Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of GSH-related antioxidant enzymes and Nrf2-mediated phase II detoxifying enzyme systems in broiler chickens

Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of GSH-related... Abstract The object of this study was to investigate the effect of curcumin on modulating the glutathione (GSH)-related antioxidant enzymes and antioxidant responses via NF-E2-related factor 2 (Nrf2) signaling pathway in heat-stressed broiler chickens. A total of 400 one-day-old male Arbor Acres broiler chicks was reared in an environmentally controlled room. At 21 d, broiler chicks were divided into 5 treatment groups and were fed one of 4 diets under 2 temperature conditions: 22°C + a basal diet (CON treatment); 34°C for 8 h (0900–1700) + a basal diet supplemented with 0, 50, 100, or 200 mg/kg curcumin (HS, CMN1, CMN2, and CMN3 treatments, respectively). The heat treatment lasted for 20 consecutive days. The results showed that heat stress significantly increased (P < 0.05) the weekly rectal temperature and average head and feet temperature. Compared to the HS treatment, feed conversion was significantly decreased (P < 0.05) in CMN1 and CMN2 treatments. CMN1 administration significantly improved (P < 0.05) the pH24 of muscle. The abnormal changes of serum malonaldehyde and corticosterone concentrations were prevented (P < 0.05) by curcumin. Mitochondrial GSH concentration in the liver was significantly increased (P < 0.05) in CMN1 and CMN2 treatments compared with the HS treatment. The CMN1, CMN2, and CMN3 supplementations significantly increased (P < 0.05) γ-GCL, GSH-Px, and GST activities. Curcumin significantly increased (P < 0.05) the expression of Nrf2, HO-1, and γ-GCLc in the liver as compared to the CON diet. The expression of Cu/ZnSOD and CAT were increased (P < 0.05) by feeding CMN2, respectively, as compared to the HS treatment. It was concluded that curcumin supplementation enhanced the resistance of broilers to heat stress, as evidenced by reversing the FC, increasing the GSH content and GSH-related enzyme activities, and inducing the expression of Nrf2 and Nrf2-mediated phase II detoxifying enzyme genes. INTRODUCTION High temperature has been a subject of serious concern in the poultry industry. Heat stress decreases performance, impairs meat quality, increases mortality, and even leads to depression of the redox system in broiler chickens (Lin et al., 2006; Quinteiro-Filho et al., 2010). Azad et al. (2010) suggested that high temperature resulted in the overproduction of reactive oxygen species (ROS) in birds, which caused an increase in oxidative stress and an imbalance of antioxidant status (Azad et al., 2010). These uncomfortable responses can negatively affect the bird's antioxidant defense system, compromising its antioxidant enzymatic activity and ability to eliminate the excessive oxidative radicals (Huang et al., 2015). Considering the undesirable effects and economic loss caused by heat stress, dietary interference with the use of naturally derived antioxidants is essential. In traditional Indian and Chinese diet, the prevalence of the consumption of the spice turmeric has been associated with a lower incidence of not only various respiratory conditions, but also liver disorders as well as diabetic wounds (Goel et al., 2008). Curcumin is the most active principle isolated from turmeric and has been used to provide its distinctive pharmacological activities, including the antioxidant activity and hepato-protective activity (Anand et al., 2008). In the last few decades, the antioxidant role of curcumin via NF-E2-related factor 2 (Nrf2) activation in the aging process and the treatment of oxidant stress-related diseases is being increasingly acknowledged (Yang et al., 2009; Carmona-Ramirez et al., 2013). As an effective stimulus of Nrf2, curcumin is capable of restoring Nrf2 levels under stress conditions and then upregulating Nrf2-dependent antioxidant and phase II detoxifying enzyme expression (Sahin et al., 2012). Moreover, the mechanisms involved in the antioxidant effect of curcumin have not been entirely explained by the transcription activation of Nrf2. Studies reported that an increased glutathione (GSH) level was commonly observed in curcumin-mediated protection against oxidant stress (Zheng et al., 2007; Banerjee et al., 2008). GSH pool, the major endogenous antioxidant, is directly maintained by the supply and consumption of GSH metabolism in cells. However, little is known about whether the GSH-related antioxidant enzymes and Nrf2-mediated antioxidant defense systems are integrated in the response of curcumin to heat-stress-induced oxidant damage in birds. Our previous study has demonstrated the link between the suppression of growth performance and mitochondrial oxidant damage in heat-stressed birds and curcumin-mediated antioxidant action. Lower malonaldehyde (MDA) and ROS concentrations were paralleled by dietary curcumin administration in association with a compromised oxidative damage (Zhang et al., 2015b). Moreover, curcumin alleviated the oxidant damages and improved the antioxidant defense capacity of the breast muscle through a possible antioxidant way that enhanced its antioxidant enzyme activities (Zhang et al., 2015a). To further elucidate the underlying antioxidant mechanisms, the same heat stress model is used in this study to investigate the effects of curcumin on the stimulation of GSH-related enzyme activities and induction of phase II detoxifying enzyme genes via Nrf2 activation, 2 of the most important pathways to fight against oxidative stress following dietary curcumin supplementation. MATERIALS AND METHODS Preparation of Curcumin The curcumin used in the present study was provided by Kehu Bio-technology Research Center (Guangzhou, China). The content of curcumin was 98% as determined by HPLC analysis (Zhang et al., 2015b). Birds, Experimental Design, and Diet The experimental protocol in the present study were approved by Nanjing Agricultural University Institutional Animal Care and Use Committee, China, and conducted in accordance with the Guidelines for Experimental Animals of the Ministry of Science and Technology (Beijing, P.R. China). A total of 400 one-day-old male Arbor Acres broiler chicks was purchased from a local hatchery (Hefei, China) with initial weights of 42 ± 5 g. During d 1 to 20, all birds were reared in a uniform condition and fed with the basal diet. Birds were kept in wire-floored battery cages, 10 per cage, in a 3-level battery in an environmentally controlled room. Ambient temperature was maintained at 35 ± 1 °C for the first 14 d and gradually decreased as the birds progressed at 21 d of age to ensure a final temperature of 25 ± 1 °C. At 21 d of age, all birds were weighed and randomly allotted to 5 treatments with 8 replicates as follows: 1) CON treatment: normal temperature + a basal diet; 2) HS treatment: high ambient temperature (heat stress) + a basal diet; 3) CMN1 treatment: high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; 4) CMN2 treatment: high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; 5) CMN3 treatment: high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. The weights of the 21-day-old birds in the 5 treatments were not significantly different (P < 0.05). The basal diet (corn-soybean meal) is shown in Table 1 and was formulated to meet nutrient requirements of broilers (NRC, 1994). The temperature scheme is shown in Table 2. The heat treatment lasted for 20 consecutive d, in which birds had free access to mash feed and water and enjoyed a 12-hour light–dark cycle of light regimen. Table 1. Temperature scheme.1   09:00 to 17:00  17:00 to 09:00  Normal temperature  22 ± 1°C  22 ± 1°C  High ambient temperature  34 ± 1°C  22 ± 1°C    09:00 to 17:00  17:00 to 09:00  Normal temperature  22 ± 1°C  22 ± 1°C  High ambient temperature  34 ± 1°C  22 ± 1°C  1Relative humidity of the room ranged from 50 to 60%. View Large Table 2. Ingredient composition and calculated nutrient content of the basal diets.1   1 to 21 d  22 to 42 d  Ingredient (%)       Corn  57.0  61.9   Soybean meal (44.2%, crude protein)  31.3  25.6   Corn gluten meal (60%, crude protein)  3.9  4.3   Soybean oil  3.1  3.8   Dicalcium phosphate  1.8  1.6   Limestone  1.3  1.2   L-lysine  0.15  0.2   DL-methionine  0.15  0.1   Premixa  1  1   Salt  0.3  0.3   Total  100  100  Calculation of nutrients       Metabolizable energy, kcal/kg  3033  3130   Crude protein, %  21.52  19.71   Lysine, %  1.14  1.04   Methionine, %  0.50  0.43   Calcium, %  1.00  0.90   Available phosphorus, %  0.46  0.42   Arginine, %  1.36  1.19   Methionine+Cystine, %  0.85  0.76    1 to 21 d  22 to 42 d  Ingredient (%)       Corn  57.0  61.9   Soybean meal (44.2%, crude protein)  31.3  25.6   Corn gluten meal (60%, crude protein)  3.9  4.3   Soybean oil  3.1  3.8   Dicalcium phosphate  1.8  1.6   Limestone  1.3  1.2   L-lysine  0.15  0.2   DL-methionine  0.15  0.1   Premixa  1  1   Salt  0.3  0.3   Total  100  100  Calculation of nutrients       Metabolizable energy, kcal/kg  3033  3130   Crude protein, %  21.52  19.71   Lysine, %  1.14  1.04   Methionine, %  0.50  0.43   Calcium, %  1.00  0.90   Available phosphorus, %  0.46  0.42   Arginine, %  1.36  1.19   Methionine+Cystine, %  0.85  0.76  1Provided per kg of diet: vitamin A (transretinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3,000 IU; vitamin E (all-rac-α-tocopherol acetate), 30 IU; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 600 mg; calcium pantothenate, 10 mg; pyridoxine•HCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc oxide), 65 mg; I (from calcium iodate), 1.1 mg; and Se (from sodium selenite), 0.3 mg. View Large Sample Collections At 42 d, one bird from each replicate was randomly selected and killed by exsanguination after an overnight fasting. The left part of the breast muscle was immediately excised and stored at 4°C for meat quality analysis. One part of liver tissue was excised, frozen with liquid nitrogen, and stored at −80°C for further analysis. The blood was collected weekly from a wing vein from the first d of the heat stress treatment (d 1, 7, 14, and 21) and then centrifuged at 3,000 × g for 10 min at 4°C to obtain serum. The serum samples were stored at −20°C for analysis. Temperature Profiles One bird per replicate was randomly selected for the weekly temperature measurements following 8 h of heat stress exposure daily. The head and feet temperatures were measured using an infrared thermometer (Fluke TIR1; Everett, Washington), and the rectal temperature was determined by a digital thermometer. All the measurements were carried out in triplicate per bird, and the results were expressed as the average values. Growth Performance Throughout the whole heat stress period, the initial and final body weights (BW) of birds per replicate were recorded. Feed intake of birds per replicate was determined by the difference between feed supplied and left. The mortality of birds was monitored daily. The average daily body weight gain (ADG), average daily feed intake (ADFI), and feed conversion (FC) were calculated per bird and adjusted by the mortality. Organ Weight At 42 d, the right part of the breast muscle, the whole liver, spleen, thymus, and bursa of Fabricius were immediately removed and weighed. The relative weights of these organs were expressed as the percentages of the live weight of birds. Meat Quality The muscle samples were collected from the left side of the breast muscle for meat quality analysis. Physicochemical characteristics of the breast muscle, namely, muscle pH, meat color, and water-holding capacity, were evaluated. The muscle pH was recorded at 45 min and 24 h postmortem (pH45 and pH24), using a portable pH meter (PH-STAR, Mattuas, Germany) equipped with an insertion glass electrode. The measurements were performed in triplicate for each muscle sample. The final result was an average of 3 replicate measurements on each individual muscle sample. The meat color, comprising of lightness (L*), redness (a*), and yellowness (b*) values, was measured using a colorimeter (Minolta CR-10, Konica Minolta Sensing, Osaka, Japan). The measurements were performed in triplicate for each muscle sample and were taken from 3 locations on the surface of each individual sample. Water-holding capacity of the muscle sample was estimated by the measurements of drip loss and cook loss. Drip loss at 24 and 48 h postmortem was measured as previously described. Briefly, the muscle sample, size of 3 cm (length) × 2 cm (width) × 1 cm (thickness), was weighed (W1) and placed in a plastic bag. After hanging in a refrigerator (4°C) for 24 and 48 h, the muscle sample was wiped with absorbent paper and reweighted (W2 and W3, respectively). The drip loss at 24 and 48 h postmortem was calculated using the following equation:   \begin{equation*} {\rm{Drip}}\,{\rm{loss}}\,{\rm{of}}\,24\,{\rm{h}}\left( \% \right) = \left( {{\rm{W}}1 - {\rm{W}}2} \right)/{\rm{W}}1 \times 100 \end{equation*}   \begin{equation*} {\rm{Drip}}\,{\rm{loss}}\,{\rm{of}}\,48\,{\rm{h}}\left( \% \right) = \left( {{\rm{W}}1-{\rm{W}}3} \right)/{\rm{W}}1 \times 100\end{equation*} For the cook loss, the initial weight (W1) of the muscle sample (about 15 ± 1 g) was recorded. Then, the muscle sample was packed in a plastic bag and heated in a boiling water bath at 90°C until the internal temperature reached 75°C. After cooling to 21°C, the final weight (W2) of the muscle sample was recorded. The cook loss was calculated using the following equation:   \begin{equation*}{\rm{Cook}}\,{\rm{loss}}\left( \% \right) = \left( {{\rm{W}}1 - {\rm{W}}2} \right)/{\rm{W}}1 \times 100\end{equation*} Determination of Serum MDA and Corticosterone Serum MDA concentrations weremeasured using a commercial kit purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The result of MDA concentration in serum was expressed as nanomole per milliliter (nmol/mL). The concentration of corticosterone was determined using an enzyme-linked immunosorbent assay kit purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The result of corticosterone content in serum was expressed as nanogram per