment [data not shown and Beatty et al. (2002)]. In LM WT-infected BMMs, galectin-3 was observed to accumulate in the vicinity of the bacterium, where the vacuolar membrane structure had been disrupted (Figure 1B, arrow). Conversely, galectin-3 localized to the cytosolic face of bacterial phagosomes in LM ∆hly-infected BMMs (Figure 1C). To gain a better understating of the kinetics of galectin-3 recruitment to LM, we monitored galectin-3-EGFP distribution in J774 macrophages during LM infection by live cell imaging. The majority of internalized LM were observed in LysoTracker-negative vacuoles. Figure 1D (arrows) shows the infectious process of an individual bacterium that was tracked from cell surface adhesion to uptake by the macrophage (28’), residence in the vacuole (34’), phagosomal escape (47’ to 55’), presence in the cytosol and the initiation of galectin-3 recruitment (64’ to 78’), rapid accumulation of large amounts of galectin-3 (79’), and appearance of the second and third bacterium (83’ to 120’). Initial recruitment of galectin-3 to the cytosolic LM occurred slowly (73’ to 78’); however, within a one-minute span (78’ to 79’), the galectin-3-EGFP signal around the bacterium intensified strikingly. These observations suggest that the recruitment of intracellular galectin-3 to cytosolic LM occurs rapidly. Notably, accumulation of galectin-3-EGFP occurred around the same time window of LM escape, and the red color representing labeled LM was no longer visible at that time. Lack of endogenous galectin-3 restricts intracellular LM growth and survival To investigate whether galectin-3 affects intracellular LM survival, we infected BMMs isolated from gal3+/+ or gal3–/– mice with LM WT and analyzed the kinetics of intracellular LM growth. To prevent extracellular multiplication of bacteria within the culture medium, gentamicin was added at 30 min post-infection. When infected with a low dose of bacteria [multiplication of infection (MOI) = 0.25], the initial levels of bacterial growth were comparable between gal3+/+ and gal3–/– BMMs, and the number of LM colony-forming units (CFUs) peaked at 5 h post-infection in both cell populations. Notably, however, the ensuing bacterial clearance rate was more rapid in gal3–/– BMMs than in gal3+/+ cells, and the bacteria load was significantly lower in gal3–/– BMMs than in gal3+/+ BMMs at 24 h and 50 h post-infection (Figure 1E), indicating that galectin-3 is beneficial for intracellular survival of LM. To assess whether galectin-3 is involved in LM phagosomal escape or host actin polymerization, respectively, we infected gal3+/+ and gal3–/– BMMs with LM ∆hly or LM ∆actA, the latter being unable to induce actin-based motility within the host cell cytosol (Skoble et al. 2000). Due to the inability of LM ∆hly to escape lysosomal destruction, this strain was almost completely eliminated by both BMM cell populations by 24 h post-infection. Likewise, the non-motile LM ∆actA mutant exhibited lower survival rates in both populations than LM WT. Moreover, the numbers of viable LM ∆actA were significantly lower in gal3–/– BMMs than in gal3+/+ BMMs (Figure 1F). Subsequent experiments suggested that galectin-3 deficiency does not affect the phagocytosis of LM by BMMs (Supplementary Figure 1A), LM phagosomal escape (Supplementary Figures 1B–C), or LM infection-induced cell death (Supplementary Figure 1D). Lastly, after infection with a high MOI (MOI = 5), high-content imaging analysis detected decreased replication of LM in gal3–/– BMMs compared to gal3+/+ BMMs, during the early stages of infection (Figure 1G); this phenomenon was observed upon infection with either LM WT or LM ∆actA. These findings are therefore consistent with galectin-3 exerting a protective effect on intracellular LM, as mentioned above. Recruitment of galectin-3 to the vicinity of LM is dependent on host N-glycans To clarify whether the rapid recruitment of galectin-3 to cytosolic LM is mediated by binding of galectin-3 directly to LM or to exposed host glycans, we modified the N-glycan composition of the J774 mouse macrophages using glycosylation enzyme inhibitors. Kifunensine (KIF) is an alkaloid compound that exhibits potent and selective inhibition of Golgi α-mannosidase I, which when placed in the cell culture medium causes a complete shift in the structure of N-linked oligosaccharides from complex chains to Man9(GlcNAc)2 (high mannose) varieties (Elbein et al. 1990), and thereby a loss of galectin-preferred complex type N-glycans (Figure 2A). After confirming that the structures on the surface of J774 cells recognizable by recombinant human galectin-3 (Figure 2B) and phytohemagglutinin-L (PHA-L), a plant lectin that preferably recognizes β1-6GlcNAc branched N-glycans, (data not shown) were markedly decreased in cells treated with KIF (20 μM) for 2 days, we infected KIF-treated J774 cells with LM WT. Notably, we found that colocalization of galectin-3 with LM WT was substantially decreased in these cells, compared to untreated cells, at 1 h post-infection (Figure 2D and E). Fig. 2. View largeDownload slide Host N-glycans are required for the accumulation of galectin-3 around LM. (A) Schematic representation of the mammalian N-glycan synthesis pathway, the enzymes required for each step, and the inhibitors that block certain steps. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). (B) Binding of recombinant human galectin-3-Atto565 (10 μg/mL) to J774 cells treated for 48 h with 20 μM kifunensine (KIF), and the mean fluorescence intensity (MFI) values of samples in (A). (C) Flow cytometry results for the binding of recombinant human galectin-3 to WT and Mgat1-KO RAW264.7 cells. (D) J774 cells treated with 20 μM KIF for 48 h were infected with LM WT at an MOI of 5. At 1 h post-infection, cells were fixed, stained for LM and galectin-3, and analyzed by confocal microscopy. (E) Quantitative results of the percentage of LM that colocalized with galectin-3 in WT and KIF-treated J774 cells. Data points represent the means ± SD of the results obtained from triplicate fields in a representative experiment (n > 100 for each field). **P < 0.01 by Student’s t-test. (F and G) WT and KIF-treated RAW264.7 cells (F) or Mgat1-KO RAW264.7 cells (G) were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM, galectin-3 and nuclei. The numbers of cells, LM and galectin-3 puncta in each sample were counted using the ImageXpress Micro XLS Widefield High-Content Analysis System, and the percentages of galectin-3-positive LM were quantified. The data shown comprise representative results from three independent experiments. Fig. 2. View largeDownload slide Host N-glycans are required for the accumulation of galectin-3 around LM. (A) Schematic representation of the mammalian N-glycan synthesis pathway, the enzymes required for each step, and the inhibitors that block certain steps. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). (B) Binding of recombinant human galectin-3-Atto565 (10 μg/mL) to J774 cells treated for 48 h with 20 μM kifunensine (KIF), and the mean fluorescence intensity (MFI) values of samples in (A). (C) Flow cytometry results for the binding of recombinant human galectin-3 to WT and Mgat1-KO RAW264.7 cells. (D) J774 cells treated with 20 μM KIF for 48 h were infected with LM WT at an MOI of 5. At 1 h post-infection, cells were fixed, stained for LM and galectin-3, and analyzed by confocal microscopy. (E) Quantitative results of the percentage of LM that colocalized with galectin-3 in WT and KIF-treated J774 cells. Data points represent the means ± SD of the results obtained from triplicate fields in a representative experiment (n > 100 for each field). **P < 0.01 by Student’s t-test. (F and G) WT and KIF-treated RAW264.7 cells (F) or Mgat1-KO RAW264.7 cells (G) were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM, galectin-3 and nuclei. The numbers of cells, LM and galectin-3 puncta in each sample were counted using the ImageXpress Micro XLS Widefield High-Content Analysis System, and the percentages of galectin-3-positive LM were quantified. The data shown comprise representative results from three independent experiments. We also monitored the kinetics of galectin-3 recruitment to LM under the influence of KIF via high-content imaging analysis. Recruitment of galectin-3 to LM peaked at 30 min–1 h post-infection, and KIF treatment resulted in a dramatic reduction in galectin-3 recruitment to both LM WT and LM ∆actA (Figure 2F). As an alternative to KIF treatment, we generated a RAW264.7 cell line with a deletion of the gene encoding mannoside acetylglucosaminyltransferase 1 (Mgat1), which is necessary for the biosynthesis of hybrid and complex N-glycans (Figure 2A) (Chen and Stanley 2003), using a CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 expression system. Deletion of Mgat1 gene resulted in loss of complex N-glycans, as determined by an absence of structures recognizable by PHA-L at the cell surface (data not shown). Mgat1 deficiency also resulted in a substantial reduction in the glycan structures recognizable by recombinant human galectin-3 (Figure 2C). Consistent with the results of the KIF experiment, recruitment of galectin-3 to LM was significantly decreased in Mgat1-KO cells compared to WT cells (Figure 2G). Together, these data indicate that host hybrid and complex N-glycans are required for the recruitment and accumulation of galectin-3 at the vicinity of LM. Interestingly, we also noted that more galectin-3 accumulated around LM ∆actA than around LM WT, which could be due to the fact that LM ∆actA is non-motile and therefore may be less capable of shedding the phagosomal membrane remnant coat that contains N-glycans. Lack of galectin-3 results in enhanced autophagy activation LM has been shown to induce activation of host cell autophagy and to interact with the host autophagic machinery, including the autophagy marker LC3 (Birmingham et al. 2007; Meyer-Morse et al. 2010; Py et al. 2007). To investigate whether galectin-3 is involved in antibacterial autophagy, we examined the association of LM and LC3 in gal3+/+ and gal3–/– cells by confocal microscopy. At 1 h post-infection, we observed more prominent colocalization of LC3 with both LM WT and LM ∆actA in gal3–/– BMMs than in gal3+/+ cells (Figure 3A). Indeed, quantitative analyses showed a significantly higher percentage of LC3-positive LM WT in gal3–/– BMMs compared to gal3+/+ BMMs (Figure 3B). Moreover, a time course study of WT and galectin-3-knock-out (G3-KO) RAW264.7 cells infected with LM WT or LM ∆actA clearly showed that recruitment of LC3 to LM was more efficient in G3-KO cells than in WT cells (Figure 3C). We also noticed a higher degree of LC3 recruitment to LM ∆actA than to LM WT, which is consistent with a previous report that LM ∆actA is more susceptible to autophagic recognition (Yoshikawa et al. 2009). In addition, we assessed LM-induced autophagy activation in gal3+/+ and gal3–/– BMMs by measuring the conversion of LC3-I to LC3-II by immunoblot analysis (Mizushima et al. 2010). Gal3–/– BMMs infected with WT LM exhibited higher levels of LC3-II at 6 h and 24 h post-infection than did infected gal3+/+ BMMs (Figure 3D). Similarly, LM ∆actA-induced LC3-II expression levels (Figure Supplementary Figure 2A) and LC3 puncta counts per cell (Supplementary Figure 2B) were higher in G3-KO RAW264.7 cells than in WT cells. These data indicate that autophagy activation and recruitment of LC3 to LM were enhanced in cells lacking galectin-3. In other words, galectin-3 dampens the formation of LC3-positive autophagosomes surrounding intracellular LM. Fig. 3. View largeDownload slide Galectin-3 protects LM by suppressing antibacterial autophagy response. (A) gal3+/+ (■) or gal3–/– (□) BMMs were infected with wild-type LM (LM WT) or LM ∆actA at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained with LC3- and galectin-3-specific antibodies. DAPI stain was used to visualize cell nuclei and bacteria. (B) Quantification of the percentage of LM WT colocalized with LC3 at 1 h post-infection in gal3+/+ (■) or gal3–/– (□) BMMs. Values represent the means ± SD of the results obtained from triplicate samples (n > 100 LM per sample). (C) Quantification of LC3-positive LM WT or LM ∆actA in WT or G3-KO RAW264.7 cells at various time points after infection, as determined by high-content imaging analysis. (D) gal3+/+ or gal3–/– BMMs were infected with wild-type LM WT at an MOI of 5. At indicated time points, cells were lysed and analyzed by immunoblot to assess tubulin and LC3 expression. Data are representative of at least three independent experiments. (E) gal3+/+ and gal3–/– BMMs were pretreated with 3-methyladenine (5 mM) for 3 h prior to infection with LM ∆actA at an MOI of 5. At 1 h and 8 h post-infection, cells were lysed and the numbers of viable bacteria were determined by CFU assay. Fold replication was calculated by normalizing the CFU number at 8 h to that at 1 h. (F) Fold replication at 8 h of LM ∆actA in WT or G3-KO RAW264.7 cells that were transfected with control or Atg5-specific siRNA (siAtg5) molecules. Immunoblot showing decreased Atg5 protein expression in siAtg5-19 transfected cells, but not in the negative control (N) or mock control (C) groups. Data are representative of at least three independent experiments. Means ± SD of triplicate samples. *P < 0.05 by Student’s t-test. Fig. 3. View largeDownload slide Galectin-3 protects LM by suppressing antibacterial autophagy response. (A) gal3+/+ (■) or gal3–/– (□) BMMs were infected with wild-type LM (LM WT) or LM ∆actA at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained with LC3- and galectin-3-specific antibodies. DAPI stain was used to visualize cell nuclei and bacteria. (B) Quantification of the percentage of LM WT colocalized with LC3 at 1 h post-infection in gal3+/+ (■) or gal3–/– (□) BMMs. Values represent the means ± SD of the results obtained from triplicate samples (n > 100 LM per sample). (C) Quantification of LC3-positive LM WT or LM ∆actA in WT or G3-KO RAW264.7 cells at various time points after infection, as determined by high-content imaging analysis. (D) gal3+/+ or gal3–/– BMMs were infected with wild-type LM WT at an MOI of 5. At indicated time points, cells were lysed and analyzed by immunoblot to assess tubulin and LC3 expression. Data are representative of at least three independent experiments. (E) gal3+/+ and gal3–/– BMMs were pretreated with 3-methyladenine (5 mM) for 3 h prior to infection with LM ∆actA at an MOI of 5. At 1 h and 8 h post-infection, cells were lysed and the numbers of viable bacteria were determined by CFU assay. Fold replication was calculated by normalizing the CFU number at 8 h to that at 1 h. (F) Fold replication at 8 h of LM ∆actA in WT or G3-KO RAW264.7 cells that were transfected with control or Atg5-specific siRNA (siAtg5) molecules. Immunoblot showing decreased Atg5 protein expression in siAtg5-19 transfected cells, but not in the negative control (N) or mock control (C) groups. Data are representative of at least three independent experiments. Means ± SD of triplicate samples. *P < 0.05 by Student’s t-test. An enhanced autophagic response is responsible for poor LM growth in galectin-3-deficient macrophages Because LM ∆actA is more susceptible to autophagic recognition and triggers a higher degree of LC3 recruitment to the vicinity of bacteria than LM WT does (Yoshikawa et al. 2009), we used LM ∆actA for all the following infection experiments. To determine whether the reduced LM growth observed in galectin-3-deficient macrophages was due to an enhanced antibacterial autophagic response, we assessed LM growth in BMMs treated with the phosphoinositide kinase 3 (PI-3) inhibitor 3-methyladenine (3-MA), which is known to inhibit autophagy (Blommaart et al. 1997; Wu et al. 2010). The inhibitory effect was confirmed by decreased induction of LC3-II levels after LM infection of BMMs (data not shown). Suppression of autophagy by 3-MA resulted in a substantial increase in LM growth in gal3–/– BMMs, and only a mild increase in LM growth in gal3+/+ BMMs. Importantly, the observed difference in LM ∆actA replication between gal3+/+ and gal3–/– BMMs was diminished after 3-MA treatment (Figure 3E). Similar results were obtained using RAW264.7 cells: when Atg5 expression was knocked-down by siRNA, there was no difference in LM ∆actA growth within WT or G3-KO RAW 264.7 cells (Figure 3F). Collectively, these findings indicate that an enhanced autophagic response restricts LM growth in gal3-deficient macrophages. Galectin-3 suppresses the LM-induced autophagic response in the absence of galectin-8 Galectin-8 was previously shown to promote antibacterial autophagy through binding to host glycans on damaged pathogen-containing vesicles (Thurston et al. 2012). Since complex N-glycans are the major ligands for galectin-3 and galectin-8 (Patnaik et al. 2006), and there are overlaps in the overall sugar-binding profiles of these two galectins (Hirabayashi et al. 2002), we investigated whether galectin-3 suppresses antibacterial autophagy simply by competing for N-glycan ligands with galectin-8. To this end, we generated galectin-8-KO (G8-KO) and galectin-3/galectin-8-double KO (G3/8-DKO) RAW264.7 cell strains using the CRISPR-Cas9 system (Supplementary Figure 3). We compared the colocalization ratio of LC3 with LM ∆actA by immunofluorescent staining, and found that at 1 h post-infection, the percentage of LC3-positive LM ∆actA was significantly higher in G3/8-DKO cells than in G8-KO cells (Figure 4A and 4B). Correspondingly, at 6 h post-infection, we detected significantly reduced LM ∆actA replication in G3/8-DKO cells than in G8-KO cells (Figure 4D). Together, these data clearly show that galectin-3 suppresses antibacterial autophagy even when galectin-8 is absent. Therefore, galectin-3 does not simply compete for glycan ligands with galectin-8, but plays an active role in down-regulating antibacterial