milliliter (ng/mL). Determination of Mitochondrial GSH-related Antioxidant Enzyme Activities Hepatic mitochondria were isolated by the method of Zhang et al. (2014). Briefly, the liver tissue was homogenized with an ice-cold isolation buffer (pH = 7.4, containing 10 mM trizma hydrochloride, 250 mM sucrose, and 1 mM EDTA) and centrifuged at 800 × g for 5 min at 4°C. Then, the supernatant was centrifuged at 12,000 × g for 15 min at 4°C to collect the mitochondrial pellet. After washing and spinning twice, the mitochondrial pellet was finally resuspended in the ice-cold isolation buffer and subjected to determination of the GSH concentration, γ-glutamylcysteine ligase (γ-GCL), glutathione peroxidase (GSH-Px), glutathione reductase (GR), and glutathione S-transferase (GST) activities using colorimetric methods with a spectrophotometer. All the corresponding diagnostic kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) and used according to the manufacturer's instructions. The protein content for liver tissue was measured by using Coomassie Brilliant Blue. The result of GSH content was expressed as microgram per gram of protein (μg/g protein). The results of γ-GCL, GSH-Px, GR, and GST activities were expressed as units per milligram of protein (U/mg protein). Total RNA Extraction and cDNA Synthesis Total RNA was extracted from liver samples using a commercial Trizol reagent (Takara, Dalian, China) according to the manufacturer's instructions. The RNA purity was determined by a Nanodrop ND-2000c spectrophotometer (Thermo Scientific, Camden, NJ) at an optical OD260 and OD260/OD280 ratio, respectively. The OD260/OD280 ratio of liver samples was in the range of 1.9 and 2.1. Meanwhile, the obtained RNA was subjected to electrophoresis in agarose gel to verify its integrity. The cDNA was synthesized by reverse transcription using the PrimeScript RT Reagent kit (TaKaRa, Dalian, China). Real-time PCR The cDNA was amplified by quantitative real-time PCR in an ABI 7300 Fast Real-Time PCR detection system (Applied Biosystems, Foster City, CA) and using the SYBR Premix Ex Taq II kit (Takara, Dalian, China). The reaction was carried out in triplicate in a 20 μL reaction volume, which contained 2 μL cDNA template, 0.4 μL ROX reference dye (50X), 10 μL SYBR Premix Ex Taq (2X), 0.4 μL each of forward and reverse primers, and 6.8 μL double-distilled H2O. The real-time PCR cycling conditions were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The primer sequences for chicken Nrf2, heme oxygenase 1 (HO-1), copper and zinc superoxide dismutase (Cu/ZnSOD), catalase (CAT), γ-GCLc, γ-GCLm, GSH-Px, and β-actin as a reference gene are shown in Table 3. The mRNA expression level of genes were calculated using the 2−ΔΔCt method and normalized to the value of β-actin. The final result of each target gene expression was expressed as the percentage of the CON treatment. Table 3. Primers used for relative real-time PCR.1 Genes  GeneBank accession no.  Primer sequence (5’→3’)  Product size (bp)  Nrf2  NM_205,117.1  GATGTCACCCTGCCCTTAG  215      CTGCCACCATGTTATTCC    HO-1  HM237181.1  GGTCCCGAATGAATGCCCTTG  138      ACCGTTCTCCTGGCTCTTGG    Cu/ZnSOD  NM_205,064.1  CCGGCTTGTCTGATGGAGAT  124      TGCATCTTTTGGTCCACCGT    CAT  NM_0,010,31215.1  GGTTCGGTGGGGTTGTCTTT  211      CACCAGTGGTCAAGGCATCT    γ-GCLc  XM_419,910.3  TGCGGTTCTGCACAAAATGG  272      TGCTGTGCGATGAATTCCCT    γ-GCLm  NM_0,010,07953.1  CCAGAACGTCAAAGCACACG  187      TCCTCCCATCCCCCAGAAAT    GSH-Px  NM_0,012,77853.1  GACCAACCCGCAGTACATCA  205      GAGGTGCGGGCTTTCCTTTA    β-Actin  NM_205,518  TGCTGTGTTCCCATCTATCG  150      TTGGTGACAATACCGTGTTCA    Genes  GeneBank accession no.  Primer sequence (5’→3’)  Product size (bp)  Nrf2  NM_205,117.1  GATGTCACCCTGCCCTTAG  215      CTGCCACCATGTTATTCC    HO-1  HM237181.1  GGTCCCGAATGAATGCCCTTG  138      ACCGTTCTCCTGGCTCTTGG    Cu/ZnSOD  NM_205,064.1  CCGGCTTGTCTGATGGAGAT  124      TGCATCTTTTGGTCCACCGT    CAT  NM_0,010,31215.1  GGTTCGGTGGGGTTGTCTTT  211      CACCAGTGGTCAAGGCATCT    γ-GCLc  XM_419,910.3  TGCGGTTCTGCACAAAATGG  272      TGCTGTGCGATGAATTCCCT    γ-GCLm  NM_0,010,07953.1  CCAGAACGTCAAAGCACACG  187      TCCTCCCATCCCCCAGAAAT    GSH-Px  NM_0,012,77853.1  GACCAACCCGCAGTACATCA  205      GAGGTGCGGGCTTTCCTTTA    β-Actin  NM_205,518  TGCTGTGTTCCCATCTATCG  150      TTGGTGACAATACCGTGTTCA    1Nrf2 = NF-E2-related factor 2; HO-1 = Heme oxygenase-1; Cu/ZnSOD = Copper and zinc superoxide dismutase; CAT = Catalase; γ-GCLc = catalytic subunit of γ-glutamate cysteine ligase; γ-GCLm = modulatory subunit of γ-glutamate cysteine ligase; GSH-Px = glutathione peroxidase. View Large Statistical Analysis All data were verified to meet assumptions of normality and homogeneity of variance. Data were subjected to one-way ANOVA using SPSS 17.0 for Windows (SPSS Inc., Chicago, IL). Differences between treatment means were tested using Tukey's multiple comparison, and a probability of P < 0.05 was considered statistically significant. RESULTS Temperature Profile The results of the rectal temperature and average surface temperature (heat and feet) in birds challenged by heat stress are shown in Figure 1. As we expected, heat stress significantly increased (P < 0.05) the weekly (on d 1, 7, 14, and 21 of the whole heat stress treatment period) rectal temperature, and average head and feet surface temperature when compared to the CON treatment. Figure 1. View largeDownload slide Effect of heat stress and curcumin on the weekly body surface temperature in broiler chickens during the whole heat exposure period. (A) Infrared image of birds; (B) data of infrared thermometer; (C) average rectal temperature; (D) average head temperature; (E) average feet temperature. The head and feet temperatures were measured using an infrared thermometer, and the rectal temperature was determined by a digital thermometer. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-b) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. Figure 1. View largeDownload slide Effect of heat stress and curcumin on the weekly body surface temperature in broiler chickens during the whole heat exposure period. (A) Infrared image of birds; (B) data of infrared thermometer; (C) average rectal temperature; (D) average head temperature; (E) average feet temperature. The head and feet temperatures were measured using an infrared thermometer, and the rectal temperature was determined by a digital thermometer. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-b) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. Growth Performance The growth performance of birds following the heat stress treatment are shown in Table 4. Birds challenged by heat stress had decreased ADG and increased FC (P < 0.05) when compared with the CON. Compared to the HS treatment, FC was significantly decreased (P < 0.05) in CMN1 and CMN2 treatments. No significant differences were observed (P > 0.05) in ADFI among various treatments. Table 4. Effects of curcumin on the growth performance in heat-stressed broilers.   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  ADFI2 (21 to 42 d, g)  145.36  132.13  130.86  139.07  141.52  2.162  0.156  ADG (21 to 42 d, g)  70.84a  61.72b  62.29b  66.92a,b  67.04a,b  1.057  0.023  FC (g:g)  2.05c  2.14a  2.10a,b  2.08b,c  2.11a,b  0.007  < 0.001    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  ADFI2 (21 to 42 d, g)  145.36  132.13  130.86  139.07  141.52  2.162  0.156  ADG (21 to 42 d, g)  70.84a  61.72b  62.29b  66.92a,b  67.04a,b  1.057  0.023  FC (g:g)  2.05c  2.14a  2.10a,b  2.08b,c  2.11a,b  0.007  < 0.001  a–cMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2ADFI = average daily feed intake; ADG = average daily body weight gain; FC = feed conversion (feed: gain ratio). View Large Organ Weight The final body weight and organ weights of birds are shown in Table 5. The final BW and the weights of breast muscle, liver, and spleen were significantly decreased (P < 0.05) in the HS treatment as compared to the CON treatment. However, the final BW and the absolute and relative weights of breast muscle, liver, spleen, thymus and bursa of Fabricius did not show any significant differences (P > 0.05) between the HS and dietary curcumin treatments. Table 5. Effects of curcumin on the relative organ weights in heat-stressed broilers.   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  Final BW (kg)  2.48a  2.14b  2.33a,b  2.43a,b  2.17b  0.037  0.004   Absolute organ weight (g)                 Breast muscle2  223.05a  170.22b  187.36a,b  191.75a,b  179.51a,b  5.584  0.026   Liver  55.92  47.65  49.37  52.82  51.62  1.085  0.135   Spleen  3.57a  2.46b  3.19a,b  2.92a,b  3.12a,b  0.121  0.052   Thymus  6.66  5.74  6.15  6.31  6.28  1.906  0.924   Bursa of Fabricius  3.37  2.92  2.94  3.10  2.96  0.195  0.953  Relative organ weight (g:kg)                 Breast muscle  89.77  80.75  80.35  79.15  83.16  2.231  0.596   Liver  22.55  22.33  21.14  21.74  23.83  0.396  0.276   Spleen  1.43  1.17  1.37  1.21  1.47  0.057  0.364   Thymus  2.68  2.71  2.64  2.58  2.87  0.120  0.963   Bursa of Fabricius  1.35  1.41  1.27  1.28  1.41  0.092  0.982    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  Final BW (kg)  2.48a  2.14b  2.33a,b  2.43a,b  2.17b  0.037  0.004   Absolute organ weight (g)                 Breast muscle2  223.05a  170.22b  187.36a,b  191.75a,b  179.51a,b  5.584  0.026   Liver  55.92  47.65  49.37  52.82  51.62  1.085  0.135   Spleen  3.57a  2.46b  3.19a,b  2.92a,b  3.12a,b  0.121  0.052   Thymus  6.66  5.74  6.15  6.31  6.28  1.906  0.924   Bursa of Fabricius  3.37  2.92  2.94  3.10  2.96  0.195  0.953  Relative organ weight (g:kg)                 Breast muscle  89.77  80.75  80.35  79.15  83.16  2.231  0.596   Liver  22.55  22.33  21.14  21.74  23.83  0.396  0.276   Spleen  1.43  1.17  1.37  1.21  1.47  0.057  0.364   Thymus  2.68  2.71  2.64  2.58  2.87  0.120  0.963   Bursa of Fabricius  1.35  1.41  1.27  1.28  1.41  0.092  0.982  a–cMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2Weight of the right part of breast muscle was measured and used for the calculation of the relative weight. View Large Meat Quality The results of the breast meat quality among various treatments are shown in Table 6. Heat stress significantly decreased the pH values of the breast muscle at both 45 min and 24 d postmortem (P < 0.05). Moreover, birds challenged by heat stress showed lower values of L*, a* and b*, and greater drip loss of the breast muscle at 24 h postmortem when compared to the CON treatment (P < 0.05). The CMN1 supplementation significantly increased (P < 0.05) the pH24 although had no effect (P > 0.05) on the pH45 of the muscle sample. However, no significant differences were observed in the L*, a*, and b* values and drip loss at 24 h and 48 h, and cook loss of muscle samples between the HS and all 3 CMN treatments (P > 0.05). Table 6. Effects of curcumin on the meat quality of the breast muscle in heat-stressed broilers.   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  pH45  6.05a  5.78b  5.83b  5.85b  5.80b  0.021  < 0.001  pH24  5.89a  5.66c  5.81a,b  5.74b,c  5.74b,c  0.016  < 0.001  L*  44.33a  41.41b  42.92a,b  43.55a,b  43.06a,b  0.275  0.010  a*  4.45a  3.56b  4.36a,b  4.33a,b  3.74a,b  0.108  0.014  b*  13.16a  10.60b  12.20a,b  11.91a,b  12.00a,b  0.276  0.056  Drip loss of 24 h (%)  5.33b  6.66a  5.81a,b  5.63a,b  5.71a,b  0.145  0.041  Drip loss of 48 h (%)  6.91  7.96  7.19  7.20  7.40  0.139  0.167  Cook loss (%)  13.95  16.38  13.84  15.22  15.42  0.357  0.119    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  pH45  6.05a  5.78b  5.83b  5.85b  5.80b  0.021  < 0.001  pH24  5.89a  5.66c  5.81a,b  5.74b,c  5.74b,c  0.016  < 0.001  L*  44.33a  41.41b  42.92a,b  43.55a,b  43.06a,b  0.275  0.010  a*  4.45a  3.56b  4.36a,b  4.33a,b  3.74a,b  0.108  0.014  b*  13.16a  10.60b  12.20a,b  11.91a,b  12.00a,b  0.276  0.056  Drip loss of 24 h (%)  5.33b  6.66a  5.81a,b  5.63a,b  5.71a,b  0.145  0.041  Drip loss of 48 h (%)  6.91  7.96  7.19  7.20  7.40  0.139  0.167  Cook loss (%)  13.95  16.38  13.84  15.22  15.42  0.357  0.119  a–cMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. View Large Serum MDA and Corticosterone Concentrations The results of serum MDA and corticosterone concentrations in broilers are presented in Figure 2. The heat stress challenge caused remarkable increases in serum MDA on d 21 and corticosterone concentrations on d 7, 14, and 21 of the whole heat stress treatment period when compared to the CON treatment (P < 0.05). Compared to the HS treatment, serum MDA concentrations on d 21 were significantly decreased in the CMN2 and CMN3 treatments (P < 0.05). The addition of 3 different curcumin levels to the diet prevented the elevation of serum corticosterone concentrations on d 7, 14, and 21 of the whole heat stress treatment period. Figure 2. View largeDownload slide Effect of curcumin on the serum MDA and corticosterone concentrations in broilers challenged by heat stress. (A) MDA; (B) corticosterone. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-d) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin; MDA = malonaldehyde. Figure 2. View largeDownload slide Effect of curcumin on the serum MDA and corticosterone concentrations in broilers challenged by heat stress. (A) MDA; (B) corticosterone. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-d) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin; MDA = malonaldehyde. Mitochondrial GSH-related Antioxidant Enzyme Activities The results of the GSH concentrations, γ-GCL, GSH-Px, GR, and GST activities in hepatic mitochondria of broilers are presented in Table 7. Birds challenged with heat stress showed decreased GSH concentrations (P < 0.05), as well as decreased γ-GCL, GSH-Px, and GST activities (P < 0.05) in the liver. GSH concentration was significantly increased (P < 0.05) in CMN1 and CMN2 treatments compared with the HS treatment. The CMN1, CMN2, and CMN3 supplementations significantly increased (P < 0.05) γ-GCL, GSH-Px, and GST enzyme activities of the liver. However, no significant differences were observed in GR activity of broilers between the HS and all 3 CMN treatments (P > 0.05). Table 7. Effects of curcumin on the GSH-related antioxidant enzyme activities of hepatic mitochondria in heat-stressed broilers.1   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  GSH2 (μg/g protein)  0.76a  0.63c  0.70b  0.69b  0.65c  0.008  < 0.001  γ-GCL (U/mg protein)  0.28a  0.12e  0.22b  0.15d  0.18c  0.010  < 0.001  GSH-Px (U/mg protein)  9.62a  5.60d  6.50c  8.68b  6.73c  0.242  < 0.001  GR (U/mg protein)  0.27  0.17  0.23  0.25  0.21  0.013  0.134  GST (U/mg protein)  4.75a  3.14d  4.22b  4.23b  3.70c  0.917  < 0.001    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  GSH2 (μg/g protein)  0.76a  0.63c  0.70b  0.69b  0.65c  0.008  < 0.001  γ-GCL (U/mg protein)  0.28a  0.12e  0.22b  0.15d  0.18c  0.010  < 0.001  GSH-Px (U/mg protein)  9.62a  5.60d  6.50c  8.68b  6.73c  0.242  < 0.001  GR (U/mg protein)  0.27  0.17  0.23  0.25  0.21  0.013  0.134  GST (U/mg protein)  4.75a  3.14d  4.22b  4.23b  3.70c  0.917  < 0.001  a–dMeans in the same row without common letters were significantly different (P < 0.05); data are expressed as mean ± SEM, n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2GSH = glutathione; γ-GCL = γ-glutamate cysteine ligase; GSH-Px = glutathione peroxidase; GR = glutathione reductase; GST = glutathione S-transferase. View Large Nrf2 nuclear Transcription Factor and Phase II Antioxidant Enzyme Expression Table 8 shows the expression levels of Nrf2 and phase II antioxidant enzyme genes (including HO-1, Cu/ZnSOD, CAT, γ-GCLc, γ-GCLm, and GPx) in the liver of birds. Compared to the CON treatment, the expression levels of Nrf2 nuclear transcription factor, HO-1, Cu/ZnSOD, CAT, γ-GCLc, γ-GCLm, and GPx genes were significantly decreased (P < 0.05) in response to heat stress challenge. Diets containing different curcumin levels significantly increased (P < 0.05) the expression levels of Nrf2 and HO-1 in the liver as compared to the CON diet. The expression levels of Cu/ZnSOD and CAT in the liver were increased (P < 0.05) in broilers by feeding CMN2, respectively, as compared to the HS treatment. The CMN2 and CMN3 supplementations significantly increased (P < 0.05) the expression levels of γ-GCLc as compared to the HS treatment. When compared to the HS treatment, no significant differences were observed in γ-GCLm or GSH-Px expression levels among the various CMN treatments (P > 0.05). Table 8. Effects of curcumin on the expression of Nrf2 and phase II antioxidant enzyme genes of liver in heat-stressed broilers.1   Treatments1        CON2  HS  CMN1  CMN2  CMN3  SEM  P value  Nrf23  100.00a  83.05c  92.05b  89.46b  89.98b  0.963  < 0.001  HO-1  100.00a  63.97d  83.85b,c  78.91c  90.69a,b  2.278  < 0.001  Cu/ZnSOD  100.00a  69.88c  72.75c  85.57b  72.94c  2.226  < 0.001  CAT  100.00a  41.31d  55.10c  73.60b  58.15c  3.252  < 0.001  γ-GCLc  100.00a  59.40c  65.75c  80.69b  84.76b  2.434  < 0.001  γ-GCLm  100.00a  87.86b  91.71a,b  90.01b  89.48b  1.192  0.006  GSH-Px  100.00a  87.69b  89.84b  91.46b  91.01b  1.052  0.001    Treatments1        CON2  HS  CMN1  CMN2  CMN3  SEM  P value  Nrf23  100.00a  83.05c  92.05b  89.46b  89.98b  0.963  < 0.001  HO-1  100.00a  63.97d  83.85b,c  78.91c  90.69a,b  2.278  < 0.001  Cu/ZnSOD  100.00a  69.88c  72.75c  85.57b  72.94c  2.226  < 0.001  CAT  100.00a  41.31d  55.10c  73.60b  58.15c  3.252  < 0.001  γ-GCLc  100.00a  59.40c  65.75c  80.69b  84.76b  2.434  < 0.001  γ-GCLm  100.00a  87.86b  91.71a,b  90.01b  89.48b  1.192  0.006  GSH-Px  100.00a  87.69b  89.84b  91.46b  91.01b  1.052  0.001  a–dMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2Values of target gene expression were expressed as the percentage of the CON treatment, which were taken as 100%. 3Nrf2 = NF-E2-related factor 2; HO-1 = heme oxygenase-1; Cu/ZnSOD = copper and zinc superoxide dismutase; CAT = catalase; γ-GCLc = catalytic subunit of γ-glutamate cysteine ligase; γ-GCLm = modulatory subunit of γ-glutamate cysteine ligase; GSH-Px = glutathione peroxidase. View Large DISSCUSION High environmental temperature can be a threat to poultry, not only because of the suppressed performance and increased mortality, but also the high incidence of oxidant stress that induces oxidation in serum, muscle, and liver tissue. Body temperature, an indicator of the heat load status, is usually determined to define the response of birds to heat stress and its thermal balance in vivo (Yunianto et al., 1997; Altan et al., 2003). It has been reported earlier that both rectal temperature and body surface temperature have a significant tendency to rise when pigs are challenged by heat stress (Yu et al., 2010). Given the feathers covering broiler chickens, we measured the average head and feet temperature as alternatives to body temperature in the present study. Dynamical changes of both the rectal temperature and body temperature (head and feet) were monitored weekly during the 21-day experimental period, revealing a validated model of heat stress and the occurrence of a physiological response in birds. Growth suppression from high ambient temperature has been well documented in a large number of studies. In this study, birds reared in high temperature (34°C for 8 h) for consecutive 21 d suffered from a higher FC and lower final BW, which were consistent with previous studies (Bottje and Carstens, 2009; Lei et al., 2013). Management manipulations such as air conditioning, genetic improvement, diet manipulation, and feed restriction have been implemented to neutralize the harmful effect of heat stress (Franco-Jimenez and Beck, 2007). In the present study, prior curcumin administration to heat exposure was employed as a low-cost and attractive solution due to its well-known safety feature and antioxidant benefits. Our results showed that curcumin decreased or partially reversed the FC but had no effect on the ADFI as previously reported (Sahin et al., 2012). Nutritional regulation of pre-slaughter through curcumin supplementation brings beneficial effects and provides an attractive avenue for improving meat quality in heat-stressed broilers. Meat quality is often described as the sum of all the meat quality characteristics, and muscular pH has been repeatedly reported as one of the most important quality aspects of meat. Generally, the pH range was classified according to initial pH (pH45) and ultimate pH (pH24) postmortem (England et al., 2014). The pH value of muscle is a direct reflection of glycolysis. At the postmortem storage period, muscle pH is lowered as a result of accumulation of lactic acid during glycolysis. Thus, low glycolytic potentials lead to higher pH24 (Zhang et al., 2011). In the present study, a rapid pH decrease of breast muscle was observed following the heat stress treatment, which was prevented by dietary curcumin administration. We hypothesized that the effect of curcumin on pH was related with glycolysis. On one hand, curcumin may be able to affect the pH values via inhibition of glycolysis. On the other hand, curcumin possibly detoxified the byproducts, such as lactic acid, which also showed a positive effect on the muscle pH. However, as we know, minimal research has been conducted regarding the mechanism of how curcumin affects the pH postmortem of muscle in broilers. The negative effect of heat stress is characterized by the overproduction of cellular ROS and a series of physiological changes in animals. MDA is a major byproduct of lipid peroxidation. The level of serum MDA indirectly indicates the degree of cellular lipid peroxidation and the accumulation of ROS (Yang et al., 2010). In addition to oxidant damage, chronic heat stress treatment also causes impairment of the endocrine system and disturbs the circulating levels of hormones, such as corticosterone (Quinteiro-Filho et al., 2010). Serum corticosterone is a good biological indicator of heat stress response in poultry. Studies showed that high temperature could activate the hypothalamic–pituitary–adrenal axis, resulting in a rapid release of serum corticosterone. In the present study, we measured the fluctuation of serum MDA and corticosterone levels throughout the duration of the 21-day heat stress exposure (Gu et al., 2012). Our results showed that chronic heat stress significantly increased serum MDA and corticosterone concentrations, suggesting the adaptive changes of body response to the environmental stimuli. These findings were consistent with those of Yu et al. (2010) in that heat challenge elevated the circulating levels of corticosterone in Chinese mini pigs (Yu et al., 2010). Nutritional interventions alleviate the negative consequences of heat stress, including the abnormal elevation of serum corticosterone concentrations and excessive lipid peroxidation. Zhou et al. (2010) reported that curcumin provided effective protection against exogenous corticosterone-induced oxidant injury (Zhou et al., 2010). On the other hand, the data from Sahin et al. (2012) showed that a curcumin-supplemented diet visibly depressed the lipid peroxidation in heat-stressed quails (Sahin et al., 2012). In our study, dietary curcumin supplementation prevented the lipid peroxidation and alleviated the elevation of serum corticosterone levels. We assumed it was associated with its strong antioxidant activity and hepato-protective effect (Elagamy, 2010). GSH is the most abundant non-protein thiol compound and functions as the principal non-enzymatic antioxidant in the antioxidant defense system. GSH and GSH-related antioxidant enzymes have been implicated in the maintenance of the intracellular GSH pool by regulating the balance between the supply and consumption of GSH in cells. The endogenic GSH content was supplied 2 ways: 1) de novo GSH synthesis catalyzed by the enzyme γ-GCL; and 2) the turnover of the GSH/GSSG redox cycle in the help of GSH-Px and GR. The consumption of intracellular GSH occurs predominantly through the catalytic reactions with GST. Pharmacological studies demonstrate that the antioxidant properties of curcumin are closely correlated with the intracellular GSH levels. Banerjee et al (2008) showed that GSH content increased in a concentration-dependent manner after incubation with different concentrations of curcumin (Banerjee et al., 2008). The finding with oral curcumin administration pointed out that it reversed the depletion of GSH in experimentally induced liver injury (Naik et al., 2010), which was consist with our data. Although an increase in GSH appears to be a ubiquitous response to curcumin treatment, the underlying mechanisms still need to be established. In our study, curcumin stimulated the enzymatic activity of γ-GCL and induced gene expression of γ-GCLc, which potentially enhanced de novo synthesis of GSH in heat-stressed broilers. γ-GCL, composed of a catalytic (GCLc) and a modifier subunit (GCLm), is a rate-limiting enzyme in de novo synthesis of GSH. Curcumin-mediated induction of both γ-GCLc and γ-GCLm gene expression has been previously reported in rodents and cells (Zheng et al., 2007). A recent study furthermore demonstrated that γ-GCLc gene expression in response to curcumin treatment was regulated prior to that of γ-GCLm (Valentine et al., 2006). Although we failed to determine the induction of γ-GCLm gene expression following curcumin administration in this study, it was assumed that the increase in GSH level with curcumin was at least partially attributed to curcumin-mediated induction of γ-GCLc gene expression and γ-GCL activity, which accelerated the GSH synthesis. Intracellular GSH level is diminished when it is either consumed by the conjugation of GST or by conversion to GSSG by GSH-Px. GST serves several vital functions, including catalyzing the conjugation of GSH with exnobiotics and protecting cells against reactive oxygen metabolites. Evidence has demonstrated that there is a strong association between GST enzyme activity and GSH content in cells. An increase of GST activity is related to a depletion on the GSH since GSH is the main substrate for the conjugation reaction of GST. Studies showed that curcumin was capable of inducing increased activity and gene expression of GST in liver (Valentine et al., 2006; Nishinaka et al., 2007). In the present study, hepatic mitochondrial GST activity was significantly increased by varying levels of curcumin. In line with a previous study, our data showed that the induction of GSH-Px activity in response to curcumin treatment was observed to a significant extent (Singhal et al., 1999). Based on the above results, it is possible that curcumin may have biphasic effects on the GSH metabolism, which both stimulate the GSH synthesis by the increased activity and gene expression of γ-GCL, and up-regulate the consumption of GSH by the induced GSH-Px and GST activities. Nrf-2 is a redox-sensitive nuclear transcription factor that augments cellular defense against oxidative damage. It regulates numerous gene encoding phase II detoxifying enzymes and antioxidant proteins through binding to the antioxidant response element present in their promoters. A variety of natural compounds were found to have cytoprotective effects by evoking the Nrf2 signaling pathway that governs the protective function of phase II detoxification and antioxidant enzymes (Zhao et al., 2010). Curcumin is a potential inducer of Nrf2-regulated phase II detoxifying enzymes (Hsu and Cheng, 2007). Balogun et al. (2003) observed a significant increase in the transcription activity of Nrf2 in cells exposed to various concentrations of curcumin (Balogun et al., 2003). The property of Nrf2 to coordinately activate phase II detoxifying enzymes, including GSH-related enzymes, HO-1, CAT, NOQ1, and Cu/ZnSOD, played a significant role in reducing ROS and decreasing lipid peroxidation and protein oxidation that led to oxidant injury and mitochondrial dysfunction (Cho et al., 2005). To further define the antioxidant role of curcumin in attenuating heat-stress-mediated oxidant damage via Nrf2 activation, we determined hepatic HO-1, CAT, Cu/ZnSOD, and GSH-Px gene expression. HO-1 is the rate-limiting enzyme in heme catabolism and catalyzes the formation of equimolar carbon monoxide, biliverdin, and ferrous iron, which provide an inducible defense system against oxidant stress (Morse et al., 2009). Rats treated with curcumin prior to focal ischemia-induced brain injury had higher gene and protein levels of Nrf2 and HO-1 (Yang et al., 2009). Lastly, curcumin was shown to induce the hepatic HO-1 expression as well as enzyme activity, which was consistent with our data (Cerný et al., 2011). Moreover, curcumin-mediated regulation in the phase II detoxifying system would be expected to be involved in the induction of HO-1, but also NQO1, CAT, Cu/ZnSOD, and GSH-Px expression (Charoensuk et al., 2011; Zhao et al., 2012). Our findings that curcumin up-regulated the mRNA expression of CAT in liver were in line with this notion. However, curcumin did not affect the Cu/ZnSOD or GSH-Px gene expression, although it effectively attenuated hepatic injury via transcriptional activation of Nrf2 in the present study. It was interesting that curcumin exhibited a significant effect on the enzyme activity but not the mRNA expression level of hepatic GSH-Px in the present study. One possible explanation we assumed was that curcumin might increase the GSH-Px activity by the control of its protein expression level, which needs to be identified in further research. These observations suggest that besides its redox-sensitive regulation on GSH-related metabolism, such as the enhanced activity and mRNA expression of GCL, another method of the antioxidant effects of curcumin proceeds by the activation of phase II enzymes through an Nrf2-dependent mechanism. Studies reported that curcumin exhibits both antioxidant/pro-oxidant activity in a concentration-dependent manner. At low concentrations of curcumin, it functions as a strong antioxidant and improves the total antioxidant capacity of tissues (Lee et al., 2010; Sood et al., 2011). At high concentrations, curcumin acted as a pro-oxidant that was capable of inducing cell apoptosis, oxidant damage, and even growth depression (Kawanishi et al., 2005; Sandur et al., 2007; Sahebkar, 2015). In the present study, CMN1 and CMN2 (50 and 100 mg/kg curcumin) supplementations had more pronounced effects on broilers, especially the antioxidant-related parameters. CMN3 (200 mg/kg curcumin) showed a less protective role against heat stress treatment based on the data, although no negative effects have been observed yet. Thus, it was recommended that the inclusion of CMN1 and CMN2 would be an appropriate dose for nutritional manipulation and serve as a potential promising antioxidant in poultry production. CONCLUSION In summary, the results indicated that the heat stress treatment induced the severe oxidant damage of liver, which led to the compromised growth performance and meat quality in birds. Dietary supplementation with curcumin increased the resistance of broilers to heat stress by reversing the FC and activating the antioxidant defense mechanism of liver. These curcumin effects are likely to be one antioxidant mechanism proceeding by induction of GSH-related enzymes and phase II enzyme response via Nrf2 activation. Further research to explicate the antioxidant effects of curcumin in animal production is significant, and curcumin will be taken more into consideration as a potential antioxidant additive for use in poultry. Acknowledgements This work was supported by the Fundamental Research Funds for the Central Universities (No. kjqn201707), National Natural Science Foundation of China (No. 31601973), Natural Science Foundation of Jiangsu Province (No. BK20160739), and China Postdoctoral Science Foundation (2015M581816). REFERENCES Altan Ö., Pabuçcuoğlu A., Altan A., Konyalioğlu S., Bayraktar H.. 2003. Effect of heat stress on oxidative stress, lipid peroxidation and some stress parameters in broilers. Br. Poult. Sci.  44: 545– 550. Google Scholar CrossRef Search ADS PubMed  Anand P., Thomas S. G., Kunnumakkara A. B., Sundaram C., Harikumar K. B., Sung B., Tharakan S. T., Misra K., Priyadarsini I. K., Rajasekharan K. N.. 2008. Biological activities of curcumin and its analogues (Congeners) made by man and Mother Nature. Biochem. Pharmacol . 76: 1590– 1611. Google Scholar CrossRef Search ADS PubMed  Azad M. A., Kikusato M., Maekawa T., Shirakawa H., Toyomizu M.. 2010. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comp. Biochem. Physiol. A Mol. Integr. Physiol.  155: 401– 406. Google Scholar CrossRef Search ADS PubMed  Balogun E., Hoque M., Gong P., Killeen E., Green C. J., Foresti R., Alam J., Motterlini R.. 2003. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-responsive element. Biochem. J.  371: 887– 895. Google Scholar CrossRef Search ADS PubMed  Banerjee A., Kunwar A., Mishra B., Priyadarsini K. I.. 2008. Concentration dependent antioxidant/pro-oxidant activity of curcumin: Studies from AAPH induced hemolysis of RBCs. Chem-Biol. Interact.  174: 134– 139. Google Scholar CrossRef Search ADS PubMed  Bottje W., Carstens G.. 2009. Association of mitochondrial function and feed efficiency in poultry and livestock species. J. Anim. Sci.  87: E48– E63. Google Scholar CrossRef Search ADS PubMed  Carmona-Ramirez I., Santamaria A., Tobon-Velasco J. C., Orozco-Ibarra M., Gonzalez-Herrera I. G., Pedraza-Chaverri J., Maldonado P. D.. 2013. Curcumin restores Nrf2 levels and prevents quinolinic acid-induced neurotoxicity. J. Nutr. Biochem.  24: 14– 24. Google Scholar CrossRef Search ADS PubMed  Cerný D., Lekić N., Váňová K., Muchova L., Hořínek A., Kmoníčková E., Zidek Z., Kamenikova L., Farghali H.. 2011. Hepatoprotective effect of curcumin in lipopolysaccharide/-galactosamine model of liver injury in rats: relationship to HO-1/CO antioxidant system. Fitoterapia  82: 786– 791. Google Scholar CrossRef Search ADS PubMed  Charoensuk L., Pinlaor P., Prakobwong S., Hiraku Y., Laothong U., Ruangjirachuporn W., Yongvanit P., Pinlaor S.. 2011. Curcumin induces a nuclear factor-erythroid 2-related factor 2-driven response against oxidative and nitrative stress after praziquantel treatment in liver fluke-infected hamsters. Int. J. Parasitol.  41: 615– 626. Google Scholar CrossRef Search ADS PubMed  Cho H. Y., Reddy S. P., Debiase A., Yamamoto M., Kleeberger S. R.. 2005. Gene expression profiling of NRF2-mediated protection against oxidative injury. Free Radic. Biol. Med.  38: 325– 343. Google Scholar CrossRef Search ADS PubMed  Elagamy D. S. 2010. Comparative effects of curcumin and resveratrol on aflatoxin B(1)-induced liver injury in rats. Arch. Toxicol.  84: 389– 396. Google Scholar CrossRef Search ADS PubMed  England E. M., Matarneh S. K., Scheffler T. L., Wachet C., Gerrard D. E.. 2014. pH inactivation of phosphofructokinase arrests postmortem glycolysis. Meat Sci . 98: 850– 857. Google Scholar CrossRef Search ADS PubMed  Franco-Jimenez D. J., Beck M. M.. 2007. Physiological changes to transient exposure to heat stress observed in laying hens. Poult. Sci.  86: 538– 544. Google Scholar PubMed  Goel A., Kunnumakkara A. B., Aggarwal B. B.. 2008. Curcumin as “Curecumin”: From kitchen to clinic. Biochem. Pharmacol.  75: 787– 809. Google Scholar CrossRef Search ADS PubMed  Gu X. H., Hao Y., Wang X. L.. 2012. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult. Sci.  91: 790– 799. Google Scholar CrossRef Search ADS PubMed  Hsu C. H., Cheng A. L.. 2007. Clinical studies with curcumin. Adv. Exp. Med. Biol.  595: 471– 480. Google Scholar CrossRef Search ADS PubMed  Huang C., Jiao H., Song Z., Zhao J., Wang X., Lin H.. 2015. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci.  93: 2144– 2153. Google Scholar CrossRef Search ADS PubMed  Kawanishi S., Oikawa S., Murata M.. 2005. Evaluation for safety of antioxidant chemopreventive agents. Antioxid. Redox Sign.  7: 1728. Google Scholar CrossRef Search ADS   Lee J. C., Kinniry P. A., Arguiri E., Serota M., Kanterakis S., Chatterjee S., Solomides C. C., Javvadi P., Koumenis C., Cengel K. A.. 2010. Dietary curcumin increases antioxidant defenses in lung, ameliorates radiation-induced pulmonary fibrosis, and improves survival in mice. Radiat. Res.  173: 590– 601. Google Scholar CrossRef Search ADS PubMed  Lei L., Hepeng L., Xianlei L., Hongchao J., Hai L., Sheikhahmadi A., Yufeng W., Zhigang S.. 2013. Effects of acute heat stress on gene expression of brain-gut neuropeptides in broiler chickens. J. Anim. Sci.  91: 5194– 5201. Google Scholar CrossRef Search ADS PubMed  Lin H., Decuypere E., Buyse J.. 2006. Acute heat stress induces oxidative stress in broiler chickens. Comp. Biochem. Physiol. A Mol. Integr. Physiol.  144: 11– 17. Google Scholar CrossRef Search ADS PubMed  Morse D., Lin L., Choi A. M. K., Ryter S. W.. 2009. Heme oxygenase-1, a critical arbitrator of cell death pathways in lung injury and disease. Free Radic. Biol. Med.  47: 1– 12. Google Scholar CrossRef Search ADS PubMed  Naik S. R., Thakare V. N., Patil S. R.. 2010. Protective effect of curcumin on experimentally induced inflammation, hepatotoxicity and cardiotoxicity in rats: Evidence of its antioxidant property. Exp. Toxicol. Pathol. : 419– 431. National Research Council (NRC). 1994. Nutrient Requirements of Poultry. 9th rev. ed. National Academies Press, Washington, DC. Nishinaka T., Ichijo Y., Ito M., Kimura M., Katsuyama M., Iwata K., Miura T., Terada T., Yabe-Nishimura C.. 2007. Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element. Toxicol. Lett.  170: 238– 247. Google Scholar CrossRef Search ADS PubMed  Quinteiro-Filho W. M., Ribeiro A., Ferraz-de-Paula V., Pinheiro M. L., Sakai M., Sa L. R., Ferreira A. J., Palermo-Neto J.. 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci.  89: 1905– 1914. Google Scholar CrossRef Search ADS PubMed  Sahebkar A. 2015. Dual effect of curcumin in preventing atherosclerosis: The potential role of pro-oxidant-antioxidant mechanisms. Nat. Prod. Res.  29: 491– 492. Google Scholar CrossRef Search ADS PubMed  Sahin K., Orhan C., Tuzcu Z., Tuzcu M., Sahin N.. 2012. Curcumin ameloriates heat stress via inhibition of oxidative stress and modulation of Nrf2/HO-1 pathway in quail. Food Chem. Toxicol.  50: 4035– 4041. Google Scholar CrossRef Search ADS PubMed  Sandur S. K., Ichikawa H., Pandey M. K., Kunnumakkara A. B., Sung B., Sethi G., Aggarwal B. B.. 2007. Role of prooxidants and antioxidants in the anti-inflammatory and apoptotic effects of curcumin (diferuloylmethane). Free Radical Bio. Med.  43: 568. Google Scholar CrossRef Search ADS   Singhal S. S., Awasthi S., Pandya U., Piper J. T., Saini M. K., Cheng J. Z., Awasthi Y. C.. 1999. The effect of curcumin on glutathione-linked enzymes in K562 human leukemia cells. Toxicol. Lett.  109: 87– 95. Google Scholar CrossRef Search ADS PubMed  Sood P. K., Nahar U., Nehru B.. 2011. Curcumin attenuates aluminum-induced oxidative stress and mitochondrial dysfunction in rat brain. Neurotoxicity Res . 20: 351– 361. Google Scholar CrossRef Search ADS   Valentine S. P., Le Nedelec M. J., Menzies A. R., Scandlyn M. J., Goodin M. G., Rosengren R. J.. 2006. Curcumin modulates drug metabolizing enzymes in the female Swiss Webster mouse. Life Sci . 78: 2391– 2398. Google Scholar CrossRef Search ADS PubMed  Yang C., Zhang X., Fan H., Liu Y.. 2009. Curcumin upregulates transcription factor Nrf2, HO-1 expression and protects rat brains against focal ischemia. Brain Res . 1282: 133– 141. Google Scholar CrossRef Search ADS PubMed  Yang L., Tan G. Y., Fu Y. Q., Feng J. H., Zhang M. H.. 2010. Effects of acute heat stress and subsequent stress removal on function of hepatic mitochondrial respiration, ROS production and lipid peroxidation in broiler chickens. Comp. Biochem. Physiol. C Toxicol. Pharmacol.  151: 204– 208. Google Scholar CrossRef Search ADS PubMed  Yu J., Yin P., Liu F., Cheng G., Guo K., Lu A., Zhu X., Luan W., Xu J.. 2010. Effect of heat stress on the porcine small intestine: A morphological and gene expression study. Comp. Biochem. Physiol. A Mol. Integr. Physiol.  156: 119– 128. Google Scholar CrossRef Search ADS PubMed  Yunianto V. D., Hayashit K., Kaiwda S., Ohtsuka A., Tomita Y.. 1997. Effect of environmental temperature on muscle protein turnover and heat production in tube-fed broiler chickens. Br. J. Nutr.  77: 897– 909. Google Scholar CrossRef Search ADS PubMed  Zhang J. F., Xu L., Zhang L. L., Ying Z. X., Su W. P., Wang T.. 2014. Curcumin attenuates D-galactosamine/lipopolysaccharide-induced liver injury and mitochondrial dysfunction in mice. J. Nutr.  144: 1211– 1218. Google Scholar CrossRef Search ADS PubMed  Zhang J., Hu Z., Lu C., Bai K., Zhang L., Tian W.. 2015a. Effect of various levels of dietary curcumin on meat quality and antioxidant profile of breast muscle in broilers. J. Agric. Food Chem.  63. Zhang J. F., Hu Z. P., Lu C. H., Yang M. X., Zhang L. L., Wang T.. 2015b. Dietary curcumin supplementation protects against heat-stress-impaired growth performance of broilers possibly through a mitochondrial pathway. J. Anim. Sci.  93: 1656– 1665. Google Scholar CrossRef Search ADS   Zhang W. H., Gao F., Zhu Q. F., Li C., Jiang Y., Dai S. F., Zhou G. H.. 2011. Dietary sodium butyrate alleviates the oxidative stress induced by corticosterone exposure and improves meat quality in broiler chickens. Poult. Sci.  90: 2592– 2599. Google Scholar CrossRef Search ADS PubMed  Zhao C. R., Gao Z. H., Qu X. J.. 2010. Nrf2-ARE signaling pathway and natural products for cancer chemoprevention. Cancer Epidemiol . 34: 523– 533. Google Scholar CrossRef Search ADS PubMed  Zhao X., Zou Y., Xu H., Fan L., Guo H., Li X., Li G., Zhang X., Dong M.. 2012. Gastrodin protect primary cultured rat hippocampal neurons against amyloid-beta peptide-induced neurotoxicity via ERK1/2-Nrf2 pathway. Brain Res . 1482: 13– 21. Google Scholar CrossRef Search ADS PubMed  Zheng S., Yumei F., Chen A.. 2007. De novo synthesis of glutathione is a prerequisite for curcumin to inhibit hepatic stellate cell (HSC) activation. Free Radic. Biol. Med.  43: 444– 453. Google Scholar CrossRef Search ADS PubMed  Zhou H., Li X., Gao M.. 2010. Curcumin protects PC12 cells from corticosterone-induced cytotoxicity: Possible involvement of the ERK1/2 pathway. Basic Clin. Pharm. Toxicol.  104: 36– 240. © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of GSH-related antioxidant enzymes and Nrf2-mediated phase II detoxifying enzyme systems in broiler chickens

Loading next page...