autophagy. Fig. 4. View largeDownload slide Galectin-3 suppresses antibacterial autophagy via a host N-glycan-dependent mechanism. (A) Representative confocal micrographs of G8-KO (clone #21) and G3/8-DKO (clone #46) RAW264.7 cells infected with LM ∆actA for 1 h and immuno-stained to detect colocalization of bacteria and LC3. (B) Quantification of the percentages of LC3-positive LM ∆actA in G8-KO and G3/8-DKO RAW264.7 cells at 1 h post-infection. (C) Percentage of LC3-positive LM ∆actA at 1 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells. (D) Fold replication of LM ∆actA at 8 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells, as determined by high-content imaging analysis. Means ± SD of the results obtained from three independent images. *P < 0.05; **P < 0.01; ***P < 0.001 by Student’s t-test. Fig. 4. View largeDownload slide Galectin-3 suppresses antibacterial autophagy via a host N-glycan-dependent mechanism. (A) Representative confocal micrographs of G8-KO (clone #21) and G3/8-DKO (clone #46) RAW264.7 cells infected with LM ∆actA for 1 h and immuno-stained to detect colocalization of bacteria and LC3. (B) Quantification of the percentages of LC3-positive LM ∆actA in G8-KO and G3/8-DKO RAW264.7 cells at 1 h post-infection. (C) Percentage of LC3-positive LM ∆actA at 1 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells. (D) Fold replication of LM ∆actA at 8 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells, as determined by high-content imaging analysis. Means ± SD of the results obtained from three independent images. *P < 0.05; **P < 0.01; ***P < 0.001 by Student’s t-test. Host N-glycans are critical for the anti-autophagic function of galectin-3 We further investigated whether the anti-autophagic function of galectin-3 is dependent on interactions between galectin-3 and host N-glycans. KIF treatment led to increased LC3 recruitment to LM ∆actA in G8-KO RAW264.7 cells but not G3/8-DKO cells, and the percentages of LC3-positive LM ∆actA became comparable between G8-KO and G3/8-DKO cells (Figure 4C) suggesting that abrogation of galectin-3-N-glycan binding upregulates the antibacterial autophagic response. Moreover, depletion of complex N-glycans by KIF treatment resulted in decreased LM ∆actA replication in G8-KO cells but not in G3/8-DKO cells (Figure 4D). Similarly, the difference in LM ∆actA growth between G8-KO and G3/8-DKO cells disappeared after KIF treatment. Notably, treatment of macrophages with KIF did not affect cell viability, as determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cytotoxicity assays (data not shown), nor did it affect LM phagosomal escape, as the percentages of F-actin-positive LM WT were comparable between control and KIF-treated J774 cells (data not shown). Polymerization of host actin on the LM surface occurs only when the bacterium has entered the cytoplasm (Bohne et al. 1994). Collectively, these data indicate that host N-glycans are essential for the suppressive effect of galectin-3 on antibacterial autophagy. Sialidase treatment increases galectin-3 recruitment to LM and promotes LM growth by down-regulating antibacterial autophagy As noted above, while galectin-3 and galectin-8 both recognize host N-glycans on damaged pathogen-containing phagosomes, the two exert opposite functions in antibacterial autophagy. Furthermore, even though the overall sugar-binding preference of galectin-8 overlaps with that of galectin-3, there are certain distinctions in the fine specificities of these two molecules (Grigorian et al. 2009; Hirabayashi et al. 2002). For example, the presence of α2-3- and α2-6-linked sialic acid on the terminal galactose of poly-N-acetyllactosamine (poly-LacNAc) chains blocks galectin-3 binding (Zhuo and Bellis 2011). On the other hand, terminal α2,3-sialylation results in much higher affinity for the N-terminal CRD of galectin-8 (Gal-8N) (Hirabayashi et al. 2002; Ideo et al. 2011), which is essential for detecting lysosomal damage (Thurston et al. 2012). Thus, modulation of terminal sialylation on N-glycans may affect the relative binding and accumulation of cytoplasmic galectin-3 and galectin-8 to bacteria-containing damaged phagosomes during infection, and consequently impact the balance of antibacterial autophagic responses. First, we confirmed that treatment of RAW264.7 macrophages with a cocktail of sialidases to remove α2–3, -6, -8, and -9-linked sialic acid residues resulted in a lower amount of structures recognizable by maackia amurensis lectin II (MAL-II), a plant lectin that binds to carbohydrates that contain sialic acid (Figure 5A). On the other hand, the treatment resulted in a higher amount of structures recognizable by recombinant galectin-3 (Figure 5B). Immediately after sialidase treatment, the cells were co-incubated with LM ∆actA for 30 min to allow the bacteria to be phagocytosed. The cells were then washed to remove unbound LM, and gentamicin was added to kill any remaining extracellular bacteria. Therefore, only the glycans present on the cell surface within 30 min after the removal of sialidase were internalized along with the bacteria and become exposed to the cytosol due to phagosome lysis induced by viable LM ∆actA. Sialidase treatment resulted in decreased intracellular galectin-8 recruitment to the vicinity of LM ∆actA in infected WT RAW264.7 cells (Figure 5C) at 1 h post-infection. In G8-KO RAW264.7 cells, after sialidase treatment, the percentage of LM ∆actA that attracted galectin-3 was doubled from 1 h to 4 h (Figure 5D), and the number of LM ∆actA per cell was also doubled at 4 h post-infection (Figure 5E). This indicates that removal of terminal sialic acid residues resulted in increased galectin-3 recruitment to host glycans on damaged phagosomes surrounding LM, leading to increased LM replication. Lastly, we showed that sialidase treatment enhanced galectin-3 recruitment (Figure 5F) and inhibited LC3 recruitment to LM ∆actA within BMMs (Figure 5G). In Gal3–/– BMMs, however, we still observed decreased LC3 recruitment to LM ∆actA after sialidase treatment (Figure 5G), which is in agreement with the notion that the absence of N-glycan sialylation may also decrease LC3 recruitment through galectin-8. Collectively, these data indicate that removal of terminal sialic acids from cell surface N-glycans can result in increased and decreased recruitment of galectin-3 and galectin-8 to damaged LM-containing phagosomes, respectively, thereby down-regulating the antibacterial autophagic response and favoring intracellular LM growth. Fig. 5. View largeDownload slide Sialidase treatment increases galectin-3 recruitment to LM and down-regulates antibacterial autophagy. (A and B) Flow cytometry results for the binding of MAL-II (A) or recombinant human galectin-3 (B) to control of sialidase-treated RAW264.7 cells. The number below the group label denotes geometric mean of fluorescence intensity. (C) Percentage of galectin-8-positive LM ∆actA at 1 h post-infection in control or sialidase-treated RAW264.7 cells. (D and E) Kinetics of the percentage of galectin-3-positive LM ∆actA (D) and the number of LM ∆actA per cell (E) in two different clones of control or sialidase-treated G8-KO RAW264.7 cells. Results were obtained by high-content imaging analysis. Data points represent the values derived from a total of nine image fields and are representative of two independent experiments. (F) Percentage of galectin-3-positive LM ∆actA in mouse gal3+/+ BMMs at 1 h post-infection. (G) Percentage of LC3-positive LM ∆actA in control or sialidase-treated gal3+/+ and gal3–/– BMMs at 1 h post-infection. Means ± SD of the results obtained from three image fields. *P < 0.05; **P < 0.01 by Student’s t-test. Fig. 5. View largeDownload slide Sialidase treatment increases galectin-3 recruitment to LM and down-regulates antibacterial autophagy. (A and B) Flow cytometry results for the binding of MAL-II (A) or recombinant human galectin-3 (B) to control of sialidase-treated RAW264.7 cells. The number below the group label denotes geometric mean of fluorescence intensity. (C) Percentage of galectin-8-positive LM ∆actA at 1 h post-infection in control or sialidase-treated RAW264.7 cells. (D and E) Kinetics of the percentage of galectin-3-positive LM ∆actA (D) and the number of LM ∆actA per cell (E) in two different clones of control or sialidase-treated G8-KO RAW264.7 cells. Results were obtained by high-content imaging analysis. Data points represent the values derived from a total of nine image fields and are representative of two independent experiments. (F) Percentage of galectin-3-positive LM ∆actA in mouse gal3+/+ BMMs at 1 h post-infection. (G) Percentage of LC3-positive LM ∆actA in control or sialidase-treated gal3+/+ and gal3–/– BMMs at 1 h post-infection. Means ± SD of the results obtained from three image fields. *P < 0.05; **P < 0.01 by Student’s t-test. Discussion Phagosomal damage induced by intracellular pathogens results in exposure of luminal glycans to the cytosol, followed by recruitment and accumulation of galectins, such as galectin-3, -8 and -9. In this study, we provide evidence that recruitment of cytosolic galectin-3 to host complex type N-glycans on damaged phagosomes results in suppression of the antibacterial autophagy response, thereby protecting intracellular LM. Importantly and intriguingly, we demonstrated that removal of sialic acids from cell surface glycans led to increased galectin-3 accumulation and decreased galectin-8 accumulation at damaged LM-containing phagosomes, indicating that cytosolic galectins are capable of sensing alterations in glycan structures that occur on the cell surface following phagocytosis and phagosomal membrane damage. Moreover, desialylation of cell surface glycans preceding LM infection resulted in down-regulation of the antibacterial autophagy response, implying that alterations of glycan structure that affect the relative binding affinities of different galectin members can impact the balance of cellular responses they regulate (Figure 6). Fig. 6. View largeDownload slide Alterations in glycan structures may affect the relative affinities of galectin-3 and galectin-8 to glycans on damaged phagosomes and modulate the balance of the autophagic response. During phagocytosis of bacteria, cell surface host glycans are internalized along with the bacteria and are confined within the luminal side of the phagosome. Upon bacteria-induced phagosome damage, host glycans become exposed to the cytosol and are accessible to galectins. Changes in cell surface glycan structures alter the relative binding affinity of galectin-3 and galectin-8 to the glycans following internalization and phagosome damage. As an example, when terminal sialic acids are present on the glycans (without sialidase), galectin-8 has higher affinity towards the glycans than galectin-3 does, leading to a stronger autophagic response. When sialic acids are removed from the glycans (with sialidase), their binding affinity increases towards galectin-3 but decrease towards galectin-8, resulting in a weaker autophagic response. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). Fig. 6. View largeDownload slide Alterations in glycan structures may affect the relative affinities of galectin-3 and galectin-8 to glycans on damaged phagosomes and modulate the balance of the autophagic response. During phagocytosis of bacteria, cell surface host glycans are internalized along with the bacteria and are confined within the luminal side of the phagosome. Upon bacteria-induced phagosome damage, host glycans become exposed to the cytosol and are accessible to galectins. Changes in cell surface glycan structures alter the relative binding affinity of galectin-3 and galectin-8 to the glycans following internalization and phagosome damage. As an example, when terminal sialic acids are present on the glycans (without sialidase), galectin-8 has higher affinity towards the glycans than galectin-3 does, leading to a stronger autophagic response. When sialic acids are removed from the glycans (with sialidase), their binding affinity increases towards galectin-3 but decrease towards galectin-8, resulting in a weaker autophagic response. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). Interestingly, the role of galectin-3 in suppressing antibacterial autophagy reported here contrasts with that described for galectin-8. Although most galectins bind to N-acetyllactosamine (LacNAc)-containing structures, each galectin exhibits unique specificities to particular glycan structures (Rabinovich and Toscano 2009). Frontal affinity chromatography analyses revealed that the overall sugar-binding profile of galectin-8 resembles that of galectin-3 (Hirabayashi et al. 2002). Also, both molecules show affinity toward repeated structures of LacNAc, blood group A and B antigens (Stowell et al. 2010), and the antigenic determinant of Providencia alcalifaciens O5 (PA O5) (Stowell et al. 2014). Moreover, both galectin-3 and -8 exhibit particular preferences for certain glycolipid-type glycans (Hirabayashi et al. 2002). However, some distinct features between galectin-3 and galectin-8 exist. For instance, although both galectin-3 and galectin-8 bind to blood group B antigen, only binding of galectin-8 induces direct killing of blood group B-positive bacteria (Stowell et al. 2010). Furthermore, while galectin-8 binds with high affinity to glycosphingolipids, including GM3 and GD1a, galectin-3 exhibits only limited affinity to these molecules (Ideo et al. 2003; Rabinovich and Toscano 2009). The partial overlap in carbohydrate binding specificities between galectin-3 and galectin-8 led us to consider whether galectin-3 inhibits the autophagy response simply by competing for glycan ligands of galectin-8. We clarified this point by demonstrating that galectin-3 actively suppresses antibacterial autophagy, even in the absence of galectin-8, by using G8-KO and G3/8-DKO macrophages. In addition to glycans, galectins can bind to non-glycosylated proteins via-protein–protein interactions. This enables galectins to serve as “signal hubs” that receive information encoded by sugars and relay these signals by interacting with downstream proteins to induce appropriate cellular responses. Galectin-8 promotes autophagy by interacting specifically with NDP52, an autophagy receptor/adaptor protein that binds to LC3. NDP52 also detects ubiquitinated targets (Thurston et al. 2009), and Thurston et al. demonstrated that DNP52 is recruited to Salmonella-containing vesicles in two waves: an early surge mediated by galectin-8 and a late phase dependent on ubiquitin (Thurston et al. 2012). In our study, we also noted that accumulation of galectin-3 at damaged LM-containing phagosomes peaked at 1 h post-infection, and dropped drastically between 2 and 4 h post-infection (Figure 2F and 2G). In contrast, recruitment of ubiquitin and the adaptor protein p62 to damaged phagosomes gradually increased and persisted until the end of our experiment (8 h post-infection; Supplementary Figures 4A,B). The kinetics of galectin-3 and ubiquitin recruitment to damaged LM-containing phagosomes resembled that of galectin-8 and ubiquitin, respectively, as reported by Thurston et al. (2012). During LM infection, p62 and NDP52 are recruited independently to LM (Mostowy et al. 2011). We found that galectin-3 does not affect the recruitment of ubiquitin or p62 to LM (Supplementary Figures 4A and 4B). Moreover, treatment of cells with KIF, which depletes complex N-glycans and abolishes galectin-3 recruitment to LM, had no impact on the recruitment of p62 (Supplementary Figures 4C and 4E) or ubiquitin (Supplementary Figures 4D and 4F) to LM. These results suggest that recognition of LM by ubiquitin and p62 occurs independently of host N-glycans or galectin-3. Thus, galectin-3 does not suppress autophagy via the ubiquitin-p62 pathway. However, whether galectin-3 influences NDP52 recruitment awaits further investigation. Distinct from galectin-8, galectin-3 is a chimeric-type galectin that contains a single CRD fused to an N-terminal non-CRD region composed of proline- and glycine-rich repeating segments. Galectin-3 has been shown to bind to intracellular proteins through protein–protein interactions (Yang et al. 1996). While galectin-3 does not physically interact with either p62 or NDP52 (Thurston et al. 2012), it is possible that after recognition of host N-glycans on damaged phagosomes, the N-terminal domain of galectin-3 binds to other molecules through protein–protein interactions and thereby contributes to the anti-autophagic effect. As carbohydrate-binding proteins, many studies of galectin functions have focused on their extracellular interactions with cell surface glycoproteins and the ensuing signaling cascades induced by galectin–glycan lattice formation (Garner and Baum 2008). However, the predominant localization of galectin in the cytosol suggests that it must play crucial roles intracellularly, and an increasing number of studies have supported this hypothesis. Other research groups showed that galectins can survey the cytosol for the abnormal appearance of complex carbohydrates, which can originate from phagosomes lysed by bacteria (Feeley et al. 2017; Paz et al. 2010; Thurston et al. 2012), endosomes damaged by adenovirus (Maier et al. 2012; Montespan et al. 2017) or calcium phosphate precipitates (Chen et al. 2014), or lysosomes ruptured due to protein aggregates (Jiang et al. 2017), amyloid beta peptide (Oku et al. 2017), or other lysosomotropic compounds (Maejima et al. 2013; Thurston et al. 2012). Thus, galectins are uniquely suited to serve as intracellular danger sensors for cytosolic exposure of glycans induced by infection or cellular stress. Moreover, each respective galectin family member might transduce distinct signals in response to cytosolic glycan exposure. As we demonstrated in the present study, galectin-3 and galectin-8 exert opposing effects on the regulation of antibacterial autophagy during LM infection. In addition, while galectin-3, -8 and -9 are recruited to damaged phagosomes, endosomes and lysosomes, galectin-1 accumulates only at damaged lysosomes, suggesting compartment-specific differences in distribution of galectin ligands (Thurston et al. 2012). This phenomenon also suggests that rupture of different vesicular compartments might lead to different outcomes, depending on the combination of galectins that are recruited. Typically, changes in cell surface glycosylation by extracellular factors such as pathogen-derived sialidase/neuraminidase affects binding between the glycosylated ligand and cell surface lectins such as siglecs, leading to activation or inhibition of signaling events (Crocker et al. 2007). In this study, we proposed a novel concept that alterations to cell surface glycans can directly influence their binding of cytosolic galectins following phagocytosis and phagosome damage. Remarkably, changes in glycan structure alter the relative binding affinity of galectin-3 and galectin-8, and the differential recruitment of galectin-3 and galectin-8 to damaged phagosomes determine the strength of antibacterial autophagy. Our findings underscore how glycans impact cellular responses through intracellular galectins, and how extracellular glycosidases shape the outcome of these responses. Finally, our study highlights the versatility of galectin members as cytosolic sentinels that regulate cell-autonomous immunity. Materials and methods Mice and reagents Gal3–/– mice were generated as described previously (Hsu et al. 2000) and backcrossed to C57BL/6 mice for nine generations. Gal3+/+ and gal3–/– littermates were obtained from gal3+/– breeders, maintained in standard specific-pathogen-free environments, and used at 6–12 weeks of age. All the experiments were approved by the Institutional Animal Care and Use Committee of the University of California, Davis (Sacramento, CA) or Academia Sinica (Taipei, Taiwan). 