 
/lp/ou_press/curcumin-attenuates-heat-stress-induced-oxidant-damage-by-simultaneous-2mDuMFmyi5
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex408
Publisher site
See Article on Publisher Site

Abstract

Abstract The object of this study was to investigate the effect of curcumin on modulating the glutathione (GSH)-related antioxidant enzymes and antioxidant responses via NF-E2-related factor 2 (Nrf2) signaling pathway in heat-stressed broiler chickens. A total of 400 one-day-old male Arbor Acres broiler chicks was reared in an environmentally controlled room. At 21 d, broiler chicks were divided into 5 treatment groups and were fed one of 4 diets under 2 temperature conditions: 22°C + a basal diet (CON treatment); 34°C for 8 h (0900–1700) + a basal diet supplemented with 0, 50, 100, or 200 mg/kg curcumin (HS, CMN1, CMN2, and CMN3 treatments, respectively). The heat treatment lasted for 20 consecutive days. The results showed that heat stress significantly increased (P < 0.05) the weekly rectal temperature and average head and feet temperature. Compared to the HS treatment, feed conversion was significantly decreased (P < 0.05) in CMN1 and CMN2 treatments. CMN1 administration significantly improved (P < 0.05) the pH24 of muscle. The abnormal changes of serum malonaldehyde and corticosterone concentrations were prevented (P < 0.05) by curcumin. Mitochondrial GSH concentration in the liver was significantly increased (P < 0.05) in CMN1 and CMN2 treatments compared with the HS treatment. The CMN1, CMN2, and CMN3 supplementations significantly increased (P < 0.05) γ-GCL, GSH-Px, and GST activities. Curcumin significantly increased (P < 0.05) the expression of Nrf2, HO-1, and γ-GCLc in the liver as compared to the CON diet. The expression of Cu/ZnSOD and CAT were increased (P < 0.05) by feeding CMN2, respectively, as compared to the HS treatment. It was concluded that curcumin supplementation enhanced the resistance of broilers to heat stress, as evidenced by reversing the FC, increasing the GSH content and GSH-related enzyme activities, and inducing the expression of Nrf2 and Nrf2-mediated phase II detoxifying enzyme genes. INTRODUCTION High temperature has been a subject of serious concern in the poultry industry. Heat stress decreases performance, impairs meat quality, increases mortality, and even leads to depression of the redox system in broiler chickens (Lin et al., 2006; Quinteiro-Filho et al., 2010). Azad et al. (2010) suggested that high temperature resulted in the overproduction of reactive oxygen species (ROS) in birds, which caused an increase in oxidative stress and an imbalance of antioxidant status (Azad et al., 2010). These uncomfortable responses can negatively affect the bird's antioxidant defense system, compromising its antioxidant enzymatic activity and ability to eliminate the excessive oxidative radicals (Huang et al., 2015). Considering the undesirable effects and economic loss caused by heat stress, dietary interference with the use of naturally derived antioxidants is essential. In traditional Indian and Chinese diet, the prevalence of the consumption of the spice turmeric has been associated with a lower incidence of not only various respiratory conditions, but also liver disorders as well as diabetic wounds (Goel et al., 2008). Curcumin is the most active principle isolated from turmeric and has been used to provide its distinctive pharmacological activities, including the antioxidant activity and hepato-protective activity (Anand et al., 2008). In the last few decades, the antioxidant role of curcumin via NF-E2-related factor 2 (Nrf2) activation in the aging process and the treatment of oxidant stress-related diseases is being increasingly acknowledged (Yang et al., 2009; Carmona-Ramirez et al., 2013). As an effective stimulus of Nrf2, curcumin is capable of restoring Nrf2 levels under stress conditions and then upregulating Nrf2-dependent antioxidant and phase II detoxifying enzyme expression (Sahin et al., 2012). Moreover, the mechanisms involved in the antioxidant effect of curcumin have not been entirely explained by the transcription activation of Nrf2. Studies reported that an increased glutathione (GSH) level was commonly observed in curcumin-mediated protection against oxidant stress (Zheng et al., 2007; Banerjee et al., 2008). GSH pool, the major endogenous antioxidant, is directly maintained by the supply and consumption of GSH metabolism in cells. However, little is known about whether the GSH-related antioxidant enzymes and Nrf2-mediated antioxidant defense systems are integrated in the response of curcumin to heat-stress-induced oxidant damage in birds. Our previous study has demonstrated the link between the suppression of growth performance and mitochondrial oxidant damage in heat-stressed birds and curcumin-mediated antioxidant action. Lower malonaldehyde (MDA) and ROS concentrations were paralleled by dietary curcumin administration in association with a compromised oxidative damage (Zhang et al., 2015b). Moreover, curcumin alleviated the oxidant damages and improved the antioxidant defense capacity of the breast muscle through a possible antioxidant way that enhanced its antioxidant enzyme activities (Zhang et al., 2015a). To further elucidate the underlying antioxidant mechanisms, the same heat stress model is used in this study to investigate the effects of curcumin on the stimulation of GSH-related enzyme activities and induction of phase II detoxifying enzyme genes via Nrf2 activation, 2 of the most important pathways to fight against oxidative stress following dietary curcumin supplementation. MATERIALS AND METHODS Preparation of Curcumin The curcumin used in the present study was provided by Kehu Bio-technology Research Center (Guangzhou, China). The content of curcumin was 98% as determined by HPLC analysis (Zhang et al., 2015b). Birds, Experimental Design, and Diet The experimental protocol in the present study were approved by Nanjing Agricultural University Institutional Animal Care and Use Committee, China, and conducted in accordance with the Guidelines for Experimental Animals of the Ministry of Science and Technology (Beijing, P.R. China). A total of 400 one-day-old male Arbor Acres broiler chicks was purchased from a local hatchery (Hefei, China) with initial weights of 42 ± 5 g. During d 1 to 20, all birds were reared in a uniform condition and fed with the basal diet. Birds were kept in wire-floored battery cages, 10 per cage, in a 3-level battery in an environmentally controlled room. Ambient temperature was maintained at 35 ± 1 °C for the first 14 d and gradually decreased as the birds progressed at 21 d of age to ensure a final temperature of 25 ± 1 °C. At 21 d of age, all birds were weighed and randomly allotted to 5 treatments with 8 replicates as follows: 1) CON treatment: normal temperature + a basal diet; 2) HS treatment: high ambient temperature (heat stress) + a basal diet; 3) CMN1 treatment: high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; 4) CMN2 treatment: high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; 5) CMN3 treatment: high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. The weights of the 21-day-old birds in the 5 treatments were not significantly different (P < 0.05). The basal diet (corn-soybean meal) is shown in Table 1 and was formulated to meet nutrient requirements of broilers (NRC, 1994). The temperature scheme is shown in Table 2. The heat treatment lasted for 20 consecutive d, in which birds had free access to mash feed and water and enjoyed a 12-hour light–dark cycle of light regimen. Table 1. Temperature scheme.1   09:00 to 17:00  17:00 to 09:00  Normal temperature  22 ± 1°C  22 ± 1°C  High ambient temperature  34 ± 1°C  22 ± 1°C    09:00 to 17:00  17:00 to 09:00  Normal temperature  22 ± 1°C  22 ± 1°C  High ambient temperature  34 ± 1°C  22 ± 1°C  1Relative humidity of the room ranged from 50 to 60%. View Large Table 2. Ingredient composition and calculated nutrient content of the basal diets.1   1 to 21 d  22 to 42 d  Ingredient (%)       Corn  57.0  61.9   Soybean meal (44.2%, crude protein)  31.3  25.6   Corn gluten meal (60%, crude protein)  3.9  4.3   Soybean oil  3.1  3.8   Dicalcium phosphate  1.8  1.6   Limestone  1.3  1.2   L-lysine  0.15  0.2   DL-methionine  0.15  0.1   Premixa  1  1   Salt  0.3  0.3   Total  100  100  Calculation of nutrients       Metabolizable energy, kcal/kg  3033  3130   Crude protein, %  21.52  19.71   Lysine, %  1.14  1.04   Methionine, %  0.50  0.43   Calcium, %  1.00  0.90   Available phosphorus, %  0.46  0.42   Arginine, %  1.36  1.19   Methionine+Cystine, %  0.85  0.76    1 to 21 d  22 to 42 d  Ingredient (%)       Corn  57.0  61.9   Soybean meal (44.2%, crude protein)  31.3  25.6   Corn gluten meal (60%, crude protein)  3.9  4.3   Soybean oil  3.1  3.8   Dicalcium phosphate  1.8  1.6   Limestone  1.3  1.2   L-lysine  0.15  0.2   DL-methionine  0.15  0.1   Premixa  1  1   Salt  0.3  0.3   Total  100  100  Calculation of nutrients       Metabolizable energy, kcal/kg  3033  3130   Crude protein, %  21.52  19.71   Lysine, %  1.14  1.04   Methionine, %  0.50  0.43   Calcium, %  1.00  0.90   Available phosphorus, %  0.46  0.42   Arginine, %  1.36  1.19   Methionine+Cystine, %  0.85  0.76  1Provided per kg of diet: vitamin A (transretinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3,000 IU; vitamin E (all-rac-α-tocopherol acetate), 30 IU; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 600 mg; calcium pantothenate, 10 mg; pyridoxine•HCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc oxide), 65 mg; I (from calcium iodate), 1.1 mg; and Se (from sodium selenite), 0.3 mg. View Large Sample Collections At 42 d, one bird from each replicate was randomly selected and killed by exsanguination after an overnight fasting. The left part of the breast muscle was immediately excised and stored at 4°C for meat quality analysis. One part of liver tissue was excised, frozen with liquid nitrogen, and stored at −80°C for further analysis. The blood was collected weekly from a wing vein from the first d of the heat stress treatment (d 1, 7, 14, and 21) and then centrifuged at 3,000 × g for 10 min at 4°C to obtain serum. The serum samples were stored at −20°C for analysis. Temperature Profiles One bird per replicate was randomly selected for the weekly temperature measurements following 8 h of heat stress exposure daily. The head and feet temperatures were measured using an infrared thermometer (Fluke TIR1; Everett, Washington), and the rectal temperature was determined by a digital thermometer. All the measurements were carried out in triplicate per bird, and the results were expressed as the average values. Growth Performance Throughout the whole heat stress period, the initial and final body weights (BW) of birds per replicate were recorded. Feed intake of birds per replicate was determined by the difference between feed supplied and left. The mortality of birds was monitored daily. The average daily body weight gain (ADG), average daily feed intake (ADFI), and feed conversion (FC) were calculated per bird and adjusted by the mortality. Organ Weight At 42 d, the right part of the breast muscle, the whole liver, spleen, thymus, and bursa of Fabricius were immediately removed and weighed. The relative weights of these organs were expressed as the percentages of the live weight of birds. Meat Quality The muscle samples were collected from the left side of the breast muscle for meat quality analysis. Physicochemical characteristics of the breast muscle, namely, muscle pH, meat color, and water-holding capacity, were evaluated. The muscle pH was recorded at 45 min and 24 h postmortem (pH45 and pH24), using a portable pH meter (PH-STAR, Mattuas, Germany) equipped with an insertion glass electrode. The measurements were performed in triplicate for each muscle sample. The final result was an average of 3 replicate measurements on each individual muscle sample. The meat color, comprising of lightness (L*), redness (a*), and yellowness (b*) values, was measured using a colorimeter (Minolta CR-10, Konica Minolta Sensing, Osaka, Japan). The measurements were performed in triplicate for each muscle sample and were taken from 3 locations on the surface of each individual sample. Water-holding capacity of the muscle sample was estimated by the measurements of drip loss and cook loss. Drip loss at 24 and 48 h postmortem was measured as previously described. Briefly, the muscle sample, size of 3 cm (length) × 2 cm (width) × 1 cm (thickness), was weighed (W1) and placed in a plastic bag. After hanging in a refrigerator (4°C) for 24 and 48 h, the muscle sample was wiped with absorbent paper and reweighted (W2 and W3, respectively). The drip loss at 24 and 48 h postmortem was calculated using the following equation:   \begin{equation*} {\rm{Drip}}\,{\rm{loss}}\,{\rm{of}}\,24\,{\rm{h}}\left( \% \right) = \left( {{\rm{W}}1 - {\rm{W}}2} \right)/{\rm{W}}1 \times 100 \end{equation*}   \begin{equation*} {\rm{Drip}}\,{\rm{loss}}\,{\rm{of}}\,48\,{\rm{h}}\left( \% \right) = \left( {{\rm{W}}1-{\rm{W}}3} \right)/{\rm{W}}1 \times 100\end{equation*} For the cook loss, the initial weight (W1) of the muscle sample (about 15 ± 1 g) was recorded. Then, the muscle sample was packed in a plastic bag and heated in a boiling water bath at 90°C until the internal temperature reached 75°C. After cooling to 21°C, the final weight (W2) of the muscle sample was recorded. The cook loss was calculated using the following equation:   \begin{equation*}{\rm{Cook}}\,{\rm{loss}}\left( \% \right) = \left( {{\rm{W}}1 - {\rm{W}}2} \right)/{\rm{W}}1 \times 100\end{equation*} Determination of Serum MDA and Corticosterone Serum MDA concentrations weremeasured using a commercial kit purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The result of MDA concentration in serum was expressed as nanomole per milliliter (nmol/mL). The concentration of corticosterone was determined using an enzyme-linked immunosorbent assay kit purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The result of corticosterone content in serum was expressed as nanogram per milliliter (ng/mL). Determination of Mitochondrial GSH-related Antioxidant Enzyme Activities Hepatic mitochondria were isolated by the method of Zhang et al. (2014). Briefly, the liver tissue was homogenized with an ice-cold isolation buffer (pH = 7.4, containing 10 mM trizma hydrochloride, 250 mM sucrose, and 1 mM EDTA) and centrifuged at 800 × g for 5 min at 4°C. Then, the supernatant was centrifuged at 12,000 × g for 15 min at 4°C to collect the mitochondrial pellet. After washing and spinning twice, the mitochondrial pellet was finally resuspended in the ice-cold isolation buffer and subjected to determination of the GSH concentration, γ-glutamylcysteine ligase (γ-GCL), glutathione peroxidase (GSH-Px), glutathione reductase (GR), and glutathione S-transferase (GST) activities using colorimetric methods with a spectrophotometer. All the corresponding diagnostic kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) and used according to the manufacturer's instructions. The protein content for liver tissue was measured by using Coomassie Brilliant Blue. The result of GSH content was expressed as microgram per gram of protein (μg/g protein). The results of γ-GCL, GSH-Px, GR, and GST activities were expressed as units per milligram of protein (U/mg protein). Total RNA Extraction and cDNA Synthesis Total RNA was extracted from liver samples using a commercial Trizol reagent (Takara, Dalian, China) according to the manufacturer's instructions. The RNA purity was determined by a Nanodrop ND-2000c spectrophotometer (Thermo Scientific, Camden, NJ) at an optical OD260 and OD260/OD280 ratio, respectively. The OD260/OD280 ratio of liver samples was in the range of 1.9 and 2.1. Meanwhile, the obtained RNA was subjected to electrophoresis in agarose gel to verify its integrity. The cDNA was synthesized by reverse transcription using the PrimeScript RT Reagent kit (TaKaRa, Dalian, China). Real-time PCR The cDNA was amplified by quantitative real-time PCR in an ABI 7300 Fast Real-Time PCR detection system (Applied Biosystems, Foster City, CA) and using the SYBR Premix Ex Taq II kit (Takara, Dalian, China). The reaction was carried out in triplicate in a 20 μL reaction volume, which contained 2 μL cDNA template, 0.4 μL ROX reference dye (50X), 10 μL SYBR Premix Ex Taq (2X), 0.4 μL each of forward and reverse primers, and 6.8 μL double-distilled H2O. The real-time PCR cycling conditions were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The primer sequences for chicken Nrf2, heme oxygenase 1 (HO-1), copper and zinc superoxide dismutase (Cu/ZnSOD), catalase (CAT), γ-GCLc, γ-GCLm, GSH-Px, and β-actin as a reference gene are shown in Table 3. The mRNA expression level of genes were calculated using the 2−ΔΔCt method and normalized to the value of β-actin. The final result of each target gene expression was expressed as the percentage of the CON treatment. Table 3. Primers used for relative real-time PCR.1 Genes  GeneBank accession no.  Primer sequence (5’→3’)  Product size (bp)  Nrf2  NM_205,117.1  GATGTCACCCTGCCCTTAG  215      CTGCCACCATGTTATTCC    HO-1  HM237181.1  GGTCCCGAATGAATGCCCTTG  138      ACCGTTCTCCTGGCTCTTGG    Cu/ZnSOD  NM_205,064.1  CCGGCTTGTCTGATGGAGAT  124      TGCATCTTTTGGTCCACCGT    CAT  NM_0,010,31215.1  GGTTCGGTGGGGTTGTCTTT  211      CACCAGTGGTCAAGGCATCT    γ-GCLc  XM_419,910.3  TGCGGTTCTGCACAAAATGG  272      TGCTGTGCGATGAATTCCCT    γ-GCLm  NM_0,010,07953.1  CCAGAACGTCAAAGCACACG  187      TCCTCCCATCCCCCAGAAAT    GSH-Px  NM_0,012,77853.1  GACCAACCCGCAGTACATCA  205      GAGGTGCGGGCTTTCCTTTA    β-Actin  NM_205,518  TGCTGTGTTCCCATCTATCG  150      TTGGTGACAATACCGTGTTCA    Genes  GeneBank accession no.  Primer sequence (5’→3’)  Product size (bp)  Nrf2  NM_205,117.1  GATGTCACCCTGCCCTTAG  215      CTGCCACCATGTTATTCC    HO-1  HM237181.1  GGTCCCGAATGAATGCCCTTG  138      ACCGTTCTCCTGGCTCTTGG    Cu/ZnSOD  NM_205,064.1  CCGGCTTGTCTGATGGAGAT  124      TGCATCTTTTGGTCCACCGT    CAT  NM_0,010,31215.1  GGTTCGGTGGGGTTGTCTTT  211      CACCAGTGGTCAAGGCATCT    γ-GCLc  XM_419,910.3  TGCGGTTCTGCACAAAATGG  272      TGCTGTGCGATGAATTCCCT    γ-GCLm  NM_0,010,07953.1  CCAGAACGTCAAAGCACACG  187      TCCTCCCATCCCCCAGAAAT    GSH-Px  NM_0,012,77853.1  GACCAACCCGCAGTACATCA  205      GAGGTGCGGGCTTTCCTTTA    β-Actin  NM_205,518  TGCTGTGTTCCCATCTATCG  150      TTGGTGACAATACCGTGTTCA    1Nrf2 = NF-E2-related factor 2; HO-1 = Heme oxygenase-1; Cu/ZnSOD = Copper and zinc superoxide dismutase; CAT = Catalase; γ-GCLc = catalytic subunit of γ-glutamate cysteine ligase; γ-GCLm = modulatory subunit of γ-glutamate cysteine ligase; GSH-Px = glutathione peroxidase. View Large Statistical Analysis All data were verified to meet assumptions of normality and homogeneity of variance. Data were subjected to one-way ANOVA using SPSS 17.0 for Windows (SPSS Inc., Chicago, IL). Differences between treatment means were tested using Tukey's multiple comparison, and a probability of P < 0.05 was considered statistically significant. RESULTS Temperature Profile The results of the rectal temperature and average surface temperature (heat and feet) in birds challenged by heat stress are shown in Figure 1. As we expected, heat stress significantly increased (P < 0.05) the weekly (on d 1, 7, 14, and 21 of the whole heat stress treatment period) rectal temperature, and average head and feet surface temperature when compared to the CON treatment. Figure 1. View largeDownload slide Effect of heat stress and curcumin on the weekly body surface temperature in broiler chickens during the whole heat exposure period. (A) Infrared image of birds; (B) data of infrared thermometer; (C) average rectal temperature; (D) average head temperature; (E) average feet temperature. The head and feet temperatures were measured using an infrared thermometer, and the rectal temperature was determined by a digital thermometer. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-b) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. Figure 1. View largeDownload slide Effect of heat stress and curcumin on the weekly body surface temperature in broiler chickens during the whole heat exposure period. (A) Infrared image of birds; (B) data of infrared thermometer; (C) average rectal temperature; (D) average head temperature; (E) average feet temperature. The head and feet temperatures were measured using an infrared thermometer, and the rectal temperature was determined by a digital thermometer. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-b) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. Growth Performance The growth performance of birds following the heat stress treatment are shown in Table 4. Birds challenged by heat stress had decreased ADG and increased FC (P < 0.05) when compared with the CON. Compared to the HS treatment, FC was significantly decreased (P < 0.05) in CMN1 and CMN2 treatments. No significant differences were observed (P > 0.05) in ADFI among various treatments. Table 4. Effects of curcumin on the growth performance in heat-stressed broilers.   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  ADFI2 (21 to 42 d, g)  145.36  132.13  130.86  139.07  141.52  2.162  0.156  ADG (21 to 42 d, g)  70.84a  61.72b  62.29b  66.92a,b  67.04a,b  1.057  0.023  FC (g:g)  2.05c  2.14a  2.10a,b  2.08b,c  2.11a,b  0.007  < 0.001    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  ADFI2 (21 to 42 d, g)  145.36  132.13  130.86  139.07  141.52  2.162  0.156  ADG (21 to 42 d, g)  70.84a  61.72b  62.29b  66.92a,b  67.04a,b  1.057  0.023  FC (g:g)  2.05c  2.14a  2.10a,b  2.08b,c  2.11a,b  0.007  < 0.001  a–cMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2ADFI = average daily feed intake; ADG = average daily body weight gain; FC = feed conversion (feed: gain ratio). View Large Organ Weight The final body weight and organ weights of birds are shown in Table 5. The final BW and the weights of breast muscle, liver, and spleen were significantly decreased (P < 0.05) in the HS treatment as compared to the CON treatment. However, the final BW and the absolute and relative weights of breast muscle, liver, spleen, thymus and bursa of Fabricius did not show any significant differences (P > 0.05) between the HS and dietary curcumin treatments. Table 5. Effects of curcumin on the relative organ weights in heat-stressed broilers.   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  Final BW (kg)  2.48a  2.14b  2.33a,b  2.43a,b  2.17b  0.037  0.004   Absolute organ weight (g)                 Breast muscle2  223.05a  170.22b  187.36a,b  191.75a,b  179.51a,b  5.584  0.026   Liver  55.92  47.65  49.37  52.82  51.62  1.085  0.135   Spleen  3.57a  2.46b  3.19a,b  2.92a,b  3.12a,b  0.121  0.052   Thymus  6.66  5.74  6.15  6.31  6.28  1.906  0.924   Bursa of Fabricius  3.37  2.92  2.94  3.10  2.96  0.195  0.953  Relative organ weight (g:kg)                 Breast muscle  89.77  80.75  80.35  79.15  83.16  2.231  0.596   Liver  22.55  22.33  21.14  21.74  23.83  0.396  0.276   Spleen  1.43  1.17  1.37  1.21  1.47  0.057  0.364   Thymus  2.68  2.71  2.64  2.58  2.87  0.120  0.963   Bursa of Fabricius  1.35  1.41  1.27  1.28  1.41  0.092  0.982    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  Final BW (kg)  2.48a  2.14b  2.33a,b  2.43a,b  2.17b  0.037  0.004   Absolute organ weight (g)                 Breast muscle2  223.05a  170.22b  187.36a,b  191.75a,b  179.51a,b  5.584  0.026   Liver  55.92  47.65  49.37  52.82  51.62  1.085  0.135   Spleen  3.57a  2.46b  3.19a,b  2.92a,b  3.12a,b  0.121  0.052   Thymus  6.66  5.74  6.15  6.31  6.28  1.906  0.924   Bursa of Fabricius  3.37  2.92  2.94  3.10  2.96  0.195  0.953  Relative organ weight (g:kg)                 Breast muscle  89.77  80.75  80.35  79.15  83.16  2.231  0.596   Liver  22.55  22.33  21.14  21.74  23.83  0.396  0.276   Spleen  1.43  1.17  1.37  1.21  1.47  0.057  0.364   Thymus  2.68  2.71  2.64  2.58  2.87  0.120  0.963   Bursa of Fabricius  1.35  1.41  1.27  1.28  1.41  0.092  0.982  a–cMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2Weight of the right part of breast muscle was measured and used for the calculation of the relative weight. View Large Meat Quality The results of the breast meat quality among various treatments are shown in Table 6. Heat stress significantly decreased the pH values of the breast muscle at both 45 min and 24 d postmortem (P < 0.05). Moreover, birds challenged by heat stress showed lower values of L*, a* and b*, and greater drip loss of the breast muscle at 24 h postmortem when compared to the CON treatment (P < 0.05). The CMN1 supplementation significantly increased (P < 0.05) the pH24 although had no effect (P > 0.05) on the pH45 of the muscle sample. However, no significant differences were observed in the L*, a*, and b* values and drip loss at 24 h and 48 h, and cook loss of muscle samples between the HS and all 3 CMN treatments (P > 0.05). Table 6. Effects of curcumin on the meat quality of the breast muscle in heat-stressed broilers.   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  pH45  6.05a  5.78b  5.83b  5.85b  5.80b  0.021  < 0.001  pH24  5.89a  5.66c  5.81a,b  5.74b,c  5.74b,c  0.016  < 0.001  L*  44.33a  41.41b  42.92a,b  43.55a,b  43.06a,b  0.275  0.010  a*  4.45a  3.56b  4.36a,b  4.33a,b  3.74a,b  0.108  0.014  b*  13.16a  10.60b  12.20a,b  11.91a,b  12.00a,b  0.276  0.056  Drip loss of 24 h (%)  5.33b  6.66a  5.81a,b  5.63a,b  5.71a,b  0.145  0.041  Drip loss of 48 h (%)  6.91  7.96  7.19  7.20  7.40  0.139  0.167  Cook loss (%)  13.95  16.38  13.84  15.22  15.42  0.357  0.119    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  pH45  6.05a  5.78b  5.83b  5.85b  5.80b  0.021  < 0.001  pH24  5.89a  5.66c  5.81a,b  5.74b,c  5.74b,c  0.016  < 0.001  L*  44.33a  41.41b  42.92a,b  43.55a,b  43.06a,b  0.275  0.010  a*  4.45a  3.56b  4.36a,b  4.33a,b  3.74a,b  0.108  0.014  b*  13.16a  10.60b  12.20a,b  11.91a,b  12.00a,b  0.276  0.056  Drip loss of 24 h (%)  5.33b  6.66a  5.81a,b  5.63a,b  5.71a,b  0.145  0.041  Drip loss of 48 h (%)  6.91  7.96  7.19  7.20  7.40  0.139  0.167  Cook loss (%)  13.95  16.38  13.84  15.22  15.42  0.357  0.119  a–cMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. View Large Serum MDA and Corticosterone Concentrations The results of serum MDA and corticosterone concentrations in broilers are presented in Figure 2. The heat stress challenge caused remarkable increases in serum MDA on d 21 and corticosterone concentrations on d 7, 14, and 21 of the whole heat stress treatment period when compared to the CON treatment (P < 0.05). Compared to the HS treatment, serum MDA concentrations on d 21 were significantly decreased in the CMN2 and CMN3 treatments (P < 0.05). The addition of 3 different curcumin levels to the diet prevented the elevation of serum corticosterone concentrations on d 7, 14, and 21 of the whole heat stress treatment period. Figure 2. View largeDownload slide Effect of curcumin on the serum MDA and corticosterone concentrations in broilers challenged by heat stress. (A) MDA; (B) corticosterone. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-d) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin; MDA = malonaldehyde. Figure 2. View largeDownload slide Effect of curcumin on the serum MDA and corticosterone concentrations in broilers challenged by heat stress. (A) MDA; (B) corticosterone. Each bar represents the mean ± SEM (n = 8). Bars not sharing the same letters (a-d) are significantly different according to Tukey's multiple comparison test at P < 0.05. CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin; MDA = malonaldehyde. Mitochondrial GSH-related Antioxidant Enzyme Activities The results of the GSH concentrations, γ-GCL, GSH-Px, GR, and GST activities in hepatic mitochondria of broilers are presented in Table 7. Birds challenged with heat stress showed decreased GSH concentrations (P < 0.05), as well as decreased γ-GCL, GSH-Px, and GST activities (P < 0.05) in the liver. GSH concentration was significantly increased (P < 0.05) in CMN1 and CMN2 treatments compared with the HS treatment. The CMN1, CMN2, and CMN3 supplementations significantly increased (P < 0.05) γ-GCL, GSH-Px, and GST enzyme activities of the liver. However, no significant differences were observed in GR activity of broilers between the HS and all 3 CMN treatments (P > 0.05). Table 7. Effects of curcumin on the GSH-related antioxidant enzyme activities of hepatic mitochondria in heat-stressed broilers.1   Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  GSH2 (μg/g protein)  0.76a  0.63c  0.70b  0.69b  0.65c  0.008  < 0.001  γ-GCL (U/mg protein)  0.28a  0.12e  0.22b  0.15d  0.18c  0.010  < 0.001  GSH-Px (U/mg protein)  9.62a  5.60d  6.50c  8.68b  6.73c  0.242  < 0.001  GR (U/mg protein)  0.27  0.17  0.23  0.25  0.21  0.013  0.134  GST (U/mg protein)  4.75a  3.14d  4.22b  4.23b  3.70c  0.917  < 0.001    Treatments1        CON  HS  CMN1  CMN2  CMN3  SEM  P-value  GSH2 (μg/g protein)  0.76a  0.63c  0.70b  0.69b  0.65c  0.008  < 0.001  γ-GCL (U/mg protein)  0.28a  0.12e  0.22b  0.15d  0.18c  0.010  < 0.001  GSH-Px (U/mg protein)  9.62a  5.60d  6.50c  8.68b  6.73c  0.242  < 0.001  GR (U/mg protein)  0.27  0.17  0.23  0.25  0.21  0.013  0.134  GST (U/mg protein)  4.75a  3.14d  4.22b  4.23b  3.70c  0.917  < 0.001  a–dMeans in the same row without common letters were significantly different (P < 0.05); data are expressed as mean ± SEM, n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2GSH = glutathione; γ-GCL = γ-glutamate cysteine ligase; GSH-Px = glutathione peroxidase; GR = glutathione reductase; GST = glutathione S-transferase. View Large Nrf2 nuclear Transcription Factor and Phase II Antioxidant Enzyme Expression Table 8 shows the expression levels of Nrf2 and phase II antioxidant enzyme genes (including HO-1, Cu/ZnSOD, CAT, γ-GCLc, γ-GCLm, and GPx) in the liver of birds. Compared to the CON treatment, the expression levels of Nrf2 nuclear transcription factor, HO-1, Cu/ZnSOD, CAT, γ-GCLc, γ-GCLm, and GPx genes were significantly decreased (P < 0.05) in response to heat stress challenge. Diets containing different curcumin levels significantly increased (P < 0.05) the expression levels of Nrf2 and HO-1 in the liver as compared to the CON diet. The expression levels of Cu/ZnSOD and CAT in the liver were increased (P < 0.05) in broilers by feeding CMN2, respectively, as compared to the HS treatment. The CMN2 and CMN3 supplementations significantly increased (P < 0.05) the expression levels of γ-GCLc as compared to the HS treatment. When compared to the HS treatment, no significant differences were observed in γ-GCLm or GSH-Px expression levels among the various CMN treatments (P > 0.05). Table 8. Effects of curcumin on the expression of Nrf2 and phase II antioxidant enzyme genes of liver in heat-stressed broilers.1   Treatments1        CON2  HS  CMN1  CMN2  CMN3  SEM  P value  Nrf23  100.00a  83.05c  92.05b  89.46b  89.98b  0.963  < 0.001  HO-1  100.00a  63.97d  83.85b,c  78.91c  90.69a,b  2.278  < 0.001  Cu/ZnSOD  100.00a  69.88c  72.75c  85.57b  72.94c  2.226  < 0.001  CAT  100.00a  41.31d  55.10c  73.60b  58.15c  3.252  < 0.001  γ-GCLc  100.00a  59.40c  65.75c  80.69b  84.76b  2.434  < 0.001  γ-GCLm  100.00a  87.86b  91.71a,b  90.01b  89.48b  1.192  0.006  GSH-Px  100.00a  87.69b  89.84b  91.46b  91.01b  1.052  0.001    Treatments1        CON2  HS  CMN1  CMN2  CMN3  SEM  P value  Nrf23  100.00a  83.05c  92.05b  89.46b  89.98b  0.963  < 0.001  HO-1  100.00a  63.97d  83.85b,c  78.91c  90.69a,b  2.278  < 0.001  Cu/ZnSOD  100.00a  69.88c  72.75c  85.57b  72.94c  2.226  < 0.001  CAT  100.00a  41.31d  55.10c  73.60b  58.15c  3.252  < 0.001  γ-GCLc  100.00a  59.40c  65.75c  80.69b  84.76b  2.434  < 0.001  γ-GCLm  100.00a  87.86b  91.71a,b  90.01b  89.48b  1.192  0.006  GSH-Px  100.00a  87.69b  89.84b  91.46b  91.01b  1.052  0.001  a–dMeans in the same row without common letters were significantly different (P < 0.05); n = 8. 1CON = normal temperature + a basal diet; HS = high ambient temperature + a basal diet; CMN1 = high ambient temperature + a basal diet supplemented with 50 mg/kg curcumin; CMN2 = high ambient temperature + a basal diet supplemented with 100 mg/kg curcumin; CMN3 = high ambient temperature + a basal diet supplemented with 200 mg/kg curcumin. 2Values of target gene expression were expressed as the percentage of the CON treatment, which were taken as 100%. 3Nrf2 = NF-E2-related factor 2; HO-1 = heme oxygenase-1; Cu/ZnSOD = copper and zinc superoxide dismutase; CAT = catalase; γ-GCLc = catalytic subunit of γ-glutamate cysteine ligase; γ-GCLm = modulatory subunit of γ-glutamate cysteine ligase; GSH-Px = glutathione peroxidase. View Large DISSCUSION High environmental temperature can be a threat to poultry, not only because of the suppressed performance and increased mortality, but also the high incidence of oxidant stress that induces oxidation in serum, muscle, and liver tissue. Body temperature, an indicator of the heat load status, is usually determined to define the response of birds to heat stress and its thermal balance in vivo (Yunianto et al., 1997; Altan et al., 2003). It has been reported earlier that both rectal temperature and body surface temperature have a significant tendency to rise when pigs are challenged by heat stress (Yu et al., 2010). Given the feathers covering broiler chickens, we measured the average head and feet temperature as alternatives to body temperature in the present study. Dynamical changes of both the rectal temperature and body temperature (head and feet) were monitored weekly during the 21-day experimental period, revealing a validated model of heat stress and the occurrence of a physiological response in birds. Growth suppression from high ambient temperature has been well documented in a large number of studies. In this study, birds reared in high temperature (34°C for 8 h) for consecutive 21 d suffered from a higher FC and lower final BW, which were consistent with previous studies (Bottje and Carstens, 2009; Lei et al., 2013). Management manipulations such as air conditioning, genetic improvement, diet manipulation, and feed restriction have been implemented to neutralize the harmful effect of heat stress (Franco-Jimenez and Beck, 2007). In the present study, prior curcumin administration to heat exposure was employed as a low-cost and attractive solution due to its well-known safety feature and antioxidant benefits. Our results showed that curcumin decreased or partially reversed the FC but had no effect on the ADFI as previously reported (Sahin et al., 2012). Nutritional regulation of pre-slaughter through curcumin supplementation brings beneficial effects and provides an attractive avenue for improving meat quality in heat-stressed broilers. Meat quality is often described as the sum of all the meat quality characteristics, and muscular pH has been repeatedly reported as one of the most important quality aspects of meat. Generally, the pH range was classified according to initial pH (pH45) and ultimate pH (pH24) postmortem (England et al., 2014). The pH value of muscle is a direct reflection of glycolysis. At the postmortem storage period, muscle pH is lowered as a result of accumulation of lactic acid during glycolysis. Thus, low glycolytic potentials lead to higher pH24 (Zhang et al., 2011). In the present study, a rapid pH decrease of breast muscle was observed following the heat stress treatment, which was prevented by dietary curcumin administration. We hypothesized that the effect of curcumin on pH was related with glycolysis. On one hand, curcumin may be able to affect the pH values via inhibition of glycolysis. On the other hand, curcumin possibly detoxified the byproducts, such as lactic acid, which also showed a positive effect on the muscle pH. However, as we know, minimal research has been conducted regarding the mechanism of how curcumin affects the pH postmortem of muscle in broilers. The negative effect of heat stress is characterized by the overproduction of cellular ROS and a series of physiological changes in animals. MDA is a major byproduct of lipid peroxidation. The level of serum MDA indirectly indicates the degree of cellular lipid peroxidation and the accumulation of ROS (Yang et al., 2010). In addition to oxidant damage, chronic heat stress treatment also causes impairment of the endocrine system and disturbs the circulating levels of hormones, such as corticosterone (Quinteiro-Filho et al., 2010). Serum corticosterone is a good biological indicator of heat stress response in poultry. Studies showed that high temperature could activate the hypothalamic–pituitary–adrenal axis, resulting in a rapid release of serum corticosterone. In the present study, we measured the fluctuation of serum MDA and corticosterone levels throughout the duration of the 21-day heat stress exposure (Gu et al., 2012). Our results showed that chronic heat stress significantly increased serum MDA and corticosterone concentrations, suggesting the adaptive changes of body response to the environmental stimuli. These findings were consistent with those of Yu et al. (2010) in that heat challenge elevated the circulating levels of corticosterone in Chinese mini pigs (Yu et al., 2010). Nutritional interventions alleviate the negative consequences of heat stress, including the abnormal elevation of serum corticosterone concentrations and excessive lipid peroxidation. Zhou et al. (2010) reported that curcumin provided effective protection against exogenous corticosterone-induced oxidant injury (Zhou et al., 2010). On the other hand, the data from Sahin et al. (2012) showed that a curcumin-supplemented diet visibly depressed the lipid peroxidation in heat-stressed quails (Sahin et al., 2012). In our study, dietary curcumin supplementation prevented the lipid peroxidation and alleviated the elevation of serum corticosterone levels. We assumed it was associated with its strong antioxidant activity and hepato-protective effect (Elagamy, 2010). GSH is the most abundant non-protein thiol compound and functions as the principal non-enzymatic antioxidant in the antioxidant defense system. GSH and GSH-related antioxidant enzymes have been implicated in the maintenance of the intracellular GSH pool by regulating the balance between the supply and consumption of GSH in cells. The endogenic GSH content was supplied 2 ways: 1) de novo GSH synthesis catalyzed by the enzyme γ-GCL; and 2) the turnover of the GSH/GSSG redox cycle in the help of GSH-Px and GR. The consumption of intracellular GSH occurs predominantly through the catalytic reactions with GST. Pharmacological studies demonstrate that the antioxidant properties of curcumin are closely correlated with the intracellular GSH levels. Banerjee et al (2008) showed that GSH content increased in a concentration-dependent manner after incubation with different concentrations of curcumin (Banerjee et al., 2008). The finding with oral curcumin administration pointed out that it reversed the depletion of GSH in experimentally induced liver injury (Naik et al., 2010), which was consist with our data. Although an increase in GSH appears to be a ubiquitous response to curcumin treatment, the underlying mechanisms still need to be established. In our study, curcumin stimulated the enzymatic activity of γ-GCL and induced gene expression of γ-GCLc, which potentially enhanced de novo synthesis of GSH in heat-stressed broilers. γ-GCL, composed of a catalytic (GCLc) and a modifier subunit (GCLm), is a rate-limiting enzyme in de novo synthesis of GSH. Curcumin-mediated induction of both γ-GCLc and γ-GCLm gene expression has been previously reported in rodents and cells (Zheng et al., 2007). A recent study furthermore demonstrated that γ-GCLc gene expression in response to curcumin treatment was regulated prior to that of γ-GCLm (Valentine et al., 2006). Although we failed to determine the induction of γ-GCLm gene expression following curcumin administration in this study, it was assumed that the increase in GSH level with curcumin was at least partially attributed to curcumin-mediated induction of γ-GCLc gene expression and γ-GCL activity, which accelerated the GSH synthesis. Intracellular GSH level is diminished when it is either consumed by the conjugation of GST or by conversion to GSSG by GSH-Px. GST serves several vital functions, including catalyzing the conjugation of GSH with exnobiotics and protecting cells against reactive oxygen metabolites. Evidence has demonstrated that there is a strong association between GST enzyme activity and GSH content in cells. An increase of GST activity is related to a depletion on the GSH since GSH is the main substrate for the conjugation reaction of GST. Studies showed that curcumin was capable of inducing increased activity and gene expression of GST in liver (Valentine et al., 2006; Nishinaka et al., 2007). In the present study, hepatic mitochondrial GST activity was significantly increased by varying levels of curcumin. In line with a previous study, our data showed that the induction of GSH-Px activity in response to curcumin treatment was observed to a significant extent (Singhal et al., 1999). Based on the above results, it is possible that curcumin may have biphasic effects on the GSH metabolism, which both stimulate the GSH synthesis by the increased activity and gene expression of γ-GCL, and up-regulate the consumption of GSH by the induced GSH-Px and GST activities. Nrf-2 is a redox-sensitive nuclear transcription factor that augments cellular defense against oxidative damage. It regulates numerous gene encoding phase II detoxifying enzymes and antioxidant proteins through binding to the antioxidant response element present in their promoters. A variety of natural compounds were found to have cytoprotective effects by evoking the Nrf2 signaling pathway that governs the protective function of phase II detoxification and antioxidant enzymes (Zhao et al., 2010). Curcumin is a potential inducer of Nrf2-regulated phase II detoxifying enzymes (Hsu and Cheng, 2007). Balogun et al. (2003) observed a significant increase in the transcription activity of Nrf2 in cells exposed to various concentrations of curcumin (Balogun et al., 2003). The property of Nrf2 to coordinately activate phase II detoxifying enzymes, including GSH-related enzymes, HO-1, CAT, NOQ1, and Cu/ZnSOD, played a significant role in reducing ROS and decreasing lipid peroxidation and protein oxidation that led to oxidant injury and mitochondrial dysfunction (Cho et al., 2005). To further define the antioxidant role of curcumin in attenuating heat-stress-mediated oxidant damage via Nrf2 activation, we determined hepatic HO-1, CAT, Cu/ZnSOD, and