3-methyladenine (3-MA) was purchased from Merck, while kifunensine and the sialidases (neuraminidases) from Arthrobacter ureafaciens (linkage specificity: α2–3, -6, -8, -9) and Clostridium perfringens (α2–3, -6, -8) were purchased from Sigma. Cell lines and bacterial strains Two mouse macrophage cell lines were used in this study: RAW264.7 (ATCC No. TIB-71) and J774A.1 (ATCC No. TIB-67). RAW264.7 cells were cultured in R10 medium [RPMI 1640 (GibcoTM) supplemented with 20 mM HEPES, non-essential amino acids (NEAA, GibcoTM), and 10% fetal bovine serum (FBS)]. J774A.1 cells were cultured in DMEM medium supplemented with 10% FBS. The LM strains used in this study included 10,403 S (WT strain), DP-L2161, which contains an in-frame deletion of the hly gene (∆hly), and DP-L3078, a strain containing an in-frame deletion of actA (∆actA, ∆7–633). Both mutants were derived from 10,403 S and were obtained from Dr. Daniel Portnoy (Jones and Portnoy 1994; Skoble et al. 2000). Bacteria were cultivated in brain heart infusion (BHI) broth (Becton Dickinson and Company). For storage, LM strains were grown in BHI broth to mid-log and stored as frozen aliquots at –80°C. Generation of knockout cell lines by CRISPR-Cas9 All RNAi reagents, including the pAll-Cas9.pPuro an all-in-one CRISPR/Cas expression system, were obtained from the National RNAi Core Facility at the Institute of Molecular Biology/Genomics Research Center, Academia Sinica, Taiwan. The National RNAi Core Facility is supported by the National Core Facility Program for Biotechnology Grants from the Taiwan National Science Council (NSC; NSC 100-2319-B-001–002). Briefly, cloning of annealed guide oligos into the sgRNA expressing vector (pAll-Cas9.pPuro) was designed as follows: GCACACGCCGGCCCCGAAAC (for Mgat1 KO), TAGCTTAACGATGCCTTAGC (for Lgals3 KO), and ACTTTAACCCTCGGTTCAAA (for Lgals8 KO). To generate the CRISPR/Cas-mediated knockout cell lines, 2 μg of pAll-Cas9.Ppuro-Mgat1, pAll-Cas9.Ppuro-Lgals3, or pAll-Cas9.Ppuro-Lgals8 were transfected into 2 × 106 RAW 264.7 cells using Lipofectamine™ 3000 reagent (Invitrogen), after which cells were subjected to puromycin selection (1.5 μg/ml). The following day, individual cell clones were sorted using a BD FACSAria III cell sorter (Becton Dickinson). Cell clones established using the CRISPR-Cas system were validated by T7 endonuclease I assay and immunoblot analysis for target protein expression (data not shown). Preparation of bone marrow-derived macrophages Mouse BMMs were prepared as previously described (Sano et al. 2003). Briefly, bone marrow harvested from the femurs and tibias of mice were cultured in R10 medium supplemented with 10 ng/mL mouse GM-CSF (Peprotech). After one day of culturing, non-adherent cells were transferred to new petri dishes and cultured for another 6–9 days. Adherent cells were harvested on days 7−11 and plated for subsequent experiments. All cells were cultured under standard conditions: 37°C with 5% CO2. Infection of BMMs with LM and bacterial load assays For infection assays, overnight cultures of LM were diluted 1:5 in fresh BHI broth and grown at 37°C for an additional 1.5 h with shaking to an OD600 of 0.5. Mid-log phase LM were washed with PBS, resuspended in antibiotic-free medium, and added to the BMMs. Plates were then centrifuged at 500 × g for 5 min to promote contact between bacteria and BMMs. The cells were incubated at 37°C for 30 min, washed twice with PBS, and provided fresh R10 medium containing 10 μg/mL gentamicin to kill extracellular bacteria. For detection of viable CFUs, cells were washed with PBS at 30 min, 2 h, 5 h, 24 h, or 48 h post-infection, and lysed by incubation in 100 μL of sterile PBS containing 0.1% TX-100 for 5 min. Lysates were serially diluted in sterile PBS and plated on BHI agar, and colonies were counted after overnight incubation at 37°C. For initial bacterial load assays, in order to monitor the kinetics of bacterial growth within macrophages for a longer period of time (>24 h), cells were infected with a low MOI of 0.25. Sialidase treatments RAW264.7 or BMM cells were plated in 96-well plates at a density of 3 × 104 cells/well in 100 μL R10 medium. The sialidases (neuraminidase) from A. ureafaciens and from C. perfringens were diluted in serum-free RPMI culture medium to a final concentration of 0.3 U/mL. Cells were incubated in serum-free sialidase-containing medium for 1 h at 37°C. Excess sialidase was removed by washing for three times with serum-free RPMI. Immunofluorescence assays BMMs, J774A.1 or RAW264.7 cells were seeded on 12-mm glass coverslips in 24-well culture plates and infected with LM at an MOI of 5. At indicated time points, cells were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.05% saponin, and then blocked with 2.5% casein in HEPES buffered saline (HBS) containing 1% BSA. Cells were stained with primary antibodies overnight at 4°C. After three washes with HBS containing 1% BSA, cells were stained with the appropriate secondary antibodies for 1 h at room temperature (RT), washed three times with HBS containing 1% BSA, and mounted with DAPI Fluoromount-G (SouthernBiotech). Stained cells were visualized using a Carl Zeiss LSM 780 Laser Scanning Confocal Microscope (Oberkochen). Primary antibodies used in this study include: goat anti-human galectin-3 (home-made), mouse-anti-human galectin-8 (MAB1305, R&D Systems), mouse anti-SQSTM1/p62 (Abcam), mouse anti-ubiquitin clone FK2 (Millipore), mouse-anti-LC3 mAb (M152-3; MBL International), and rabbit anti-Listeria antisera (Denka Seiken). High-content imaging analysis Cells were plated in CellCarrier-96 plates (PerkinElmer) at a density of 3 × 104 cells/well in 100 μL culture medium. After the indicated treatment and infection, cells were processed for immunofluorescence staining as described in the Immunofluorescence assays section. Images were acquired and analyzed using the ImageXpress Micro XLS Widefield High-Content Analysis System (Molecular Devices). Live cell imaging with time-lapse microscopy Galectin-3-EGFP-expressing J774 cells were grown on glass coverslips, loaded with 1 μM LysoTracker Red DND-99 (Molecular Probes), and incubated at 37°C for 10 min. Cells were washed twice with PBS, and then incubated with fresh DMEM medium containing 10% FBS. LM from mid-log phase cultures was labeled with BacLight Red bacterial stain (Molecular Probes), according to the manufacturer’s instructions, and resuspended in PBS. Immediately before placing the cells under the microscope, labeled LM were added to the cell culture at an approximate MOI of 100. This high MOI was used to increase the chance of cell-LM contact because we could not centrifuge the apparatus containing the glass coverslip under this experimental setting. Live cell imaging was performed using an UltraVIEW Live Cell Imaging (LCI) Confocal Scanner (PerkinElmer) equipped with an environmental control chamber (37°C, 5% CO2) at 100× magnification. Images were taken at 1-min intervals and analyzed with Volocity software (Improvision, PerkinElmer). Immuno-transmission electron microscopy Gal3+/+ and gal3–/– BMMs were grown in 6-cm petri dishes and infected with LM WT or LM ∆hly at an MOI of 5 for either 30 or 60 min. Cells were then washed twice with PBS, fixed with 4% paraformaldehyde in 0.1 M Sorenson’s phosphate buffer, and collected in Eppendorf tubes for ultrathin cryosectioning. For immunolabeling of galectin-3, samples on gold grids were blocked with 1% fish gelatin in dH2O for 30 min at RT, and incubated overnight at 4°C with 0.2, 0.5 or 1 μg/mL goat anti-human galectin-3 in PBS. After seven washes with PBS, samples were incubated with 10-nm gold-conjugated anti-goat IgG (G-5527; Sigma) diluted 1:50 in PBS, incubated for 1 h at RT, and processed for staining with 4% uranyl acetate in 70% EtOH and lead citrate solution. Samples were analyzed using a Philips CM120 BioTwin Lens (FEI Company) with a Gatan MegaScan model 794/20 2 K × 2 K digital camera. Immunoblot analyses BMMs were infected with LM at an MOI of 5. At 30 min post-infection, cells were washed with PBS twice and incubated in fresh R10 medium supplemented with 10 μg/mL gentamicin. At 6 h and 24 h post-infection, cells were washed with PBS and lysed with RIPA lysis buffer [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2% Triton X-100, 0.5% deoxycholate, and 0.1% SDS] containing a protease inhibitor cocktail (1:100) (Calbiochem, Billerica, MA). Lysates were centrifuged at 14,000 × g for 15 min at 4°C, and the total protein concentrations of the resulting supernatants were measured using a PierceTM BCA protein assay kit (Thermo Scientific, Waltham, MA). Between 10 and 20 μg of total protein were mixed with 6× sample loading buffer and boiled at 95°C for 10 min. Protein samples were then separated by 14% SDS-PAGE, transferred to PVDF membranes, and immunoblotted using rabbit anti-alpha tubulin (Epitomics), rabbit-anti-human galectin-3 and rabbit-anti-LC3A/B (Cell Signaling) antibodies. Flow cytometry For analyses of lectin binding to the cell surface, cells (106/mL) were incubated in PBS containing 2% BSA with 2 μg/mL of FITC-PHA-L (Vector Labs) or 1 μg/mL of FITC-recombinant human galectin-3 for 20 min at 4°C. For MAL-II binding, cells were incubated with 5 μg/mL of biotin-MAL-II for 30 min followed by streptavidin-AL488 for 20 min at 4°C. After washing with PBS containing 2% BSA for three times, cells were analyzed with the Attune NxT flow cytometer (Thermo Fisher Scientific). The data were further analyzed with the FlowJo software. Statistical analysis All experiments were performed at least three times. Statistical analyses were performed using GraphPad Prism software. Statistical significance (P < 0.05) was calculated by unpaired Student’s t-tests. Supplementary data Supplementary data is available at GLYCOBIOLOGY online. Funding This work was supported by grants from Academia Sinica and Ministry of Science and Technology (MOST 104-0210-01-09-02, MOST 105-0210-01-13-01, MOST 106-0210-01-15-02), and Academia Sinica Thematic Project (AS-105-TP-B08). Abbreviations BMM bone marrow-derived macrophage CFU colony-forming unit CRD carbohydrate-recognition domain CRISPR clustered regularly interspaced short palindromic repeats G3-KO galectin-3 knock-out 3-MA 3-methyladenine G8-KO galectin-8 knock-out G3/8-DKO galectin-3/galectin-8-double knock-out Gal galectin GBP guanylate binding protein KIF kifunensine KO knock out LacNAc N-acetyllactosamine LC3 microtubule-associated protein light chain 3 LLO listeriolysin O LM Listeria monocytogenes MAL-II maackia amurensis lectin II Mgat1 mannoside acetylglucosaminyltransferase 1 MOI multiplication of infection MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide NDP52 nuclear dot protein 52 PHA-L phytothemagglutin-L ROS reactive oxygen species TBK1 Tank-binding kinase 1 WT wild-type Acknowledgements We would like to thank Dr. Daniel Portnoy for kindly providing the L. monocytogenes mutant strains. We also thank the staff at the Common Equipment Core Facilities Lab, Institute of Biomedical Sciences, Academia Sinica, Taiwan for their technical assistance. Conflict of interest statement None declared. References Ashida H , Ogawa M , Mimuro H , Kobayashi T , Sanada T , Sasakawa C . 2011 . Shigella are versatile mucosal pathogens that circumvent the host innate immune system . Curr Opin Immunol . 23 : 448 – 455 . Google Scholar CrossRef Search ADS PubMed Barondes SH , Cooper DNW , Gitt MA , Leffler H . 1994 . Galectins . J Biol Chem . 269 : 20807 – 20810 . Google Scholar PubMed Beatty WL , Rhoades ER , Hsu DK , Liu F-T , Russell DG . 2002 . Association of a macrophage galactoside-binding protein with Mycobacterium-containing phagosomes . Cell Microbiol . 4 : 167 – 176 . Google Scholar CrossRef Search ADS PubMed Birmingham CL , Canadien V , Gouin E , Troy EB , Yoshimori T , Cossart P , Higgins DE , Brumell JH . 2007 . Listeria monocytogenes evades killing by autophagy during colonization of host cells . Autophagy . 3 : 442 – 451 . Google Scholar CrossRef Search ADS PubMed Blommaart EFC , Krause U , Schellens JPM , Vreeling-Sindelárová H , Meijer AJ . 1997 . The phosphatidylinositol 3-kinase inhibitors Wortmannin and LY294002 inhibit autophagy in isolated rat hepatocytes . Eur J Biochem . 243 : 240 – 246 . Google Scholar CrossRef Search ADS PubMed Bohne J , Sokolovic Z , Goebel W . 1994 . Transcriptional regulation of prfA and PrfA-regulated virulence genes in Listeria monocytogenes . Mol Microbiol . 11 : 1141 – 1150 . Google Scholar CrossRef Search ADS PubMed Chen X , Khambu B , Zhang H , Gao W , Li M , Chen X , Yoshimori T , Yin X-M . 2014 a. Autophagy induced by calcium phosphate precipitates targets damaged endosomes . J Biol Chem . 289 : 11162 – 11174 . Google Scholar CrossRef Search ADS PubMed Chen W , Stanley P . 2003 . Five Lec1 CHO cell mutants have distinct Mgat1 gene mutations that encode truncated N-acetylglucosaminyltransferase I . Glycobiology . 13 : 43 – 50 . Google Scholar CrossRef Search ADS PubMed Chen H-Y , Weng IC , Hong M-H , Liu F-T . 2014 b. Galectins as bacterial sensors in the host innate response . Curr Opin Microbiol . 17 : 75 – 81 . Google Scholar CrossRef Search ADS PubMed Collins CA , Brown EJ . 2010 . Cytosol as battleground: Ubiquitin as a weapon for both host and pathogen . Trends Cell Biol . 20 : 205 – 213 . Google Scholar CrossRef Search ADS PubMed Crocker PR , Paulson JC , Varki A . 2007 . Siglecs and their roles in the immune system . Nat Rev Immunol . 7 : 255 – 266 . Google Scholar CrossRef Search ADS PubMed Deretic V , Saitoh T , Akira S . 2013 . Autophagy in infection, inflammation and immunity . Nat Rev Immunol . 13 : 722 – 737 . Google Scholar CrossRef Search ADS PubMed Dupont N , Lacas-Gervais S , Bertout J , Paz I , Freche B , Van Nhieu GT , van der Goot FG , Sansonetti PJ , Lafont F . 2009 . Shigella phagocytic vacuolar membrane remnants participate in the cellular response to pathogen invasion and are regulated by autophagy . Cell Host Microbe . 6 : 137 – 149 . Google Scholar CrossRef Search ADS PubMed Elbein AD , Tropea JE , Mitchell M , Kaushal GP . 1990 . Kifunensine, a potent inhibitor of the glycoprotein processing mannosidase I . J Biol Chem . 265 : 15599 – 15605 . Google Scholar PubMed Feeley EM , Pilla-Moffett DM , Zwack EE , Piro AS , Finethy R , Kolb JP , Martinez J , Brodsky IE , Coers J . 2017 . Galectin-3 directs antimicrobial guanylate binding proteins to vacuoles furnished with bacterial secretion systems . Proc Natl Acad Sci U S A . 114 : E1698 – E1706 . Google Scholar CrossRef Search ADS PubMed Fowler M , Thomas RJ , Atherton J , Roberts IS , High NJ . 2006 . Galectin-3 binds to Helicobacter pylori O-antigen: It is upregulated and rapidly secreted by gastric epithelial cells in response to H. pylori adhesion . Cell Microbiol . 8 : 44 – 54 . Google Scholar CrossRef Search ADS PubMed Garner OB , Baum LG . 2008 . Galectin–glycan lattices regulate cell-surface glycoprotein organization and signalling . Biochem Soc Trans . 36 : 1472 – 1477 . Google Scholar CrossRef Search ADS PubMed Grigorian A , Torossian S , Demetriou M . 2009 . T-cell growth, cell surface organization, and the galectin glycoprotein lattice . Immunol Rev . 230 : 232 – 246 . Google Scholar CrossRef Search ADS PubMed Hirabayashi J , Hashidate T , Arata Y , Nishi N , Nakamura T , Hirashima M , Urashima T , Oka T , Futai M , Muller WEG et al. . 2002 . Oligosaccharide specificity of galectins: a search by frontal affinity chromatography . Biochim Biophys Acta (BBA)-Gen Subj . 1572 : 232 – 254 . Google Scholar CrossRef Search ADS Hsu DK , Yang R-Y , Pan Z , Yu L , Salomon DR , Fung-Leung W-P , Liu F-T . 2000 . Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses . Am J Pathol . 156 : 1073 – 1083 . Google Scholar CrossRef Search ADS PubMed Ideo H , Matsuzaka T , Nonaka T , Seko A , Yamashita K . 2011 . Galectin-8-N-domain recognition mechanism for sialylated and sulfated glycans . J Biol Chem . 286 : 11346 – 11355 . Google Scholar CrossRef Search ADS PubMed Ideo H , Seko A , Ishizuka I , Yamashita K . 2003 . The N-terminal carbohydrate recognition domain of galectin-8 recognizes specific glycosphingolipids with high affinity . Glycobiology . 13 : 713 – 723 . Google Scholar CrossRef Search ADS PubMed Jiang P , Gan M , Yen S-H , McLean PJ , Dickson DW . 2017 . Impaired endo-lysosomal membrane integrity accelerates the seeding progression of α-synuclein aggregates . Sci Rep . 7 : 7690 . Google Scholar CrossRef Search ADS PubMed John CM , Jarvis GA , Swanson KV , Leffler H , Cooper MD , Huflejt ME , Griffiss JM . 2002 . Galectin-3 binds lactosaminylated lipooligosaccharides from Neisseria gonorrhoeae and is selectively expressed by mucosal epithelial cells that are infected . Cell Microbiol . 4 : 649 – 662 . Google Scholar CrossRef Search ADS PubMed Jones S , Portnoy DA . 1994 . Characterization of Listeria monocytogenes pathogenesis in a strain expressing perfringolysin O in place of listeriolysin O . Infect Immun . 62 : 5608 – 5613 . Google Scholar PubMed Kohatsu L , Hsu DK , Jegalian AG , Liu FT , Baum LG . 2006 . Galectin-3 induces death of Candida species expressing specific beta-1,2-linked mannans . J Immunol . 177 : 4718 – 4726 . Google Scholar CrossRef Search ADS PubMed Lewis AL , Lewis WG . 2012 . Host sialoglycans and bacterial sialidases: A mucosal perspective . Cell Microbiol . 14 : 1174 – 1182 . Google Scholar CrossRef Search ADS PubMed Liu F-T , Rabinovich GA . 2005 . Galectins as modulators of tumour progression . Nat Rev Cancer . 5 : 29 – 41 . Google Scholar CrossRef Search ADS PubMed Liu F-T , Yang R-Y , Hsu DK . 2012 . Galectins in acute and chronic inflammation . Ann N Y Acad Sci . 1253 : 80 – 91 . Google Scholar CrossRef Search ADS PubMed Maejima I , Takahashi A , Omori H , Kimura T , Takabatake Y , Saitoh T , Yamamoto A , Hamasaki M , Noda T , Isaka Y et al. . 2013 . Autophagy sequesters damaged lysosomes to control lysosomal biogenesis and kidney injury . EMBO J . 32 : 2336 – 2347 . Google Scholar CrossRef Search ADS PubMed Maier O , Marvin SA , Wodrich H , Campbell EM , Wiethoff CM . 2012 . Spatiotemporal dynamics of adenovirus membrane rupture and endosomal escape . J Virol . 86 : 10821 – 10828 . Google Scholar CrossRef Search ADS PubMed Meyer-Morse N , Robbins JR , Rae CS , Mochegova SN , Swanson MS , Zhao Z , Virgin HW , Portnoy D . 2010 . Listeriolysin O is necessary and sufficient to induce autophagy during Listeria monocytogenes infection . PLoS One . 5 : e8610 . Google Scholar CrossRef Search ADS PubMed Mizushima N , Yoshimori T , Levine B . 2010 . Methods in mammalian autophagy research . Cell . 140 : 313 – 326 . Google Scholar CrossRef Search ADS PubMed Montespan C , Marvin SA , Austin S , Burrage AM , Roger B , Rayne F , Faure M , Campell EM , Schneider C , Reimer R et al. . 2017 . Multi-layered control of Galectin-8 mediated autophagy during adenovirus cell entry through a conserved PPxY motif in the viral capsid . PLoS Pathog . 13 : e1006217 . Google Scholar CrossRef Search ADS PubMed Mostowy S , Sancho-Shimizu V , Hamon MA , Simeone R , Brosch R , Johansen T , Cossart P . 2011 . p62 and NDP52 proteins target intracytosolic Shigella and Listeria to different autophagy pathways . J Biol Chem . 286 : 26987 – 26995 . Google Scholar CrossRef Search ADS PubMed Nita-Lazar M , Banerjee A , Feng C , Amin MN , Frieman MB , Chen WH , Cross AS , Wang L-X , Vasta GR . 2015 . Desialylation of airway epithelial cells during influenza virus infection enhances pneumococcal adhesion via galectin binding . Mol Immunol . 65 : 1 – 16 . Google Scholar CrossRef Search ADS PubMed Ohtsubo K , Marth JD . 2006 . Glycosylation in cellular mechanisms of health and disease . Cell . 126 : 855 – 867 . Google Scholar CrossRef Search ADS PubMed Oku Y , Murakami K , Irie K , Hoseki J , Sakai Y . 2017 . Synthesized Aβ42 caused intracellular oxidative damage, leading to cell death, via lysosome rupture . Cell Struct Funct . 42 : 71 – 79 . Google Scholar CrossRef Search ADS PubMed Patnaik SK , Potvin B , Carlsson S , Sturm D , Leffler H , Stanley P . 2006 . Complex N-glycans are the major ligands for galectin-1, -3, and -8 on Chinese hamster ovary cells . Glycobiology . 16 : 305 – 317 . Google Scholar CrossRef Search ADS PubMed Paz I , Sachse M , Dupont N , Mounier J , Cederfur C , Enninga J , Leffler H , Poirier F , Prevost M-C , Lafont F et al. . 2010 . Galectin-3, a marker for vacuole lysis by invasive pathogens . Cell Microbiol . 12 : 530 – 544 . Google Scholar CrossRef Search ADS PubMed Portnoy DA , Auerbuch V , Glomski IJ . 2002 . The cell biology of Listeria monocytogenes infection: The intersection of bacterial pathogenesis and cell-mediated immunity . J Cell Biol . 158 : 409 – 414 . Google Scholar CrossRef Search ADS PubMed Py BF , Lipinski MM , Yuan J . 2007 . Autophagy limits Listeria monocytogenes intracellular growth in the early phase of primary infection . Autophagy . 3 : 117 – 125 . Google Scholar CrossRef Search ADS PubMed Quattroni P , Li Y , Lucchesi D , Lucas S , Hood DW , Herrmann M , Gabius H-J , Tang CM , Exley RM . 2012 . Galectin-3 binds Neisseria meningitidis and increases interaction with phagocytic cells . Cell Microbiol . 14 : 1657 – 1675 . Google Scholar CrossRef Search ADS PubMed Rabinovich GA , Toscano MA . 2009 . Turning ‘sweet’ on immunity: Galectin-glycan interactions in immune tolerance and inflammation . Nat Rev Immunol . 9 : 338 – 352 . Google Scholar CrossRef Search ADS PubMed Sano H , Hsu DK , Apgar JR , Yu L , Sharma BB , Kuwabara I , Izui S , Liu F-T . 2003 . Critical role of galectin-3 in phagocytosis by macrophages . Eur J Clin Invest . 112 : 389 – 397 . Google Scholar CrossRef Search ADS Skoble J , Portnoy DA , Welch MD . 2000 . Three regions within acta promote Arp2/3 complex-mediated actin nucleation and Listeria monocytogenes motility . J Cell Biol . 150 : 527 – 538 . Google Scholar CrossRef Search ADS PubMed Stowell SR , Arthur CM , Dias-Baruffi M , Rodrigues LC , Gourdine J-P , Heimburg-Molinaro J , Ju T , Molinaro RJ , Rivera-Marrero C , Xia B et al. . 2010 . Innate immune lectins kill bacteria expressing blood group antigen . Nat Med . 16 : 295 – 301 . Google Scholar CrossRef Search ADS PubMed Stowell SR , Arthur CM , McBride R , Berger O , Razi N , Heimburg-Molinaro J , Rodrigues LC , Gourdine J-P , Noll AJ , von Gunten S et al. . 2014 . Microbial glycan microarrays define key features of host-microbial interactions . Nat Chem Biol . 10 : 470 – 476 . Google Scholar CrossRef Search ADS PubMed Stowell SR , Arthur CM , Mehta P , Slanina KA , Blixt O , Leffler H , Smith DF , Cummings RD . 2008 . Galectin-1, -2, and -3 exhibit differential recognition of sialylated glycans and blood group antigens . J Biol Chem . 283 : 10109 – 10123 . Google Scholar CrossRef Search ADS PubMed Thurston TLM , Ryzhakov G , Bloor S , von Muhlinen N , Randow F . 2009 . The TBK1 adaptor and autophagy receptor NDP52 restricts the proliferation of ubiquitin-coated bacteria . Nat Immunol . 10 : 1215 – 1221 . Google Scholar CrossRef Search ADS PubMed Thurston TLM , Wandel MP , von Muhlinen N , Foeglein A , Randow F . 2012 . Galectin 8 targets damaged vesicles for autophagy to defend cells against bacterial invasion . Nature . 482 : 414 – 418 . Google Scholar CrossRef Search ADS PubMed Tschopp J , Schroder K . 2010 . NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production? Nat Rev Immunol . 10 : 210 – 215 . Google Scholar CrossRef Search ADS PubMed Vande Velde S. 2013 . The role of viral, bacterial, parasitic and human sialidases in disease. Faculty of Medicine and Health Sciences: Unitersiteit Gent. Varki A , Cummings RD , Aebi M , Packer NH , Seeberger PH , Esko JD , Stanley P , Hart G , Darvill A , Kinoshita T et al. . 2015 . Symbol nomenclature for graphical representations of glycans . Glycobiology . 25 : 1323 – 1324 . Google Scholar CrossRef Search ADS PubMed Varki A , Cummings RD , Esko JD , Freeze HH , Stanley P , Bertozzi CR , Hart GW , Etzler ME , editors . 2009 . Essentials of Glycobiology , 2nd ed . Cold Spring Harbor (NY) : Cold Spring Harbor Laboratory Press . Vasta GR . 2009 . Roles of galectins in infection . Nat Rev Micro . 7 : 424 – 438 . Google Scholar CrossRef Search ADS Vasta GR , Ahmed H , Nita-Lazar M , Banerjee A , Pasek M , Shridhar S , Guha P , Fernandez-Robledo JA . 2012 . Galectins as self/non-self recognition receptors in innate and adaptive immunity: An unresolved paradox . Front Immunol . 3 : 199 . Google Scholar CrossRef Search ADS PubMed Wild P , Farhan H , McEwan DG , Wagner S , Rogov VV , Brady NR , Richter B , Korac J , Waidmann O , Choudhary C et al. . 2011 . Phosphorylation of the autophagy receptor optineurin restricts Salmonella growth . Science . 333 : 228 – 233 . Google Scholar CrossRef Search ADS PubMed Wu Y-T , Tan H-L , Shui G , Bauvy C , Huang Q , Wenk MR , Ong C-N , Codogno P , Shen H-M . 2010 . Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on Class I and III phosphoinositide 3-kinase . J Biol Chem . 285 : 10850 – 10861 . Google Scholar CrossRef Search ADS PubMed Yang RY , Hsu DK , Liu FT . 1996 . Expression of galectin-3 modulates T-cell growth and apoptosis . Proc Natl Acad Sci U S A . 93 : 6737 – 6742 . Google Scholar CrossRef Search ADS PubMed Yang R-Y , Rabinovich GA , Liu F-T . 2008 . Galectins: Structure, function and therapeutic potential . Expert Rev Mol Med . 10 : e17 . Google Scholar CrossRef Search ADS PubMed Yoshikawa Y , Ogawa M , Hain T , Yoshida M , Fukumatsu M , Kim M , Mimuro H , Nakagawa I , Yanagawa T , Ishii T et al. . 2009 . Listeria monocytogenes ActA-mediated escape from autophagic recognition . Nat Cell Biol . 11 : 1233 – 1240 . Google Scholar CrossRef Search ADS PubMed Zheng YT , Shahnazari S , Brech A , Lamark T , Johansen T , Brumell JH . 2009 . The adaptor protein p62/SQSTM1 targets invading bacteria to the autophagy pathway . J Immunol . 183 : 5909 – 5916 . Google Scholar CrossRef Search ADS PubMed Zhuo Y , Bellis SL . 2011 . Emerging role of α2,6-sialic acid as a negative regulator of galectin binding and function . J Biol Chem . 286 : 5935 – 5941 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Glycobiology Oxford University Press

Cytosolic galectin-3 and -8 regulate antibacterial autophagy through differential recognition of host glycans on damaged phagosomes

Loading next page...
 
/lp/ou_press/cytosolic-galectin-3-and-8-regulate-antibacterial-autophagy-through-FhrwJAhcwS
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0959-6658
eISSN
1460-2423
D.O.I.
10.1093/glycob/cwy017
Publisher site
See Article on Publisher Site

Abstract

Abstract While glycans are generally displayed on the cell surface or confined within the lumen of organelles, they can become exposed to the cytosolic milieu upon disruption of organelle membrane by various stresses or pathogens. Galectins are a family of β-galactoside-binding animal lectins synthesized and predominantly localized in the cytosol. Recent research indicates that some galectins may act as “danger signal sensors” by detecting unusual exposure of glycans to the cytosol. Galectin-8 was shown to promote antibacterial autophagy by recognizing host glycans on ruptured vacuolar membranes and interacting with the autophagy adaptor protein NDP52. Galectin-3 also accumulates at damaged phagosomes containing bacteria; however, its functional consequence remains obscure. By studying mouse macrophages infected with Listeria monocytogenes (LM), we showed that endogenous galectin-3 protects intracellular LM by suppressing the autophagic response through a host N-glycan-dependent mechanism. Knock out of the galectin-3 gene resulted in enhanced LC3 recruitment to LM and decreased bacterial replication, a phenotype recapitulated when Galectin-8-deficient macrophages were depleted of N-glycans. Moreover, we explored the concept that alterations in cell surface glycosylation by extracellular factors can be deciphered by cytosolic galectins during the process of phagocytosis/endocytosis, followed by rupture of phagosomal/endosomal membrane. Notably, treatment of cells with sialidase, which removes sialic acid from glycans, resulted in increased galectin-3 accumulation and decreased galectin-8 recruitment at damaged phagosomes, and led to a stronger anti-autophagic response. Our findings demonstrate that cytosolic galectins may sense changes in glycosylation at the cell surface and modulate cellular response through differential recognition of glycans on ruptured phagosomal membranes. autophagy, galectin, Listeria, macrophage, sialidase Introduction Multicellular organisms are equipped with an array of defense systems that provide protection from pathogens and other cellular insults. Phagocytic cells such as macrophages are among the first lines of defense, killing pathogens in part by engulfing and delivering them to lysosomes for degradation. To evade lysosomal degradation and gain access to the nutrient-rich host cell cytoplasm, many intracellular bacterial pathogens, including Listeria monocytogenes (LM), have evolved strategies to lyse the phagosomal membrane (Portnoy et al. 2002; Ashida et al. 2011). The mammalian cell cytosol contains several antimicrobial surveillance systems that either recognize microbial components directly or detect invasion-associated signals, such as the generation of reactive oxygen species (ROS) and phagosomal membrane damage (Tschopp and Schroder 2010). Subsequently, invading bacteria are targeted for lysosomal degradation via an essential mechanism referred to as selective autophagy (Deretic et al. 2013). Recent studies have identified multiple mechanisms that induce antibacterial autophagy. Typically, bacterial pathogens are tagged with ubiquitin and then targeted by adaptor proteins [e.g., p62, nuclear dot protein 52 (NDP52), Tank-binding kinase 1 (TBK1) and optineurin], which bind to microtubule-associated protein light chain 3 (LC3) on newly formed isolation membranes and allow ubiquitin-tagged cargos to be delivered to autophagosomes (Collins and Brown 2010; Thurston et al. 2009; Wild et al. 2011; Zheng et al. 2009). Galectins are β-galactoside-binding animal lectins that have been reported to participate in various physiological and pathological processes, including immunity, inflammation and cancer progression (Liu and Rabinovich 2005; Liu et al. 2012; Rabinovich and Toscano 2009). Each member of the galectin family contains a consensus amino acid sequence in the carbohydrate-recognition domain (CRD). These molecules are sub-categorized based on their protein structures into one-CRD type (galectin-1, -2, -5, -7, -10, -11, -13, -14 and -15), two-CRD type (galectin-4, -6, -8, -9 and -12), and a chimera type (galectin-3) (Barondes et al. 1994; Yang et al. 2008). While galectins are primarily located in the cytoplasm, under certain circumstances they localize to the nucleus or associate with intracellular vesicles, and are detected in the extracellular space (Liu et al. 2012). A number of studies have demonstrated that galectins recognize microbial glycans [reviewed in Chen et al. (2014); Vasta (2009); Vasta et al. (2012)]; however, the majority of these interactions were demonstrated by binding of recombinant galectins to isolated microorganisms, and thus may not reflect natural infectious condition in vivo (Fowler et al. 2006; John et al. 2002; Kohatsu et al. 2006; Quattroni et al. 2012). Galectin-3, -8, and -9 were shown to be recruited to vesicles that initially contained intracellular bacteria such as Salmonella typhimurium, Shigella flexneri and LM, but were subsequently ruptured by the bacteria as the latter escaped from the vesicles (Dupont et al. 2009; Thurston et al. 2012). Recruitment and accumulation of galectins on these ruptured vesicles is dependent on binding of galectins to host glycans that are normally confined to the luminal side of the vesicle, but exposed to the cytosol upon lysis (Paz et al. 2010; Thurston et al. 2012). Recently, Thurston et al. reported that after binding to host N-glycans on ruptured Salmonella-containing vesicles, galectin-8 recruits the adaptor protein NDP52, which triggers autophagic activation resulting in the confinement of both the bacteria and damaged vesicles within autophagosomes (Thurston et al. 2012). Meanwhile, Feeley et al. demonstrated that galectin-3 promotes the recruitment of guanylate binding proteins (GBPs) to Legionella- and Yersinia-containing vacuoles in IFN-γ-primed mouse bone marrow-derived macrophages in a host glycan-dependent manner (Feeley et al. 2017). Aside from these reports, however, the functional consequence of recruitment of galectins to ruptured bacteria-containing vesicles remains largely unexplored. During infection by microbial pathogens, glycans displayed on the host cell surface may be modified by endogenous or exogenous glycosidase, thereby affecting host–pathogen interaction and downstream cellular defense mechanisms (Nita-Lazar et al. 2015; Ohtsubo and Marth 2006). Sialic acids are a family of nine-carbon monosaccharides commonly present at the terminal position of eukaryotic cell glycans. They are highly expressed on the outer cell membrane, at the interior of lysosomal membranes, and on secreted glycoproteins, and are involved in the stabilization of molecules and modulation of interactions with the environment (Varki et al. 2009). Because of their outermost position, sialic acids are vulnerable to the action of microbial esterases, sialidases and lyases (Ideo et al. 2003). Various microorganisms, including viruses, bacteria, protozoa and fungi, produce sialidases, and degradation of human sialic acids by pathogen-produced sialidases is associated with diseases such as periodontitis, cystic fibrosis, pneumonia, and influenza infection (Lewis and Lewis 2012; Vande Velde 2013). Many microbial sialidases are powerful virulence factors that assist in invasion, unmask potential binding sites, and provide nutrients for the bacteria (Vande Velde 2013). Several studies have shown that α2-6 sialylation blocks binding of β-galactosides to most galectins, including galectin-1, -3, -8, and -9 (Hirabayashi et al. 2002; Stowell et al. 2008; Zhuo and Bellis 2011), whereas α2–3 sialylation substantially enhances the affinity of the N-terminal CRD of galectin-8 (Gal-8N) but not the C-terminal CRD of galectin-8 (Gal8-C) or galectin-3 (Hirabayashi et al. 2002). Thus, we proposed that changes in cell surface glycosylation, such as the sialylation status of cell surface glycans, can impact galectin-mediated intracellular responses resulting from the interaction of cytosolic galectins with these glycans following endocytosis and vacuole damage. In this study, we utilized macrophages from homozygous wild-type (gal3+/+) and homozygous Lgals3 gene knockout (gal3–/–) mice as a model to delineate the function of endogenous galectin-3 during intracellular LM infection. We report that, unlike galectin-8, galectin-3 promotes bacterial survival by suppressing the activation of antibacterial autophagy. This anti-autophagic activity of galectin-3 is dependent on the presence of host N-glycans on damaged phagosomal membranes, which induce galectin-3 accumulation near damaged phagosomes containing bacteria. By studying galectin-3 and galectin-8 double-knock-out macrophages, we further demonstrate that galectin-3 does not inhibit autophagy simply by blocking galectin-8 binding to glycan ligands, but is an active player in down-regulating autophagy. Importantly, we show that changes in cell surface glycosylation may impact the outcome of infections through the antagonistic interaction of galectin-3 and galectin-8 in regulating antibacterial autophagy. This study provides significant insight into the role of intracellular galectins in bacterial pathogenesis and the innate immune function of macrophages. Results Galectin-3 accumulates at damaged LM-containing phagosomes and exerts a protective effect on LM in macrophages Given that galectin-3 was shown to accumulate at damaged bacteria-containing vacuoles (Dupont et al. 2009; Paz et al. 2010; Thurston et al. 2012), we examined the distribution pattern of this protein in mouse macrophages during LM infection via immunofluorescence staining. While significant accumulation of galectin-3 was observed adjacent to wild-type (WT) LM at 1 h post-infection in mouse J774 macrophages (Figure 1A), this effect was not observed in J774 cells infected with the LM ∆hly strain, which is deficient in the pore-forming cytolysin listeriolysin O (LLO) and is unable to escape from host cell vacuoles (Figure 1A) (Jones and Portnoy 1994). These data indicate that recruitment of galectin-3 to the LM-containing phagosome occurs after phagosomal integrity is compromised by the bacterium. Fig. 1. View largeDownload slide Galectin-3 accumulates at damaged phagosomes containing LM and provides a protective effect for LM within macrophages. (A) J774 cells were infected with wild-type LM 10,403 S (LM WT) or LM DP-L2161 (LM ∆hly) at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained using galectin-3 and LM-specific antibodies. (B and C) gal3+/+ BMMs were infected with LM WT (B) or LM ∆hly (C) at an MOI of 5 for 30 min. Cells were fixed, prepared for cryosectioning, and labeled using a galectin-3-specific antibody conjugated to 10-nm gold particles. Scale bars represent 100 nm. (D) Time-lapse images of rapid recruitment of cytosolic galectin-3 to escaping LM. J774 cells stably expressing galectin-3-EGFP were loaded with LysoTracker Red DND-99 and infected with BacLight Red-stained LM WT at an approximate MOI of 100. Cells were monitored by confocal microscopy and live images were taken at 1-min intervals. Galectin-3 is shown in green, LM is shown in red, and LysoTracker is shown in blue. Arrows point to specific bacteria followed over the time course. Magnified pictures of the boxed regions are shown in the bottom. (E) gal3+/+ (●) or gal3–/– (○) BMMs were infected with LM WT at an MOI of 0.25. At various time points post-infection, cells were lysed, and diluted lysates were plated on BHI agar for enumeration of CFUs. (F) gal3+/+ (■) or gal3–/– (□) BMMs were infected with LM WT or the mutant strains LM ∆hly or LM ∆actA at an MOI of 0.25. At 24 h post-infection, cells were lysed, and diluted lysates were plated for enumeration of CFUs. Data points represent the means ± standard deviations (SD) of the results obtained from triplicate wells. Results are representative of at least three independent experiments. *P < 0.05; **P < 0.01; gal3–/– compared to gal3+/+ by Student’s t-test. (G) gal3+/+ or gal3–/– BMMs were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM and nuclei. The number of LM per cell was quantified using an ImageXpress Micro XLS Widefield High-Content Analysis System. Typically, for each sample, nine randomly-chosen image fields containing a total of at least 100 cells were analyzed. Data shown are representative of three independent experiments. Fig. 1. View largeDownload slide Galectin-3 accumulates at damaged phagosomes containing LM and provides a protective effect for LM within macrophages. (A) J774 cells were infected with wild-type LM 10,403 S (LM WT) or LM DP-L2161 (LM ∆hly) at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained using galectin-3 and LM-specific antibodies. (B and C) gal3+/+ BMMs were infected with LM WT (B) or LM ∆hly (C) at an MOI of 5 for 30 min. Cells were fixed, prepared for cryosectioning, and labeled using a galectin-3-specific antibody conjugated to 10-nm gold particles. Scale bars represent 100 nm. (D) Time-lapse images of rapid recruitment of cytosolic galectin-3 to escaping LM. J774 cells stably expressing galectin-3-EGFP were loaded with LysoTracker Red DND-99 and infected with BacLight Red-stained LM WT at an approximate MOI of 100. Cells were monitored by confocal microscopy and live images were taken at 1-min intervals. Galectin-3 is shown in green, LM is shown in red, and LysoTracker is shown in blue. Arrows point to specific bacteria followed over the time course. Magnified pictures of the boxed regions are shown in the bottom. (E) gal3+/+ (●) or gal3–/– (○) BMMs were infected with LM WT at an MOI of 0.25. At various time points post-infection, cells were lysed, and diluted lysates were plated on BHI agar for enumeration of CFUs. (F) gal3+/+ (■) or gal3–/– (□) BMMs were infected with LM WT or the mutant strains LM ∆hly or LM ∆actA at an MOI of 0.25. At 24 h post-infection, cells were lysed, and diluted lysates were plated for enumeration of CFUs. Data points represent the means ± standard deviations (SD) of the results obtained from triplicate wells. Results are representative of at least three independent experiments. *P < 0.05; **P < 0.01; gal3–/– compared to gal3+/+ by Student’s t-test. (G) gal3+/+ or gal3–/– BMMs were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM and nuclei. The number of LM per cell was quantified using an ImageXpress Micro XLS Widefield High-Content Analysis System. Typically, for each sample, nine randomly-chosen image fields containing a total of at least 100 cells were analyzed. Data shown are representative of three independent experiments. To clarify the topological localization of galectin-3 with regard to LM-containing phagosomes, we performed immuno-transmission electron microscopy (immuno-TEM). As expected, sparse intracellular labeling of galectin-3 was detected throughout the cytoplasm of uninfected bone marrow-derived macrophages (BMMs), with no evident accumulation at any compartment [data not shown and Beatty et al. (2002)]. In LM WT-infected BMMs, galectin-3 was observed to accumulate in the vicinity of the bacterium, where the vacuolar membrane structure had been disrupted (Figure 1B, arrow). Conversely, galectin-3 localized to the cytosolic face of bacterial phagosomes in LM ∆hly-infected BMMs (Figure 1C). To gain a better understating of the kinetics of galectin-3 recruitment to LM, we monitored galectin-3-EGFP distribution in J774 macrophages during LM infection by live cell imaging. The majority of internalized LM were observed in LysoTracker-negative vacuoles. Figure 1D (arrows) shows the infectious process of an individual bacterium that was tracked from cell surface adhesion to uptake by the macrophage (28’), residence in the vacuole (34’), phagosomal escape (47’ to 55’), presence in the cytosol and the initiation of galectin-3 recruitment (64’ to 78’), rapid accumulation of large amounts of galectin-3 (79’), and appearance of the second and third bacterium (83’ to 120’). Initial recruitment of galectin-3 to the cytosolic LM occurred slowly (73’ to 78’); however, within a one-minute span (78’ to 79’), the galectin-3-EGFP signal around the bacterium intensified strikingly. These observations suggest that the recruitment of intracellular galectin-3 to cytosolic LM occurs rapidly. Notably, accumulation of galectin-3-EGFP occurred around the same time window of LM escape, and the red color representing labeled LM was no longer visible at that time. Lack of endogenous galectin-3 restricts intracellular LM growth and survival To investigate whether galectin-3 affects intracellular LM survival, we infected BMMs isolated from gal3+/+ or gal3–/– mice with LM WT and analyzed the kinetics of intracellular LM growth. To prevent extracellular multiplication of bacteria within the culture medium, gentamicin was added at 30 min post-infection. When infected with a low dose of bacteria [multiplication of infection (MOI) = 0.25], the initial levels of bacterial growth were comparable between gal3+/+ and gal3–/– BMMs, and the number of LM colony-forming units (CFUs) peaked at 5 h post-infection in both cell populations. Notably, however, the ensuing bacterial clearance rate was more rapid in gal3–/– BMMs than in gal3+/+ cells, and the bacteria load was significantly lower in gal3–/– BMMs than in gal3+/+ BMMs at 24 h and 50 h post-infection (Figure 1E), indicating that galectin-3 is beneficial for intracellular survival of LM. To assess whether galectin-3 is involved in LM phagosomal escape or host actin polymerization, respectively, we infected gal3+/+ and gal3–/– BMMs with LM ∆hly or LM ∆actA, the latter being unable to induce actin-based motility within the host cell cytosol (Skoble et al. 2000). Due to the inability of LM ∆hly to escape lysosomal destruction, this strain was almost completely eliminated by both BMM cell populations by 24 h post-infection. Likewise, the non-motile LM ∆actA mutant exhibited lower survival rates in both populations than LM WT. Moreover, the numbers of viable LM ∆actA were significantly lower in gal3–/– BMMs than in gal3+/+ BMMs (Figure 1F). Subsequent experiments suggested that galectin-3 deficiency does not affect the phagocytosis of LM by BMMs (Supplementary Figure 1A), LM phagosomal escape (Supplementary Figures 1B–C), or LM infection-induced cell death (Supplementary Figure 1D). Lastly, after infection with a high MOI (MOI = 5), high-content imaging analysis detected decreased replication of LM in gal3–/– BMMs compared to gal3+/+ BMMs, during the early stages of infection (Figure 1G); this phenomenon was observed upon infection with either LM WT or LM ∆actA. These findings are therefore consistent with galectin-3 exerting a protective effect on intracellular LM, as mentioned above. Recruitment of galectin-3 to the vicinity of LM is dependent on host N-glycans To clarify whether the rapid recruitment of galectin-3 to cytosolic LM is mediated by binding of galectin-3 directly to LM or to exposed host glycans, we modified the N-glycan composition of the J774 mouse macrophages using glycosylation enzyme inhibitors. Kifunensine (KIF) is an alkaloid compound that exhibits potent and selective inhibition of Golgi α-mannosidase I, which when placed in the cell culture medium causes a complete shift in the structure of N-linked oligosaccharides from complex chains to Man9(GlcNAc)2 (high mannose) varieties (Elbein et al. 1990), and thereby a loss of galectin-preferred complex type N-glycans (Figure 2A). After confirming that the structures on the surface of J774 cells recognizable by recombinant human galectin-3 (Figure 2B) and phytohemagglutinin-L (PHA-L), a plant lectin that preferably recognizes β1-6GlcNAc branched N-glycans, (data not shown) were markedly decreased in cells treated with KIF (20 μM) for 2 days, we infected KIF-treated J774 cells with LM WT. Notably, we found that colocalization of galectin-3 with LM WT was substantially decreased in these cells, compared to untreated cells, at 1 h post-infection (Figure 2D and E). Fig. 2. View largeDownload slide Host N-glycans are required for the accumulation of galectin-3 around LM. (A) Schematic representation of the mammalian N-glycan synthesis pathway, the enzymes required for each step, and the inhibitors that block certain steps. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). (B) Binding of recombinant human galectin-3-Atto565 (10 μg/mL) to J774 cells treated for 48 h with 20 μM kifunensine (KIF), and the mean fluorescence intensity (MFI) values of samples in (A). (C) Flow cytometry results for the binding of recombinant human galectin-3 to WT and Mgat1-KO RAW264.7 cells. (D) J774 cells treated with 20 μM KIF for 48 h were infected with LM WT at an MOI of 5. At 1 h post-infection, cells were fixed, stained for LM and galectin-3, and analyzed by confocal microscopy. (E) Quantitative results of the percentage of LM that colocalized with galectin-3 in WT and KIF-treated J774 cells. Data points represent the means ± SD of the results obtained from triplicate fields in a representative experiment (n > 100 for each field). **P < 0.01 by Student’s t-test. (F and G) WT and KIF-treated RAW264.7 cells (F) or Mgat1-KO RAW264.7 cells (G) were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM, galectin-3 and nuclei. The numbers of cells, LM and galectin-3 puncta in each sample were counted using the ImageXpress Micro XLS Widefield High-Content Analysis System, and the percentages of galectin-3-positive LM were quantified. The data shown comprise representative results from three independent experiments. Fig. 2. View largeDownload slide Host N-glycans are required for the accumulation of galectin-3 around LM. (A) Schematic representation of the mammalian N-glycan synthesis pathway, the enzymes required for each step, and the inhibitors that block certain steps. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). (B) Binding of recombinant human galectin-3-Atto565 (10 μg/mL) to J774 cells treated for 48 h with 20 μM kifunensine (KIF), and the mean fluorescence intensity (MFI) values of samples in (A). (C) Flow cytometry results for the binding of recombinant human galectin-3 to WT and Mgat1-KO RAW264.7 cells. (D) J774 cells treated with 20 μM KIF for 48 h were infected with LM WT at an MOI of 5. At 1 h post-infection, cells were fixed, stained for LM and galectin-3, and analyzed by confocal microscopy. (E) Quantitative results of the percentage of LM that colocalized with galectin-3 in WT and KIF-treated J774 cells. Data points represent the means ± SD of the results obtained from triplicate fields in a representative experiment (n > 100 for each field). **P < 0.01 by Student’s t-test. (F and G) WT and KIF-treated RAW264.7 cells (F) or Mgat1-KO RAW264.7 cells (G) were infected with LM WT or LM ∆actA at an MOI of 5. At various time points, cells were fixed and stained for LM, galectin-3 and nuclei. The numbers of cells, LM and galectin-3 puncta in each sample were counted using the ImageXpress Micro XLS Widefield High-Content Analysis System, and the percentages of galectin-3-positive LM were quantified. The data shown comprise representative results from three independent experiments. We also monitored the kinetics of galectin-3 recruitment to LM under the influence of KIF via high-content imaging analysis. Recruitment of galectin-3 to LM peaked at 30 min–1 h post-infection, and KIF treatment resulted in a dramatic reduction in galectin-3 recruitment to both LM WT and LM ∆actA (Figure 2F). As an alternative to KIF treatment, we generated a RAW264.7 cell line with a deletion of the gene encoding mannoside acetylglucosaminyltransferase 1 (Mgat1), which is necessary for the biosynthesis of hybrid and complex N-glycans (Figure 2A) (Chen and Stanley 2003), using a CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 expression system. Deletion of Mgat1 gene resulted in loss of complex N-glycans, as determined by an absence of structures recognizable by PHA-L at the cell surface (data not shown). Mgat1 deficiency also resulted in a substantial reduction in the glycan structures recognizable by recombinant human galectin-3 (Figure 2C). Consistent with the results of the KIF experiment, recruitment of galectin-3 to LM was significantly decreased in Mgat1-KO cells compared to WT cells (Figure 2G). Together, these data indicate that host hybrid and complex N-glycans are required for the recruitment and accumulation of galectin-3 at the vicinity of LM. Interestingly, we also noted that more galectin-3 accumulated around LM ∆actA than around LM WT, which could be due to the fact that LM ∆actA is non-motile and therefore may be less capable of shedding the phagosomal membrane remnant coat that contains N-glycans. Lack of galectin-3 results in enhanced autophagy activation LM has been shown to induce activation of host cell autophagy and to interact with the host autophagic machinery, including the autophagy marker LC3 (Birmingham et al. 2007; Meyer-Morse et al. 2010; Py et al. 2007). To investigate whether galectin-3 is involved in antibacterial autophagy, we examined the association of LM and LC3 in gal3+/+ and gal3–/– cells by confocal microscopy. At 1 h post-infection, we observed more prominent colocalization of LC3 with both LM WT and LM ∆actA in gal3–/– BMMs than in gal3+/+ cells (Figure 3A). Indeed, quantitative analyses showed a significantly higher percentage of LC3-positive LM WT in gal3–/– BMMs compared to gal3+/+ BMMs (Figure 3B). Moreover, a time course study of WT and galectin-3-knock-out (G3-KO) RAW264.7 cells infected with LM WT or LM ∆actA clearly showed that recruitment of LC3 to LM was more efficient in G3-KO cells than in WT cells (Figure 3C). We also noticed a higher degree of LC3 recruitment to LM ∆actA than to LM WT, which is consistent with a previous report that LM ∆actA is more susceptible to autophagic recognition (Yoshikawa et al. 2009). In addition, we assessed LM-induced autophagy activation in gal3+/+ and gal3–/– BMMs by measuring the conversion of LC3-I to LC3-II by immunoblot analysis (Mizushima et al. 2010). Gal3–/– BMMs infected with WT LM exhibited higher levels of LC3-II at 6 h and 24 h post-infection than did infected gal3+/+ BMMs (Figure 3D). Similarly, LM ∆actA-induced LC3-II expression levels (Figure Supplementary Figure 2A) and LC3 puncta counts per cell (Supplementary Figure 2B) were higher in G3-KO RAW264.7 cells than in WT cells. These data indicate that autophagy activation and recruitment of LC3 to LM were enhanced in cells lacking galectin-3. In other words, galectin-3 dampens the formation of LC3-positive autophagosomes surrounding intracellular LM. Fig. 3. View largeDownload slide Galectin-3 protects LM by suppressing antibacterial autophagy response. (A) gal3+/+ (■) or gal3–/– (□) BMMs were infected with wild-type LM (LM WT) or LM ∆actA at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained with LC3- and galectin-3-specific antibodies. DAPI stain was used to visualize cell nuclei and bacteria. (B) Quantification of the percentage of LM WT colocalized with LC3 at 1 h post-infection in gal3+/+ (■) or gal3–/– (□) BMMs. Values represent the means ± SD of the results obtained from triplicate samples (n > 100 LM per sample). (C) Quantification of LC3-positive LM WT or LM ∆actA in WT or G3-KO RAW264.7 cells at various time points after infection, as determined by high-content imaging analysis. (D) gal3+/+ or gal3–/– BMMs were infected with wild-type LM WT at an MOI of 5. At indicated time points, cells were lysed and analyzed by immunoblot to assess tubulin and LC3 expression. Data are representative of at least three independent experiments. (E) gal3+/+ and gal3–/– BMMs were pretreated with 3-methyladenine (5 mM) for 3 h prior to infection with LM ∆actA at an MOI of 5. At 1 h and 8 h post-infection, cells were lysed and the numbers of viable bacteria were determined by CFU assay. Fold replication was calculated by normalizing the CFU number at 8 h to that at 1 h. (F) Fold replication at 8 h of LM ∆actA in WT or G3-KO RAW264.7 cells that were transfected with control or Atg5-specific siRNA (siAtg5) molecules. Immunoblot showing decreased Atg5 protein expression in siAtg5-19 transfected cells, but not in the negative control (N) or mock control (C) groups. Data are representative of at least three independent experiments. Means ± SD of triplicate samples. *P < 0.05 by Student’s t-test. Fig. 3. View largeDownload slide Galectin-3 protects LM by suppressing antibacterial autophagy response. (A) gal3+/+ (■) or gal3–/– (□) BMMs were infected with wild-type LM (LM WT) or LM ∆actA at an MOI of 5 for 1 h. Cells were fixed, permeabilized, and stained with LC3- and galectin-3-specific antibodies. DAPI stain was used to visualize cell nuclei and bacteria. (B) Quantification of the percentage of LM WT colocalized with LC3 at 1 h post-infection in gal3+/+ (■) or gal3–/– (□) BMMs. Values represent the means ± SD of the results obtained from triplicate samples (n > 100 LM per sample). (C) Quantification of LC3-positive LM WT or LM ∆actA in WT or G3-KO RAW264.7 cells at various time points after infection, as determined by high-content imaging analysis. (D) gal3+/+ or gal3–/– BMMs were infected with wild-type LM WT at an MOI of 5. At indicated time points, cells were lysed and analyzed by immunoblot to assess tubulin and LC3 expression. Data are representative of at least three independent experiments. (E) gal3+/+ and gal3–/– BMMs were pretreated with 3-methyladenine (5 mM) for 3 h prior to infection with LM ∆actA at an MOI of 5. At 1 h and 8 h post-infection, cells were lysed and the numbers of viable bacteria were determined by CFU assay. Fold replication was calculated by normalizing the CFU number at 8 h to that at 1 h. (F) Fold replication at 8 h of LM ∆actA in WT or G3-KO RAW264.7 cells that were transfected with control or Atg5-specific siRNA (siAtg5) molecules. Immunoblot showing decreased Atg5 protein expression in siAtg5-19 transfected cells, but not in the negative control (N) or mock control (C) groups. Data are representative of at least three independent experiments. Means ± SD of triplicate samples. *P < 0.05 by Student’s t-test. An enhanced autophagic response is responsible for poor LM growth in galectin-3-deficient macrophages Because LM ∆actA is more susceptible to autophagic recognition and triggers a higher degree of LC3 recruitment to the vicinity of bacteria than LM WT does (Yoshikawa et al. 2009), we used LM ∆actA for all the following infection experiments. To determine whether the reduced LM growth observed in galectin-3-deficient macrophages was due to an enhanced antibacterial autophagic response, we assessed LM growth in BMMs treated with the phosphoinositide kinase 3 (PI-3) inhibitor 3-methyladenine (3-MA), which is known to inhibit autophagy (Blommaart et al. 1997; Wu et al. 2010). The inhibitory effect was confirmed by decreased induction of LC3-II levels after LM infection of BMMs (data not shown). Suppression of autophagy by 3-MA resulted in a substantial increase in LM growth in gal3–/– BMMs, and only a mild increase in LM growth in gal3+/+ BMMs. Importantly, the observed difference in LM ∆actA replication between gal3+/+ and gal3–/– BMMs was diminished after 3-MA treatment (Figure 3E). Similar results were obtained using RAW264.7 cells: when Atg5 expression was knocked-down by siRNA, there was no difference in LM ∆actA growth within WT or G3-KO RAW 264.7 cells (Figure 3F). Collectively, these findings indicate that an enhanced autophagic response restricts LM growth in gal3-deficient macrophages. Galectin-3 suppresses the LM-induced autophagic response in the absence of galectin-8 Galectin-8 was previously shown to promote antibacterial autophagy through binding to host glycans on damaged pathogen-containing vesicles (Thurston et al. 2012). Since complex N-glycans are the major ligands for galectin-3 and galectin-8 (Patnaik et al. 2006), and there are overlaps in the overall sugar-binding profiles of these two galectins (Hirabayashi et al. 2002), we investigated whether galectin-3 suppresses antibacterial autophagy simply by competing for N-glycan ligands with galectin-8. To this end, we generated galectin-8-KO (G8-KO) and galectin-3/galectin-8-double KO (G3/8-DKO) RAW264.7 cell strains using the CRISPR-Cas9 system (Supplementary Figure 3). We compared the colocalization ratio of LC3 with LM ∆actA by immunofluorescent staining, and found that at 1 h post-infection, the percentage of LC3-positive LM ∆actA was significantly higher in G3/8-DKO cells than in G8-KO cells (Figure 4A and 4B). Correspondingly, at 6 h post-infection, we detected significantly reduced LM ∆actA replication in G3/8-DKO cells than in G8-KO cells (Figure 4D). Together, these data clearly show that galectin-3 suppresses antibacterial autophagy even when galectin-8 is absent. Therefore, galectin-3 does not simply compete for glycan ligands with galectin-8, but plays an active role in down-regulating antibacterial autophagy. Fig. 4. View largeDownload slide Galectin-3 suppresses antibacterial autophagy via a host N-glycan-dependent mechanism. (A) Representative confocal micrographs of G8-KO (clone #21) and G3/8-DKO (clone #46) RAW264.7 cells infected with LM ∆actA for 1 h and immuno-stained to detect colocalization of bacteria and LC3. (B) Quantification of the percentages of LC3-positive LM ∆actA in G8-KO and G3/8-DKO RAW264.7 cells at 1 h post-infection. (C) Percentage of LC3-positive LM ∆actA at 1 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells. (D) Fold replication of LM ∆actA at 8 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells, as determined by high-content imaging analysis. Means ± SD of the results obtained from three independent images. *P < 0.05; **P < 0.01; ***P < 0.001 by Student’s t-test. Fig. 4. View largeDownload slide Galectin-3 suppresses antibacterial autophagy via a host N-glycan-dependent mechanism. (A) Representative confocal micrographs of G8-KO (clone #21) and G3/8-DKO (clone #46) RAW264.7 cells infected with LM ∆actA for 1 h and immuno-stained to detect colocalization of bacteria and LC3. (B) Quantification of the percentages of LC3-positive LM ∆actA in G8-KO and G3/8-DKO RAW264.7 cells at 1 h post-infection. (C) Percentage of LC3-positive LM ∆actA at 1 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells. (D) Fold replication of LM ∆actA at 8 h post-infection in control or KIF-treated G8-KO and G3/8-DKO RAW264.7 cells, as determined by high-content imaging analysis. Means ± SD of the results obtained from three independent images. *P < 0.05; **P < 0.01; ***P < 0.001 by Student’s t-test. Host N-glycans are critical for the anti-autophagic function of galectin-3 We further investigated whether the anti-autophagic function of galectin-3 is dependent on interactions between galectin-3 and host N-glycans. KIF treatment led to increased LC3 recruitment to LM ∆actA in G8-KO RAW264.7 cells but not G3/8-DKO cells, and the percentages of LC3-positive LM ∆actA became comparable between G8-KO and G3/8-DKO cells (Figure 4C) suggesting that abrogation of galectin-3-N-glycan binding upregulates the antibacterial autophagic response. Moreover, depletion of complex N-glycans by KIF treatment resulted in decreased LM ∆actA replication in G8-KO cells but not in G3/8-DKO cells (Figure 4D). Similarly, the difference in LM ∆actA growth between G8-KO and G3/8-DKO cells disappeared after KIF treatment. Notably, treatment of macrophages with KIF did not affect cell viability, as determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cytotoxicity assays (data not shown), nor did it affect LM phagosomal escape, as the percentages of F-actin-positive LM WT were comparable between control and KIF-treated J774 cells (data not shown). Polymerization of host actin on the LM surface occurs only when the bacterium has entered the cytoplasm (Bohne et al. 1994). Collectively, these data indicate that host N-glycans are essential for the suppressive effect of galectin-3 on antibacterial autophagy. Sialidase treatment increases galectin-3 recruitment to LM and promotes LM growth by down-regulating antibacterial autophagy As noted above, while galectin-3 and galectin-8 both recognize host N-glycans on damaged pathogen-containing phagosomes, the two exert opposite functions in antibacterial autophagy. Furthermore, even though the overall sugar-binding preference of galectin-8 overlaps with that of galectin-3, there are certain distinctions in the fine specificities of these two molecules (Grigorian et al. 2009; Hirabayashi et al. 2002). For example, the presence of α2-3- and α2-6-linked sialic acid on the terminal galactose of poly-N-acetyllactosamine (poly-LacNAc) chains blocks galectin-3 binding (Zhuo and Bellis 2011). On the other hand, terminal α2,3-sialylation results in much higher affinity for the N-terminal CRD of galectin-8 (Gal-8N) (Hirabayashi et al. 2002; Ideo et al. 2011), which is essential for detecting lysosomal damage (Thurston et al. 2012). Thus, modulation of terminal sialylation on N-glycans may affect the relative binding and accumulation of cytoplasmic galectin-3 and galectin-8 to bacteria-containing damaged phagosomes during infection, and consequently impact the balance of antibacterial autophagic responses. First, we confirmed that treatment of RAW264.7 macrophages with a cocktail of sialidases to remove α2–3, -6, -8, and -9-linked sialic acid residues resulted in a lower amount of structures recognizable by maackia amurensis lectin II (MAL-II), a plant lectin that binds to carbohydrates that contain sialic acid (Figure 5A). On the other hand, the treatment resulted in a higher amount of structures recognizable by recombinant galectin-3 (Figure 5B). Immediately after sialidase treatment, the cells were co-incubated with LM ∆actA for 30 min to allow the bacteria to be phagocytosed. The cells were then washed to remove unbound LM, and gentamicin was added to kill any remaining extracellular bacteria. Therefore, only the glycans present on the cell surface within 30 min after the removal of sialidase were internalized along with the bacteria and become exposed to the cytosol due to phagosome lysis induced by viable LM ∆actA. Sialidase treatment resulted in decreased intracellular galectin-8 recruitment to the vicinity of LM ∆actA in infected WT RAW264.7 cells (Figure 5C) at 1 h post-infection. In G8-KO RAW264.7 cells, after sialidase treatment, the percentage of LM ∆actA that attracted galectin-3 was doubled from 1 h to 4 h (Figure 5D), and the number of LM ∆actA per cell was also doubled at 4 h post-infection (Figure 5E). This indicates that removal of terminal sialic acid residues resulted in increased galectin-3 recruitment to host glycans on damaged phagosomes surrounding LM, leading to increased LM replication. Lastly, we showed that sialidase treatment enhanced galectin-3 recruitment (Figure 5F) and inhibited LC3 recruitment to LM ∆actA within BMMs (Figure 5G). In Gal3–/– BMMs, however, we still observed decreased LC3 recruitment to LM ∆actA after sialidase treatment (Figure 5G), which is in agreement with the notion that the absence of N-glycan sialylation may also decrease LC3 recruitment through galectin-8. Collectively, these data indicate that removal of terminal sialic acids from cell surface N-glycans can result in increased and decreased recruitment of galectin-3 and galectin-8 to damaged LM-containing phagosomes, respectively, thereby down-regulating the antibacterial autophagic response and favoring intracellular LM growth. Fig. 5. View largeDownload slide Sialidase treatment increases galectin-3 recruitment to LM and down-regulates antibacterial autophagy. (A and B) Flow cytometry results for the binding of MAL-II (A) or recombinant human galectin-3 (B) to control of sialidase-treated RAW264.7 cells. The number below the group label denotes geometric mean of fluorescence intensity. (C) Percentage of galectin-8-positive LM ∆actA at 1 h post-infection in control or sialidase-treated RAW264.7 cells. (D and E) Kinetics of the percentage of galectin-3-positive LM ∆actA (D) and the number of LM ∆actA per cell (E) in two different clones of control or sialidase-treated G8-KO RAW264.7 cells. Results were obtained by high-content imaging analysis. Data points represent the values derived from a total of nine image fields and are representative of two independent experiments. (F) Percentage of galectin-3-positive LM ∆actA in mouse gal3+/+ BMMs at 1 h post-infection. (G) Percentage of LC3-positive LM ∆actA in control or sialidase-treated gal3+/+ and gal3–/– BMMs at 1 h post-infection. Means ± SD of the results obtained from three image fields. *P < 0.05; **P < 0.01 by Student’s t-test. Fig. 5. View largeDownload slide Sialidase treatment increases galectin-3 recruitment to LM and down-regulates antibacterial autophagy. (A and B) Flow cytometry results for the binding of MAL-II (A) or recombinant human galectin-3 (B) to control of sialidase-treated RAW264.7 cells. The number below the group label denotes geometric mean of fluorescence intensity. (C) Percentage of galectin-8-positive LM ∆actA at 1 h post-infection in control or sialidase-treated RAW264.7 cells. (D and E) Kinetics of the percentage of galectin-3-positive LM ∆actA (D) and the number of LM ∆actA per cell (E) in two different clones of control or sialidase-treated G8-KO RAW264.7 cells. Results were obtained by high-content imaging analysis. Data points represent the values derived from a total of nine image fields and are representative of two independent experiments. (F) Percentage of galectin-3-positive LM ∆actA in mouse gal3+/+ BMMs at 1 h post-infection. (G) Percentage of LC3-positive LM ∆actA in control or sialidase-treated gal3+/+ and gal3–/– BMMs at 1 h post-infection. Means ± SD of the results obtained from three image fields. *P < 0.05; **P < 0.01 by Student’s t-test. Discussion Phagosomal damage induced by intracellular pathogens results in exposure of luminal glycans to the cytosol, followed by recruitment and accumulation of galectins, such as galectin-3, -8 and -9. In this study, we provide evidence that recruitment of cytosolic galectin-3 to host complex type N-glycans on damaged phagosomes results in suppression of the antibacterial autophagy response, thereby protecting intracellular LM. Importantly and intriguingly, we demonstrated that removal of sialic acids from cell surface glycans led to increased galectin-3 accumulation and decreased galectin-8 accumulation at damaged LM-containing phagosomes, indicating that cytosolic galectins are capable of sensing alterations in glycan structures that occur on the cell surface following phagocytosis and phagosomal membrane damage. Moreover, desialylation of cell surface glycans preceding LM infection resulted in down-regulation of the antibacterial autophagy response, implying that alterations of glycan structure that affect the relative binding affinities of different galectin members can impact the balance of cellular responses they regulate (Figure 6). Fig. 6. View largeDownload slide Alterations in glycan structures may affect the relative affinities of galectin-3 and galectin-8 to glycans on damaged phagosomes and modulate the balance of the autophagic response. During phagocytosis of bacteria, cell surface host glycans are internalized along with the bacteria and are confined within the luminal side of the phagosome. Upon bacteria-induced phagosome damage, host glycans become exposed to the cytosol and are accessible to galectins. Changes in cell surface glycan structures alter the relative binding affinity of galectin-3 and galectin-8 to the glycans following internalization and phagosome damage. As an example, when terminal sialic acids are present on the glycans (without sialidase), galectin-8 has higher affinity towards the glycans than galectin-3 does, leading to a stronger autophagic response. When sialic acids are removed from the glycans (with sialidase), their binding affinity increases towards galectin-3 but decrease towards galectin-8, resulting in a weaker autophagic response. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). Fig. 6. View largeDownload slide Alterations in glycan structures may affect the relative affinities of galectin-3 and galectin-8 to glycans on damaged phagosomes and modulate the balance of the autophagic response. During phagocytosis of bacteria, cell surface host glycans are internalized along with the bacteria and are confined within the luminal side of the phagosome. Upon bacteria-induced phagosome damage, host glycans become exposed to the cytosol and are accessible to galectins. Changes in cell surface glycan structures alter the relative binding affinity of galectin-3 and galectin-8 to the glycans following internalization and phagosome damage. As an example, when terminal sialic acids are present on the glycans (without sialidase), galectin-8 has higher affinity towards the glycans than galectin-3 does, leading to a stronger autophagic response. When sialic acids are removed from the glycans (with sialidase), their binding affinity increases towards galectin-3 but decrease towards galectin-8, resulting in a weaker autophagic response. Monosaccharide symbols follow the SNFG (Symbol Nomenclature for Glycans) system (Varki et al. 2015). Interestingly, the role of galectin-3 in suppressing antibacterial autophagy reported here contrasts with that described for galectin-8. Although most galectins bind to N-acetyllactosamine (LacNAc)-containing structures, each galectin exhibits unique specificities to particular glycan structures (Rabinovich and Toscano 2009). Frontal affinity chromatography analyses revealed that the overall sugar-binding profile of galectin-8 resembles that of galectin-3 (Hirabayashi et al. 2002). Also, both molecules show affinity toward repeated structures of LacNAc, blood group A and B antigens (Stowell et al. 2010), and the antigenic determinant of Providencia alcalifaciens O5 (PA O5) (Stowell et al. 2014). Moreover, both galectin-3 and -8 exhibit particular preferences for certain glycolipid-type glycans (Hirabayashi et al. 2002). However, some distinct features between galectin-3 and galectin-8 exist. For instance, although both galectin-3 and galectin-8 bind to blood group B antigen, only binding of galectin-8 induces direct killing of blood group B-positive bacteria (Stowell et al. 2010). Furthermore, while galectin-8 binds with high affinity to glycosphingolipids, including GM3 and GD1a, galectin-3 exhibits only limited affinity to these molecules (Ideo et al. 2003; Rabinovich and Toscano 2009). The partial overlap in carbohydrate binding specificities between galectin-3 and galectin-8 led us to consider whether galectin-3 inhibits the autophagy response simply by competing for glycan ligands of galectin-8. We clarified this point by demonstrating that galectin-3 actively suppresses antibacterial autophagy, even in the absence of galectin-8, by using G8-KO and G3/8-DKO macrophages. In addition to glycans, galectins can bind to non-glycosylated proteins via-protein–protein interactions. This enables galectins to serve as “signal hubs” that receive information encoded by sugars and relay these signals by interacting with downstream proteins to induce appropriate cellular responses. Galectin-8 promotes autophagy by interacting specifically with NDP52, an autophagy receptor/adaptor protein that binds to LC3. NDP52 also detects ubiquitinated targets (Thurston et al. 2009), and Thurston et al. demonstrated that DNP52 is recruited to Salmonella-containing vesicles in two waves: an early surge mediated by galectin-8 and a late phase dependent on ubiquitin (Thurston et al. 2012). In our study, we also noted that accumulation of galectin-3 at damaged LM-containing phagosomes peaked at 1 h post-infection, and dropped drastically between 2 and 4 h post-infection (Figure 2F and 2G). In contrast, recruitment of ubiquitin and the adaptor protein p62 to damaged phagosomes gradually increased and persisted until the end of our experiment (8 h post-infection; Supplementary Figures 4A,B). The kinetics of galectin-3 and ubiquitin recruitment to damaged LM-containing phagosomes resembled that of galectin-8 and ubiquitin, respectively, as reported by Thurston et al. (2012). During LM infection, p62 and NDP52 are recruited independently to LM (Mostowy et al. 2011). We found that galectin-3 does not affect the recruitment of ubiquitin or p62 to LM (Supplementary Figures 4A and 4B). Moreover, treatment of cells with KIF, which depletes complex N-glycans and abolishes galectin-3 recruitment to LM, had no impact on the recruitment of p62 (Supplementary Figures 4C and 4E) or ubiquitin (Supplementary Figures 4D and 4F) to LM. These results suggest that recognition of LM by ubiquitin and p62 occurs independently of host N-glycans or galectin-3. Thus, galectin-3 does not suppress autophagy via the ubiquitin-p62 pathway. However, whether galectin-3 influences NDP52 recruitment awaits further investigation. Distinct from galectin-8, galectin-3 is a chimeric-type galectin that contains a single CRD fused to an N-terminal non-CRD region composed of proline- and glycine-rich repeating segments. Galectin-3 has been shown to bind to intracellular proteins through protein–protein interactions (Yang et al. 1996). While galectin-3 does not physically interact with either p62 or NDP52 (Thurston et al. 2012), it is possible that after recognition of host N-glycans on damaged phagosomes, the N-terminal domain of galectin-3 binds to other molecules through protein–protein interactions and thereby contributes to the anti-autophagic effect. As carbohydrate-binding proteins, many studies of galectin functions have focused on their extracellular interactions with cell surface glycoproteins and the ensuing signaling cascades induced by galectin–glycan lattice formation (Garner and Baum 2008). However, the predominant localization of galectin in the cytosol suggests that it must play crucial roles intracellularly, and an increasing number of studies have supported this hypothesis. Other research groups showed that galectins can survey the cytosol for the abnormal appearance of complex carbohydrates, which can originate from phagosomes lysed by bacteria (Feeley et al. 2017; Paz et al. 2010; Thurston et al. 2012), endosomes damaged by adenovirus (Maier et al. 2012; Montespan et al. 2017) or calcium phosphate precipitates (Chen et al. 2014), or lysosomes ruptured due to protein aggregates (Jiang et al. 2017), amyloid beta peptide (Oku et al. 2017), or other lysosomotropic compounds (Maejima et al. 2013; Thurston et al. 2012). Thus, galectins are uniquely suited to serve as intracellular danger sensors for cytosolic exposure of glycans induced by infection or cellular stress. Moreover, each respective galectin family member might transduce distinct signals in response to cytosolic glycan exposure. As we demonstrated in the present study, galectin-3 and galectin-8 exert opposing effects on the regulation of antibacterial autophagy during LM infection. In addition, while galectin-3, -8 and -9 are recruited to damaged phagosomes, endosomes and lysosomes, galectin-1 accumulates only at damaged lysosomes, suggesting compartment-specific differences in distribution of galectin ligands (Thurston et al. 2012). This phenomenon also suggests that rupture of different vesicular compartments might lead to different outcomes, depending on the combination of galectins that are recruited. Typically, changes in cell surface glycosylation by extracellular factors such as pathogen-derived sialidase/neuraminidase affects binding between the glycosylated ligand and cell surface lectins such as siglecs, leading to activation or inhibition of signaling events (Crocker et al. 2007). In this study, we proposed a novel concept that alterations to cell surface glycans can directly influence their binding of cytosolic galectins following phagocytosis and phagosome damage. Remarkably, changes in glycan structure alter the relative binding affinity of galectin-3 and galectin-8, and the differential recruitment of galectin-3 and galectin-8 to damaged phagosomes determine the strength of antibacterial autophagy. Our findings underscore how glycans impact cellular responses through intracellular galectins, and how extracellular glycosidases shape the outcome of these responses. Finally, our study highlights the versatility of galectin members as cytosolic sentinels that regulate cell-autonomous immunity. Materials and methods Mice and reagents Gal3–/– mice were generated as described previously (Hsu et al. 2000) and backcrossed to C57BL/6 mice for nine generations. Gal3+/+ and gal3–/– littermates were obtained from gal3+/– breeders, maintained in standard specific-pathogen-free environments, and used at 6–12 weeks of age. All the experiments were approved by the Institutional Animal Care and Use Committee of the University of California, Davis (Sacramento, CA) or Academia Sinica (Taipei, Taiwan). 3-methyladenine (3-MA) was purchased from Merck, while kifunensine and the sialidases (neuraminidases) from Arthrobacter ureafaciens (linkage specificity: α2–3, -6, -8, -9) and Clostridium perfringens (α2–3, -6, -8) were purchased from Sigma. Cell lines and bacterial strains Two mouse macrophage cell lines were used in this study: RAW264.7 (ATCC No. TIB-71) and J774A.1 (ATCC No. TIB-67). RAW264.7 cells were cultured in R10 medium [RPMI 1640 (GibcoTM) supplemented with 20 mM HEPES, non-essential amino acids (NEAA, GibcoTM), and 10% fetal bovine serum (FBS)]. J774A.1 cells were cultured in DMEM medium supplemented with 10% FBS. The LM strains used in this study included 10,403 S (WT strain), DP-L2161, which contains an in-frame deletion of the hly gene (∆hly), and DP-L3078, a strain containing an in-frame deletion of actA (∆actA, ∆7–633). Both mutants were derived from 10,403 S and were obtained from Dr. Daniel Portnoy (Jones and Portnoy 1994; Skoble et al. 2000). Bacteria were cultivated in brain heart infusion (BHI) broth (Becton Dickinson and Company). For storage, LM strains were grown in BHI broth to mid-log and stored as frozen aliquots at –80°C. Generation of knockout cell lines by CRISPR-Cas9 All RNAi reagents, including the pAll-Cas9.pPuro an all-in-one CRISPR/Cas expression system, were obtained from the National RNAi Core Facility at the Institute of Molecular Biology/Genomics Research Center, Academia Sinica, Taiwan. The National RNAi Core Facility is supported by the National Core Facility Program for Biotechnology Grants from the Taiwan National Science Council (NSC; NSC 100-2319-B-001–002). Briefly, cloning of annealed guide oligos into the sgRNA expressing vector (pAll-Cas9.pPuro) was designed as follows: GCACACGCCGGCCCCGAAAC (for Mgat1 KO), TAGCTTAACGATGCCTTAGC (for Lgals3 KO), and ACTTTAACCCTCGGTTCAAA (for Lgals8 KO). To generate the CRISPR/Cas-mediated knockout cell lines, 2 μg of pAll-Cas9.Ppuro-Mgat1, pAll-Cas9.Ppuro-Lgals3, or pAll-Cas9.Ppuro-Lgals8 were transfected into 2 × 106 RAW 264.7 cells using Lipofectamine™ 3000 reagent (Invitrogen), after which cells were subjected to puromycin selection (1.5 μg/ml). The following day, individual cell clones were sorted using a BD FACSAria III cell sorter (Becton Dickinson). Cell clones established using the CRISPR-Cas system were validated by T7 endonuclease I assay and immunoblot analysis for target protein expression (data not shown). Preparation of bone marrow-derived macrophages Mouse BMMs were prepared as previously described (Sano et al. 2003). Briefly, bone marrow harvested from the femurs and tibias of mice were cultured in R10 medium supplemented with 10 ng/mL mouse GM-CSF (Peprotech). After one day of culturing, non-adherent cells were transferred to new petri dishes and cultured for another 6–9 days. Adherent cells were harvested on days 7−11 and plated for subsequent experiments. All cells were cultured under standard conditions: 37°C with 5% CO2. Infection of BMMs with LM and bacterial load assays For infection assays, overnight cultures of LM were diluted 1:5 in fresh BHI broth and grown at 37°C for an additional 1.5 h with shaking to an OD600 of 0.5. Mid-log phase LM were washed with PBS, resuspended in antibiotic-free medium, and added to the BMMs. Plates were then centrifuged at 500 × g for 5 min to promote contact between bacteria and BMMs. The cells were incubated at 37°C for 30 min, washed twice with PBS, and provided fresh R10 medium containing 10 μg/mL gentamicin to kill extracellular bacteria. For detection of viable CFUs, cells were washed with PBS at 30 min, 2 h, 5 h, 24 h, or 48 h post-infection, and lysed by incubation in 100 μL of sterile PBS containing 0.1% TX-100 for 5 min. Lysates were serially diluted in sterile PBS and plated on BHI agar, and colonies were counted after overnight incubation at 37°C. For initial bacterial load assays, in order to monitor the kinetics of bacterial growth within macrophages for a longer period of time (>24 h), cells were infected with a low MOI of 0.25. Sialidase treatments RAW264.7 or BMM cells were plated in 96-well plates at a density of 3 × 104 cells/well in 100 μL R10 medium. The sialidases (neuraminidase) from A. ureafaciens and from C. perfringens were diluted in serum-free RPMI culture medium to a final concentration of 0.3 U/mL. Cells were incubated in serum-free sialidase-containing medium for 1 h at 37°C. Excess sialidase was removed by washing for three times with serum-free RPMI. Immunofluorescence assays BMMs, J774A.1 or RAW264.7 cells were seeded on 12-mm glass coverslips in 24-well culture plates and infected with LM at an MOI of 5. At indicated time points, cells were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.05% saponin, and then blocked with 2.5% casein in HEPES buffered saline (HBS) containing 1% BSA. Cells were stained with primary antibodies overnight at 4°C. After three washes with HBS containing 1% BSA, cells were stained with the appropriate secondary antibodies for 1 h at room temperature (RT), washed three times with HBS containing 1% BSA, and mounted with DAPI Fluoromount-G (SouthernBiotech). Stained cells were visualized using a Carl Zeiss LSM 780 Laser Scanning Confocal Microscope (Oberkochen). Primary antibodies used in this study include: goat anti-human galectin-3 (home-made), mouse-anti-human galectin-8 (MAB1305, R&D Systems), mouse anti-SQSTM1/p62 (Abcam), mouse anti-ubiquitin clone FK2 (Millipore), mouse-anti-LC3 mAb (M152-3; MBL International), and rabbit anti-Listeria antisera (Denka Seiken). High-content imaging analysis Cells were plated in CellCarrier-96 plates (PerkinElmer) at a density of 3 × 104 cells/well in 100 μL culture medium. After the indicated treatment and infection, cells were processed for immunofluorescence staining as described in the Immunofluorescence assays section. Images were acquired and analyzed using the ImageXpress Micro XLS Widefield High-Content Analysis System (Molecular Devices). Live cell imaging with time-lapse microscopy Galectin-3-EGFP-expressing J774 cells were grown on glass coverslips, loaded with 1 μM LysoTracker Red DND-99 (Molecular Probes), and incubated at 37°C for 10 min. Cells were washed twice with PBS, and then incubated with fresh DMEM medium containing 10% FBS. LM from mid-log phase cultures was labeled with BacLight Red bacterial stain (Molecular Probes), according to the manufacturer’s instructions, and resuspended in PBS. Immediately before placing the cells under the microscope, labeled LM were added to the cell culture at an approximate MOI of 100. This high MOI was used to increase the chance of cell-LM contact because we could not centrifuge the apparatus containing the glass coverslip under this experimental setting. Live cell imaging was performed using an UltraVIEW Live Cell Imaging (LCI) Confocal Scanner (PerkinElmer) equipped with an environmental control chamber (37°C, 5% CO2) at 100× magnification. Images were taken at 1-min intervals and analyzed with Volocity software (Improvision, PerkinElmer). Immuno-transmission electron microscopy Gal3+/+ and gal3–/– BMMs were grown in 6-cm petri dishes and infected with LM WT or LM ∆hly at an MOI of 5 for either 30 or 60 min. Cells were then washed twice with PBS, fixed with 4% paraformaldehyde in 0.1 M Sorenson’s phosphate buffer, and collected in Eppendorf tubes for ultrathin cryosectioning. For immunolabeling of galectin-3, samples on gold grids were blocked with 1% fish gelatin in dH2O for 30 min at RT, and incubated overnight at 4°C with 0.2, 0.5 or 1 μg/mL goat anti-human galectin-3 in PBS. After seven washes with PBS, samples were incubated with 10-nm gold-conjugated anti-goat IgG (G-5527; Sigma) diluted 1:50 in PBS, incubated for 1 h at RT, and processed for staining with 4% uranyl acetate in 70% EtOH and lead citrate solution. Samples were analyzed using a Philips CM120 BioTwin Lens (FEI Company) with a Gatan MegaScan model 794/20 2 K × 2 K digital camera. Immunoblot analyses BMMs were infected with LM at an MOI of 5. At 30 min post-infection, cells were washed with PBS twice and incubated in fresh R10 medium supplemented with 10 μg/mL gentamicin. At 6 h and 24 h post-infection, cells were washed with PBS and lysed with RIPA lysis buffer [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2% Triton X-100, 0.5% deoxycholate, and 0.1% SDS] containing a protease inhibitor cocktail (1:100) (Calbiochem, Billerica, MA). Lysates were centrifuged at 14,000 × g for 15 min at 4°C, and the total protein concentrations of the resulting supernatants were measured using a PierceTM BCA protein assay kit (Thermo Scientific, Waltham, MA). Between 10 and 20 μg of total protein were mixed with 6× sample loading buffer and boiled at 95°C for 10 min. Protein samples were then separated by 14% SDS-PAGE, transferred to PVDF membranes, and immunoblotted using rabbit anti-alpha tubulin (Epitomics), rabbit-anti-human galectin-3 and rabbit-anti-LC3A/B (Cell Signaling) antibodies. Flow cytometry For analyses of lectin binding to the cell surface, cells (106/mL) were incubated in PBS containing 2% BSA with 2 μg/mL of FITC-PHA-L (Vector Labs) or 1 μg/mL of FITC-recombinant human galectin-3 for 20 min at 4°C. For MAL-II binding, cells were incubated with 5 μg/mL of biotin-MAL-II for 30 min followed by streptavidin-AL488 for 20 min at 4°C. After washing with PBS containing 2% BSA for three times, cells were analyzed with the Attune NxT flow cytometer (Thermo Fisher Scientific). The data were further analyzed with the FlowJo software. Statistical analysis All experiments were performed at least three times. Statistical analyses were performed using GraphPad Prism software. Statistical significance (P < 0.05) was calculated by unpaired Student’s t-tests. Supplementary data Supplementary data is available at GLYCOBIOLOGY online. Funding This work was supported by grants from Academia Sinica and Ministry of Science and Technology (MOST 104-0210-01-09-02, MOST 105-0210-01-13-01, MOST 106-0210-01-15-02), and Academia Sinica Thematic Project (AS-105-TP-B08). Abbreviations BMM bone marrow-derived macrophage CFU colony-forming unit CRD carbohydrate-recognition domain CRISPR clustered regularly interspaced short palindromic repeats G3-KO galectin-3 knock-out 3-MA 3-methyladenine G8-KO galectin-8 knock-out G3/8-DKO galectin-3/galectin-8-double knock-out Gal galectin GBP guanylate binding protein KIF kifunensine KO knock out LacNAc N-acetyllactosamine LC3 microtubule-associated protein light chain 3 LLO listeriolysin O LM Listeria monocytogenes MAL-II maackia amurensis lectin II Mgat1 mannoside acetylglucosaminyltransferase 1 MOI multiplication of infection MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide NDP52 nuclear dot protein 52 PHA-L phytothemagglutin-L ROS reactive oxygen species TBK1 Tank-binding kinase 1 WT wild-type Acknowledgements We would like to thank Dr. Daniel Portnoy for kindly providing the L. monocytogenes mutant strains. We also thank the staff at the Common Equipment Core Facilities Lab, Institute of Biomedical Sciences, Academia Sinica, Taiwan for their technical assistance. Conflict of interest statement None declared. References Ashida H , Ogawa M , Mimuro H , Kobayashi T , Sanada T , Sasakawa C . 2011 . Shigella are versatile mucosal pathogens that circumvent the host innate immune system . Curr Opin Immunol . 23 : 448 – 455 . Google Scholar CrossRef Search ADS PubMed Barondes SH , Cooper DNW , Gitt MA , Leffler H . 1994 . Galectins . J Biol Chem . 269 : 20807 – 20810 . Google Scholar PubMed Beatty WL , Rhoades ER , Hsu DK , Liu F-T , Russell DG . 2002 . Association of a macrophage galactoside-binding protein with Mycobacterium-containing phagosomes . Cell Microbiol . 4 : 167 – 176 . Google Scholar CrossRef Search ADS PubMed Birmingham CL , Canadien V , Gouin E , Troy EB , Yoshimori T , Cossart P , Higgins DE , Brumell JH . 2007 . Listeria monocytogenes evades killing by autophagy during colonization of host cells . Autophagy . 3 : 442 – 451 . Google Scholar CrossRef Search ADS PubMed Blommaart EFC , Krause U , Schellens JPM , Vreeling-Sindelárová H , Meijer AJ . 1997 . The phosphatidylinositol 3-kinase inhibitors Wortmannin and LY294002 inhibit autophagy in isolated rat hepatocytes . Eur J Biochem . 243 : 240 – 246 . Google Scholar CrossRef Search ADS PubMed Bohne J , Sokolovic Z , Goebel W . 1994 . Transcriptional regulation of prfA and PrfA-regulated virulence genes in Listeria monocytogenes . Mol Microbiol . 11 : 1141 – 1150 . Google Scholar CrossRef Search ADS PubMed Chen X , Khambu B , Zhang H , Gao W , Li M , Chen X , Yoshimori T , Yin X-M . 2014 a. Autophagy induced by calcium phosphate precipitates targets damaged endosomes . J Biol Chem . 289 : 11162 – 11174 . Google Scholar CrossRef Search ADS PubMed Chen W , Stanley P . 2003 . Five Lec1 CHO cell mutants have distinct Mgat1 gene mutations that encode truncated N-acetylglucosaminyltransferase I . Glycobiology . 13 : 43 – 50 . Google Scholar CrossRef Search ADS PubMed Chen H-Y , Weng IC , Hong M-H , Liu F-T . 2014 b. Galectins as bacterial sensors in the host innate response . Curr Opin Microbiol . 17 : 75 – 81 . Google Scholar CrossRef Search ADS PubMed Collins CA , Brown EJ . 2010 . Cytosol as battleground: Ubiquitin as a weapon for both host and pathogen . Trends Cell Biol . 20 : 205 – 213 . Google Scholar CrossRef Search ADS PubMed Crocker PR , Paulson JC , Varki A . 2007 . Siglecs and their roles in the immune system . Nat Rev Immunol . 7 : 255 – 266 . Google Scholar CrossRef Search ADS PubMed Deretic V , Saitoh T , Akira S . 2013 . Autophagy in infection, inflammation and immunity . Nat Rev Immunol . 13 : 722 – 737 . Google Scholar CrossRef Search ADS PubMed Dupont N , Lacas-Gervais S , Bertout J , Paz I , Freche B , Van Nhieu GT , van der Goot FG , Sansonetti PJ , Lafont F . 2009 . Shigella phagocytic vacuolar membrane remnants participate in the cellular response to pathogen invasion and are regulated by autophagy . Cell Host Microbe . 6 : 137 – 149 . Google Scholar CrossRef Search ADS PubMed Elbein AD , Tropea JE , Mitchell M , Kaushal GP . 1990 . Kifunensine, a potent inhibitor of the glycoprotein processing mannosidase I . J Biol Chem . 265 : 15599 – 15605 . Google Scholar PubMed Feeley EM , Pilla-Moffett DM , Zwack EE , Piro AS , Finethy R , Kolb JP , Martinez J , Brodsky IE , Coers J . 2017 . Galectin-3 directs antimicrobial guanylate binding proteins to vacuoles furnished with bacterial secretion systems . Proc Natl Acad Sci U S A . 114 : E1698 – E1706 . Google Scholar CrossRef Search ADS PubMed Fowler M , Thomas RJ , Atherton J , Roberts IS , High NJ . 2006 . Galectin-3 binds to Helicobacter pylori O-antigen: It is upregulated and rapidly secreted by gastric epithelial cells in response to H. pylori adhesion . Cell Microbiol . 8 : 44 – 54 . Google Scholar CrossRef Search ADS PubMed Garner OB , Baum LG . 2008 . Galectin–glycan lattices regulate cell-surface glycoprotein organization and signalling . Biochem Soc Trans . 36 : 1472 – 1477 . Google Scholar CrossRef Search ADS PubMed Grigorian A , Torossian S , Demetriou M . 2009 . T-cell growth, cell surface organization, and the galectin glycoprotein lattice . Immunol Rev . 230 : 232 – 246 . Google Scholar CrossRef Search ADS PubMed Hirabayashi J , Hashidate T , Arata Y , Nishi N , Nakamura T , Hirashima M , Urashima T , Oka T , Futai M , Muller WEG et al. . 2002 . Oligosaccharide specificity of galectins: a search by frontal affinity chromatography . Biochim Biophys Acta (BBA)-Gen Subj . 1572 : 232 – 254 . Google Scholar CrossRef Search ADS Hsu DK , Yang R-Y , Pan Z , Yu L , Salomon DR , Fung-Leung W-P , Liu F-T . 2000 . Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses . Am J Pathol . 156 : 1073 – 1083 . Google Scholar CrossRef Search ADS PubMed Ideo H , Matsuzaka T , Nonaka T , Seko A , Yamashita K . 2011 . Galectin-8-N-domain recognition mechanism for sialylated and sulfated glycans . J Biol Chem . 286 : 11346 – 11355 . Google Scholar CrossRef Search ADS PubMed Ideo H , Seko A , Ishizuka I , Yamashita K . 2003 . The N-terminal carbohydrate recognition domain of galectin-8 recognizes specific glycosphingolipids with high affinity . Glycobiology . 13 : 713 – 723 . Google Scholar CrossRef Search ADS PubMed Jiang P , Gan M , Yen S-H , McLean PJ , Dickson DW . 2017 . Impaired endo-lysosomal membrane integrity accelerates the seeding progression of α-synuclein aggregates . Sci Rep . 7 : 7690 . Google Scholar CrossRef Search ADS PubMed John CM , Jarvis GA , Swanson KV , Leffler H , Cooper MD , Huflejt ME , Griffiss JM . 2002 . Galectin-3 binds lactosaminylated lipooligosaccharides from Neisseria gonorrhoeae and is selectively expressed by mucosal epithelial cells that are infected . Cell Microbiol . 4 : 649 – 662 . Google Scholar CrossRef Search ADS PubMed Jones S , Portnoy DA . 1994 . Characterization of Listeria monocytogenes pathogenesis in a strain expressing perfringolysin O in place of listeriolysin O . Infect Immun . 62 : 5608 – 5613 . Google Scholar PubMed Kohatsu L , Hsu DK , Jegalian AG , Liu FT , Baum LG . 2006 . Galectin-3 induces death of Candida species expressing specific beta-1,2-linked mannans . J Immunol . 177 : 4718 – 4726 . Google Scholar CrossRef Search ADS PubMed Lewis AL , Lewis WG . 2012 . Host sialoglycans and bacterial sialidases: A mucosal perspective . Cell Microbiol . 14 : 1174 – 1182 . Google Scholar CrossRef Search ADS PubMed Liu F-T , Rabinovich GA . 2005 . Galectins as modulators of tumour progression . Nat Rev Cancer . 5 : 29 – 41 . Google Scholar CrossRef Search ADS PubMed Liu F-T , Yang R-Y , Hsu DK . 2012 . Galectins in acute and chronic inflammation . Ann N Y Acad Sci . 1253 : 80 – 91 . Google Scholar CrossRef Search ADS PubMed Maejima I , Takahashi A , Omori H , Kimura T , Takabatake Y , Saitoh T , Yamamoto A , Hamasaki M , Noda T , Isaka Y et al. . 2013 . Autophagy sequesters damaged lysosomes to control lysosomal biogenesis and kidney injury . EMBO J . 32 : 2336 – 2347 . Google Scholar CrossRef Search ADS PubMed Maier O , Marvin SA , Wodrich H , Campbell EM , Wiethoff CM . 2012 . Spatiotemporal dynamics of adenovirus membrane rupture and endosomal escape . J Virol . 86 : 10821 – 10828 . Google Scholar CrossRef Search ADS PubMed Meyer-Morse N , Robbins JR , Rae CS , Mochegova SN , Swanson MS , Zhao Z , Virgin HW , Portnoy D . 2010 . Listeriolysin O is necessary and sufficient to induce autophagy during Listeria monocytogenes infection . PLoS One . 5 : e8610 . Google Scholar CrossRef Search ADS PubMed Mizushima N , Yoshimori T , Levine B . 2010 . Methods in mammalian autophagy research . Cell . 140 : 313 – 326 . Google Scholar CrossRef Search ADS PubMed Montespan C , Marvin SA , Austin S , Burrage AM , Roger B , Rayne F , Faure M , Campell EM , Schneider C , Reimer R et al. . 2017 . Multi-layered control of Galectin-8 mediated autophagy during adenovirus cell entry through a conserved PPxY motif in the viral capsid . PLoS Pathog . 13 : e1006217 . Google Scholar CrossRef Search ADS PubMed Mostowy S , Sancho-Shimizu V , Hamon MA , Simeone R , Brosch R , Johansen T , Cossart P . 2011 . p62 and NDP52 proteins target intracytosolic Shigella and Listeria to different autophagy pathways . J Biol Chem . 286 : 26987 – 26995 . Google Scholar CrossRef Search ADS PubMed Nita-Lazar M , Banerjee A , Feng C , Amin MN , Frieman MB , Chen WH , Cross AS , Wang L-X , Vasta GR . 2015 . Desialylation of airway epithelial cells during influenza virus infection enhances pneumococcal adhesion via galectin binding . Mol Immunol . 65 : 1 – 16 . Google Scholar CrossRef Search ADS PubMed Ohtsubo K , Marth JD . 2006 . Glycosylation in cellular mechanisms of health and disease . Cell . 126 : 855 – 867 . Google Scholar CrossRef Search ADS PubMed Oku Y , Murakami K , Irie K , Hoseki J , Sakai Y . 2017 . Synthesized Aβ42 caused intracellular oxidative damage, leading to cell death, via lysosome rupture . Cell Struct Funct . 42 : 71 – 79 . Google Scholar CrossRef Search ADS PubMed Patnaik SK , Potvin B , Carlsson S , Sturm D , Leffler H , Stanley P . 2006 . Complex N-glycans are the major ligands for galectin-1, -3, and -8 on Chinese hamster ovary cells . Glycobiology . 16 : 305 – 317 . Google Scholar CrossRef Search ADS PubMed Paz I , Sachse M , Dupont N , Mounier J , Cederfur C , Enninga J , Leffler H , Poirier F , Prevost M-C , Lafont F et al. . 2010 . Galectin-3, a marker for vacuole lysis by invasive pathogens . Cell Microbiol . 12 : 530 – 544 . Google Scholar CrossRef Search ADS PubMed Portnoy DA , Auerbuch V , Glomski IJ . 2002 . The cell biology of Listeria monocytogenes infection: The intersection of bacterial pathogenesis and cell-mediated immunity . J Cell Biol . 158 : 409 – 414 . Google Scholar CrossRef Search ADS PubMed Py BF , Lipinski MM , Yuan J . 2007 . Autophagy limits Listeria monocytogenes intracellular growth in the early phase of primary infection . Autophagy . 3 : 117 – 125 . Google Scholar CrossRef Search ADS PubMed Quattroni P , Li Y , Lucchesi D , Lucas S , Hood DW , Herrmann M , Gabius H-J , Tang CM , Exley RM . 2012 . Galectin-3 binds Neisseria meningitidis and increases interaction with phagocytic cells . Cell Microbiol . 14 : 1657 – 1675 . Google Scholar CrossRef Search ADS PubMed Rabinovich GA , Toscano MA . 2009 . Turning ‘sweet’ on immunity: Galectin-glycan interactions in immune tolerance and inflammation . Nat Rev Immunol . 9 : 338 – 352 . Google Scholar CrossRef Search ADS PubMed Sano H , Hsu DK , Apgar JR , Yu L , Sharma BB , Kuwabara I , Izui S , Liu F-T . 2003 . Critical role of galectin-3 in phagocytosis by macrophages . Eur J Clin Invest . 112 : 389 – 397 . Google Scholar CrossRef Search ADS Skoble J , Portnoy DA , Welch MD . 2000 . Three regions within acta promote Arp2/3 complex-mediated actin nucleation and Listeria monocytogenes motility . J Cell Biol . 150 : 527 – 538 . Google Scholar CrossRef Search ADS PubMed Stowell SR , Arthur CM , Dias-Baruffi M , Rodrigues LC , Gourdine J-P , Heimburg-Molinaro J , Ju T , Molinaro RJ , Rivera-Marrero C , Xia B et al. . 2010 . Innate immune lectins kill bacteria expressing blood group antigen . Nat Med . 16 : 295 – 301 . Google Scholar CrossRef Search ADS PubMed Stowell SR , Arthur CM , McBride R , Berger O , Razi N , Heimburg-Molinaro J , Rodrigues LC , Gourdine J-P , Noll AJ , von Gunten S et al. . 2014 . Microbial glycan microarrays define key features of host-microbial interactions . Nat Chem Biol . 10 : 470 – 476 . Google Scholar CrossRef Search ADS PubMed Stowell SR , Arthur CM , Mehta P , Slanina KA , Blixt O , Leffler H , Smith DF , Cummings RD . 2008 . Galectin-1, -2, and -3 exhibit differential recognition of sialylated glycans and blood group antigens . J Biol Chem . 283 : 10109 – 10123 . Google Scholar CrossRef Search ADS PubMed Thurston TLM , Ryzhakov G , Bloor S , von Muhlinen N , Randow F . 2009 . The TBK1 adaptor and autophagy receptor NDP52 restricts the proliferation of ubiquitin-coated bacteria . Nat Immunol . 10 : 1215 – 1221 . Google Scholar CrossRef Search ADS PubMed Thurston TLM , Wandel MP , von Muhlinen N , Foeglein A , Randow F . 2012 . Galectin 8 targets damaged vesicles for autophagy to defend cells against bacterial invasion . Nature . 482 : 414 – 418 . Google Scholar CrossRef Search ADS PubMed Tschopp J , Schroder K . 2010 . NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production? Nat Rev Immunol . 10 : 210 – 215 . Google Scholar CrossRef Search ADS PubMed Vande Velde S. 2013 . The role of viral, bacterial, parasitic and human sialidases in disease. Faculty of Medicine and Health Sciences: Unitersiteit Gent. Varki A , Cummings RD , Aebi M , Packer NH , Seeberger PH , Esko JD , Stanley P , Hart G , Darvill A , Kinoshita T et al. . 2015 . Symbol nomenclature for graphical representations of glycans . Glycobiology . 25 : 1323 – 1324 . Google Scholar CrossRef Search ADS PubMed Varki A , Cummings RD , Esko JD , Freeze HH , Stanley P , Bertozzi CR , Hart GW , Etzler ME , editors . 2009 . Essentials of Glycobiology , 2nd ed . Cold Spring Harbor (NY) : Cold Spring Harbor Laboratory Press . Vasta GR . 2009 . Roles of galectins in infection . Nat Rev Micro . 7 : 424 – 438 . Google Scholar CrossRef Search ADS Vasta GR , Ahmed H , Nita-Lazar M , Banerjee A , Pasek M , Shridhar S , Guha P , Fernandez-Robledo JA . 2012 . Galectins as self/non-self recognition receptors in innate and adaptive immunity: An unresolved paradox . Front Immunol . 3 : 199 . Google Scholar CrossRef Search ADS PubMed Wild P , Farhan H , McEwan DG , Wagner S , Rogov VV , Brady NR , Richter B , Korac J , Waidmann O , Choudhary C et al. . 2011 . Phosphorylation of the autophagy receptor optineurin restricts Salmonella growth . Science . 333 : 228 – 233 . Google Scholar CrossRef Search ADS PubMed Wu Y-T , Tan H-L , Shui G , Bauvy C , Huang Q , Wenk MR , Ong C-N , Codogno P , Shen H-M . 2010 . Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on Class I and III phosphoinositide 3-kinase . J Biol Chem . 285 : 10850 – 10861 . Google Scholar CrossRef Search ADS PubMed Yang RY , Hsu DK , Liu FT . 1996 . Expression of galectin-3 modulates T-cell growth and apoptosis . Proc Natl Acad Sci U S A . 93 : 6737 – 6742 . Google Scholar CrossRef Search ADS PubMed Yang R-Y , Rabinovich GA , Liu F-T . 2008 . Galectins: Structure, function and therapeutic potential . Expert Rev Mol Med . 10 : e17 . Google Scholar CrossRef Search ADS PubMed Yoshikawa Y , Ogawa M , Hain T , Yoshida M , Fukumatsu M , Kim M , Mimuro H , Nakagawa I , Yanagawa T , Ishii T et al. . 2009 . Listeria monocytogenes ActA-mediated escape from autophagic recognition . Nat Cell Biol . 11 : 1233 – 1240 . Google Scholar CrossRef Search ADS PubMed Zheng YT , Shahnazari S , Brech A , Lamark T , Johansen T , Brumell JH . 2009 . The adaptor protein p62/SQSTM1 targets invading bacteria to the autophagy pathway . J Immunol . 183 : 5909 – 5916 . Google Scholar CrossRef Search ADS PubMed Zhuo Y , Bellis SL . 2011 . Emerging role of α2,6-sialic acid as a negative regulator of galectin binding and function . J Biol Chem . 286 : 5935 – 5941 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

GlycobiologyOxford University Press

Published: Feb 23, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off