GSH-Px gene expression. HO-1 is the rate-limiting enzyme in heme catabolism and catalyzes the formation of equimolar carbon monoxide, biliverdin, and ferrous iron, which provide an inducible defense system against oxidant stress (Morse et al., 2009). Rats treated with curcumin prior to focal ischemia-induced brain injury had higher gene and protein levels of Nrf2 and HO-1 (Yang et al., 2009). Lastly, curcumin was shown to induce the hepatic HO-1 expression as well as enzyme activity, which was consistent with our data (Cerný et al., 2011). Moreover, curcumin-mediated regulation in the phase II detoxifying system would be expected to be involved in the induction of HO-1, but also NQO1, CAT, Cu/ZnSOD, and GSH-Px expression (Charoensuk et al., 2011; Zhao et al., 2012). Our findings that curcumin up-regulated the mRNA expression of CAT in liver were in line with this notion. However, curcumin did not affect the Cu/ZnSOD or GSH-Px gene expression, although it effectively attenuated hepatic injury via transcriptional activation of Nrf2 in the present study. It was interesting that curcumin exhibited a significant effect on the enzyme activity but not the mRNA expression level of hepatic GSH-Px in the present study. One possible explanation we assumed was that curcumin might increase the GSH-Px activity by the control of its protein expression level, which needs to be identified in further research. These observations suggest that besides its redox-sensitive regulation on GSH-related metabolism, such as the enhanced activity and mRNA expression of GCL, another method of the antioxidant effects of curcumin proceeds by the activation of phase II enzymes through an Nrf2-dependent mechanism. Studies reported that curcumin exhibits both antioxidant/pro-oxidant activity in a concentration-dependent manner. At low concentrations of curcumin, it functions as a strong antioxidant and improves the total antioxidant capacity of tissues (Lee et al., 2010; Sood et al., 2011). At high concentrations, curcumin acted as a pro-oxidant that was capable of inducing cell apoptosis, oxidant damage, and even growth depression (Kawanishi et al., 2005; Sandur et al., 2007; Sahebkar, 2015). In the present study, CMN1 and CMN2 (50 and 100 mg/kg curcumin) supplementations had more pronounced effects on broilers, especially the antioxidant-related parameters. CMN3 (200 mg/kg curcumin) showed a less protective role against heat stress treatment based on the data, although no negative effects have been observed yet. Thus, it was recommended that the inclusion of CMN1 and CMN2 would be an appropriate dose for nutritional manipulation and serve as a potential promising antioxidant in poultry production. CONCLUSION In summary, the results indicated that the heat stress treatment induced the severe oxidant damage of liver, which led to the compromised growth performance and meat quality in birds. Dietary supplementation with curcumin increased the resistance of broilers to heat stress by reversing the FC and activating the antioxidant defense mechanism of liver. These curcumin effects are likely to be one antioxidant mechanism proceeding by induction of GSH-related enzymes and phase II enzyme response via Nrf2 activation. Further research to explicate the antioxidant effects of curcumin in animal production is significant, and curcumin will be taken more into consideration as a potential antioxidant additive for use in poultry. Acknowledgements This work was supported by the Fundamental Research Funds for the Central Universities (No. kjqn201707), National Natural Science Foundation of China (No. 31601973), Natural Science Foundation of Jiangsu Province (No. BK20160739), and China Postdoctoral Science Foundation (2015M581816). REFERENCES Altan Ö., Pabuçcuoğlu A., Altan A., Konyalioğlu S., Bayraktar H.. 2003. Effect of heat stress on oxidative stress, lipid peroxidation and some stress parameters in broilers. Br. Poult. Sci.  44: 545– 550. Google Scholar CrossRef Search ADS PubMed  Anand P., Thomas S. G., Kunnumakkara A. B., Sundaram C., Harikumar K. B., Sung B., Tharakan S. T., Misra K., Priyadarsini I. K., Rajasekharan K. N.. 2008. Biological activities of curcumin and its analogues (Congeners) made by man and Mother Nature. Biochem. Pharmacol . 76: 1590– 1611. Google Scholar CrossRef Search ADS PubMed  Azad M. A., Kikusato M., Maekawa T., Shirakawa H., Toyomizu M.. 2010. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comp. Biochem. Physiol. A Mol. Integr. Physiol.  155: 401– 406. Google Scholar CrossRef Search ADS PubMed  Balogun E., Hoque M., Gong P., Killeen E., Green C. J., Foresti R., Alam J., Motterlini R.. 2003. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-responsive element. Biochem. J.  371: 887– 895. Google Scholar CrossRef Search ADS PubMed  Banerjee A., Kunwar A., Mishra B., Priyadarsini K. I.. 2008. Concentration dependent antioxidant/pro-oxidant activity of curcumin: Studies from AAPH induced hemolysis of RBCs. Chem-Biol. Interact.  174: 134– 139. Google Scholar CrossRef Search ADS PubMed  Bottje W., Carstens G.. 2009. Association of mitochondrial function and feed efficiency in poultry and livestock species. J. Anim. Sci.  87: E48– E63. Google Scholar CrossRef Search ADS PubMed  Carmona-Ramirez I., Santamaria A., Tobon-Velasco J. C., Orozco-Ibarra M., Gonzalez-Herrera I. G., Pedraza-Chaverri J., Maldonado P. D.. 2013. Curcumin restores Nrf2 levels and prevents quinolinic acid-induced neurotoxicity. J. Nutr. Biochem.  24: 14– 24. Google Scholar CrossRef Search ADS PubMed  Cerný D., Lekić N., Váňová K., Muchova L., Hořínek A., Kmoníčková E., Zidek Z., Kamenikova L., Farghali H.. 2011. Hepatoprotective effect of curcumin in lipopolysaccharide/-galactosamine model of liver injury in rats: relationship to HO-1/CO antioxidant system. Fitoterapia  82: 786– 791. Google Scholar CrossRef Search ADS PubMed  Charoensuk L., Pinlaor P., Prakobwong S., Hiraku Y., Laothong U., Ruangjirachuporn W., Yongvanit P., Pinlaor S.. 2011. Curcumin induces a nuclear factor-erythroid 2-related factor 2-driven response against oxidative and nitrative stress after praziquantel treatment in liver fluke-infected hamsters. Int. J. Parasitol.  41: 615– 626. Google Scholar CrossRef Search ADS PubMed  Cho H. Y., Reddy S. P., Debiase A., Yamamoto M., Kleeberger S. R.. 2005. Gene expression profiling of NRF2-mediated protection against oxidative injury. Free Radic. Biol. Med.  38: 325– 343. Google Scholar CrossRef Search ADS PubMed  Elagamy D. S. 2010. Comparative effects of curcumin and resveratrol on aflatoxin B(1)-induced liver injury in rats. Arch. Toxicol.  84: 389– 396. Google Scholar CrossRef Search ADS PubMed  England E. M., Matarneh S. K., Scheffler T. L., Wachet C., Gerrard D. E.. 2014. pH inactivation of phosphofructokinase arrests postmortem glycolysis. Meat Sci . 98: 850– 857. Google Scholar CrossRef Search ADS PubMed  Franco-Jimenez D. J., Beck M. M.. 2007. Physiological changes to transient exposure to heat stress observed in laying hens. Poult. Sci.  86: 538– 544. Google Scholar PubMed  Goel A., Kunnumakkara A. B., Aggarwal B. B.. 2008. Curcumin as “Curecumin”: From kitchen to clinic. Biochem. Pharmacol.  75: 787– 809. Google Scholar CrossRef Search ADS PubMed  Gu X. H., Hao Y., Wang X. L.. 2012. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult. Sci.  91: 790– 799. Google Scholar CrossRef Search ADS PubMed  Hsu C. H., Cheng A. L.. 2007. Clinical studies with curcumin. Adv. Exp. Med. Biol.  595: 471– 480. Google Scholar CrossRef Search ADS PubMed  Huang C., Jiao H., Song Z., Zhao J., Wang X., Lin H.. 2015. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci.  93: 2144– 2153. Google Scholar CrossRef Search ADS PubMed  Kawanishi S., Oikawa S., Murata M.. 2005. Evaluation for safety of antioxidant chemopreventive agents. Antioxid. Redox Sign.  7: 1728. Google Scholar CrossRef Search ADS   Lee J. C., Kinniry P. A., Arguiri E., Serota M., Kanterakis S., Chatterjee S., Solomides C. C., Javvadi P., Koumenis C., Cengel K. A.. 2010. Dietary curcumin increases antioxidant defenses in lung, ameliorates radiation-induced pulmonary fibrosis, and improves survival in mice. Radiat. Res.  173: 590– 601. Google Scholar CrossRef Search ADS PubMed  Lei L., Hepeng L., Xianlei L., Hongchao J., Hai L., Sheikhahmadi A., Yufeng W., Zhigang S.. 2013. Effects of acute heat stress on gene expression of brain-gut neuropeptides in broiler chickens. J. Anim. Sci.  91: 5194– 5201. Google Scholar CrossRef Search ADS PubMed  Lin H., Decuypere E., Buyse J.. 2006. Acute heat stress induces oxidative stress in broiler chickens. Comp. Biochem. Physiol. A Mol. Integr. Physiol.  144: 11– 17. Google Scholar CrossRef Search ADS PubMed  Morse D., Lin L., Choi A. M. K., Ryter S. W.. 2009. Heme oxygenase-1, a critical arbitrator of cell death pathways in lung injury and disease. Free Radic. Biol. Med.  47: 1– 12. Google Scholar CrossRef Search ADS PubMed  Naik S. R., Thakare V. N., Patil S. R.. 2010. Protective effect of curcumin on experimentally induced inflammation, hepatotoxicity and cardiotoxicity in rats: Evidence of its antioxidant property. Exp. Toxicol. Pathol. : 419– 431. National Research Council (NRC). 1994. Nutrient Requirements of Poultry. 9th rev. ed. National Academies Press, Washington, DC. Nishinaka T., Ichijo Y., Ito M., Kimura M., Katsuyama M., Iwata K., Miura T., Terada T., Yabe-Nishimura C.. 2007. Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element. Toxicol. Lett.  170: 238– 247. Google Scholar CrossRef Search ADS PubMed  Quinteiro-Filho W. M., Ribeiro A., Ferraz-de-Paula V., Pinheiro M. L., Sakai M., Sa L. R., Ferreira A. J., Palermo-Neto J.. 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci.  89: 1905– 1914. Google Scholar CrossRef Search ADS PubMed  Sahebkar A. 2015. Dual effect of curcumin in preventing atherosclerosis: The potential role of pro-oxidant-antioxidant mechanisms. Nat. Prod. Res.  29: 491– 492. Google Scholar CrossRef Search ADS PubMed  Sahin K., Orhan C., Tuzcu Z., Tuzcu M., Sahin N.. 2012. Curcumin ameloriates heat stress via inhibition of oxidative stress and modulation of Nrf2/HO-1 pathway in quail. Food Chem. Toxicol.  50: 4035– 4041. Google Scholar CrossRef Search ADS PubMed  Sandur S. K., Ichikawa H., Pandey M. K., Kunnumakkara A. B., Sung B., Sethi G., Aggarwal B. B.. 2007. Role of prooxidants and antioxidants in the anti-inflammatory and apoptotic effects of curcumin (diferuloylmethane). Free Radical Bio. Med.  43: 568. Google Scholar CrossRef Search ADS   Singhal S. S., Awasthi S., Pandya U., Piper J. T., Saini M. K., Cheng J. Z., Awasthi Y. C.. 1999. The effect of curcumin on glutathione-linked enzymes in K562 human leukemia cells. Toxicol. Lett.  109: 87– 95. Google Scholar CrossRef Search ADS PubMed  Sood P. K., Nahar U., Nehru B.. 2011. Curcumin attenuates aluminum-induced oxidative stress and mitochondrial dysfunction in rat brain. Neurotoxicity Res . 20: 351– 361. Google Scholar CrossRef Search ADS   Valentine S. P., Le Nedelec M. J., Menzies A. R., Scandlyn M. J., Goodin M. G., Rosengren R. J.. 2006. Curcumin modulates drug metabolizing enzymes in the female Swiss Webster mouse. Life Sci . 78: 2391– 2398. Google Scholar CrossRef Search ADS PubMed  Yang C., Zhang X., Fan H., Liu Y.. 2009. Curcumin upregulates transcription factor Nrf2, HO-1 expression and protects rat brains against focal ischemia. Brain Res . 1282: 133– 141. Google Scholar CrossRef Search ADS PubMed  Yang L., Tan G. Y., Fu Y. Q., Feng J. H., Zhang M. H.. 2010. Effects of acute heat stress and subsequent stress removal on function of hepatic mitochondrial respiration, ROS production and lipid peroxidation in broiler chickens. Comp. Biochem. Physiol. C Toxicol. Pharmacol.  151: 204– 208. Google Scholar CrossRef Search ADS PubMed  Yu J., Yin P., Liu F., Cheng G., Guo K., Lu A., Zhu X., Luan W., Xu J.. 2010. Effect of heat stress on the porcine small intestine: A morphological and gene expression study. Comp. Biochem. Physiol. A Mol. Integr. Physiol.  156: 119– 128. Google Scholar CrossRef Search ADS PubMed  Yunianto V. D., Hayashit K., Kaiwda S., Ohtsuka A., Tomita Y.. 1997. Effect of environmental temperature on muscle protein turnover and heat production in tube-fed broiler chickens. Br. J. Nutr.  77: 897– 909. Google Scholar CrossRef Search ADS PubMed  Zhang J. F., Xu L., Zhang L. L., Ying Z. X., Su W. P., Wang T.. 2014. Curcumin attenuates D-galactosamine/lipopolysaccharide-induced liver injury and mitochondrial dysfunction in mice. J. Nutr.  144: 1211– 1218. Google Scholar CrossRef Search ADS PubMed  Zhang J., Hu Z., Lu C., Bai K., Zhang L., Tian W.. 2015a. Effect of various levels of dietary curcumin on meat quality and antioxidant profile of breast muscle in broilers. J. Agric. Food Chem.  63. Zhang J. F., Hu Z. P., Lu C. H., Yang M. X., Zhang L. L., Wang T.. 2015b. Dietary curcumin supplementation protects against heat-stress-impaired growth performance of broilers possibly through a mitochondrial pathway. J. Anim. Sci.  93: 1656– 1665. Google Scholar CrossRef Search ADS   Zhang W. H., Gao F., Zhu Q. F., Li C., Jiang Y., Dai S. F., Zhou G. H.. 2011. Dietary sodium butyrate alleviates the oxidative stress induced by corticosterone exposure and improves meat quality in broiler chickens. Poult. Sci.  90: 2592– 2599. Google Scholar CrossRef Search ADS PubMed  Zhao C. R., Gao Z. H., Qu X. J.. 2010. Nrf2-ARE signaling pathway and natural products for cancer chemoprevention. Cancer Epidemiol . 34: 523– 533. Google Scholar CrossRef Search ADS PubMed  Zhao X., Zou Y., Xu H., Fan L., Guo H., Li X., Li G., Zhang X., Dong M.. 2012. Gastrodin protect primary cultured rat hippocampal neurons against amyloid-beta peptide-induced neurotoxicity via ERK1/2-Nrf2 pathway. Brain Res . 1482: 13– 21. Google Scholar CrossRef Search ADS PubMed  Zheng S., Yumei F., Chen A.. 2007. De novo synthesis of glutathione is a prerequisite for curcumin to inhibit hepatic stellate cell (HSC) activation. Free Radic. Biol. Med.  43: 444– 453. Google Scholar CrossRef Search ADS PubMed  Zhou H., Li X., Gao M.. 2010. Curcumin protects PC12 cells from corticosterone-induced cytotoxicity: Possible involvement of the ERK1/2 pathway. Basic Clin. Pharm. Toxicol.  104: 36– 240. © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial