CRISPR/Cas9‒Mediated Tspo Gene Mutations Lead to Reduced Mitochondrial Membrane Potential and Steroid Formation in MA-10 Mouse Tumor Leydig Cells

Jinjiang Fan; Kevin Wang; Barry Zirkin; Vassilios Papadopoulos

doi:10.1210/en.2017-03065

CRISPR/Cas9‒Mediated Tspo Gene Mutations Lead to Reduced Mitochondrial Membrane Potential and Steroid Formation in MA-10 Mouse Tumor Leydig Cells

Fan, Jinjiang;Wang, Kevin;Zirkin, Barry;Papadopoulos, Vassilios 2018-02-01 00:00:00 Abstract The outer mitochondrial membrane translocator protein (TSPO) binds cholesterol with high affinity and is involved in mediating its delivery into mitochondria, the rate-limiting step in hormone-induced steroidogenesis. Specific ligand binding to TSPO has been shown to initiate steroid formation. However, recent studies of the genetic deletion of Tspo have provided conflicting results. Here, we address and extend previous studies by examining the effects of Tspo-specific mutations on steroid formation in hormone- and cyclic adenosine monophosphate (cAMP)–responsive MA-10 cells, using the CRISPR/Cas9 system. Two mutant subcell lines, nG1 and G2G, each carrying a Tspo exon2-specific genome modification, and two control subcell lines, G1 and HH, each carrying a wild-type Tspo, were produced. In response to dibutyryl cAMP, the nG1 and G2G cells produced progesterone at levels significantly lower than those produced by the corresponding control cells G1 and HH. Neutral lipid homeostasis, which provides free cholesterol for steroid biosynthesis, was altered significantly in the Tspo mutant cells. Interestingly, the mitochondrial membrane potential (ΔΨm) of the Tspo mutant cells was significantly reduced compared with that of the control cells, likely because of TSPO interactions with the voltage-dependent anion channel and tubulin at the outer mitochondrial membrane. Steroidogenic acute regulatory protein (STAR) expression was induced in nG1 cells, suggesting that reduced TSPO affected STAR synthesis and/or processing. Taken together, these results provide further evidence for the critical role of TSPO in steroid biosynthesis and suggest that it may function at least in part via its regulation of ΔΨm and effects on STAR. Steroid hormone biosynthesis begins with the conversion of cholesterol to pregnenolone by the mitochondrial enzyme CYP11A1. This reaction is dependent in part upon delivery of cholesterol from intracellular stores into mitochondria, the latter constituting the rate-determining step in steroidogenesis. Transport of free cholesterol to mitochondria for steroid biosynthesis involves steroidogenic acute regulatory protein (STAR or STARD1), soluble N-ethylmaleimide–sensitive factor attachment protein receptor proteins, and interactions of lipid droplets (LDs) with mitochondria and of mitochondria with the endoplasmic reticulum (1–7). STAR and soluble N-ethylmaleimide–sensitive factor attachment protein receptor proteins were shown to function primarily outside the mitochondria, where they are considered to be involved in trafficking of free cholesterol to the outer mitochondrial membrane (OMM) (8, 9). This pool of cholesterol must be segregated from the structural cholesterol of OMM and subsequently crosses from the OMM to the inner mitochondrial membrane (IMM) where CYP11A1 is located. Translocator protein (TSPO; 18 kDa) is a well-conserved, ubiquitous, integral OMM protein that is abundant in steroid-synthesizing cells. With its high affinity for cholesterol, TSPO is able to segregate cholesterol and to participate in its targeting to CYP11A1 (10, 11). Cholesterol binds at a specific binding site of TSPO, the latter termed the cholesterol recognition/interaction amino acid consensus motif (12–14). TSPO-mediated cholesterol targeting to CYP11A1 is likely achieved through the formation of a multiprotein complex of OMM and IMM proteins, including TSPO, voltage-dependent anion channel (VDAC), adenosine triphosphatase family AAA domain–containing protein 3, and CYP11A1 (11). TSPO binds with high affinity to diverse compounds and endogenous ligands that can regulate its activity (5). Biochemical and pharmacological studies using TSPO ligands strongly support the contention that TSPO plays an important role in cholesterol import into mitochondria and thus in steroidogenesis (5, 15, 16). TSPO abundance in steroidogenic cells may be linked to the tissue/cell-specific need for the amounts of free cholesterol to be imported into mitochondria. The presence of TSPO and cholesterol in the OMM may affect mitochondrial membrane fluidity/permeability, fission/fusion processes, membrane protein/transporter function(s), and membrane potential (ΔΨm) (17–19). Recent studies of genetic deletion of Tspo in mice have provided conflicting data, including no effect on steroid synthesis, ablation of corticosteroid response to adrenocorticotropic hormone, and changes in lipid homeostasis in testicular Leydig cells (20–23). Conflicting data based on MA-10 mouse Leydig cells also have been published. Thus, knockdown of Tspo expression using antisense oligonucleotides was reported to reduce the ability of the cells to form steroids, but CRISPR/Cas9‒guided Tspo deletion was reported to have no effect on steroid synthesis (24–26). The current studies were designed to reevaluate the effect of CRISPR/Cas9‒guided Tspo deletion on the ability of MA-10 cells to form steroids and to further our understanding of how TSPO functions in this process. TSPO deficiency led to reduced dibutyryl–cyclic adenosine monophosphate (dbcAMP)‒stimulated steroid biosynthesis and increased esterified, cholesterol-enriched neutral lipid accumulation, suggesting reduction in the import of the steroidogenic pool of cholesterol into mitochondria. Data suggest that this is most likely due to TSPO-mediated reduced mitochondrial ΔΨmvia regulation of VDAC1/tubulin interaction. In addition, we show that STAR levels were increased in TSPO-deficient cells, suggesting that increased STAR expression levels and/or altered STAR processing might compensate to some extent for reduced TSPO. These results support the contention that TSPO plays a major role in steroid biosynthesis and further suggest that TSPO may function at least in part via regulation of ΔΨm and effects on STAR. Materials and Methods Cell culture MA-10 cells were maintained in Dulbecco’s modified Eagle medium/F-12 medium supplemented with 5% heat-inactivated fetal bovine serum and 2.5% horse serum (27). The MA-10-derived wild-type (WT) subcell lines and the Tspo genome-edited subcell lines nG1 and G2G were grown in this medium supplemented with 400 μg/mL of G418 (Roche Diagnostics, Indianapolis, IN), 100 U/mL of penicillin, and 100 μg/mL of streptomycin in 5% CO2/air at 37°C, as described previously (28). The cells used for confocal microscopy and microplate reader studies were cultured on single 35-mm FluoroDishTM sterile culture dishes (World Precision Instruments, Sarasota, FL) or in 96-well plates (ViewPlate-96 black with optically clear bottom; PerkinElmer Canada Inc., Markham, ON, Canada). CRISPR/Cas9–mediated genome editing of Tspo genes in MA-10 cell lines Two guide RNAs (gRNAs) specifically targeting Tspo exon2 were designed using the CRISPR gRNA Design Tool (https://www.atum.bio). They were cloned into the GeneArt® CRISPR Nuclease Vector with OFP Reporter (Thermo Fisher Scientific, Mississauga, ON, Canada) through annealing of the following two oligonucleotides: Tspo-gRNA#1 ‒ gRNA1-Rn: 5′-GCCTACTTTGTACGTGGCGAGTTTT-3′ and gRNA1-Fn: 5′- TCGCCACGTACAAAGTAGGCCGGTG-3′; Tspo-gRNA#2 ‒ gRNA2-Rn: 5′-GCAAGCTAGCATACCACCGGGTTTT-3′ and gRNA2-Fn: 5′-CCGGTGGTATGCTAGCTTGCCGGTG-3′. The orange fluorescent protein (OFP) reporter allows for the transient expression of the OFP needed for fluorescence-based tracking of transfection efficiency and fluorescence-activated cell sorting (FACS)‒based sorting/enrichment of Cas9- and CRISPR-expressing cells. All the plasmids that contained the gRNAs were confirmed by sequencing, using U6 forward sequencing primer 5′-GGACTATCATATGCTTACCG-3′. The verified plasmids were purified with a Qiagen Endofree Maxi-Prep Kit (QIAGEN, Germantown, MD). To monitor mitochondrial activity, we established a subcell line derived from MA-10 cells, designated Mito-H, in which a mitochondrial reduction-oxidation sensitive green fluorescent protein 1 (Mito-roGFP) was stably expressed (28). The Mito-H cells expressed high levels of Mito-roGFP and formed progesterone in response to dbcAMP (28). Mito-H cells were cultured overnight in six-well plates to 80% confluence and then transfected with the GeneArt CRISPR Nuclease Vector with OFP Reporter containing each Tspo-specific gRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. After 24-hour transfection, the cells were subjected to FACS using BD FACSAria Fusion (five lasers, 18 parameters; BD Biosciences, San Jose, CA), and the positive cells were sorted and expanded. Tspo deletion was confirmed by polymerase chain reaction of genomic DNA using the Tspo-specific primers Exon2-R, 5′-TCAGATCTTTCCAGAACATCAGTTGC-3′ and Exon2-F, 5′-TGGCACCTACAACTACCTACCCCATGG-3′ and reverse transcription polymerase chain reaction using primers TSPO-R, 5′-GCGAAGCTTCGATGCCTGAATCCTGGGTGCC-3′ and TSPO-F, 5′-GCGGGATCCCTCACTCTGGGAGCCGGGAGCC-3′. Immunoblotting assay was performed using commercial anti-TSPO antibodies (Abs) (Table 1), and immunofluorescence was carried out using a laser-scanning confocal microscopy imaging system and epifluorescence microscopy. Table 1. Table of Information About Antibodies Peptide/Protein Target Antigen Sequence (if Known) Name of Antibody Manufacturer: Catalog No., or Name of Source; RRID Species Raised in; Monoclonal or Polyclonal Dilution Used (IF, IB) TSPO Anti-TSPO [EPR5384] Abcam: ab109497; RRID: AB_10862345 Rabbit 1:100 (IF) 1:1000 (IB) STAR Anti-STAR (FL-285) Santa Cruz Biotechnology Inc.: sc-25806; RRID: AB_2115937 Rabbit 1:1000 (IF) CYP11A1 Anti-CYP11A1 Abcam: ab175408; RRID: AB_2721042 Rabbit 1:1500 (IB) Rabbit IgG Anti-Rabbit IgG (H+L) Secondary Antibody conjugated with Alexa Fluor® 546 Thermo Fisher: A10040; RRID: AB_2534016 Donkey 1:100 (IF) HPRT Anti-HPRT Abcam: ab10479; RRID: AB_297217 Rabbit 1:1300 COX IV Anti-COX IV Abcam: ab16056; RRID: AB_443304 Rabbit 1:1300 GAPDH Anti-GAPDH Trevigen: 2275-PC-100; RRID: AB_2107456 Rabbit 1:5000 Rabbit IgG HRP-linked antibody Cell Signaling Technology: #7074; RRID: AB_2099233 Goat 1:1300 Mouse IgG HRP-linked antibody Cell Signaling Technology: #7076; RRID: AB_330924 Horse 1:1300 Biotin HRP-linked antibody Cell Signaling Technology: #7075; RRID: AB_10696897 Goat 1:3000 Rabbit IgG Rabbit IgG (H+L) Molecular Probes: A10040; RRID: AB_2534016 Donkey 1:500 Mouse IgG Anti-mouse IgG (H+L) Molecular Probes: P31582; RRID: AB_10374586 Goat 1:500 Goat IgG Anti-goat IgG (H+L) Molecular Probes: A-11055; RRID: AB_142672 Donkey 1:500 Peptide/Protein Target Antigen Sequence (if Known) Name of Antibody Manufacturer: Catalog No., or Name of Source; RRID Species Raised in; Monoclonal or Polyclonal Dilution Used (IF, IB) TSPO Anti-TSPO [EPR5384] Abcam: ab109497; RRID: AB_10862345 Rabbit 1:100 (IF) 1:1000 (IB) STAR Anti-STAR (FL-285) Santa Cruz Biotechnology Inc.: sc-25806; RRID: AB_2115937 Rabbit 1:1000 (IF) CYP11A1 Anti-CYP11A1 Abcam: ab175408; RRID: AB_2721042 Rabbit 1:1500 (IB) Rabbit IgG Anti-Rabbit IgG (H+L) Secondary Antibody conjugated with Alexa Fluor® 546 Thermo Fisher: A10040; RRID: AB_2534016 Donkey 1:100 (IF) HPRT Anti-HPRT Abcam: ab10479; RRID: AB_297217 Rabbit 1:1300 COX IV Anti-COX IV Abcam: ab16056; RRID: AB_443304 Rabbit 1:1300 GAPDH Anti-GAPDH Trevigen: 2275-PC-100; RRID: AB_2107456 Rabbit 1:5000 Rabbit IgG HRP-linked antibody Cell Signaling Technology: #7074; RRID: AB_2099233 Goat 1:1300 Mouse IgG HRP-linked antibody Cell Signaling Technology: #7076; RRID: AB_330924 Horse 1:1300 Biotin HRP-linked antibody Cell Signaling Technology: #7075; RRID: AB_10696897 Goat 1:3000 Rabbit IgG Rabbit IgG (H+L) Molecular Probes: A10040; RRID: AB_2534016 Donkey 1:500 Mouse IgG Anti-mouse IgG (H+L) Molecular Probes: P31582; RRID: AB_10374586 Goat 1:500 Goat IgG Anti-goat IgG (H+L) Molecular Probes: A-11055; RRID: AB_142672 Donkey 1:500 Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT, hypoxanthine-guanine phosphoribosyltransferase; IB, immunoblotting; IF, immunofluorescence; IgG, immunoglobulin G; RRID, Research Resource Identifier. View Large Radioimmunoassay Progesterone production was determined by radioimmunoassay using antiprogesterone antisera (MP Biomedicals, Santa Anna, CA) and [1,2,6,7-3H] progesterone (specific activity 94.1 Ci/mmol; PerkinElmer), as we have done previously (28). The interassay coefficient of variation for the progesterone assay was 7.5%. All measurements were further validated using the solid-phase enzyme immunoassay. All samples were assayed in triplicate. Mean values of progesterone in medium from four biological replicates ranged between 25.19 and 326.65 pg/mL, and the %B/B0 values were from 44.6% to 78.5%, which are within the 20% to 80% B/B0 range. Progesterone production was normalized to the amount of protein in each well and quantified using the Bio-Rad Protein Assay reagent (Bio-Rad Laboratories Ltd., Mississauga, ON, Canada). Radioimmunoassay data were analyzed using GraphPad Prism (version 5.02; GraphPad Software, La Jolla, CA). Neutral lipid staining and measurement Neutral lipid staining was performed using Nile red (also known as Nile blue oxazone; AAT Bioquest, Inc., San Francisco, CA). To this end, cells were incubated at 37°C for 10 minutes in a solution of Nile red in dimethyl sulfoxide (DMSO) diluted 1:200 in serum-free OPTI medium (Invitrogen). Cells were observed by confocal microscopy to monitor fluorescence change at excitation/emission (Ex/Em) = 488/528 nm. The stained LDs were quantified using ImageJ software (https://imagej.nih.gov/ij/). Mitochondrial staining and transmission electron microscopy imaging To stain mitochondria, the cells were grown to 50% confluence, treated with 1 mM of dbcAMP for 2 hours, and then stained with MitoTracker Red CMXRos (Invitrogen) for 20 minutes at 37°C. Live cells were observed by Zeiss LSM780 inverted laser scanning confocal microscopy (Carl Zeiss Microscopy LLC, Thornwood, NY). Transmission electron microscopy (TEM) imaging was performed at the Facility for Electron Microscopy Research of McGill University (7). In brief, subcell lines were fixed in 2.5% glutaraldehyde in 0.1 M of sodium cacodylate buffer, postfixed in 1% OsO4, and examined by TEM (TecnaiTM 12; FEI, Hillsboro, OR). Mitochondrial Δψm, redox measurement, and high-content imaging To assay mitochondrial Δψm, MA-10 and MA-10‒derived cells were washed with reduced-serum medium (Opti-MEM; Thermo Fisher Scientific), treated without or with 1 mM of dbcAMP for 2 hours, and then stained with JC-10 (1:600) for 30 minutes. The plates were read using the PerkinElmer EnSpire Multimode Plate Reader with Ex/Em = 485/534 nm or 540/570 nm. The same plates were imaged using the ImageXpress micro XLS wide-field high-content analysis system (Molecular Devices, Sunnyvale, CA) or an ultra-confocal high-content analysis system to validate the plate readings. For HH and G2G subcell lines with stable Mito-roGFP expression, Δψm was measured using the TMRE‒Mitochondrial Membrane Potential Assay Kit (Abcam, Toronto, ON, Canada). Tetramethylrhodamine ethyl ester (TMRE) was used to treat the cells without or with carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP), an ionophore uncoupler of oxidative phosphorylation that eliminates membrane potential (Δψm). After staining with 200 nM of TMRE for 20 minutes, measurements were performed with Ex/Em = 549/575 nm and 361/486 nm. As control, 20 μM of FCCP was added before the staining/measurement. The same assays were performed under different treatments and time periods. The treatments included incubation with PK 11195 [1-(2-chlorophenyl)-N-methyl-N-(1-methylpropyl)-3-isoquinolinecarboxamide; Sigma-Aldrich Canada Ltd., Oakville, ON, Canada] used at 100 nM in medium from 100 mM of stock solution in DMSO; XBD173 (AC-5216; Emapunil; Tractus Chemical, Hong Kong, China) at 20 μM in medium from 5 mM of stock solution in DMSO; H-89 dihydrochloride hydrate (Sigma-Aldrich) used at 1 and 10 μM in medium from 10 mM of stock solution in DMSO; or paclitaxel (Sigma-Aldrich Canada Ltd.) at 100 nM in culture medium from 1 mM of stock solution in DMSO. Cells were treated with PK 11195, XBD173, or paclitaxel for 4 hours or with H-89 for 30 minutes before the Δψm measurements were undertaken. Laser scanning confocal microscopy For live cell staining of microtubules, the cells were stained with MitoTracker Red CMXRos (Invitrogen; Ex/Em: 579/599) for 20 minutes and then with TubulinTracker™ Green (Oregon Green® 488 Taxol, bis-acetate; Ex/Em: 494/522 nm) (Thermo Fisher Scientific) for 30 minutes (37°C), as described by the manufacturer. For live cell staining of STAR protein, the cells were transfected with the plasmids encoding a mitochondria-targeted blue fluorescent protein (Ex/Em: 402/457 nm) and STAR-DsRed monomer (Ex/Em: 557/592 nm) overnight and then incubated with MitoTracker® Deep Red FM (Invitrogen; Ex/Em: 644/665 nm) for 20 to 30 minutes. The stained cells were viewed by confocal microscopy. For immunofluorescence staining, the cells were fixed in a 4% paraformaldehyde solution plus 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 5 minutes and washed in PBS for 5 minutes. After blocking with 1% bovine serum albumin in PBS plus 10% donkey normal serum for 30 minutes at 37°C, the cells were incubated with rabbit anti-TSPO monoclonal Ab [EPR5384] (Abcam) overnight and then with Donkey anti-Rabbit IgG (H+L) Secondary Antibody conjugated with Alexa Fluor® 546 (Thermo Fisher Scientific) for 1 hour at room temperature (Table 1). Cells were mounted using UltraCruz® Aqueous Mounting Medium containing 4′,6-diamidino-2-phenylindole (Santa Cruz Biotechnology, Dallas, TX). Cells were imaged with the Olympus FluoviewTM FV1000 laser confocal microscope and Olympus IX51 inverted epifluorescence microscope (Tokyo, Japan) and/or a Zeiss LSM780 inverted laser scanning confocal microscope (Carl Zeiss Inc.). Images were analyzed by ImageJ software (https://imagej.nih.gov/ij/). Detection of caspase-3/7 activity and cell proliferation and viability assay To assess whether the reduced progesterone production in cells with TSPO deficiency was due to programmed cell death induced by the dbcAMP treatment, we treated the cells with dbcAMP for 2 hours, then added CellEventTM caspase-3/7 green detection reagent (1:600; Thermo Fisher Scientific) for 30 minutes before imaging with the Olympus FluoviewTM FV1000 laser confocal microscope. Apoptotic cells (green) and nonapoptotic cells (counterstained blue) were counted using Image-Pro 6.3 (Media Cybernetics Inc., Silver Spring, MD). Cell proliferation assays were performed using the WST-1 colorimetric test, which measures mitochondrial dehydrogenase activity by the cleavage of the tetrazolium salt WST-1 to form a red formazan dye by viable cells (Cell Proliferation Reagent WST-1; Roche). Cells were seeded at the same density in serum-free media. Cell density per well before and after dbcAMP treatment was assessed by collecting OD450nm/620 nm values using the VictorTM X5 2030 Multilabel Reader (PerkinElmer, Waltham, MA). Immunoblot analysis Total protein extracts for immunoblot analysis were prepared from MA-10 cells and its derived cell lines using M-PER Mammalian Protein Extraction Reagent (Thermo Fisher Scientific). After centrifugation, protein concentration was quantified using the Bradford dye assay (Bio-Rad Laboratories Ltd.). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblot analysis were performed as previously described (29). In brief, 20 μg of protein extract was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis using a 4% to 20% Tris-glycine gradient gel (Invitrogen) and electrotransferred to a polyvinylidene fluoride membrane. Membranes were blocked in 10% fat-free milk overnight and incubated with primary Abs specific for TSPO, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine-guanine phosphoribosyltransferase, STAR, CYP11A1, or COX IV, followed by anti-rabbit immunoglobulin-G horseradish peroxidase-conjugated secondary Ab (Cell Signaling Technology, Danvers, MA). Information about the Abs and dilutions used are provided in Table 1. In the case of anti-STAR immunoblot, the membranes were stripped of the Ab using Restore™ Western Blot Stripping Buffer (Thermo Fisher Scientific) and were reprobed using anti-COX IV. Immunoreactive proteins were visualized using the Amersham ECL Western Blotting Detection Reagent (GE Healthcare Life Sciences, Mississauga, ON, Canada), and images were captured using a FUJI image reader LAS4000 (Fujifilm, Tokyo, Japan). Molecular modeling The predicted secondary structure of TSPO was produced using TMRPres2D (30). The molecular surfaces of WT TSPO (PDB: 2MGY) were produced after removal of PK 11195 and with minimized energy in the Swiss-PdbViewer (V.4.1) (31, 32). Statistical analysis Data were expressed as mean ± standard error of the mean, and graphic presentation was performed using GraphPad Prism (version 5.02; GraphPad Software) for Windows. Statistical analyses of data were performed by the unpaired Student t test. Mean differences were considered statistically different when P < 0.05. Results CRISPR/Cas9‒mediated Tspo deletion mutation in MA-10 cells To generate Tspo mutant/deleted cell lines, we designed two gRNAs specifically targeting Tspo exon2. The two, gRNA1 (in red) and gRNA2 (in green), were cloned into the GeneArt® CRISPR Nuclease Vector with OFP Reporter (Fig. 1A and 1B). After their transfection into cells of the MA-10 subline Mito-H, we performed FACS analysis that resulted in four major groups of cell populations [quarter (Q) 1, Q2, Q3, and Q4]: G1, cells expressing OFP without detectable gene deletion; nG1, cells expressing OFP with detectable Tspo-targeted gene deletion; G2G, cells expressing both Mito-roGFP and OFP with Tspo-targeted gene deletion; and HH, cells expressing Mito-GFP without Tspo gene deletion (Fig. 1C and 1D). The Tspo-specific gene deletions were confirmed by locus-specific polymerase chain reaction and sequencing in comparison with the WT gene sequence (Supplemental Fig. 1A‒1C). The characteristics of each MA-10‒derived subcell line are summarized in Table 2. After expansion of the cell colonies, immunoblotting analyses were performed to validate the TSPO protein depletion or mutation. The results showed that no immunoreactive TSPO protein could be detected in G2G cells (Supplemental Fig. 1D), a result supported by reverse transcription polymerase chain reaction analysis showing that the sizes of corresponding messenger RNA shifted, especially in the nG1 cells (Supplemental Fig. 1E). In addition, immunoblotting analysis of the nG1 cells showed that the 18 kDa TSPO protein monomer disappeared, although a higher molecular weight immunoreactive TSPO polymer appeared (Supplemental Fig. 1F). We also assessed whether the expression levels of CYP11A1, the mitochondrial enzyme that catalyzes conversion of cholesterol to pregnenolone, were affected by the genome editing system. The results show that the subcell line contained CYP11A1 at levels equal to those of WT cells (Supplemental Fig. 1G). These data suggest that Tspo in both nG1 and G2G was successfully mutated using the CRISPR/Cas9 methodology, resulting in depletion of the 18 kDa TSPO or dramatic reduction of its expression. Figure 1. View large Download slide Screening and validation of CRISPR/Cas9‒mediated Tspo mutant MA-10 mouse Leydig cells. (A) Two gRNAs, cloned-gRNA1 and cloned-gRNA2, were designed within exon2 of the Tspo gene after the codon ATG. Exon2-R and Exon2-F were the primers used for screening of mutant genomic DNAs. (B) Exon2 and its flanking sequences are shown. Red, gRNA1; green, gRNA2; orange, the gap between gRNA1 and gRNA2. Bold letters, exon2; small letters, intron sequence. (C, D) Cell sorting of the Mito-H cells [MA-10 cells expressing Mito-roGFP (28)] transfected with the two plasmid constructs from (C) gRNA1 and (D) gRNA2 for 24 hours was performed by FACS. The resulting graphs show the four subpopulations of cells in scattergrams: G1/nG1 (Q1), the transfected cells lacking Mito-roGFP; G2G (Q2), the transfected cells expressing Mito-roGFP; basal (Q3) cells expressing Mito-roGFP; and HH (Q4), cells with higher expression of Mito-roGFP. (E–L) Immunofluorescence (IF) staining of TSPO in the CRISPR/Cas9‒mediated mutant cells nG1 and G2G in comparison with the WT cells G1 and HH, respectively. The IF was performed using laser scanning confocal microscopy as well as epifluorescence microscopy in WT cells [(E) and (G) for G1; (I) and (K) for HH] and in mutant cells [(F) and (H) for nG1; (J) and (L) for G2G]. TSPO was labeled with rabbit monoclonal anti-TSPO Ab and Alexa Fluor® 546 Donkey Anti-Rabbit IgG (E, F, I, and J) in red for confocal images and (G, H, K, and L) in yellow for epifluorescence images. Original images for highlighted areas in panels E, F, I, and J are presented in Supplemental Fig. 2. (H, L) The merged channel of red/blue, where only a few G2G cells have very weak staining for TSPO or background staining, is shown; the nucleus was counterstained in blue using DAPI. Mitochondria were counterstained with MitoTrackerTM Deep Red FM and painted in green and are also shown by Mito-roGFP in blue for cells HH and G2G. Scale bars: 5 μm for confocal images and 100 μm for epifluorescence images. DAPI, 4′,6-diamidino-2-phenylindole; IgG, immunoglobulin-G. Figure 1. View large Download slide Screening and validation of CRISPR/Cas9‒mediated Tspo mutant MA-10 mouse Leydig cells. (A) Two gRNAs, cloned-gRNA1 and cloned-gRNA2, were designed within exon2 of the Tspo gene after the codon ATG. Exon2-R and Exon2-F were the primers used for screening of mutant genomic DNAs. (B) Exon2 and its flanking sequences are shown. Red, gRNA1; green, gRNA2; orange, the gap between gRNA1 and gRNA2. Bold letters, exon2; small letters, intron sequence. (C, D) Cell sorting of the Mito-H cells [MA-10 cells expressing Mito-roGFP (28)] transfected with the two plasmid constructs from (C) gRNA1 and (D) gRNA2 for 24 hours was performed by FACS. The resulting graphs show the four subpopulations of cells in scattergrams: G1/nG1 (Q1), the transfected cells lacking Mito-roGFP; G2G (Q2), the transfected cells expressing Mito-roGFP; basal (Q3) cells expressing Mito-roGFP; and HH (Q4), cells with higher expression of Mito-roGFP. (E–L) Immunofluorescence (IF) staining of TSPO in the CRISPR/Cas9‒mediated mutant cells nG1 and G2G in comparison with the WT cells G1 and HH, respectively. The IF was performed using laser scanning confocal microscopy as well as epifluorescence microscopy in WT cells [(E) and (G) for G1; (I) and (K) for HH] and in mutant cells [(F) and (H) for nG1; (J) and (L) for G2G]. TSPO was labeled with rabbit monoclonal anti-TSPO Ab and Alexa Fluor® 546 Donkey Anti-Rabbit IgG (E, F, I, and J) in red for confocal images and (G, H, K, and L) in yellow for epifluorescence images. Original images for highlighted areas in panels E, F, I, and J are presented in Supplemental Fig. 2. (H, L) The merged channel of red/blue, where only a few G2G cells have very weak staining for TSPO or background staining, is shown; the nucleus was counterstained in blue using DAPI. Mitochondria were counterstained with MitoTrackerTM Deep Red FM and painted in green and are also shown by Mito-roGFP in blue for cells HH and G2G. Scale bars: 5 μm for confocal images and 100 μm for epifluorescence images. DAPI, 4′,6-diamidino-2-phenylindole; IgG, immunoglobulin-G. Table 2. MA-10 Cells (WT) and Derived Cell Lines Used in This Study MA-10 Cell/Characteristics Mito-roGFP a OFP b Tspo WT − − + Mito-H + − + G1 − +/− + nG1 − +/− − G2G ++ +/− − HH ++ − + Basal − − + MA-10 Cell/Characteristics Mito-roGFP a OFP b Tspo WT − − + Mito-H + − + G1 − +/− + nG1 − +/− − G2G ++ +/− − HH ++ − + Basal − − + Abbreviations: −, no expression; +, expression; ++, strong expression; +/−, transient expression. a Mito-H, a stable cell line expressing Mito-roGFP; Mito-HH, a stable cell line expressing Mito-roGFP after resorting the Mito-H cells using an excitation wavelength of 488 nm. b The expression of OFP is transient; OFP will be absent after the expansion of the cell line(s). View Large Immunofluorescence analyses of WT and Tspo-deleted cell lines by confocal laser scanning microscopy and epifluorescence microscopy show that the WT TSPO was expressed on the OMM (Fig. 1E, 1G, 1I, and 1K; Supplemental Fig. 2A and 2C). However, in the Tspo mutant cells, there were no or very few cells stained by the anti-TSPO Ab (Fig. 1F, 1H, 1J, and 1L; and Supplemental Fig. 2B and 2D). These data suggest that TSPO was mutated and/or depleted in the MA-10 subcell lines nG1 and G2G, whereas the expression of TSPO in the corresponding original MA-10 subcell lines G1 and HH was not affected. TSPO deficiency inhibited dbcAMP-stimulated progesterone production The sequence alignment of the targeting regions from WT, nG1, and G2G cells indicated the deletion of four nucleotide acids, “GTGG,” in G2G and 26 nucleotide acids, “TGTACGTGGCGAGGGCCTCCGGTGGT,” in nG1 (Fig. 2A). The corresponding open reading frames were aligned to show that both Tspo mutant cells likely encode an N-terminal truncated protein, as shown in the amino acid sequence alignment (Fig. 2B) and secondary structure of the WT TSPO (Supplemental Fig. 3A). Nevertheless, the mutant TSPO from both cell lines, if any was expressed, may not have functioned the same as WT TSPO because its molecular surface would be changed from a positive potential to a neutral potential (Supplemental Fig. 3B). Figure 2. View largeDownload slide Genomic structure, predicted truncated peptides, defective steroid biosynthesis, and altered neutral lipid homeostasis in the Tspo mutant cells nG1 and G2G. (A) Genomic sequence alignments of nG1, G2G, and WT Tspo loci around the CRISPR/Cas9 targeting area. Dashes indicate the deletion of 26 nucleotides in nG1 cells and four nucleotides in G2G cells. (B) Predicted peptides of mutant TSPO in nG1, G2G, and WT cells. The second likely methionine (M60) seems to be present in both mutant nG1 and G2G cells. Dashes indicate the gaps introduced for sequence alignment or the missing amino acids in the predicted mutant proteins. Red arrow indicates one of the two tyrosines forming the covalent bound in TSPO dual topology model. (C, D) Disrupted stimulated progesterone production in nG1 vs G1 cells: (C) control vs (D) dbcAMP treatment. (E, F) Reduced stimulated progesterone production in G2G vs HH cells: (E) control vs (F) dbcAMP treatment. Results shown are means ± standard error of the mean (SEM; n = 4). (G–K) TSPO deficiency led to increased cytosolic neutral lipid accumulation in the cells after dbcAMP treatment. (G, H) The LDs include esterificed cholesterol stained with Nile Red in G1 cells (G) before and (H) after dbcAMP treatment. (I, J) LDs include esterificed cholesterol stained with Nile red in nG1 cells (I) before and (J) after dbcAMP treatment. Red arrows indicate representative LDs in white. (K) Quantification of LDs per cell among the cells used: G1 control, G1 with dbcAMP treatment, nG1 control, and nG1 with dbcAMP treatment. Results shown are means ± SEM (n = 386). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. Figure 2. View largeDownload slide Genomic structure, predicted truncated peptides, defective steroid biosynthesis, and altered neutral lipid homeostasis in the Tspo mutant cells nG1 and G2G. (A) Genomic sequence alignments of nG1, G2G, and WT Tspo loci around the CRISPR/Cas9 targeting area. Dashes indicate the deletion of 26 nucleotides in nG1 cells and four nucleotides in G2G cells. (B) Predicted peptides of mutant TSPO in nG1, G2G, and WT cells. The second likely methionine (M60) seems to be present in both mutant nG1 and G2G cells. Dashes indicate the gaps introduced for sequence alignment or the missing amino acids in the predicted mutant proteins. Red arrow indicates one of the two tyrosines forming the covalent bound in TSPO dual topology model. (C, D) Disrupted stimulated progesterone production in nG1 vs G1 cells: (C) control vs (D) dbcAMP treatment. (E, F) Reduced stimulated progesterone production in G2G vs HH cells: (E) control vs (F) dbcAMP treatment. Results shown are means ± standard error of the mean (SEM; n = 4). (G–K) TSPO deficiency led to increased cytosolic neutral lipid accumulation in the cells after dbcAMP treatment. (G, H) The LDs include esterificed cholesterol stained with Nile Red in G1 cells (G) before and (H) after dbcAMP treatment. (I, J) LDs include esterificed cholesterol stained with Nile red in nG1 cells (I) before and (J) after dbcAMP treatment. Red arrows indicate representative LDs in white. (K) Quantification of LDs per cell among the cells used: G1 control, G1 with dbcAMP treatment, nG1 control, and nG1 with dbcAMP treatment. Results shown are means ± SEM (n = 386). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. To examine the effect of mutant TSPO on Leydig cell steroid biosynthesis, we assessed progesterone production by nG1 and G2G cells under basal conditions and in response to dbcAMP treatment. There were no significant changes in basal progesterone production between TSPO mutant nG1 and G2G cells compared with their respective control G1 and HH cells (Fig. 2C and 2E). However, progesterone production in response to dbcAMP treatment was abolished in nG1 cells compared with control G1 cells (Fig. 2D) and was significantly reduced, by 60% in G2G cells compared with their control HH cells (Fig. 2F). TSPO deficiency led to neutral lipid accumulation after dbcAMP stimulation To interpret reduced progesterone biosynthesis by cells with TSPO deficiency, we speculated that the free cholesterol used for steroid biosynthesis would accumulate in the cytosol. In steroidogenic cells, free cholesterol can be stored in LDs containing a neutral lipid core surrounded by a phospholipid monolayer and associated proteins (33). We used Nile red to stain the neutral lipids in LDs (Fig. 2G‒2J). In control G1 cells, dbcAMP stimulation resulted in significant reduction in LDs, suggesting that LDs were used to supply cholesterol for steroidogenesis. In contrast, there was a significant increase in LD numbers in dbcAMP-stimulated TSPO-deficient nG1 cells (Fig. 2K). These data suggest that the free cholesterol used for steroid biosynthesis was compromised in the TSPO-deficient cells, leading to LD accumulation. TSPO deficiency resulted in changes in mitochondrial morphology and in OMM and IMM contact sites and/or fusion MitoTracker probes are cell-permeable, mitochondria-selective dyes that passively diffuse across the plasma membrane and accumulate in active mitochondria. We used these probes to examine whether there are changes in mitochondrial morphology in cells depleted of TSPO. Untreated cells or cells treated with dbcAMP were stained with Mitotracker Red CMXRos (Invitrogen) (Fig. 3; Supplemental Fig. 4). Mitochondrial morphology in G1 (Fig. 3A‒3C) and nG1 (Fig. 3D‒3F) cells in response to dbcAMP treatment differed with mitochondrial swelling seen in nG1 cells (compare Fig. 3C with Fig. 3F). Figure 3. View largeDownload slide TSPO depletion affected mitochondrial membrane structure and morphology. (A‒F) The live mitochondria in G1 and nG1 cells were stained with Mitotracker Red CMXRos (Invitrogen), which depends on Δψm (A, D) before and (B, E) after dbcAMP treatment. (C, F) The magnified areas after dbcAMP treatment, where the staining of mitochondria in G1 cells was diffused, are highlighted, which may be correlated with the mitochondrial fusion that has been related with steroidogenesis (34); the staining of mitochondria in nG1 cells is shown in “ballooning” or swelling shapes, indicating that there was a dramatic change in mitochondrial morphology or Δψm after TSPO depletion. (G–J) TEM of fixed mitochondria from the same cells as indicated in (A–F). Indel, imaging the intensity of the highlighted area painted in pseudocolor according to the reference bar. (G, H) The mitochondrial double membrane barrier is clearly seen in the G1 cells, but the boundary is blurred after dbcAMP treatment. (I, J) However, in the nG1 cells, the contact sites between the OMM and IMM are clearly seen (yellow arrows and lines); the membranes are clearly seen as a boundary between the mitochondria and cytoplasm after cAMP stimulation. The mitochondrial spheroids (Msp) or mitophagy (Mtp) are also indicated. The red arrows indicate the mitochondria (Mt); the Cristae membrane is indicated. Figure 3. View largeDownload slide TSPO depletion affected mitochondrial membrane structure and morphology. (A‒F) The live mitochondria in G1 and nG1 cells were stained with Mitotracker Red CMXRos (Invitrogen), which depends on Δψm (A, D) before and (B, E) after dbcAMP treatment. (C, F) The magnified areas after dbcAMP treatment, where the staining of mitochondria in G1 cells was diffused, are highlighted, which may be correlated with the mitochondrial fusion that has been related with steroidogenesis (34); the staining of mitochondria in nG1 cells is shown in “ballooning” or swelling shapes, indicating that there was a dramatic change in mitochondrial morphology or Δψm after TSPO depletion. (G–J) TEM of fixed mitochondria from the same cells as indicated in (A–F). Indel, imaging the intensity of the highlighted area painted in pseudocolor according to the reference bar. (G, H) The mitochondrial double membrane barrier is clearly seen in the G1 cells, but the boundary is blurred after dbcAMP treatment. (I, J) However, in the nG1 cells, the contact sites between the OMM and IMM are clearly seen (yellow arrows and lines); the membranes are clearly seen as a boundary between the mitochondria and cytoplasm after cAMP stimulation. The mitochondrial spheroids (Msp) or mitophagy (Mtp) are also indicated. The red arrows indicate the mitochondria (Mt); the Cristae membrane is indicated. We then examined subcellular features of the mitochondria by TEM. In the control G1 cells, the mitochondrial membranes were distinct and of high density. The membranes became more diffuse after the cells were treated with dbcAMP (Fig. 3G and 3H). These observations are consistent with those from MitoTracker staining (Fig. 3C). In TSPO-depleted nG1 cells, the two mitochondrial membranes were separate but with a number of contact sites (Fig. 3I). After dbcAMP treatment, the OMM and IMM of these cells were fused (Fig. 3J). In contrast to analysis of nG1 cells, confocal and TEM analyses of TSPO-depleted G2G cells indicated that there were no remarkable changes in mitochondrial morphology from the control HH cells. However, staining with MitoTracker differed somewhat between G2G and HH cells, appearing more in the periphery rather than inside the mitochondria in G2G cells (Supplemental Fig. 4). The Mito-roGFP1 probe in Mito-H cells and its subcell lines is in dynamic equilibrium with the mitochondrial redox status and responds to membrane-permeable reductants and oxidants (35). Thus, Mito-roGFP (in green), which was used to monitor the redox status, was counterstained with MitoTracker (Supplemental Fig. 4B, 4D, 4G, and 4H). Although control HH cells treated with dbcAMP showed reduced roGFP staining at 480 nM, indicating changes in the mitochondrial redox conditions (Supplemental Fig. 4B and 4D), there was no change in TSPO-depleted G2G cells (Supplemental Fig. 4F and 4H). These observations are consistent with the direct measurement of redox status (400/488 ratio) between these two cell lines and indicate that the presence of TSPO is related to mitochondrial redox homeostasis (see later). TSPO deficiency resulted in reduced mitochondrial Δψm The cationic and lipophilic JC-10 dye, a derivative of JC-1 (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazoyl carbocyanine iodide), has been widely used to monitor mitochondrial health via its reversible changes from red fluorescence in normal cells to green fluorescence in apoptotic and necrotic cells as membrane potential decreases (36–38). JC-10 staining was performed to assess changes in mitochondrial Δψm in the control and TSPO-mutant cells. Δψm was significantly reduced in the TSPO-deficient nG1 cells compared with the control G1 cells. Treatment with dbcAMP further reduced Δψm in nG1 cells (Fig. 4A). Examination of the stained cells from high-content imaging similarly revealed mitochondrial color shift from red to green with TSPO depletion (compare Fig. 4B with Fig. 4C) and after dbcAMP treatment (compare Fig. 4D with Fig. 4E). In HH and G2G cells expressing Mito-roGFP, we used TRME staining, which emits red fluorescence, to assess changes in Δψm. The results showed that Δψm was significantly reduced in TSPO-deficient G2G compared with control HH cells (Fig. 4F). However, the reduced Δψm was not as low as that seen using the mitochondrial oxidative phosphorylation uncoupler (FCCP) or as much as that seen in nG1 cells, where TSPO expression was absent (Fig. 4E and 4A). These results indicate that TSPO deficiency leads to mitochondrial depolarization. Figure 4. View largeDownload slide TSPO deficiency decreased Δψm. (A) The ratio of JC-10 red/green fluorescence intensity of G1 and nG1 before and after 1-mM dbcAMP treatment was obtained from PerkinElmer EnSpire multimode plate reader. (B–E) High-content images of corresponding cells: G1 (control vs dbcAMP) and nG1 (control vs dbcAMP) from Molecular Devices ImageXpress Micro XLS wide-field high-content analysis system. Red (540/570 nm), healthy mitochondria; green (485/534 nm), depolarized or apoptotic cells. (F) Evaluation of Δψm in TSPO-deficient cells: G2G vs WT cell: HH. TMRE fluorescence intensity was graphed before and after FCCP treatment (to eliminate the Δψm), where the G2G cells have a lower Δψm than the WT cells, which is the same as in the nG1 cells. Results shown are means ± standard error of the mean (n = 24). *P < 0.05; ***P < 0.001 by Student t test. Figure 4. View largeDownload slide TSPO deficiency decreased Δψm. (A) The ratio of JC-10 red/green fluorescence intensity of G1 and nG1 before and after 1-mM dbcAMP treatment was obtained from PerkinElmer EnSpire multimode plate reader. (B–E) High-content images of corresponding cells: G1 (control vs dbcAMP) and nG1 (control vs dbcAMP) from Molecular Devices ImageXpress Micro XLS wide-field high-content analysis system. Red (540/570 nm), healthy mitochondria; green (485/534 nm), depolarized or apoptotic cells. (F) Evaluation of Δψm in TSPO-deficient cells: G2G vs WT cell: HH. TMRE fluorescence intensity was graphed before and after FCCP treatment (to eliminate the Δψm), where the G2G cells have a lower Δψm than the WT cells, which is the same as in the nG1 cells. Results shown are means ± standard error of the mean (n = 24). *P < 0.05; ***P < 0.001 by Student t test. Decreased Δψm and progesterone synthesis in Tspo mutant cells were TSPO specific Two TSPO-specific ligands, PK 11195 (100 nM; Sigma-Aldrich Canada Ltd.) and XBD173 (20 μM; Tractus Chemical), were used to treat cells. Both compounds significantly enhanced Δψm in control cells but not in cells with mutated Tspo (Fig. 5A and 5B). The cyclic adenosine monophosphate (cAMP)–dependent protein kinase (PKA) inhibitor H-89 (Sigma-Aldrich), used at 1 and 10 μM, increased the Δψm in all cells examined (Fig. 5C), suggesting that the repressed Δψm in TSPO-deficient cells can be recovered. TSPO deficiency led to a significantly elevated mitochondrial oxidized condition, but no changes were seen after PK 11197 or XBD173 treatment (Fig. 5D and 5E). Treatment with dbcAMP decreased the Δψm in controls but not in TSPO-deficient cells (Fig. 5F). Under the same conditions, control HH but not TSPO-deficient G2G cells responded to PK 11195 by producing increased levels of progesterone (Fig. 5G). Moreover, although TSPO-deficient cells were characterized by low Δψm, they were resistant to apoptosis and had similar relative proliferation rates before and after dbcAMP treatment (Supplemental Fig. 5). Figure 5. View largeDownload slide The reduced Δψm in TSPO-deficient cells was TSPO specific. The TSPO ligands PK 11195 (Sigma-Aldrich Canada Ltd.) and XBD173 (Tractus Chemical) increased Δψmvia TSPO. (A) Increased Δψm after PK 11195 treatment in control G1 cells. 100 nM of PK 11195 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (B) Increased Δψm after 20-μM XBD173 treatment in G1 control cells; 20-μM XBD173 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (C) Recovery of the collapse of Δψm in TSPO-deficient cells by the PKA inhibitor H-89 (10 μM; Sigma-Aldrich) and effects of H-89 (1 and 10 μM) on the Δψm of G1 and nG1 cells. H-89 (10 μM) significantly increased the Δψm. (D, E) No effect on mitochondrial redox status monitored by Mito-roGFP after PK 11195 (100 nM) and XBD173 (20 μM) treatments. However, the TSPO-deficient cells maintained a higher oxidized mitochondrial condition. (F) No effect of mitochondrial redox status after dbcAMP treatment of TSPO-deficient cells, but control cells kept a significantly reduced condition. Results shown are means ± standard error of the mean (SEM; n = 24). (G) PK 11195‒stimulated steroid production. Control HH cells and TSPO mutant G2G cells were treated with and without PK 11196 (100 nM) for 2 hours. Progesterone formed was measured by radioimmunoassay. Results shown are means ± SEM (n = 4). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. Figure 5. View largeDownload slide The reduced Δψm in TSPO-deficient cells was TSPO specific. The TSPO ligands PK 11195 (Sigma-Aldrich Canada Ltd.) and XBD173 (Tractus Chemical) increased Δψmvia TSPO. (A) Increased Δψm after PK 11195 treatment in control G1 cells. 100 nM of PK 11195 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (B) Increased Δψm after 20-μM XBD173 treatment in G1 control cells; 20-μM XBD173 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (C) Recovery of the collapse of Δψm in TSPO-deficient cells by the PKA inhibitor H-89 (10 μM; Sigma-Aldrich) and effects of H-89 (1 and 10 μM) on the Δψm of G1 and nG1 cells. H-89 (10 μM) significantly increased the Δψm. (D, E) No effect on mitochondrial redox status monitored by Mito-roGFP after PK 11195 (100 nM) and XBD173 (20 μM) treatments. However, the TSPO-deficient cells maintained a higher oxidized mitochondrial condition. (F) No effect of mitochondrial redox status after dbcAMP treatment of TSPO-deficient cells, but control cells kept a significantly reduced condition. Results shown are means ± standard error of the mean (SEM; n = 24). (G) PK 11195‒stimulated steroid production. Control HH cells and TSPO mutant G2G cells were treated with and without PK 11196 (100 nM) for 2 hours. Progesterone formed was measured by radioimmunoassay. Results shown are means ± SEM (n = 4). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. TSPO-deficient cells lost response to the tubulin stabilizing agent paclitaxel and show reduced colocalization of mitochondria with microtubules To investigate the mechanism of TSPO-mediated Δψm reduction, we examined the effect of the tubulin-stabilizing agent paclitaxel (Sigma-Aldrich Canada Ltd.) on TSPO-deficient cells nG1 and G2G compared with the effect on their respective control cells G1 and HH. Free tubulin has been shown to regulate Δψm in cancer cells by blocking VDAC function in a PKA-dependent manner (39–41). Free tubulin and organized microtubules were also associated with adrenocorticotropic hormone‒ and cAMP–stimulated steroidogenesis in murine adrenal and rat Leydig cells (42). In the current studies, paclitaxel (100 nM; Sigma-Aldrich Canada Ltd.) significantly increased the Δψm in controls by enhancing tubulin polymerization but not in TSPO-deficient cells, indicating that the TSPO-mediated Δψm regulation involved VDAC-tubulin interaction (Fig. 6A and 6B). Data from previous mass spectrometry studies on the mitochondrial protein complex involved in steroidogenesis indicated that cytoskeletal proteins were involved in the dbcAMP treatment and that microtubule elements were lost in the lower-molecular-weight complexes, whereas the ACTG1 and vimentin proteins were upregulated in the higher molecular protein complexes (Fig. 6C) (11). A search through the protein-protein interaction network STRING (https://string-db.org/) showed that TSPO is associated with cytoskeletal proteins via VDAC (Fig. 6D). Confocal images of microtubules and mitochondria show that the overlap of mitochondria and polymerized tubulin was reduced in TSPO-deficient cells (Fig. 6E–6J). Fluorescence intensity analysis shown by scatter plots and a bar graph of Mander’s overlap coefficient R also showed reduced colocalization in TSPO-deficient nG1 cells (Fig. 6K). These confocal data suggest a TSPO-mediated microtubule-mitochondria interaction most likely occurring via the regulation of dimeric tubulin-VDAC interaction (41, 43). Figure 6. View largeDownload slide TSPO-mediated Δψm reduction via VDAC-tubulin interaction. The tubulin stabilizing agent paclitaxel (Sigma-Aldrich Canada Ltd.) increased Δψmvia TSPO. (A) Increased Δψm after 100-nM paclitaxel treatment of control G1 cells, but lack of response in TSPO-deficient nG1 cells. (B) Significant changes in Δψm after 100-nM paclitaxel treatment of control HH cells, but no response in TSPO-deficient G2G cells. (C) Cytoskeleton proteins, including tubulins, were involved in dbcAMP-induced steroidogenesis in MA-10 cells. Microtubule-associated proteins were identified in the mitochondrial protein complexes found in bands 1 to 9, whereas actin filament‒associated proteins were increased in the mitochondrial protein complexes. The mass spectrometry data were extracted from a previous study on TSPO-mediated cholesterol mitochondrial transport complexes (11). (D) The TSPO-associated cytoskeleton protein-protein interaction. The main interactions were retrieved from the STRING database (http://string-db.org), except that the VDAC-tubulin interaction is from a previous publication on dimeric tubulin blocking VDAC closure at negative potentials (40). (E–J) Confocal imaging of the overlap of polymerized tubules and mitochondria in (E–G) control G1 cells and (H–J) TSPO-deficient nG1 cells. Insets in panels (E) and (F) identify the areas shown in panel (G), and insets in panels (H) and (I) identify the areas shown in panel (J). Cells were stained with MitoTracker Red CMXRos (Invitrogen; Ex/Em: 579/599) for 20 minutes, then with the Thermo Fisher Scientific TubulinTracker™ Green (Oregon Green® 488 Taxol, bis-acetate; Ex/Em: 494/522 nm) for 30 minutes. (K) Scatter plots of two channels in G1 (left) and nG1 (right) cells and a bar graph show the Mander’s overlap coefficient (R) value as a measure of colocalization between polymerized tubules and mitochondria. ***P < 0.001 by Student t test. n.s., no significance. Figure 6. View largeDownload slide TSPO-mediated Δψm reduction via VDAC-tubulin interaction. The tubulin stabilizing agent paclitaxel (Sigma-Aldrich Canada Ltd.) increased Δψmvia TSPO. (A) Increased Δψm after 100-nM paclitaxel treatment of control G1 cells, but lack of response in TSPO-deficient nG1 cells. (B) Significant changes in Δψm after 100-nM paclitaxel treatment of control HH cells, but no response in TSPO-deficient G2G cells. (C) Cytoskeleton proteins, including tubulins, were involved in dbcAMP-induced steroidogenesis in MA-10 cells. Microtubule-associated proteins were identified in the mitochondrial protein complexes found in bands 1 to 9, whereas actin filament‒associated proteins were increased in the mitochondrial protein complexes. The mass spectrometry data were extracted from a previous study on TSPO-mediated cholesterol mitochondrial transport complexes (11). (D) The TSPO-associated cytoskeleton protein-protein interaction. The main interactions were retrieved from the STRING database (http://string-db.org), except that the VDAC-tubulin interaction is from a previous publication on dimeric tubulin blocking VDAC closure at negative potentials (40). (E–J) Confocal imaging of the overlap of polymerized tubules and mitochondria in (E–G) control G1 cells and (H–J) TSPO-deficient nG1 cells. Insets in panels (E) and (F) identify the areas shown in panel (G), and insets in panels (H) and (I) identify the areas shown in panel (J). Cells were stained with MitoTracker Red CMXRos (Invitrogen; Ex/Em: 579/599) for 20 minutes, then with the Thermo Fisher Scientific TubulinTracker™ Green (Oregon Green® 488 Taxol, bis-acetate; Ex/Em: 494/522 nm) for 30 minutes. (K) Scatter plots of two channels in G1 (left) and nG1 (right) cells and a bar graph show the Mander’s overlap coefficient (R) value as a measure of colocalization between polymerized tubules and mitochondria. ***P < 0.001 by Student t test. n.s., no significance. TSPO was involved in STAR protein mitochondrial import/function, which was correlated with reduced Δψm in TSPO-deficient cells Immunoblot analysis showed the induction of STAR immunoreactive proteins in control G1 and HH cells after treatment with dbcAMP for 2 hours (Fig. 7A‒7D), but to a lesser extent than that seen in the TSPO-deficient nG1 and G2G cells (Fig. 7B and 7D). The presence of increased levels of the 37-kDa cytosolic STAR and cleaved STAR protein before dbcAMP stimulation in nG1 cells suggests that although most STAR is not processed, some is imported and processed in the mitochondria (Fig. 7B). The lack of change in the pattern of STAR before and after dbcAMP treatment in G2G cells indicates that STAR accumulated outside the mitochondria (Fig. 7D); no processing occurred. These observations are most likely due to the fact that STAR can be processed only by the mitochondrial Lon protease after mitochondrial import (44). These data also suggest that STAR is imported into mitochondria in a TSPO-dependent fashion. Confocal imaging of STAR-DsRed protein was used to track the STAR mitochondrial import. STAR-DsRed was found to be imported into mitochondria in control G1 cells in response to dbcAMP treatment, whereas nG1 TSPO-deficient cells showed a notable amount of protein outside the mitochondria (Fig. 7E–7L). Similar results were obtained using HH control and G2G TSPO-deficient cells (Supplemental Fig. 6). Both the immunoblot analysis and confocal imaging suggest that the mitochondrial import of STAR depends on the presence of TSPO and polarized mitochondria (i.e., maintenance of its Δψm). Figure 7. View largeDownload slide TSPO is involved in the function and/or mitochondrial import of STAR. (A, C) Immunoblot analyses for TSPO in cell lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Robust TSPO expression is seen in G1 and HH cells. No TSPO expression is seen in nG1 cells; weak TSPO expression is seen in G2G cells. (B, D) Immunoblot analyses of STAR in lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Immunoreactive STAR proteins were induced by depletion of TSPO in nG1 cells. Anti‒glyceraldehyde-3-phosphate dehydrogenase (36 kDa) was used for reprobing the same membrane used for TSPO, whereas anti-Cox IV (16 kDa) was used to reprobe the same membrane used for anti-STAR. The gel photos were taken using the Bio-Rad Gel Imager. (E‒J) Confocal images of the STAR-DsRed fusion protein used for validation of the STAR protein mitochondrial import. Insets in panel (E) identify the areas shown in (F) and (G), and insets in panel (H) identify the areas shown in panels (I) and (J). STAR-DsRed protein is (G) localized remarkably outside the mitochondria in control G1 cells but (J) localized more within the mitochondria and less outside the mitochondria in nG1 TSPO-deficient cells, in comparison with mitochondria-targeted blue fluorescent protein and Mitotracker Deep Red Fm staining. (K) After 1-mM dbcAMP treatment, the STAR-DsRed was imported into the mitochondria in control G1 cells; (L) however, a still remarkable amount of the protein stayed outside the mitochondria in the mutant nG1 cells. The STAR mitochondrial import may be correlated with the Δψm (45, 46). White arrows indicate the distribution of STAR-DsRed fusion protein (red) (F, G, I and J) on the surface or (K) inside mitochondria. Scale bar: 5 μm. M, protein ladder. Figure 7. View largeDownload slide TSPO is involved in the function and/or mitochondrial import of STAR. (A, C) Immunoblot analyses for TSPO in cell lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Robust TSPO expression is seen in G1 and HH cells. No TSPO expression is seen in nG1 cells; weak TSPO expression is seen in G2G cells. (B, D) Immunoblot analyses of STAR in lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Immunoreactive STAR proteins were induced by depletion of TSPO in nG1 cells. Anti‒glyceraldehyde-3-phosphate dehydrogenase (36 kDa) was used for reprobing the same membrane used for TSPO, whereas anti-Cox IV (16 kDa) was used to reprobe the same membrane used for anti-STAR. The gel photos were taken using the Bio-Rad Gel Imager. (E‒J) Confocal images of the STAR-DsRed fusion protein used for validation of the STAR protein mitochondrial import. Insets in panel (E) identify the areas shown in (F) and (G), and insets in panel (H) identify the areas shown in panels (I) and (J). STAR-DsRed protein is (G) localized remarkably outside the mitochondria in control G1 cells but (J) localized more within the mitochondria and less outside the mitochondria in nG1 TSPO-deficient cells, in comparison with mitochondria-targeted blue fluorescent protein and Mitotracker Deep Red Fm staining. (K) After 1-mM dbcAMP treatment, the STAR-DsRed was imported into the mitochondria in control G1 cells; (L) however, a still remarkable amount of the protein stayed outside the mitochondria in the mutant nG1 cells. The STAR mitochondrial import may be correlated with the Δψm (45, 46). White arrows indicate the distribution of STAR-DsRed fusion protein (red) (F, G, I and J) on the surface or (K) inside mitochondria. Scale bar: 5 μm. M, protein ladder. Discussion Data from several independent laboratories have shown an important role of TSPO in steroidogenesis (10, 23, 25, 47–51). In addition to the stimulatory effect of numerous TSPO-specific drug ligands on steroid production both in vivo and in vitro, in all steroidogenic cells and tissues tested, the role of TSPO in steroidogenesis is supported strongly by studies of the effects of the specific inhibition of TSPO-specific ligands on steroid formation (5, 52). In particular, several TSPO ligands that bind either to the drug-binding sites or to the cholesterol recognition/interaction amino acid consensus domains of TSPO were shown to block hormone-induced steroid formation in cells both in vitro and in vivo. These ligands include flunitrazepam, 5-androsten-3β,17,19-triol, imidazo[1,2-a]pyridine‒containing and triazol-containing ligands, and peptide antagonists identified through a phage library screening (53–57). However, recent studies in rodents with genetic depletion of TSPO reported results inconsistent with those of many studies reporting a critical role for TSPO in steroid formation (20, 22, 23, 58–60). In the first study of the genetic depletion of TSPO in a mouse model by Amhr2-Cre–mediated Tspo conditional knockout (cKO), the authors concluded that TSPO is not required for steroid biosynthesis (20). However, although the Amhr2-Cre–mediated Tspo cKO approach had been used for the KO of other genes, the early expression of the Amhr2 gene during preimplantation stages of mouse development could lead to a gene’s global KO and/or WT-like animals with a cKO genotype and thus to an animal population with mixed variable genotypes (22). Using CRISPR/Cas9 technology to knock out Tspo in MA-10 cells, the same group of investigators again argued against an intimate relationship between TSPO and steroidogenesis and argued that the effect of the high-affinity TSPO ligand PK 11195 on steroid formation is independent of TSPO (26). If validated, these results would challenge the use of PK 11195 as a diagnostic ligand for the TSPO protein (31, 61). These findings clearly argue for further investigation using the MA-10 system to clarify and extend our understanding of the relationship between TSPO and steroidogenesis. To this end, we used the CRISPR/Cas9 system to create Tspo-specific mutations in MA-10 cells and then examined the effects on steroid formation. Two mutant subcell lines were developed, each carrying a Tspo exon2‒specific genome modification. Similar levels of basal progesterone were seen between the control and Tspo mutant cells. These observations suggest that CYP11A1 and HSD3B1, the enzymes responsible for cholesterol metabolism downstream of TSPO, were functionally intact. Indeed, CYP11A1 expression levels in TSPO-deficient cells were found to be the same as in WT cells. Importantly, in response to dbcAMP, both Tspo mutant cell lines exhibited reduced progesterone formation in comparison with the corresponding control cells, but with different features in terms of the reduction in progesterone production, which are most likely due to cell line‒specific mitochondrial redox conditions (28). These results support the long-held contention of an important role for TSPO in steroid formation. Moreover, we found a buildup of LDs in the cytosol of the mutant cells, suggesting a deficiency in the ability of the cells to translocate lipid into the mitochondria. In addition, we observed that Tspo mutant cells lost the ability to respond to the TSPO drug ligand PK 11195 to produce progesterone, unlike control cells. These findings strongly support an important role of TSPO in steroidogenesis, in contrast to previous negative reports (20, 26). The discrepant results are most likely due to the different systems used or the different approaches taken in the interpretation of the results. The current study provides strong evidence of a role for TSPO in regulation of Δψm in MA-10 cell mitochondria. Among the experimental approaches and studies that lead to this conclusion are Δψm-dependent MitoTracker staining with a pattern of predominantly peripheral distribution in mitochondria; OMM morphology; TEM studies of the contact sites between the OMM and the IMM; JC-10 staining indicating a decrease in the red/green fluorescence intensity ratio; the effects of TSPO-specific ligands (PK 11195 and XBD173) on the repolarization of mitochondria; and the association of Δψm with mitochondrial redox homeostasis. However, change in Δψm in MA-10 cells under TSPO deficiency behaves in a reversible manner because PKA inhibition hyperpolarizes the mitochondria, whereas dbcAMP-stimulated PKA activation decreases Δψm. These observations are consistent with the report that cAMP stimulation decreases Δψm but that cAMP inhibition repolarizes the mitochondria (39). The ΔΨM of the mutant cells was significantly reduced compared with that of control cells. This finding is in agreement with a previous report showing a decreased Δψm in fibroblast mitochondria in response to TSPO deficiency (62). These findings suggest a possible role for TSPO in the regulation of Δψm and thus in maintaining normal mitochondrial function. Δψm reflects mitochondrial function in the maintenance of the respiratory chain, generation of adenosine triphosphate, cellular differentiation, and apoptosis. With regard to apoptosis, the lower the Δψm, the more susceptible cells are to apoptotic stimuli (63). However, our results show that the reduced Δψm in TSPO-deficient cells neither affected cell proliferation nor increased apoptosis in response to dbcAMP treatment. In contrast, Tspo deletion led to resistance to apoptosis. This finding is in agreement with previous reports on the Drosophila TSPO ortholog (CG2789/dTSPO) (64) and on the antiapoptotic effects of TSPO-specific ligands (e.g., PK 11195) and Tspo knockdown (65, 66). These results suggest that reduced steroid production by Tspo mutant cells was not due to apoptotic cell death after dbcAMP treatment. It should be noted that TSPO has been thought to regulate Δψmvia its interaction with the mitochondrial membrane permeability transition pore, though this is not without controversy (65, 67, 68). Reduction in ΔΨM of the Tspo mutant cells is most likely attributable to TSPO interactions with the VDAC and tubulin (dimeric and polymerized) at the OMM (Supplemental Fig. 7). This conclusion is based on findings using the tubulin stabilizing reagent paclitaxel (Sigma-Aldrich Canada Ltd.) showing that TSPO interfered with a membrane lipid composition‒dependent VDAC/tubulin interaction (39, 69). Paclitaxel has been shown to bind the interior surface of microtubules (70), and tubulin has been reported to interact with VDAC1 in regulation of mitochondrial respiration as well as Δψm (40, 41). The Δψm depends on the flux of respiratory substrates adenosine triphosphate, adenosine diphosphate, and Pi through the VDAC, whereas the VDAC is controlled by tubulin. Adenine nucleotide translocator also plays a role in maintenance of the Δψm (39, 71). Therefore, TSPO apparently controls cellular and mitochondrial metabolism in MA-10 cells in general via regulation of Δψm, and affects OMM permeability and/or outer and inner membrane contacts/fusion, as hypothesized previously (72). This suggests that the contact sites are essential for dbcAMP-stimulated steroidogenesis. The changes in mitochondrial membranes may be related to TSPO-mediated membrane properties, such as their dynamics, physical properties, and facilitating or impairing of mitochondrial membrane permeabilization with dbcAMP treatment. Indeed, the Δψm is needed for mitochondrial fusion, which in turn is required for steroid biosynthesis (34). STAR, another protein known to be integrally involved in steroid formation, was induced in nG1 cells, suggesting the possible involvement of TSPO in STAR functioning/mitochondrial import. Thus, the Δψm is necessary for STAR protein mitochondrial import in Leydig cells in steroidogenesis (45, 73). Our immunoblot analysis and confocal imaging results are consistent with the concept that the STAR protein works on the mitochondrial surface rather than inside the mitochondria (74). However, whether STAR is inside mitochondria (nG1 cells) or outside mitochondria (G2G cells), it acts functionally with TSPO, an OMM protein, during hormone-stimulated steroidogenesis. How STAR functions in relationship to TSPO to deliver cholesterol into the mitochondria remains to be elucidated (72). Nevertheless, these observations are in agreement with previous findings that TSPO is involved in STAR import into mitochondria and processing either directly or indirectly via changes in Δψm (24, 53, 75). Taken together, these results provide further compelling evidence for a critical role of TSPO in steroid biosynthesis and suggest that it may function at least in part via its regulation of ΔΨm and effects on STAR synthesis and/or processing. Abbreviations: Ab antibody cAMP cyclic adenosine monophosphate cKO conditional knockout dbcAMP dibutyryl–cyclic adenosine monophosphate DMSO dimethyl sulfoxide Ex/Em excitation/emission FACS fluorescence-activated cell sorting FCCP carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone gRNA guide RNA IMM inner mitochondrial membrane LD lipid droplet Mito-roGFP mitochondrial reduction-oxidation sensitive green fluorescent protein 1 OFP orange fluorescent protein OMM outer mitochondrial membrane PBS phosphate-buffered saline PKA cyclic adenosine monophosphate–dependent protein kinase Q quarter STAR steroidogenic acute regulatory protein TEM transmission electron microscopy TMRE tetramethylrhodamine ethyl ester TSPO translocator protein VDAC voltage-dependent anion channel WT wild-type ΔΨm mitochondrial membrane potential. Acknowledgments We thank Dr. Mario Ascoli (University of Iowa, Iowa City, IA) for supplying the MA-10 cell line, and Ms. Jeannie Mui for performing the TEM at the Facility for Electron Microscopy Research, McGill University. We also thank the Immunophenotyping and Molecular Imaging Platforms of the Research Institute of the McGill University Health Centre. Financial Support: This work was supported by Canadian Institutes of Health Research Grants MOP125983 and PJT148659 (to V.P.), a Canada Research Chair in Biochemical Pharmacology (to V.P.), the John Stauffer Dean’s Chair in Pharmaceutical Sciences (University of Southern California; to V.P.), and National Institutes of Health Grants R37 AG021092 and R21 AG051259 (to B.Z.). Disclosure Summary: The authors have nothing to disclose. References 1. Kraemer FB, Shen WJ, Azhar S. SNAREs and cholesterol movement for steroidogenesis. Mol Cell Endocrinol . 2017; 441: 17– 21. Google Scholar CrossRef Search ADS PubMed 2. Fan J, Papadopoulos V. Evolutionary origin of the mitochondrial cholesterol transport machinery reveals a universal mechanism of steroid hormone biosynthesis in animals. PLoS One . 2013; 8( 10): e76701. Google Scholar CrossRef Search ADS PubMed 3. Stocco DM, Zhao AH, Tu LN, Morohaku K, Selvaraj V. A brief history of the search for the protein(s) involved in the acute regulation of steroidogenesis. Mol Cell Endocrinol . 2017; 441: 7– 16. Google Scholar CrossRef Search ADS PubMed 4. Shen WJ, Azhar S, Kraemer FB. Lipid droplets and steroidogenic cells. Exp Cell Res . 2016; 340( 2): 209– 214. Google Scholar CrossRef Search ADS PubMed 5. Papadopoulos V, Aghazadeh Y, Fan J, Campioli E, Zirkin B, Midzak A. Translocator protein-mediated pharmacology of cholesterol transport and steroidogenesis. Mol Cell Endocrinol . 2015; 408: 90– 98. Google Scholar CrossRef Search ADS PubMed 6. Miller WL. Mechanism of StAR’s regulation of mitochondrial cholesterol import. Mol Cell Endocrinol . 2007; 265-266: 46– 50. Google Scholar CrossRef Search ADS PubMed 7. Issop L, Fan J, Lee S, Rone MB, Basu K, Mui J, Papadopoulos V. Mitochondria-associated membrane formation in hormone-stimulated Leydig cell steroidogenesis: role of ATAD3. Endocrinology . 2015; 156( 1): 334– 345. Google Scholar CrossRef Search ADS PubMed 8. Lin Y, Hou X, Shen WJ, Hanssen R, Khor VK, Cortez Y, Roseman AN, Azhar S, Kraemer FB. SNARE-mediated cholesterol movement to mitochondria supports steroidogenesis in rodent cells. Mol Endocrinol . 2016; 30( 2): 234– 247. Google Scholar CrossRef Search ADS PubMed 9. Arakane F, Kallen CB, Watari H, Stayrook SE, Lewis M, Strauss JF III. Steroidogenic acute regulatory protein (StAR) acts on the outside of mitochondria to stimulate steroidogenesis. Endocr Res . 1998; 24( 3-4): 463– 468. Google Scholar CrossRef Search ADS PubMed 10. Papadopoulos V, Baraldi M, Guilarte TR, Knudsen TB, Lacapère JJ, Lindemann P, Norenberg MD, Nutt D, Weizman A, Zhang MR, Gavish M. Translocator protein (18kDa): new nomenclature for the peripheral-type benzodiazepine receptor based on its structure and molecular function. Trends Pharmacol Sci . 2006; 27( 8): 402– 409. Google Scholar CrossRef Search ADS PubMed 11. Rone MB, Midzak AS, Issop L, Rammouz G, Jagannathan S, Fan J, Ye X, Blonder J, Veenstra T, Papadopoulos V. Identification of a dynamic mitochondrial protein complex driving cholesterol import, trafficking, and metabolism to steroid hormones. Mol Endocrinol . 2012; 26( 11): 1868– 1882. Google Scholar CrossRef Search ADS PubMed 12. Li H, Papadopoulos V. Peripheral-type benzodiazepine receptor function in cholesterol transport: identification of a putative cholesterol recognition/interaction amino acid sequence and consensus pattern. Endocrinology . 1998; 139( 12): 4991– 4997. Google Scholar CrossRef Search ADS PubMed 13. Jamin N, Neumann JM, Ostuni MA, Vu TK, Yao ZX, Murail S, Robert JC, Giatzakis C, Papadopoulos V, Lacapère JJ. Characterization of the cholesterol recognition amino acid consensus sequence of the peripheral-type benzodiazepine receptor. Mol Endocrinol . 2005; 19( 3): 588– 594. Google Scholar CrossRef Search ADS PubMed 14. Li F, Liu J, Zheng Y, Garavito RM, Ferguson-Miller S. Crystal structures of translocator protein (TSPO) and mutant mimic of a human polymorphism. Science . 2015; 347( 6221): 555– 558. Google Scholar CrossRef Search ADS PubMed 15. Aghazadeh Y, Zirkin BR, Papadopoulos V. Pharmacological regulation of the cholesterol transport machinery in steroidogenic cells of the testis. Vitam Horm . 2015; 98: 189– 227. Google Scholar CrossRef Search ADS PubMed 16. Midzak A, Zirkin B, Papadopoulos V. Translocator protein: pharmacology and steroidogenesis. Biochem Soc Trans . 2015; 43( 4): 572– 578. Google Scholar CrossRef Search ADS PubMed 17. Elustondo P, Martin LA, Karten B. Mitochondrial cholesterol import. Biochim Biophys Acta . 2017; 1862( 1): 90– 101. Google Scholar CrossRef Search ADS PubMed 18. Rone MB, Fan J, Papadopoulos V. Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states. Biochim Biophys Acta . 2009; 1791( 7): 646– 658. Google Scholar CrossRef Search ADS PubMed 19. Marí M, Morales A, Colell A, García-Ruiz C, Fernández-Checa JC. Mitochondrial glutathione, a key survival antioxidant. Antioxid Redox Signal . 2009; 11( 11): 2685– 2700. Google Scholar CrossRef Search ADS PubMed 20. Morohaku K, Pelton SH, Daugherty DJ, Butler WR, Deng W, Selvaraj V. Translocator protein/peripheral benzodiazepine receptor is not required for steroid hormone biosynthesis. Endocrinology . 2014; 155( 1): 89– 97. Google Scholar CrossRef Search ADS PubMed 21. Tu LN, Morohaku K, Manna PR, Pelton SH, Butler WR, Stocco DM, Selvaraj V. Peripheral benzodiazepine receptor/translocator protein global knock-out mice are viable with no effects on steroid hormone biosynthesis. J Biol Chem . 2014; 289( 40): 27444– 27454. Google Scholar CrossRef Search ADS PubMed 22. Fan J, Campioli E, Midzak A, Culty M, Papadopoulos V. Conditional steroidogenic cell-targeted deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation. Proc Natl Acad Sci USA . 2015; 112( 23): 7261– 7266. Google Scholar CrossRef Search ADS PubMed 23. Papadopoulos V, Fan J, Zirkin B. Translocator protein (18 kDa): an update on its function in steroidogenesis [published online ahead of print July 1, 2017]. J Neuroendocrinol . doi: 10.1111/jne.12500. 24. Hauet T, Yao ZX, Bose HS, Wall CT, Han Z, Li W, Hales DB, Miller WL, Culty M, Papadopoulos V. Peripheral-type benzodiazepine receptor-mediated action of steroidogenic acute regulatory protein on cholesterol entry into Leydig cell mitochondria. Mol Endocrinol . 2005; 19( 2): 540– 554. Google Scholar CrossRef Search ADS PubMed 25. Kelly-Hershkovitz E, Weizman R, Spanier I, Leschiner S, Lahav M, Weisinger G, Gavish M. Effects of peripheral-type benzodiazepine receptor antisense knockout on MA-10 Leydig cell proliferation and steroidogenesis. J Biol Chem . 1998; 273( 10): 5478– 5483. Google Scholar CrossRef Search ADS PubMed 26. Tu LN, Zhao AH, Stocco DM, Selvaraj V. PK11195 effect on steroidogenesis is not mediated through the translocator protein (TSPO). Endocrinology . 2015; 156( 3): 1033– 1039. Google Scholar CrossRef Search ADS PubMed 27. Ascoli M. Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology . 1981; 108( 1): 88– 95. Google Scholar CrossRef Search ADS PubMed 28. Fan J, Li X, Issop L, Culty M, Papadopoulos V. ACBD2/ECI2-mediated peroxisome-mitochondria interactions in Leydig cell steroid biosynthesis. Mol Endocrinol . 2016; 30( 7): 763– 782. Google Scholar CrossRef Search ADS PubMed 29. Fan J, Rone MB, Papadopoulos V. Translocator protein 2 is involved in cholesterol redistribution during erythropoiesis. J Biol Chem . 2009; 284( 44): 30484– 30497. Google Scholar CrossRef Search ADS PubMed 30. Spyropoulos IC, Liakopoulos TD, Bagos PG, Hamodrakas SJ. TMRPres2D: high quality visual representation of transmembrane protein models. Bioinformatics . 2004; 20( 17): 3258– 3260. Google Scholar CrossRef Search ADS PubMed 31. Jaremko M, Jaremko Ł, Jaipuria G, Becker S, Zweckstetter M. Structure of the mammalian TSPO/PBR protein. Biochem Soc Trans . 2015; 43( 4): 566– 571. Google Scholar CrossRef Search ADS PubMed 32. Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis . 1997; 18( 15): 2714– 2723. Google Scholar CrossRef Search ADS PubMed 33. Khor VK, Ahrends R, Lin Y, Shen WJ, Adams CM, Roseman AN, Cortez Y, Teruel MN, Azhar S, Kraemer FB. The proteome of cholesteryl-ester-enriched versus triacylglycerol-enriched lipid droplets. PLoS One . 2014; 9( 8): e105047. Google Scholar CrossRef Search ADS PubMed 34. Duarte A, Poderoso C, Cooke M, Soria G, Cornejo Maciel F, Gottifredi V, Podestá EJ. Mitochondrial fusion is essential for steroid biosynthesis. PLoS One . 2012; 7( 9): e45829. Google Scholar CrossRef Search ADS PubMed 35. Hanson GT, Aggeler R, Oglesbee D, Cannon M, Capaldi RA, Tsien RY, Remington SJ. Investigating mitochondrial redox potential with redox-sensitive green fluorescent protein indicators. J Biol Chem . 2004; 279( 13): 13044– 13053. Google Scholar CrossRef Search ADS PubMed 36. Reers M, Smiley ST, Mottola-Hartshorn C, Chen A, Lin M, Chen LB. Mitochondrial membrane potential monitored by JC-1 dye. Methods Enzymol . 1995; 260: 406– 417. Google Scholar CrossRef Search ADS PubMed 37. Sirenko O, Hesley J, Rusyn I, Cromwell EF. High-content assays for hepatotoxicity using induced pluripotent stem cell-derived cells. Assay Drug Dev Technol . 2014; 12( 1): 43– 54. Google Scholar CrossRef Search ADS PubMed 38. Li W, Yang C, Lu J, Huang P, Barnstable CJ, Zhang C, Zhang SS. Tetrandrine protects mouse retinal ganglion cells from ischemic injury. Drug Des Devel Ther . 2014; 8: 327– 339. Google Scholar CrossRef Search ADS PubMed 39. Maldonado EN, Patnaik J, Mullins MR, Lemasters JJ. Free tubulin modulates mitochondrial membrane potential in cancer cells. Cancer Res . 2010; 70( 24): 10192– 10201. Google Scholar CrossRef Search ADS PubMed 40. Rostovtseva TK, Sheldon KL, Hassanzadeh E, Monge C, Saks V, Bezrukov SM, Sackett DL. Tubulin binding blocks mitochondrial voltage-dependent anion channel and regulates respiration. Proc Natl Acad Sci USA . 2008; 105( 48): 18746– 18751. Google Scholar CrossRef Search ADS PubMed 41. Rostovtseva TK, Bezrukov SM. VDAC inhibition by tubulin and its physiological implications. Biochim Biophys Acta . 2012; 1818( 6): 1526– 1535. Google Scholar CrossRef Search ADS PubMed 42. Clark MA, Shay JW. The role of tubulin in the steroidogenic response of murine adrenal and rat Leydig cells. Endocrinology . 1981; 109( 6): 2261– 2263. Google Scholar CrossRef Search ADS PubMed 43. Gatliff J, East D, Crosby J, Abeti R, Harvey R, Craigen W, Parker P, Campanella M. TSPO interacts with VDAC1 and triggers a ROS-mediated inhibition of mitochondrial quality control [published correction appears in Autophagy. 2016;12(2):4420]. Autophagy . 2014; 10( 12): 2279– 2296. Google Scholar CrossRef Search ADS PubMed 44. Granot Z, Kobiler O, Melamed-Book N, Eimerl S, Bahat A, Lu B, Braun S, Maurizi MR, Suzuki CK, Oppenheim AB, Orly J. Turnover of mitochondrial steroidogenic acute regulatory (StAR) protein by Lon protease: the unexpected effect of proteasome inhibitors. Mol Endocrinol . 2007; 21( 9): 2164– 2177. Google Scholar CrossRef Search ADS PubMed 45. King SR, Liu Z, Soh J, Eimerl S, Orly J, Stocco DM. Effects of disruption of the mitochondrial electrochemical gradient on steroidogenesis and the Steroidogenic Acute Regulatory (StAR) protein. J Steroid Biochem Mol Biol . 1999; 69( 1-6): 143– 154. Google Scholar CrossRef Search ADS PubMed 46. Martin J, Mahlke K, Pfanner N. Role of an energized inner membrane in mitochondrial protein import: delta psi drives the movement of presequences. J Biol Chem . 1991; 266( 27): 18051– 18057. Google Scholar PubMed 47. Papadopoulos V. On the role of the translocator protein (18-kDa) TSPO in steroid hormone biosynthesis. Endocrinology . 2014; 155( 1): 15– 20. Google Scholar CrossRef Search ADS PubMed 48. Papadopoulos V, Mukhin AG, Costa E, Krueger KE. The peripheral-type benzodiazepine receptor is functionally linked to Leydig cell steroidogenesis. J Biol Chem . 1990; 265( 7): 3772– 3779. Google Scholar PubMed 49. Mukhin AG, Papadopoulos V, Costa E, Krueger KE. Mitochondrial benzodiazepine receptors regulate steroid biosynthesis. Proc Natl Acad Sci USA . 1989; 86( 24): 9813– 9816. Google Scholar CrossRef Search ADS PubMed 50. Krueger KE, Papadopoulos V. Peripheral-type benzodiazepine receptors mediate translocation of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells. J Biol Chem . 1990; 265( 25): 15015– 15022. Google Scholar PubMed 51. Gavish M, Weizman R. Role of peripheral-type benzodiazepine receptors in steroidogenesis. Clin Neuropharmacol . 1997; 20( 6): 473– 481. Google Scholar CrossRef Search ADS PubMed 52. Lacapère JJ, Papadopoulos V. Peripheral-type benzodiazepine receptor: structure and function of a cholesterol-binding protein in steroid and bile acid biosynthesis. Steroids . 2003; 68( 7-8): 569– 585. Google Scholar CrossRef Search ADS PubMed 53. Gazouli M, Han Z, Papadopoulos V. Identification of a peptide antagonist to the peripheral-type benzodiazepine receptor that inhibits hormone-stimulated Leydig cell steroid formation. J Pharmacol Exp Ther . 2002; 303( 2): 627– 632. Google Scholar CrossRef Search ADS PubMed 54. Midzak A, Akula N, Lecanu L, Papadopoulos V. Novel androstenetriol interacts with the mitochondrial translocator protein and controls steroidogenesis. J Biol Chem . 2011; 286( 11): 9875– 9887. Google Scholar CrossRef Search ADS PubMed 55. Midzak A, Denora N, Laquintana V, Cutrignelli A, Lopedota A, Franco M, Altomare CD, Papadopoulos V. 2-Phenylimidazo[1,2-a]pyridine-containing ligands of the 18-kDa translocator protein (TSPO) behave as agonists and antagonists of steroidogenesis in a mouse leydig tumor cell line. Eur J Pharm Sci . 2015; 76: 231– 237. Google Scholar CrossRef Search ADS PubMed 56. Midzak AS, Akula N, Rone MB, Papadopoulos V. Computational modeling and biological validation of novel non-steroidal ligands for the cholesterol recognition/interaction amino acid consensus (CRAC) motif of the mitochondrial translocator protein (TSPO). Pharmacol Res . 2015; 99: 393– 403. Google Scholar CrossRef Search ADS PubMed 57. Papadopoulos V, Nowzari FB, Krueger KE. Hormone-stimulated steroidogenesis is coupled to mitochondrial benzodiazepine receptors: tropic hormone action on steroid biosynthesis is inhibited by flunitrazepam. J Biol Chem . 1991; 266( 6): 3682– 3687. Google Scholar PubMed 58. Owen DR, Fan J, Campioli E, Venugopal S, Midzak A, Daly E, Harlay A, Issop L, Libri V, Kalogiannopoulou D, Oliver E, Gallego-Colon E, Colasanti A, Huson L, Rabiner EA, Suppiah P, Essagian C, Matthews PM, Papadopoulos V. TSPO mutations in rats and a human polymorphism impair the rate of steroid synthesis. Biochem J . 2017; 474( 23): 3985– 3999. Google Scholar CrossRef Search ADS PubMed 59. Banati RB, Middleton RJ, Chan R, Hatty CR, Kam WW, Quin C, Graeber MB, Parmar A, Zahra D, Callaghan P, Fok S, Howell NR, Gregoire M, Szabo A, Pham T, Davis E, Liu GJ. Positron emission tomography and functional characterization of a complete PBR/TSPO knockout. Nat Commun . 2014; 5: 5452. Google Scholar CrossRef Search ADS PubMed 60. Barron AM, Ji B, Kito S, Suhara T, Higuchi M. Steroidogenic abnormalities in translocator protein knockout mice and significance in the aging male. Biochem J . 2017; BCJ20170645. 61. Rupprecht R, Papadopoulos V, Rammes G, Baghai TC, Fan J, Akula N, Groyer G, Adams D, Schumacher M. Translocator protein (18 kDa) (TSPO) as a therapeutic target for neurological and psychiatric disorders. Nat Rev Drug Discov . 2010; 9( 12): 971– 988. Google Scholar CrossRef Search ADS PubMed 62. Zhao AH, Tu LN, Mukai C, Sirivelu MP, Pillai VV, Morohaku K, Cohen R, Selvaraj V. Mitochondrial translocator protein (TSPO) function is not essential for heme biosynthesis. J Biol Chem . 2016; 291( 4): 1591– 1603. Google Scholar CrossRef Search ADS PubMed 63. Zhang BB, Wang DG, Guo FF, Xuan C. Mitochondrial membrane potential and reactive oxygen species in cancer stem cells. Fam Cancer . 2015; 14( 1): 19– 23. Google Scholar CrossRef Search ADS PubMed 64. Lin R, Angelin A, Da Settimo F, Martini C, Taliani S, Zhu S, Wallace DC. Genetic analysis of dTSPO, an outer mitochondrial membrane protein, reveals its functions in apoptosis, longevity, and Ab42-induced neurodegeneration. Aging Cell . 2014; 13( 3): 507– 518. Google Scholar CrossRef Search ADS PubMed 65. Veenman L, Gavish M. The role of 18 kDa mitochondrial translocator protein (TSPO) in programmed cell death, and effects of steroids on TSPO expression. Curr Mol Med . 2012; 12( 4): 398– 412. Google Scholar PubMed 66. Zeno S, Zaaroor M, Leschiner S, Veenman L, Gavish M. CoCl(2) induces apoptosis via the 18 kDa translocator protein in U118MG human glioblastoma cells. Biochemistry . 2009; 48( 21): 4652– 4661. Google Scholar CrossRef Search ADS PubMed 67. Šileikytė J, Blachly-Dyson E, Sewell R, Carpi A, Menabò R, Di Lisa F, Ricchelli F, Bernardi P, Forte M. Regulation of the mitochondrial permeability transition pore by the outer membrane does not involve the peripheral benzodiazepine receptor (Translocator Protein of 18 kDa (TSPO)). J Biol Chem . 2014; 289( 20): 13769– 13781. Google Scholar CrossRef Search ADS PubMed 68. Šileikytė J, Petronilli V, Zulian A, Dabbeni-Sala F, Tognon G, Nikolov P, Bernardi P, Ricchelli F. Regulation of the inner membrane mitochondrial permeability transition by the outer membrane translocator protein (peripheral benzodiazepine receptor). J Biol Chem . 2011; 286( 2): 1046– 1053. Google Scholar CrossRef Search ADS PubMed 69. Rostovtseva TK, Gurnev PA, Chen MY, Bezrukov SM. Membrane lipid composition regulates tubulin interaction with mitochondrial voltage-dependent anion channel. J Biol Chem . 2012; 287( 35): 29589– 29598. Google Scholar CrossRef Search ADS PubMed 70. Dumontet C, Jordan MA. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nat Rev Drug Discov . 2010; 9( 10): 790– 803. Google Scholar CrossRef Search ADS PubMed 71. Liu Y, Chen XJ. Adenine nucleotide translocase, mitochondrial stress, and degenerative cell death. Oxid Med Cell Longev . 2013 ; 2013: 146860. 72. Thomson M. Does cholesterol use the mitochondrial contact site as a conduit to the steroidogenic pathway? BioEssays . 2003; 25( 3): 252– 258. Google Scholar CrossRef Search ADS PubMed 73. Allen JA, Shankara T, Janus P, Buck S, Diemer T, Hales KH, Hales DB. Energized, polarized, and actively respiring mitochondria are required for acute Leydig cell steroidogenesis. Endocrinology . 2006; 147( 8): 3924– 3935. Google Scholar CrossRef Search ADS PubMed 74. Arakane F, Sugawara T, Nishino H, Liu Z, Holt JA, Pain D, Stocco DM, Miller WL, Strauss JF III. Steroidogenic acute regulatory protein (StAR) retains activity in the absence of its mitochondrial import sequence: implications for the mechanism of StAR action. Proc Natl Acad Sci USA . 1996; 93( 24): 13731– 13736. Google Scholar CrossRef Search ADS PubMed 75. Estabrook RW, Rainey WE. Twinkle, twinkle little StAR, how we wonder what you are. Proc Natl Acad Sci USA . 1996; 93( 24): 13552– 13554. Google Scholar CrossRef Search ADS PubMed Copyright © 2018 Endocrine Society http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Endocrinology Oxford University Press http://www.deepdyve.com/lp/oxford-university-press/crispr-cas9-mediated-tspo-gene-mutations-lead-to-reduced-mitochondrial-a3Z2YwRt0I

Loading next page...

References (99)

M. Clark, J. Shay (1981)
The role of tubulin in the steroidogenic response of murine adrenal and rat Leydig cells.
Endocrinology, 109 6
V. Papadopoulos, M. Baraldi, T. Guilarte, T. Knudsen, J. Lacapere, P. Lindemann, M. Norenberg, D. Nutt, Abraham Weizman, Ming-Rong Zhang, M. Gavish (2006)
Translocator protein (18kDa): new nomenclature for the peripheral-type benzodiazepine receptor based on its structure and molecular function.
Trends in pharmacological sciences, 27 8
F. Arakane, T. Sugawara, Hideaki Nishino, Zhiming Liu, John Holt, Debkumar Pain, D. Stocco, Walter Miller, Jerome Strauss (1996)
Steroidogenic acute regulatory protein (StAR) retains activity in the absence of its mitochondrial import sequence: implications for the mechanism of StAR action.
Proceedings of the National Academy of Sciences of the United States of America, 93 24
W. Shen, S. Azhar, F. Kraemer (2016)
Lipid droplets and steroidogenic cells.
Experimental cell research, 340 2
V. Khor, R. Ahrends, Ye Lin, W. Shen, Christopher Adams, A. Roseman, Y. Cortez, M. Teruel, S. Azhar, F. Kraemer (2014)
The Proteome of Cholesteryl-Ester-Enriched Versus Triacylglycerol-Enriched Lipid Droplets
PLoS ONE, 9
Li (1998)
4991
Endocrinology, 139
Jinjiang Fan, V. Papadopoulos (2013)
Evolutionary Origin of the Mitochondrial Cholesterol Transport Machinery Reveals a Universal Mechanism of Steroid Hormone Biosynthesis in Animals
PLoS ONE, 8
Midzak (2015)
572
Biochem Soc Trans, 43
A. Mukhin, V. Papadopoulos, E. Costa, K. Krueger (1989)
Mitochondrial benzodiazepine receptors regulate steroid biosynthesis.
Proceedings of the National Academy of Sciences of the United States of America, 86 24
M. Reers, S. Smiley, Cristina Mottola-Hartshorn, A. Chen, M. Lin, Lan-bo Chen (1995)
Mitochondrial membrane potential monitored by JC-1 dye.
Methods in enzymology, 260
Jinjiang Fan, M. Rone, V. Papadopoulos (2009)
Translocator Protein 2 Is Involved in Cholesterol Redistribution during Erythropoiesis*
The Journal of Biological Chemistry, 284
P. Elustondo, Laura Martin, B. Karten (2017)
Mitochondrial cholesterol import.
Biochimica et biophysica acta. Molecular and cell biology of lipids, 1862 1
S. King, Zhiming Liu, J. Soh, S. Eimerl, J. Orly, D. Stocco (1999)
Effects of disruption of the mitochondrial electrochemical gradient on steroidogenesis and the Steroidogenic Acute Regulatory (StAR) proteinProceedings of Xth International Congress on Hormonal Steroids, Quebec, Canada, 17–21 June 1998.
The Journal of Steroid Biochemistry and Molecular Biology, 69
Li (2015)
555
Science, 347
Bei-bei Zhang, Dao-gang Wang, Fen-fen Guo, Chao Xuan (2015)
Mitochondrial membrane potential and reactive oxygen species in cancer stem cells
Familial Cancer, 14
F. Arakane, C. Kallen, H. Watari, S. Stayrook, M. Lewis, J. Strauss (1998)
Steroidogenic acute regulatory protein (StAR) acts on the outside of mitochondria to stimulate steroidogenesis.
Endocrine research, 24 3-4
Rone (2009)
646
Biochim Biophys Acta, 1791
Mariusz Jaremko, Łukasz Jaremko, Garima Jaipuria, S. Becker, M. Zweckstetter (2015)
Structure of the mammalian TSPO/PBR protein.
Biochemical Society transactions, 43 4
V. Papadopoulos, A. Mukhin, E. Costa, K. Krueger (1990)
The peripheral-type benzodiazepine receptor is functionally linked to Leydig cell steroidogenesis.
The Journal of biological chemistry, 265 7
Jörg Martin, Kerstin Mahlke, Nikolaus PfannerS (1991)
Role of an energized inner membrane in mitochondrial protein import. Delta psi drives the movement of presequences.
The Journal of biological chemistry, 266 27
R. Banati, Ryan Middleton, Ronald Chan, Claire Hatty, Winnie Kam, Candice Quin, M. Graeber, A. Parmar, D. Zahra, P. Callaghan, S. Fok, N. Howell, M. Grégoire, A. Szabo, T. Pham, Emma Davis, Guo-Jun Liu (2014)
Positron emission tomography and functional characterization of a complete PBR/TSPO knockout
Nature Communications, 5
Justina Šileikytė, V. Petronilli, A. Zulian, F. Dabbeni-sala, G. Tognon, P. Nikolov, P. Bernardi, F. Ricchelli (2010)
Regulation of the Inner Membrane Mitochondrial Permeability Transition by the Outer Membrane Translocator Protein (Peripheral Benzodiazepine Receptor)*
The Journal of Biological Chemistry, 286
W. Miller (2007)
Mechanism of StAR's regulation of mitochondrial cholesterol import
Molecular and Cellular Endocrinology, 265
Fan (2013)
e76701
PLoS One, 8
Z. Granot, O. Kobiler, N. Melamed‐Book, S. Eimerl, Assaf Bahat, Bin Lu, S. Braun, M. Maurizi, C. Suzuki, A. Oppenheim, J. Orly (2007)
Turnover of mitochondrial steroidogenic acute regulatory (StAR) protein by Lon protease: the unexpected effect of proteasome inhibitors.
Molecular endocrinology, 21 9
Andrew Midzak, N. Denora, V. Laquintana, A. Cutrignelli, A. Lopedota, M. Franco, C. Altomare, V. Papadopoulos (2015)
2-Phenylimidazo[1,2-a]pyridine-containing ligands of the 18-kDa translocator protein (TSPO) behave as agonists and antagonists of steroidogenesis in a mouse leydig tumor cell line.
European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences, 76
Andrew Midzak, B. Zirkin, V. Papadopoulos (2015)
Translocator protein: pharmacology and steroidogenesis.
Biochemical Society transactions, 43 4
L. Veenman, M. Gavish (2012)
The role of 18 kDa mitochondrial translocator protein (TSPO) in programmed cell death, and effects of steroids on TSPO expression.
Current molecular medicine, 12 4
M. Ascoli (1981)
Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses.
Endocrinology, 108 1
Jamin (2005)
588
Mol Endocrinol, 19
Morohaku (2014)
89
Endocrinology, 155
R. Lin, A. Angelin, F. Settimo, C. Martini, S. Taliani, Shigong Zhu, D. Wallace (2014)
Genetic analysis of dTSPO, an outer mitochondrial membrane protein, reveals its functions in apoptosis, longevity, and Aβ42-induced neurodegeneration
Aging Cell, 13
Leeyah Issop, Jinjiang Fan, Sunghoon Lee, M. Rone, K. Basu, J. Mui, V. Papadopoulos (2015)
Mitochondria-associated membrane formation in hormone-stimulated Leydig cell steroidogenesis: role of ATAD3.
Endocrinology, 156 1
Papadopoulos (2006)
402
Trends Pharmacol Sci, 27
E. Maldonado, Jyoti Patnaik, Matthew Mullins, J. Lemasters (2010)
Free tubulin modulates mitochondrial membrane potential in cancer cells.
Cancer research, 70 24
Elustondo (2017)
90
Biochim Biophys Acta, 1862
Fan (2015)
Conditional steroidogenic cell-targeted deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation
Proc Natl Acad Sci USA, 112
N. Jamin, J. Neumann, M. Ostuni, T. Vu, Z. Yao, S. Murail, J. Robert, C. Giatzakis, V. Papadopoulos, J. Lacapere (2005)
Characterization of the cholesterol recognition amino acid consensus sequence of the peripheral-type benzodiazepine receptor.
Molecular endocrinology, 19 3
Jinjiang Fan, E. Campioli, Andrew Midzak, M. Culty, V. Papadopoulos (2015)
Conditional steroidogenic cell-targeted deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation
Proceedings of the National Academy of Sciences, 112
T. Hauet, Z. Yao, H. Bose, C. Wall, Zeqiu Han, Wenping Li, D. Hales, W. Miller, M. Culty, V. Papadopoulos (2005)
Peripheral-type benzodiazepine receptor-mediated action of steroidogenic acute regulatory protein on cholesterol entry into leydig cell mitochondria.
Molecular endocrinology, 19 2
Marí (2009)
2685
Antioxid Redox Signal, 11
Yaxin Liu, Xin Chen (2013)
Adenine Nucleotide Translocase, Mitochondrial Stress, and Degenerative Cell Death
Oxidative Medicine and Cellular Longevity, 2013
M. Rone, Jinjiang Fan, V. Papadopoulos (2009)
Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.
Biochimica et biophysica acta, 1791 7
C. Dumontet, M. Jordan (2010)
Microtubule-binding agents: a dynamic field of cancer therapeutics
Nature Reviews Drug Discovery, 9
Fan (2015)
7261
Proc Natl Acad Sci USA, 112
Jinjiang Fan, Xinlu Li, Leeyah Issop, M. Culty, V. Papadopoulos (2016)
ACBD2/ECI2-Mediated Peroxisome-Mitochondria Interactions in Leydig Cell Steroid Biosynthesis.
Molecular endocrinology, 30 7
M. Marí, A. Morales, A. Colell, C. Garcia-Ruiz, J. Fernandez-Checa (2009)
Mitochondrial glutathione, a key survival antioxidant.
Antioxidants & redox signaling, 11 11
Amy Zhao, Lan Tu, C. Mukai, M. Sirivelu, Viju Pillai, Kanako Morohaku, R. Cohen, V. Selvaraj (2015)
Mitochondrial Translocator Protein (TSPO) Function Is Not Essential for Heme Biosynthesis*
The Journal of Biological Chemistry, 291
T. Rostovtseva, P. Gurnev, Mengran Chen, S. Bezrukov (2012)
Membrane Lipid Composition Regulates Tubulin Interaction with Mitochondrial Voltage-dependent Anion Channel*
The Journal of Biological Chemistry, 287
Fei Li, Jian Liu, Yi Zheng, R. Garavito, S. Ferguson-Miller (2015)
Crystal structures of translocator protein (TSPO) and mutant mimic of a human polymorphism
Science, 347
N. Guex, M. Peitsch (1997)
SWISS‐MODEL and the Swiss‐Pdb Viewer: An environment for comparative protein modeling
ELECTROPHORESIS, 18
Kraemer (2017)
17
Mol Cell Endocrinol, 441
Vassilios Papadopoulos, Vassilios Papadopoulos, Jinjiang Fan, B. Zirkin (2018)
Translocator protein (18 kDa): an update on its function in steroidogenesis
Journal of Neuroendocrinology, 30
J. Gatliff, Daniel East, J. Crosby, R. Abeti, Robert Harvey, William Craigen, Peter Parker, M. Campanella (2014)
TSPO interacts with VDAC1 and triggers a ROS-mediated inhibition of mitochondrial quality control
Autophagy, 10
D. Stocco, Amy Zhao, Lan Tu, Kanako Morohaku, V. Selvaraj (2017)
A brief history of the search for the protein(s) involved in the acute regulation of steroidogenesis
Molecular and Cellular Endocrinology, 441
R. Rupprecht, V. Papadopoulos, G. Rammes, T. Baghai, Jinjiang Fan, Nagaraju Akula, Ghislaine Groyer, David Adams, M. Schumacher (2010)
Translocator protein (18 kDa) (TSPO) as a therapeutic target for neurological and psychiatric disorders
Nature Reviews Drug Discovery, 9
M. Gazouli, Zeqiu Han, V. Papadopoulos (2002)
Identification of a Peptide Antagonist to the Peripheral-Type Benzodiazepine Receptor That Inhibits Hormone-Stimulated Leydig Cell Steroid Formation
Journal of Pharmacology and Experimental Therapeutics, 303
Ela Kelly-Hershkovitz, R. Weizman, I. Spanier, S. Leschiner, M. Lahav, G. Weisinger, M. Gavish (1998)
Effects of Peripheral-type Benzodiazepine Receptor Antisense Knockout on MA-10 Leydig Cell Proliferation and Steroidogenesis*
The Journal of Biological Chemistry, 273
J. Lacapere, V. Papadopoulos (2003)
Peripheral-type benzodiazepine receptor: structure and function of a cholesterol-binding protein in steroid and bile acid biosynthesis
Steroids, 68
I. Spyropoulos, Theodore Liakopoulos, P. Bagos, S. Hamodrakas (2004)
TMRPres2D: high quality visual representation of transmembrane protein models
Bioinformatics, 20 17
V. Papadopoulos, F. Nowzari, K. Krueger (1991)
Hormone-stimulated steroidogenesis is coupled to mitochondrial benzodiazepine receptors. Tropic hormone action on steroid biosynthesis is inhibited by flunitrazepam.
The Journal of biological chemistry, 266 6
V. Papadopoulos, Yasaman Aghazadeh, Jinjiang Fan, E. Campioli, B. Zirkin, Andrew Midzak (2015)
Translocator protein-mediated pharmacology of cholesterol transport and steroidogenesis
Molecular and Cellular Endocrinology, 408
A. Barron, Bin Ji, S. Kito, T. Suhara, M. Higuchi (2018)
Steroidogenic abnormalities in translocator protein knockout mice and significance in the aging male.
The Biochemical journal, 475 1
T. Rostovtseva, Kely Sheldon, E. Hassanzadeh, C. Monge, V. Saks, S. Bezrukov, D. Sackett (2008)
Tubulin binding blocks mitochondrial voltage-dependent anion channel and regulates respiration
Proceedings of the National Academy of Sciences, 105
Miller (2007)
46
Mol Cell Endocrinol, 265-266
Andrew Midzak, Nagaraju Akula, L. Lecanu, V. Papadopoulos (2011)
Novel Androstenetriol Interacts with the Mitochondrial Translocator Protein and Controls Steroidogenesis*
The Journal of Biological Chemistry, 286
O. Sirenko, Jayne Hesley, I. Rusyn, E. Cromwell (2014)
High-content assays for hepatotoxicity using induced pluripotent stem cell-derived cells.
Assay and drug development technologies, 12 1
A. Duarte, C. Poderoso, Mariana Cooke, Gastón Soria, F. Maciel, V. Gottifredi, E. Podesta (2012)
Mitochondrial Fusion Is Essential for Steroid Biosynthesis
PLoS ONE, 7
K. Krueger, V. Papadopoulos (1990)
Peripheral-type benzodiazepine receptors mediate translocation of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells.
The Journal of biological chemistry, 265 25
V. Papadopoulos (2014)
On the role of the translocator protein (18-kDa) TSPO in steroid hormone biosynthesis.
Endocrinology, 155 1
Rone (2012)
1868
Mol Endocrinol, 26
M. Thomson (2003)
Does cholesterol use the mitochondrial contact site as a conduit to the steroidogenic pathway?
BioEssays, 25
Andrew Midzak, Nagaraju Akula, M. Rone, V. Papadopoulos (2015)
Computational modeling and biological validation of novel non-steroidal ligands for the cholesterol recognition/interaction amino acid consensus (CRAC) motif of the mitochondrial translocator protein (TSPO).
Pharmacological research, 99
R. Estabrook, W. Rainey (1996)
Twinkle, twinkle little StAR, how we wonder what you are.
Proceedings of the National Academy of Sciences of the United States of America, 93 24
D. Owen, Jinjiang Fan, E. Campioli, Sathvika Venugopal, Andrew Midzak, E. Daly, Aline Harlay, Leeyah Issop, V. Libri, Dimitra Kalogiannopoulou, E. Oliver, Enrique Gallego-Colon, A. Colasanti, L. Huson, E. Rabiner, P. Suppiah, C. Essagian, P. Matthews, V. Papadopoulos (2017)
TSPO mutations in rats and a human polymorphism impair the rate of steroid synthesis
Biochemical Journal, 474
M. Rone, Andrew Midzak, Leeyah Issop, G. Rammouz, S. Jagannathan, Jinjiang Fan, Xiaoying Ye, J. Blonder, T. Veenstra, V. Papadopoulos (2012)
Identification of a dynamic mitochondrial protein complex driving cholesterol import, trafficking, and metabolism to steroid hormones.
Molecular endocrinology, 26 11
Justina Šileikytė, E. Blachly‐Dyson, R. Sewell, A. Carpi, R. Menabò, F. Lisa, F. Ricchelli, P. Bernardi, M. Forte (2014)
Regulation of the Mitochondrial Permeability Transition Pore by the Outer Membrane Does Not Involve the Peripheral Benzodiazepine Receptor (Translocator Protein of 18 kDa (TSPO))*
The Journal of Biological Chemistry, 289
M. Gavish, R. Weizman (1997)
Role of peripheral-type benzodiazepine receptors in steroidogenesis.
Clinical neuropharmacology, 20 6
Stocco (2017)
7
Mol Cell Endocrinol, 441
Papadopoulos (2015)
90
Mol Cell Endocrinol, 408
Hua Li, V. Papadopoulos (1998)
Peripheral-Type Benzodiazepine Receptor Function in Cholesterol Transport. Identification of a Putative Cholesterol Recognition/Interaction Amino Acid Sequence and Consensus Pattern* * This work was supported by grant number ES-07747 from the National Institute of Environmental Health Sciences, NIH
Endocrinology, 139 12
T. Rostovtseva, S. Bezrukov (2012)
VDAC inhibition by tubulin and its physiological implications.
Biochimica et biophysica acta, 1818 6
Yasaman Aghazadeh, B. Zirkin, V. Papadopoulos (2015)
Pharmacological regulation of the cholesterol transport machinery in steroidogenic cells of the testis.
Vitamins and hormones, 98
Lan Tu, Kanako Morohaku, P. Manna, S. Pelton, W. Butler, D. Stocco, V. Selvaraj (2014)
Peripheral Benzodiazepine Receptor/Translocator Protein Global Knock-out Mice Are Viable with No Effects on Steroid Hormone Biosynthesis*♦
The Journal of Biological Chemistry, 289
Arakane (1998)
463
Endocr Res, 24
Li (1998)
Peripheral-type benzodiazepine receptor function in cholesterol transport: identification of a putative cholesterol recognition/interaction amino acid sequence and consensus pattern
Endocrinology, 139
F. Kraemer, W. Shen, S. Azhar (2017)
SNAREs and cholesterol movement for steroidogenesis
Molecular and Cellular Endocrinology, 441
Ye Lin, Xiaoming Hou, W. Shen, R. Hanssen, V. Khor, Y. Cortez, A. Roseman, S. Azhar, F. Kraemer (2016)
SNARE-Mediated Cholesterol Movement to Mitochondria Supports Steroidogenesis in Rodent Cells.
Molecular endocrinology, 30 2
Issop (2015)
334
Endocrinology, 156
Lin (2016)
234
Mol Endocrinol, 30
Lan Tu, Amy Zhao, D. Stocco, V. Selvaraj (2015)
PK11195 effect on steroidogenesis is not mediated through the translocator protein (TSPO).
Endocrinology, 156 3
S. Zeno, M. Zaaroor, S. Leschiner, L. Veenman, M. Gavish (2009)
CoCl(2) induces apoptosis via the 18 kDa translocator protein in U118MG human glioblastoma cells.
Biochemistry, 48 21
G. Hanson, R. Aggeler, D. Oglesbee, M. Cannon, R. Capaldi, R. Tsien, S. Remington (2004)
Investigating Mitochondrial Redox Potential with Redox-sensitive Green Fluorescent Protein Indicators*
Journal of Biological Chemistry, 279
Kanako Morohaku, S. Pelton, Daniel Daugherty, W. Butler, W. Deng, V. Selvaraj (2014)
Translocator protein/peripheral benzodiazepine receptor is not required for steroid hormone biosynthesis.
Endocrinology, 155 1
Weiyi Li, Chen Yang, Jing Lu, Ping Huang, C. Barnstable, Chun Zhang, S. Zhang (2014)
Tetrandrine protects mouse retinal ganglion cells from ischemic injury
Drug Design, Development and Therapy, 8
John Allen, Tristan Shankara, P. Janus, S. Buck, T. Diemer, K. Hales, D. Hales (2006)
Energized, polarized, and actively respiring mitochondria are required for acute Leydig cell steroidogenesis.
Endocrinology, 147 8
Aghazadeh (2015)
189
Vitam Horm, 98
Shen (2016)
209
Exp Cell Res, 340
Tu (2014)
27444
J Biol Chem, 289

Publisher: Oxford University Press
Copyright: Copyright © 2018 Endocrine Society
ISSN: 0013-7227
eISSN: 1945-7170
DOI: 10.1210/en.2017-03065
pmid: 29300865
Publisher site: See Article on Publisher Site

Abstract

Abstract The outer mitochondrial membrane translocator protein (TSPO) binds cholesterol with high affinity and is involved in mediating its delivery into mitochondria, the rate-limiting step in hormone-induced steroidogenesis. Specific ligand binding to TSPO has been shown to initiate steroid formation. However, recent studies of the genetic deletion of Tspo have provided conflicting results. Here, we address and extend previous studies by examining the effects of Tspo-specific mutations on steroid formation in hormone- and cyclic adenosine monophosphate (cAMP)–responsive MA-10 cells, using the CRISPR/Cas9 system. Two mutant subcell lines, nG1 and G2G, each carrying a Tspo exon2-specific genome modification, and two control subcell lines, G1 and HH, each carrying a wild-type Tspo, were produced. In response to dibutyryl cAMP, the nG1 and G2G cells produced progesterone at levels significantly lower than those produced by the corresponding control cells G1 and HH. Neutral lipid homeostasis, which provides free cholesterol for steroid biosynthesis, was altered significantly in the Tspo mutant cells. Interestingly, the mitochondrial membrane potential (ΔΨm) of the Tspo mutant cells was significantly reduced compared with that of the control cells, likely because of TSPO interactions with the voltage-dependent anion channel and tubulin at the outer mitochondrial membrane. Steroidogenic acute regulatory protein (STAR) expression was induced in nG1 cells, suggesting that reduced TSPO affected STAR synthesis and/or processing. Taken together, these results provide further evidence for the critical role of TSPO in steroid biosynthesis and suggest that it may function at least in part via its regulation of ΔΨm and effects on STAR. Steroid hormone biosynthesis begins with the conversion of cholesterol to pregnenolone by the mitochondrial enzyme CYP11A1. This reaction is dependent in part upon delivery of cholesterol from intracellular stores into mitochondria, the latter constituting the rate-determining step in steroidogenesis. Transport of free cholesterol to mitochondria for steroid biosynthesis involves steroidogenic acute regulatory protein (STAR or STARD1), soluble N-ethylmaleimide–sensitive factor attachment protein receptor proteins, and interactions of lipid droplets (LDs) with mitochondria and of mitochondria with the endoplasmic reticulum (1–7). STAR and soluble N-ethylmaleimide–sensitive factor attachment protein receptor proteins were shown to function primarily outside the mitochondria, where they are considered to be involved in trafficking of free cholesterol to the outer mitochondrial membrane (OMM) (8, 9). This pool of cholesterol must be segregated from the structural cholesterol of OMM and subsequently crosses from the OMM to the inner mitochondrial membrane (IMM) where CYP11A1 is located. Translocator protein (TSPO; 18 kDa) is a well-conserved, ubiquitous, integral OMM protein that is abundant in steroid-synthesizing cells. With its high affinity for cholesterol, TSPO is able to segregate cholesterol and to participate in its targeting to CYP11A1 (10, 11). Cholesterol binds at a specific binding site of TSPO, the latter termed the cholesterol recognition/interaction amino acid consensus motif (12–14). TSPO-mediated cholesterol targeting to CYP11A1 is likely achieved through the formation of a multiprotein complex of OMM and IMM proteins, including TSPO, voltage-dependent anion channel (VDAC), adenosine triphosphatase family AAA domain–containing protein 3, and CYP11A1 (11). TSPO binds with high affinity to diverse compounds and endogenous ligands that can regulate its activity (5). Biochemical and pharmacological studies using TSPO ligands strongly support the contention that TSPO plays an important role in cholesterol import into mitochondria and thus in steroidogenesis (5, 15, 16). TSPO abundance in steroidogenic cells may be linked to the tissue/cell-specific need for the amounts of free cholesterol to be imported into mitochondria. The presence of TSPO and cholesterol in the OMM may affect mitochondrial membrane fluidity/permeability, fission/fusion processes, membrane protein/transporter function(s), and membrane potential (ΔΨm) (17–19). Recent studies of genetic deletion of Tspo in mice have provided conflicting data, including no effect on steroid synthesis, ablation of corticosteroid response to adrenocorticotropic hormone, and changes in lipid homeostasis in testicular Leydig cells (20–23). Conflicting data based on MA-10 mouse Leydig cells also have been published. Thus, knockdown of Tspo expression using antisense oligonucleotides was reported to reduce the ability of the cells to form steroids, but CRISPR/Cas9‒guided Tspo deletion was reported to have no effect on steroid synthesis (24–26). The current studies were designed to reevaluate the effect of CRISPR/Cas9‒guided Tspo deletion on the ability of MA-10 cells to form steroids and to further our understanding of how TSPO functions in this process. TSPO deficiency led to reduced dibutyryl–cyclic adenosine monophosphate (dbcAMP)‒stimulated steroid biosynthesis and increased esterified, cholesterol-enriched neutral lipid accumulation, suggesting reduction in the import of the steroidogenic pool of cholesterol into mitochondria. Data suggest that this is most likely due to TSPO-mediated reduced mitochondrial ΔΨmvia regulation of VDAC1/tubulin interaction. In addition, we show that STAR levels were increased in TSPO-deficient cells, suggesting that increased STAR expression levels and/or altered STAR processing might compensate to some extent for reduced TSPO. These results support the contention that TSPO plays a major role in steroid biosynthesis and further suggest that TSPO may function at least in part via regulation of ΔΨm and effects on STAR. Materials and Methods Cell culture MA-10 cells were maintained in Dulbecco’s modified Eagle medium/F-12 medium supplemented with 5% heat-inactivated fetal bovine serum and 2.5% horse serum (27). The MA-10-derived wild-type (WT) subcell lines and the Tspo genome-edited subcell lines nG1 and G2G were grown in this medium supplemented with 400 μg/mL of G418 (Roche Diagnostics, Indianapolis, IN), 100 U/mL of penicillin, and 100 μg/mL of streptomycin in 5% CO2/air at 37°C, as described previously (28). The cells used for confocal microscopy and microplate reader studies were cultured on single 35-mm FluoroDishTM sterile culture dishes (World Precision Instruments, Sarasota, FL) or in 96-well plates (ViewPlate-96 black with optically clear bottom; PerkinElmer Canada Inc., Markham, ON, Canada). CRISPR/Cas9–mediated genome editing of Tspo genes in MA-10 cell lines Two guide RNAs (gRNAs) specifically targeting Tspo exon2 were designed using the CRISPR gRNA Design Tool (https://www.atum.bio). They were cloned into the GeneArt® CRISPR Nuclease Vector with OFP Reporter (Thermo Fisher Scientific, Mississauga, ON, Canada) through annealing of the following two oligonucleotides: Tspo-gRNA#1 ‒ gRNA1-Rn: 5′-GCCTACTTTGTACGTGGCGAGTTTT-3′ and gRNA1-Fn: 5′- TCGCCACGTACAAAGTAGGCCGGTG-3′; Tspo-gRNA#2 ‒ gRNA2-Rn: 5′-GCAAGCTAGCATACCACCGGGTTTT-3′ and gRNA2-Fn: 5′-CCGGTGGTATGCTAGCTTGCCGGTG-3′. The orange fluorescent protein (OFP) reporter allows for the transient expression of the OFP needed for fluorescence-based tracking of transfection efficiency and fluorescence-activated cell sorting (FACS)‒based sorting/enrichment of Cas9- and CRISPR-expressing cells. All the plasmids that contained the gRNAs were confirmed by sequencing, using U6 forward sequencing primer 5′-GGACTATCATATGCTTACCG-3′. The verified plasmids were purified with a Qiagen Endofree Maxi-Prep Kit (QIAGEN, Germantown, MD). To monitor mitochondrial activity, we established a subcell line derived from MA-10 cells, designated Mito-H, in which a mitochondrial reduction-oxidation sensitive green fluorescent protein 1 (Mito-roGFP) was stably expressed (28). The Mito-H cells expressed high levels of Mito-roGFP and formed progesterone in response to dbcAMP (28). Mito-H cells were cultured overnight in six-well plates to 80% confluence and then transfected with the GeneArt CRISPR Nuclease Vector with OFP Reporter containing each Tspo-specific gRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. After 24-hour transfection, the cells were subjected to FACS using BD FACSAria Fusion (five lasers, 18 parameters; BD Biosciences, San Jose, CA), and the positive cells were sorted and expanded. Tspo deletion was confirmed by polymerase chain reaction of genomic DNA using the Tspo-specific primers Exon2-R, 5′-TCAGATCTTTCCAGAACATCAGTTGC-3′ and Exon2-F, 5′-TGGCACCTACAACTACCTACCCCATGG-3′ and reverse transcription polymerase chain reaction using primers TSPO-R, 5′-GCGAAGCTTCGATGCCTGAATCCTGGGTGCC-3′ and TSPO-F, 5′-GCGGGATCCCTCACTCTGGGAGCCGGGAGCC-3′. Immunoblotting assay was performed using commercial anti-TSPO antibodies (Abs) (Table 1), and immunofluorescence was carried out using a laser-scanning confocal microscopy imaging system and epifluorescence microscopy. Table 1. Table of Information About Antibodies Peptide/Protein Target Antigen Sequence (if Known) Name of Antibody Manufacturer: Catalog No., or Name of Source; RRID Species Raised in; Monoclonal or Polyclonal Dilution Used (IF, IB) TSPO Anti-TSPO [EPR5384] Abcam: ab109497; RRID: AB_10862345 Rabbit 1:100 (IF) 1:1000 (IB) STAR Anti-STAR (FL-285) Santa Cruz Biotechnology Inc.: sc-25806; RRID: AB_2115937 Rabbit 1:1000 (IF) CYP11A1 Anti-CYP11A1 Abcam: ab175408; RRID: AB_2721042 Rabbit 1:1500 (IB) Rabbit IgG Anti-Rabbit IgG (H+L) Secondary Antibody conjugated with Alexa Fluor® 546 Thermo Fisher: A10040; RRID: AB_2534016 Donkey 1:100 (IF) HPRT Anti-HPRT Abcam: ab10479; RRID: AB_297217 Rabbit 1:1300 COX IV Anti-COX IV Abcam: ab16056; RRID: AB_443304 Rabbit 1:1300 GAPDH Anti-GAPDH Trevigen: 2275-PC-100; RRID: AB_2107456 Rabbit 1:5000 Rabbit IgG HRP-linked antibody Cell Signaling Technology: #7074; RRID: AB_2099233 Goat 1:1300 Mouse IgG HRP-linked antibody Cell Signaling Technology: #7076; RRID: AB_330924 Horse 1:1300 Biotin HRP-linked antibody Cell Signaling Technology: #7075; RRID: AB_10696897 Goat 1:3000 Rabbit IgG Rabbit IgG (H+L) Molecular Probes: A10040; RRID: AB_2534016 Donkey 1:500 Mouse IgG Anti-mouse IgG (H+L) Molecular Probes: P31582; RRID: AB_10374586 Goat 1:500 Goat IgG Anti-goat IgG (H+L) Molecular Probes: A-11055; RRID: AB_142672 Donkey 1:500 Peptide/Protein Target Antigen Sequence (if Known) Name of Antibody Manufacturer: Catalog No., or Name of Source; RRID Species Raised in; Monoclonal or Polyclonal Dilution Used (IF, IB) TSPO Anti-TSPO [EPR5384] Abcam: ab109497; RRID: AB_10862345 Rabbit 1:100 (IF) 1:1000 (IB) STAR Anti-STAR (FL-285) Santa Cruz Biotechnology Inc.: sc-25806; RRID: AB_2115937 Rabbit 1:1000 (IF) CYP11A1 Anti-CYP11A1 Abcam: ab175408; RRID: AB_2721042 Rabbit 1:1500 (IB) Rabbit IgG Anti-Rabbit IgG (H+L) Secondary Antibody conjugated with Alexa Fluor® 546 Thermo Fisher: A10040; RRID: AB_2534016 Donkey 1:100 (IF) HPRT Anti-HPRT Abcam: ab10479; RRID: AB_297217 Rabbit 1:1300 COX IV Anti-COX IV Abcam: ab16056; RRID: AB_443304 Rabbit 1:1300 GAPDH Anti-GAPDH Trevigen: 2275-PC-100; RRID: AB_2107456 Rabbit 1:5000 Rabbit IgG HRP-linked antibody Cell Signaling Technology: #7074; RRID: AB_2099233 Goat 1:1300 Mouse IgG HRP-linked antibody Cell Signaling Technology: #7076; RRID: AB_330924 Horse 1:1300 Biotin HRP-linked antibody Cell Signaling Technology: #7075; RRID: AB_10696897 Goat 1:3000 Rabbit IgG Rabbit IgG (H+L) Molecular Probes: A10040; RRID: AB_2534016 Donkey 1:500 Mouse IgG Anti-mouse IgG (H+L) Molecular Probes: P31582; RRID: AB_10374586 Goat 1:500 Goat IgG Anti-goat IgG (H+L) Molecular Probes: A-11055; RRID: AB_142672 Donkey 1:500 Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT, hypoxanthine-guanine phosphoribosyltransferase; IB, immunoblotting; IF, immunofluorescence; IgG, immunoglobulin G; RRID, Research Resource Identifier. View Large Radioimmunoassay Progesterone production was determined by radioimmunoassay using antiprogesterone antisera (MP Biomedicals, Santa Anna, CA) and [1,2,6,7-3H] progesterone (specific activity 94.1 Ci/mmol; PerkinElmer), as we have done previously (28). The interassay coefficient of variation for the progesterone assay was 7.5%. All measurements were further validated using the solid-phase enzyme immunoassay. All samples were assayed in triplicate. Mean values of progesterone in medium from four biological replicates ranged between 25.19 and 326.65 pg/mL, and the %B/B0 values were from 44.6% to 78.5%, which are within the 20% to 80% B/B0 range. Progesterone production was normalized to the amount of protein in each well and quantified using the Bio-Rad Protein Assay reagent (Bio-Rad Laboratories Ltd., Mississauga, ON, Canada). Radioimmunoassay data were analyzed using GraphPad Prism (version 5.02; GraphPad Software, La Jolla, CA). Neutral lipid staining and measurement Neutral lipid staining was performed using Nile red (also known as Nile blue oxazone; AAT Bioquest, Inc., San Francisco, CA). To this end, cells were incubated at 37°C for 10 minutes in a solution of Nile red in dimethyl sulfoxide (DMSO) diluted 1:200 in serum-free OPTI medium (Invitrogen). Cells were observed by confocal microscopy to monitor fluorescence change at excitation/emission (Ex/Em) = 488/528 nm. The stained LDs were quantified using ImageJ software (https://imagej.nih.gov/ij/). Mitochondrial staining and transmission electron microscopy imaging To stain mitochondria, the cells were grown to 50% confluence, treated with 1 mM of dbcAMP for 2 hours, and then stained with MitoTracker Red CMXRos (Invitrogen) for 20 minutes at 37°C. Live cells were observed by Zeiss LSM780 inverted laser scanning confocal microscopy (Carl Zeiss Microscopy LLC, Thornwood, NY). Transmission electron microscopy (TEM) imaging was performed at the Facility for Electron Microscopy Research of McGill University (7). In brief, subcell lines were fixed in 2.5% glutaraldehyde in 0.1 M of sodium cacodylate buffer, postfixed in 1% OsO4, and examined by TEM (TecnaiTM 12; FEI, Hillsboro, OR). Mitochondrial Δψm, redox measurement, and high-content imaging To assay mitochondrial Δψm, MA-10 and MA-10‒derived cells were washed with reduced-serum medium (Opti-MEM; Thermo Fisher Scientific), treated without or with 1 mM of dbcAMP for 2 hours, and then stained with JC-10 (1:600) for 30 minutes. The plates were read using the PerkinElmer EnSpire Multimode Plate Reader with Ex/Em = 485/534 nm or 540/570 nm. The same plates were imaged using the ImageXpress micro XLS wide-field high-content analysis system (Molecular Devices, Sunnyvale, CA) or an ultra-confocal high-content analysis system to validate the plate readings. For HH and G2G subcell lines with stable Mito-roGFP expression, Δψm was measured using the TMRE‒Mitochondrial Membrane Potential Assay Kit (Abcam, Toronto, ON, Canada). Tetramethylrhodamine ethyl ester (TMRE) was used to treat the cells without or with carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP), an ionophore uncoupler of oxidative phosphorylation that eliminates membrane potential (Δψm). After staining with 200 nM of TMRE for 20 minutes, measurements were performed with Ex/Em = 549/575 nm and 361/486 nm. As control, 20 μM of FCCP was added before the staining/measurement. The same assays were performed under different treatments and time periods. The treatments included incubation with PK 11195 [1-(2-chlorophenyl)-N-methyl-N-(1-methylpropyl)-3-isoquinolinecarboxamide; Sigma-Aldrich Canada Ltd., Oakville, ON, Canada] used at 100 nM in medium from 100 mM of stock solution in DMSO; XBD173 (AC-5216; Emapunil; Tractus Chemical, Hong Kong, China) at 20 μM in medium from 5 mM of stock solution in DMSO; H-89 dihydrochloride hydrate (Sigma-Aldrich) used at 1 and 10 μM in medium from 10 mM of stock solution in DMSO; or paclitaxel (Sigma-Aldrich Canada Ltd.) at 100 nM in culture medium from 1 mM of stock solution in DMSO. Cells were treated with PK 11195, XBD173, or paclitaxel for 4 hours or with H-89 for 30 minutes before the Δψm measurements were undertaken. Laser scanning confocal microscopy For live cell staining of microtubules, the cells were stained with MitoTracker Red CMXRos (Invitrogen; Ex/Em: 579/599) for 20 minutes and then with TubulinTracker™ Green (Oregon Green® 488 Taxol, bis-acetate; Ex/Em: 494/522 nm) (Thermo Fisher Scientific) for 30 minutes (37°C), as described by the manufacturer. For live cell staining of STAR protein, the cells were transfected with the plasmids encoding a mitochondria-targeted blue fluorescent protein (Ex/Em: 402/457 nm) and STAR-DsRed monomer (Ex/Em: 557/592 nm) overnight and then incubated with MitoTracker® Deep Red FM (Invitrogen; Ex/Em: 644/665 nm) for 20 to 30 minutes. The stained cells were viewed by confocal microscopy. For immunofluorescence staining, the cells were fixed in a 4% paraformaldehyde solution plus 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 5 minutes and washed in PBS for 5 minutes. After blocking with 1% bovine serum albumin in PBS plus 10% donkey normal serum for 30 minutes at 37°C, the cells were incubated with rabbit anti-TSPO monoclonal Ab [EPR5384] (Abcam) overnight and then with Donkey anti-Rabbit IgG (H+L) Secondary Antibody conjugated with Alexa Fluor® 546 (Thermo Fisher Scientific) for 1 hour at room temperature (Table 1). Cells were mounted using UltraCruz® Aqueous Mounting Medium containing 4′,6-diamidino-2-phenylindole (Santa Cruz Biotechnology, Dallas, TX). Cells were imaged with the Olympus FluoviewTM FV1000 laser confocal microscope and Olympus IX51 inverted epifluorescence microscope (Tokyo, Japan) and/or a Zeiss LSM780 inverted laser scanning confocal microscope (Carl Zeiss Inc.). Images were analyzed by ImageJ software (https://imagej.nih.gov/ij/). Detection of caspase-3/7 activity and cell proliferation and viability assay To assess whether the reduced progesterone production in cells with TSPO deficiency was due to programmed cell death induced by the dbcAMP treatment, we treated the cells with dbcAMP for 2 hours, then added CellEventTM caspase-3/7 green detection reagent (1:600; Thermo Fisher Scientific) for 30 minutes before imaging with the Olympus FluoviewTM FV1000 laser confocal microscope. Apoptotic cells (green) and nonapoptotic cells (counterstained blue) were counted using Image-Pro 6.3 (Media Cybernetics Inc., Silver Spring, MD). Cell proliferation assays were performed using the WST-1 colorimetric test, which measures mitochondrial dehydrogenase activity by the cleavage of the tetrazolium salt WST-1 to form a red formazan dye by viable cells (Cell Proliferation Reagent WST-1; Roche). Cells were seeded at the same density in serum-free media. Cell density per well before and after dbcAMP treatment was assessed by collecting OD450nm/620 nm values using the VictorTM X5 2030 Multilabel Reader (PerkinElmer, Waltham, MA). Immunoblot analysis Total protein extracts for immunoblot analysis were prepared from MA-10 cells and its derived cell lines using M-PER Mammalian Protein Extraction Reagent (Thermo Fisher Scientific). After centrifugation, protein concentration was quantified using the Bradford dye assay (Bio-Rad Laboratories Ltd.). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblot analysis were performed as previously described (29). In brief, 20 μg of protein extract was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis using a 4% to 20% Tris-glycine gradient gel (Invitrogen) and electrotransferred to a polyvinylidene fluoride membrane. Membranes were blocked in 10% fat-free milk overnight and incubated with primary Abs specific for TSPO, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine-guanine phosphoribosyltransferase, STAR, CYP11A1, or COX IV, followed by anti-rabbit immunoglobulin-G horseradish peroxidase-conjugated secondary Ab (Cell Signaling Technology, Danvers, MA). Information about the Abs and dilutions used are provided in Table 1. In the case of anti-STAR immunoblot, the membranes were stripped of the Ab using Restore™ Western Blot Stripping Buffer (Thermo Fisher Scientific) and were reprobed using anti-COX IV. Immunoreactive proteins were visualized using the Amersham ECL Western Blotting Detection Reagent (GE Healthcare Life Sciences, Mississauga, ON, Canada), and images were captured using a FUJI image reader LAS4000 (Fujifilm, Tokyo, Japan). Molecular modeling The predicted secondary structure of TSPO was produced using TMRPres2D (30). The molecular surfaces of WT TSPO (PDB: 2MGY) were produced after removal of PK 11195 and with minimized energy in the Swiss-PdbViewer (V.4.1) (31, 32). Statistical analysis Data were expressed as mean ± standard error of the mean, and graphic presentation was performed using GraphPad Prism (version 5.02; GraphPad Software) for Windows. Statistical analyses of data were performed by the unpaired Student t test. Mean differences were considered statistically different when P < 0.05. Results CRISPR/Cas9‒mediated Tspo deletion mutation in MA-10 cells To generate Tspo mutant/deleted cell lines, we designed two gRNAs specifically targeting Tspo exon2. The two, gRNA1 (in red) and gRNA2 (in green), were cloned into the GeneArt® CRISPR Nuclease Vector with OFP Reporter (Fig. 1A and 1B). After their transfection into cells of the MA-10 subline Mito-H, we performed FACS analysis that resulted in four major groups of cell populations [quarter (Q) 1, Q2, Q3, and Q4]: G1, cells expressing OFP without detectable gene deletion; nG1, cells expressing OFP with detectable Tspo-targeted gene deletion; G2G, cells expressing both Mito-roGFP and OFP with Tspo-targeted gene deletion; and HH, cells expressing Mito-GFP without Tspo gene deletion (Fig. 1C and 1D). The Tspo-specific gene deletions were confirmed by locus-specific polymerase chain reaction and sequencing in comparison with the WT gene sequence (Supplemental Fig. 1A‒1C). The characteristics of each MA-10‒derived subcell line are summarized in Table 2. After expansion of the cell colonies, immunoblotting analyses were performed to validate the TSPO protein depletion or mutation. The results showed that no immunoreactive TSPO protein could be detected in G2G cells (Supplemental Fig. 1D), a result supported by reverse transcription polymerase chain reaction analysis showing that the sizes of corresponding messenger RNA shifted, especially in the nG1 cells (Supplemental Fig. 1E). In addition, immunoblotting analysis of the nG1 cells showed that the 18 kDa TSPO protein monomer disappeared, although a higher molecular weight immunoreactive TSPO polymer appeared (Supplemental Fig. 1F). We also assessed whether the expression levels of CYP11A1, the mitochondrial enzyme that catalyzes conversion of cholesterol to pregnenolone, were affected by the genome editing system. The results show that the subcell line contained CYP11A1 at levels equal to those of WT cells (Supplemental Fig. 1G). These data suggest that Tspo in both nG1 and G2G was successfully mutated using the CRISPR/Cas9 methodology, resulting in depletion of the 18 kDa TSPO or dramatic reduction of its expression. Figure 1. View large Download slide Screening and validation of CRISPR/Cas9‒mediated Tspo mutant MA-10 mouse Leydig cells. (A) Two gRNAs, cloned-gRNA1 and cloned-gRNA2, were designed within exon2 of the Tspo gene after the codon ATG. Exon2-R and Exon2-F were the primers used for screening of mutant genomic DNAs. (B) Exon2 and its flanking sequences are shown. Red, gRNA1; green, gRNA2; orange, the gap between gRNA1 and gRNA2. Bold letters, exon2; small letters, intron sequence. (C, D) Cell sorting of the Mito-H cells [MA-10 cells expressing Mito-roGFP (28)] transfected with the two plasmid constructs from (C) gRNA1 and (D) gRNA2 for 24 hours was performed by FACS. The resulting graphs show the four subpopulations of cells in scattergrams: G1/nG1 (Q1), the transfected cells lacking Mito-roGFP; G2G (Q2), the transfected cells expressing Mito-roGFP; basal (Q3) cells expressing Mito-roGFP; and HH (Q4), cells with higher expression of Mito-roGFP. (E–L) Immunofluorescence (IF) staining of TSPO in the CRISPR/Cas9‒mediated mutant cells nG1 and G2G in comparison with the WT cells G1 and HH, respectively. The IF was performed using laser scanning confocal microscopy as well as epifluorescence microscopy in WT cells [(E) and (G) for G1; (I) and (K) for HH] and in mutant cells [(F) and (H) for nG1; (J) and (L) for G2G]. TSPO was labeled with rabbit monoclonal anti-TSPO Ab and Alexa Fluor® 546 Donkey Anti-Rabbit IgG (E, F, I, and J) in red for confocal images and (G, H, K, and L) in yellow for epifluorescence images. Original images for highlighted areas in panels E, F, I, and J are presented in Supplemental Fig. 2. (H, L) The merged channel of red/blue, where only a few G2G cells have very weak staining for TSPO or background staining, is shown; the nucleus was counterstained in blue using DAPI. Mitochondria were counterstained with MitoTrackerTM Deep Red FM and painted in green and are also shown by Mito-roGFP in blue for cells HH and G2G. Scale bars: 5 μm for confocal images and 100 μm for epifluorescence images. DAPI, 4′,6-diamidino-2-phenylindole; IgG, immunoglobulin-G. Figure 1. View large Download slide Screening and validation of CRISPR/Cas9‒mediated Tspo mutant MA-10 mouse Leydig cells. (A) Two gRNAs, cloned-gRNA1 and cloned-gRNA2, were designed within exon2 of the Tspo gene after the codon ATG. Exon2-R and Exon2-F were the primers used for screening of mutant genomic DNAs. (B) Exon2 and its flanking sequences are shown. Red, gRNA1; green, gRNA2; orange, the gap between gRNA1 and gRNA2. Bold letters, exon2; small letters, intron sequence. (C, D) Cell sorting of the Mito-H cells [MA-10 cells expressing Mito-roGFP (28)] transfected with the two plasmid constructs from (C) gRNA1 and (D) gRNA2 for 24 hours was performed by FACS. The resulting graphs show the four subpopulations of cells in scattergrams: G1/nG1 (Q1), the transfected cells lacking Mito-roGFP; G2G (Q2), the transfected cells expressing Mito-roGFP; basal (Q3) cells expressing Mito-roGFP; and HH (Q4), cells with higher expression of Mito-roGFP. (E–L) Immunofluorescence (IF) staining of TSPO in the CRISPR/Cas9‒mediated mutant cells nG1 and G2G in comparison with the WT cells G1 and HH, respectively. The IF was performed using laser scanning confocal microscopy as well as epifluorescence microscopy in WT cells [(E) and (G) for G1; (I) and (K) for HH] and in mutant cells [(F) and (H) for nG1; (J) and (L) for G2G]. TSPO was labeled with rabbit monoclonal anti-TSPO Ab and Alexa Fluor® 546 Donkey Anti-Rabbit IgG (E, F, I, and J) in red for confocal images and (G, H, K, and L) in yellow for epifluorescence images. Original images for highlighted areas in panels E, F, I, and J are presented in Supplemental Fig. 2. (H, L) The merged channel of red/blue, where only a few G2G cells have very weak staining for TSPO or background staining, is shown; the nucleus was counterstained in blue using DAPI. Mitochondria were counterstained with MitoTrackerTM Deep Red FM and painted in green and are also shown by Mito-roGFP in blue for cells HH and G2G. Scale bars: 5 μm for confocal images and 100 μm for epifluorescence images. DAPI, 4′,6-diamidino-2-phenylindole; IgG, immunoglobulin-G. Table 2. MA-10 Cells (WT) and Derived Cell Lines Used in This Study MA-10 Cell/Characteristics Mito-roGFP a OFP b Tspo WT − − + Mito-H + − + G1 − +/− + nG1 − +/− − G2G ++ +/− − HH ++ − + Basal − − + MA-10 Cell/Characteristics Mito-roGFP a OFP b Tspo WT − − + Mito-H + − + G1 − +/− + nG1 − +/− − G2G ++ +/− − HH ++ − + Basal − − + Abbreviations: −, no expression; +, expression; ++, strong expression; +/−, transient expression. a Mito-H, a stable cell line expressing Mito-roGFP; Mito-HH, a stable cell line expressing Mito-roGFP after resorting the Mito-H cells using an excitation wavelength of 488 nm. b The expression of OFP is transient; OFP will be absent after the expansion of the cell line(s). View Large Immunofluorescence analyses of WT and Tspo-deleted cell lines by confocal laser scanning microscopy and epifluorescence microscopy show that the WT TSPO was expressed on the OMM (Fig. 1E, 1G, 1I, and 1K; Supplemental Fig. 2A and 2C). However, in the Tspo mutant cells, there were no or very few cells stained by the anti-TSPO Ab (Fig. 1F, 1H, 1J, and 1L; and Supplemental Fig. 2B and 2D). These data suggest that TSPO was mutated and/or depleted in the MA-10 subcell lines nG1 and G2G, whereas the expression of TSPO in the corresponding original MA-10 subcell lines G1 and HH was not affected. TSPO deficiency inhibited dbcAMP-stimulated progesterone production The sequence alignment of the targeting regions from WT, nG1, and G2G cells indicated the deletion of four nucleotide acids, “GTGG,” in G2G and 26 nucleotide acids, “TGTACGTGGCGAGGGCCTCCGGTGGT,” in nG1 (Fig. 2A). The corresponding open reading frames were aligned to show that both Tspo mutant cells likely encode an N-terminal truncated protein, as shown in the amino acid sequence alignment (Fig. 2B) and secondary structure of the WT TSPO (Supplemental Fig. 3A). Nevertheless, the mutant TSPO from both cell lines, if any was expressed, may not have functioned the same as WT TSPO because its molecular surface would be changed from a positive potential to a neutral potential (Supplemental Fig. 3B). Figure 2. View largeDownload slide Genomic structure, predicted truncated peptides, defective steroid biosynthesis, and altered neutral lipid homeostasis in the Tspo mutant cells nG1 and G2G. (A) Genomic sequence alignments of nG1, G2G, and WT Tspo loci around the CRISPR/Cas9 targeting area. Dashes indicate the deletion of 26 nucleotides in nG1 cells and four nucleotides in G2G cells. (B) Predicted peptides of mutant TSPO in nG1, G2G, and WT cells. The second likely methionine (M60) seems to be present in both mutant nG1 and G2G cells. Dashes indicate the gaps introduced for sequence alignment or the missing amino acids in the predicted mutant proteins. Red arrow indicates one of the two tyrosines forming the covalent bound in TSPO dual topology model. (C, D) Disrupted stimulated progesterone production in nG1 vs G1 cells: (C) control vs (D) dbcAMP treatment. (E, F) Reduced stimulated progesterone production in G2G vs HH cells: (E) control vs (F) dbcAMP treatment. Results shown are means ± standard error of the mean (SEM; n = 4). (G–K) TSPO deficiency led to increased cytosolic neutral lipid accumulation in the cells after dbcAMP treatment. (G, H) The LDs include esterificed cholesterol stained with Nile Red in G1 cells (G) before and (H) after dbcAMP treatment. (I, J) LDs include esterificed cholesterol stained with Nile red in nG1 cells (I) before and (J) after dbcAMP treatment. Red arrows indicate representative LDs in white. (K) Quantification of LDs per cell among the cells used: G1 control, G1 with dbcAMP treatment, nG1 control, and nG1 with dbcAMP treatment. Results shown are means ± SEM (n = 386). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. Figure 2. View largeDownload slide Genomic structure, predicted truncated peptides, defective steroid biosynthesis, and altered neutral lipid homeostasis in the Tspo mutant cells nG1 and G2G. (A) Genomic sequence alignments of nG1, G2G, and WT Tspo loci around the CRISPR/Cas9 targeting area. Dashes indicate the deletion of 26 nucleotides in nG1 cells and four nucleotides in G2G cells. (B) Predicted peptides of mutant TSPO in nG1, G2G, and WT cells. The second likely methionine (M60) seems to be present in both mutant nG1 and G2G cells. Dashes indicate the gaps introduced for sequence alignment or the missing amino acids in the predicted mutant proteins. Red arrow indicates one of the two tyrosines forming the covalent bound in TSPO dual topology model. (C, D) Disrupted stimulated progesterone production in nG1 vs G1 cells: (C) control vs (D) dbcAMP treatment. (E, F) Reduced stimulated progesterone production in G2G vs HH cells: (E) control vs (F) dbcAMP treatment. Results shown are means ± standard error of the mean (SEM; n = 4). (G–K) TSPO deficiency led to increased cytosolic neutral lipid accumulation in the cells after dbcAMP treatment. (G, H) The LDs include esterificed cholesterol stained with Nile Red in G1 cells (G) before and (H) after dbcAMP treatment. (I, J) LDs include esterificed cholesterol stained with Nile red in nG1 cells (I) before and (J) after dbcAMP treatment. Red arrows indicate representative LDs in white. (K) Quantification of LDs per cell among the cells used: G1 control, G1 with dbcAMP treatment, nG1 control, and nG1 with dbcAMP treatment. Results shown are means ± SEM (n = 386). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. To examine the effect of mutant TSPO on Leydig cell steroid biosynthesis, we assessed progesterone production by nG1 and G2G cells under basal conditions and in response to dbcAMP treatment. There were no significant changes in basal progesterone production between TSPO mutant nG1 and G2G cells compared with their respective control G1 and HH cells (Fig. 2C and 2E). However, progesterone production in response to dbcAMP treatment was abolished in nG1 cells compared with control G1 cells (Fig. 2D) and was significantly reduced, by 60% in G2G cells compared with their control HH cells (Fig. 2F). TSPO deficiency led to neutral lipid accumulation after dbcAMP stimulation To interpret reduced progesterone biosynthesis by cells with TSPO deficiency, we speculated that the free cholesterol used for steroid biosynthesis would accumulate in the cytosol. In steroidogenic cells, free cholesterol can be stored in LDs containing a neutral lipid core surrounded by a phospholipid monolayer and associated proteins (33). We used Nile red to stain the neutral lipids in LDs (Fig. 2G‒2J). In control G1 cells, dbcAMP stimulation resulted in significant reduction in LDs, suggesting that LDs were used to supply cholesterol for steroidogenesis. In contrast, there was a significant increase in LD numbers in dbcAMP-stimulated TSPO-deficient nG1 cells (Fig. 2K). These data suggest that the free cholesterol used for steroid biosynthesis was compromised in the TSPO-deficient cells, leading to LD accumulation. TSPO deficiency resulted in changes in mitochondrial morphology and in OMM and IMM contact sites and/or fusion MitoTracker probes are cell-permeable, mitochondria-selective dyes that passively diffuse across the plasma membrane and accumulate in active mitochondria. We used these probes to examine whether there are changes in mitochondrial morphology in cells depleted of TSPO. Untreated cells or cells treated with dbcAMP were stained with Mitotracker Red CMXRos (Invitrogen) (Fig. 3; Supplemental Fig. 4). Mitochondrial morphology in G1 (Fig. 3A‒3C) and nG1 (Fig. 3D‒3F) cells in response to dbcAMP treatment differed with mitochondrial swelling seen in nG1 cells (compare Fig. 3C with Fig. 3F). Figure 3. View largeDownload slide TSPO depletion affected mitochondrial membrane structure and morphology. (A‒F) The live mitochondria in G1 and nG1 cells were stained with Mitotracker Red CMXRos (Invitrogen), which depends on Δψm (A, D) before and (B, E) after dbcAMP treatment. (C, F) The magnified areas after dbcAMP treatment, where the staining of mitochondria in G1 cells was diffused, are highlighted, which may be correlated with the mitochondrial fusion that has been related with steroidogenesis (34); the staining of mitochondria in nG1 cells is shown in “ballooning” or swelling shapes, indicating that there was a dramatic change in mitochondrial morphology or Δψm after TSPO depletion. (G–J) TEM of fixed mitochondria from the same cells as indicated in (A–F). Indel, imaging the intensity of the highlighted area painted in pseudocolor according to the reference bar. (G, H) The mitochondrial double membrane barrier is clearly seen in the G1 cells, but the boundary is blurred after dbcAMP treatment. (I, J) However, in the nG1 cells, the contact sites between the OMM and IMM are clearly seen (yellow arrows and lines); the membranes are clearly seen as a boundary between the mitochondria and cytoplasm after cAMP stimulation. The mitochondrial spheroids (Msp) or mitophagy (Mtp) are also indicated. The red arrows indicate the mitochondria (Mt); the Cristae membrane is indicated. Figure 3. View largeDownload slide TSPO depletion affected mitochondrial membrane structure and morphology. (A‒F) The live mitochondria in G1 and nG1 cells were stained with Mitotracker Red CMXRos (Invitrogen), which depends on Δψm (A, D) before and (B, E) after dbcAMP treatment. (C, F) The magnified areas after dbcAMP treatment, where the staining of mitochondria in G1 cells was diffused, are highlighted, which may be correlated with the mitochondrial fusion that has been related with steroidogenesis (34); the staining of mitochondria in nG1 cells is shown in “ballooning” or swelling shapes, indicating that there was a dramatic change in mitochondrial morphology or Δψm after TSPO depletion. (G–J) TEM of fixed mitochondria from the same cells as indicated in (A–F). Indel, imaging the intensity of the highlighted area painted in pseudocolor according to the reference bar. (G, H) The mitochondrial double membrane barrier is clearly seen in the G1 cells, but the boundary is blurred after dbcAMP treatment. (I, J) However, in the nG1 cells, the contact sites between the OMM and IMM are clearly seen (yellow arrows and lines); the membranes are clearly seen as a boundary between the mitochondria and cytoplasm after cAMP stimulation. The mitochondrial spheroids (Msp) or mitophagy (Mtp) are also indicated. The red arrows indicate the mitochondria (Mt); the Cristae membrane is indicated. We then examined subcellular features of the mitochondria by TEM. In the control G1 cells, the mitochondrial membranes were distinct and of high density. The membranes became more diffuse after the cells were treated with dbcAMP (Fig. 3G and 3H). These observations are consistent with those from MitoTracker staining (Fig. 3C). In TSPO-depleted nG1 cells, the two mitochondrial membranes were separate but with a number of contact sites (Fig. 3I). After dbcAMP treatment, the OMM and IMM of these cells were fused (Fig. 3J). In contrast to analysis of nG1 cells, confocal and TEM analyses of TSPO-depleted G2G cells indicated that there were no remarkable changes in mitochondrial morphology from the control HH cells. However, staining with MitoTracker differed somewhat between G2G and HH cells, appearing more in the periphery rather than inside the mitochondria in G2G cells (Supplemental Fig. 4). The Mito-roGFP1 probe in Mito-H cells and its subcell lines is in dynamic equilibrium with the mitochondrial redox status and responds to membrane-permeable reductants and oxidants (35). Thus, Mito-roGFP (in green), which was used to monitor the redox status, was counterstained with MitoTracker (Supplemental Fig. 4B, 4D, 4G, and 4H). Although control HH cells treated with dbcAMP showed reduced roGFP staining at 480 nM, indicating changes in the mitochondrial redox conditions (Supplemental Fig. 4B and 4D), there was no change in TSPO-depleted G2G cells (Supplemental Fig. 4F and 4H). These observations are consistent with the direct measurement of redox status (400/488 ratio) between these two cell lines and indicate that the presence of TSPO is related to mitochondrial redox homeostasis (see later). TSPO deficiency resulted in reduced mitochondrial Δψm The cationic and lipophilic JC-10 dye, a derivative of JC-1 (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazoyl carbocyanine iodide), has been widely used to monitor mitochondrial health via its reversible changes from red fluorescence in normal cells to green fluorescence in apoptotic and necrotic cells as membrane potential decreases (36–38). JC-10 staining was performed to assess changes in mitochondrial Δψm in the control and TSPO-mutant cells. Δψm was significantly reduced in the TSPO-deficient nG1 cells compared with the control G1 cells. Treatment with dbcAMP further reduced Δψm in nG1 cells (Fig. 4A). Examination of the stained cells from high-content imaging similarly revealed mitochondrial color shift from red to green with TSPO depletion (compare Fig. 4B with Fig. 4C) and after dbcAMP treatment (compare Fig. 4D with Fig. 4E). In HH and G2G cells expressing Mito-roGFP, we used TRME staining, which emits red fluorescence, to assess changes in Δψm. The results showed that Δψm was significantly reduced in TSPO-deficient G2G compared with control HH cells (Fig. 4F). However, the reduced Δψm was not as low as that seen using the mitochondrial oxidative phosphorylation uncoupler (FCCP) or as much as that seen in nG1 cells, where TSPO expression was absent (Fig. 4E and 4A). These results indicate that TSPO deficiency leads to mitochondrial depolarization. Figure 4. View largeDownload slide TSPO deficiency decreased Δψm. (A) The ratio of JC-10 red/green fluorescence intensity of G1 and nG1 before and after 1-mM dbcAMP treatment was obtained from PerkinElmer EnSpire multimode plate reader. (B–E) High-content images of corresponding cells: G1 (control vs dbcAMP) and nG1 (control vs dbcAMP) from Molecular Devices ImageXpress Micro XLS wide-field high-content analysis system. Red (540/570 nm), healthy mitochondria; green (485/534 nm), depolarized or apoptotic cells. (F) Evaluation of Δψm in TSPO-deficient cells: G2G vs WT cell: HH. TMRE fluorescence intensity was graphed before and after FCCP treatment (to eliminate the Δψm), where the G2G cells have a lower Δψm than the WT cells, which is the same as in the nG1 cells. Results shown are means ± standard error of the mean (n = 24). *P < 0.05; ***P < 0.001 by Student t test. Figure 4. View largeDownload slide TSPO deficiency decreased Δψm. (A) The ratio of JC-10 red/green fluorescence intensity of G1 and nG1 before and after 1-mM dbcAMP treatment was obtained from PerkinElmer EnSpire multimode plate reader. (B–E) High-content images of corresponding cells: G1 (control vs dbcAMP) and nG1 (control vs dbcAMP) from Molecular Devices ImageXpress Micro XLS wide-field high-content analysis system. Red (540/570 nm), healthy mitochondria; green (485/534 nm), depolarized or apoptotic cells. (F) Evaluation of Δψm in TSPO-deficient cells: G2G vs WT cell: HH. TMRE fluorescence intensity was graphed before and after FCCP treatment (to eliminate the Δψm), where the G2G cells have a lower Δψm than the WT cells, which is the same as in the nG1 cells. Results shown are means ± standard error of the mean (n = 24). *P < 0.05; ***P < 0.001 by Student t test. Decreased Δψm and progesterone synthesis in Tspo mutant cells were TSPO specific Two TSPO-specific ligands, PK 11195 (100 nM; Sigma-Aldrich Canada Ltd.) and XBD173 (20 μM; Tractus Chemical), were used to treat cells. Both compounds significantly enhanced Δψm in control cells but not in cells with mutated Tspo (Fig. 5A and 5B). The cyclic adenosine monophosphate (cAMP)–dependent protein kinase (PKA) inhibitor H-89 (Sigma-Aldrich), used at 1 and 10 μM, increased the Δψm in all cells examined (Fig. 5C), suggesting that the repressed Δψm in TSPO-deficient cells can be recovered. TSPO deficiency led to a significantly elevated mitochondrial oxidized condition, but no changes were seen after PK 11197 or XBD173 treatment (Fig. 5D and 5E). Treatment with dbcAMP decreased the Δψm in controls but not in TSPO-deficient cells (Fig. 5F). Under the same conditions, control HH but not TSPO-deficient G2G cells responded to PK 11195 by producing increased levels of progesterone (Fig. 5G). Moreover, although TSPO-deficient cells were characterized by low Δψm, they were resistant to apoptosis and had similar relative proliferation rates before and after dbcAMP treatment (Supplemental Fig. 5). Figure 5. View largeDownload slide The reduced Δψm in TSPO-deficient cells was TSPO specific. The TSPO ligands PK 11195 (Sigma-Aldrich Canada Ltd.) and XBD173 (Tractus Chemical) increased Δψmvia TSPO. (A) Increased Δψm after PK 11195 treatment in control G1 cells. 100 nM of PK 11195 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (B) Increased Δψm after 20-μM XBD173 treatment in G1 control cells; 20-μM XBD173 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (C) Recovery of the collapse of Δψm in TSPO-deficient cells by the PKA inhibitor H-89 (10 μM; Sigma-Aldrich) and effects of H-89 (1 and 10 μM) on the Δψm of G1 and nG1 cells. H-89 (10 μM) significantly increased the Δψm. (D, E) No effect on mitochondrial redox status monitored by Mito-roGFP after PK 11195 (100 nM) and XBD173 (20 μM) treatments. However, the TSPO-deficient cells maintained a higher oxidized mitochondrial condition. (F) No effect of mitochondrial redox status after dbcAMP treatment of TSPO-deficient cells, but control cells kept a significantly reduced condition. Results shown are means ± standard error of the mean (SEM; n = 24). (G) PK 11195‒stimulated steroid production. Control HH cells and TSPO mutant G2G cells were treated with and without PK 11196 (100 nM) for 2 hours. Progesterone formed was measured by radioimmunoassay. Results shown are means ± SEM (n = 4). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. Figure 5. View largeDownload slide The reduced Δψm in TSPO-deficient cells was TSPO specific. The TSPO ligands PK 11195 (Sigma-Aldrich Canada Ltd.) and XBD173 (Tractus Chemical) increased Δψmvia TSPO. (A) Increased Δψm after PK 11195 treatment in control G1 cells. 100 nM of PK 11195 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (B) Increased Δψm after 20-μM XBD173 treatment in G1 control cells; 20-μM XBD173 affected the Δψm only in G1 cells, not in TSPO-deficient nG1 cells. (C) Recovery of the collapse of Δψm in TSPO-deficient cells by the PKA inhibitor H-89 (10 μM; Sigma-Aldrich) and effects of H-89 (1 and 10 μM) on the Δψm of G1 and nG1 cells. H-89 (10 μM) significantly increased the Δψm. (D, E) No effect on mitochondrial redox status monitored by Mito-roGFP after PK 11195 (100 nM) and XBD173 (20 μM) treatments. However, the TSPO-deficient cells maintained a higher oxidized mitochondrial condition. (F) No effect of mitochondrial redox status after dbcAMP treatment of TSPO-deficient cells, but control cells kept a significantly reduced condition. Results shown are means ± standard error of the mean (SEM; n = 24). (G) PK 11195‒stimulated steroid production. Control HH cells and TSPO mutant G2G cells were treated with and without PK 11196 (100 nM) for 2 hours. Progesterone formed was measured by radioimmunoassay. Results shown are means ± SEM (n = 4). *P < 0.05; **P < 0.01; ***P < 0.001 by Student t test. n.s., no significance. TSPO-deficient cells lost response to the tubulin stabilizing agent paclitaxel and show reduced colocalization of mitochondria with microtubules To investigate the mechanism of TSPO-mediated Δψm reduction, we examined the effect of the tubulin-stabilizing agent paclitaxel (Sigma-Aldrich Canada Ltd.) on TSPO-deficient cells nG1 and G2G compared with the effect on their respective control cells G1 and HH. Free tubulin has been shown to regulate Δψm in cancer cells by blocking VDAC function in a PKA-dependent manner (39–41). Free tubulin and organized microtubules were also associated with adrenocorticotropic hormone‒ and cAMP–stimulated steroidogenesis in murine adrenal and rat Leydig cells (42). In the current studies, paclitaxel (100 nM; Sigma-Aldrich Canada Ltd.) significantly increased the Δψm in controls by enhancing tubulin polymerization but not in TSPO-deficient cells, indicating that the TSPO-mediated Δψm regulation involved VDAC-tubulin interaction (Fig. 6A and 6B). Data from previous mass spectrometry studies on the mitochondrial protein complex involved in steroidogenesis indicated that cytoskeletal proteins were involved in the dbcAMP treatment and that microtubule elements were lost in the lower-molecular-weight complexes, whereas the ACTG1 and vimentin proteins were upregulated in the higher molecular protein complexes (Fig. 6C) (11). A search through the protein-protein interaction network STRING (https://string-db.org/) showed that TSPO is associated with cytoskeletal proteins via VDAC (Fig. 6D). Confocal images of microtubules and mitochondria show that the overlap of mitochondria and polymerized tubulin was reduced in TSPO-deficient cells (Fig. 6E–6J). Fluorescence intensity analysis shown by scatter plots and a bar graph of Mander’s overlap coefficient R also showed reduced colocalization in TSPO-deficient nG1 cells (Fig. 6K). These confocal data suggest a TSPO-mediated microtubule-mitochondria interaction most likely occurring via the regulation of dimeric tubulin-VDAC interaction (41, 43). Figure 6. View largeDownload slide TSPO-mediated Δψm reduction via VDAC-tubulin interaction. The tubulin stabilizing agent paclitaxel (Sigma-Aldrich Canada Ltd.) increased Δψmvia TSPO. (A) Increased Δψm after 100-nM paclitaxel treatment of control G1 cells, but lack of response in TSPO-deficient nG1 cells. (B) Significant changes in Δψm after 100-nM paclitaxel treatment of control HH cells, but no response in TSPO-deficient G2G cells. (C) Cytoskeleton proteins, including tubulins, were involved in dbcAMP-induced steroidogenesis in MA-10 cells. Microtubule-associated proteins were identified in the mitochondrial protein complexes found in bands 1 to 9, whereas actin filament‒associated proteins were increased in the mitochondrial protein complexes. The mass spectrometry data were extracted from a previous study on TSPO-mediated cholesterol mitochondrial transport complexes (11). (D) The TSPO-associated cytoskeleton protein-protein interaction. The main interactions were retrieved from the STRING database (http://string-db.org), except that the VDAC-tubulin interaction is from a previous publication on dimeric tubulin blocking VDAC closure at negative potentials (40). (E–J) Confocal imaging of the overlap of polymerized tubules and mitochondria in (E–G) control G1 cells and (H–J) TSPO-deficient nG1 cells. Insets in panels (E) and (F) identify the areas shown in panel (G), and insets in panels (H) and (I) identify the areas shown in panel (J). Cells were stained with MitoTracker Red CMXRos (Invitrogen; Ex/Em: 579/599) for 20 minutes, then with the Thermo Fisher Scientific TubulinTracker™ Green (Oregon Green® 488 Taxol, bis-acetate; Ex/Em: 494/522 nm) for 30 minutes. (K) Scatter plots of two channels in G1 (left) and nG1 (right) cells and a bar graph show the Mander’s overlap coefficient (R) value as a measure of colocalization between polymerized tubules and mitochondria. ***P < 0.001 by Student t test. n.s., no significance. Figure 6. View largeDownload slide TSPO-mediated Δψm reduction via VDAC-tubulin interaction. The tubulin stabilizing agent paclitaxel (Sigma-Aldrich Canada Ltd.) increased Δψmvia TSPO. (A) Increased Δψm after 100-nM paclitaxel treatment of control G1 cells, but lack of response in TSPO-deficient nG1 cells. (B) Significant changes in Δψm after 100-nM paclitaxel treatment of control HH cells, but no response in TSPO-deficient G2G cells. (C) Cytoskeleton proteins, including tubulins, were involved in dbcAMP-induced steroidogenesis in MA-10 cells. Microtubule-associated proteins were identified in the mitochondrial protein complexes found in bands 1 to 9, whereas actin filament‒associated proteins were increased in the mitochondrial protein complexes. The mass spectrometry data were extracted from a previous study on TSPO-mediated cholesterol mitochondrial transport complexes (11). (D) The TSPO-associated cytoskeleton protein-protein interaction. The main interactions were retrieved from the STRING database (http://string-db.org), except that the VDAC-tubulin interaction is from a previous publication on dimeric tubulin blocking VDAC closure at negative potentials (40). (E–J) Confocal imaging of the overlap of polymerized tubules and mitochondria in (E–G) control G1 cells and (H–J) TSPO-deficient nG1 cells. Insets in panels (E) and (F) identify the areas shown in panel (G), and insets in panels (H) and (I) identify the areas shown in panel (J). Cells were stained with MitoTracker Red CMXRos (Invitrogen; Ex/Em: 579/599) for 20 minutes, then with the Thermo Fisher Scientific TubulinTracker™ Green (Oregon Green® 488 Taxol, bis-acetate; Ex/Em: 494/522 nm) for 30 minutes. (K) Scatter plots of two channels in G1 (left) and nG1 (right) cells and a bar graph show the Mander’s overlap coefficient (R) value as a measure of colocalization between polymerized tubules and mitochondria. ***P < 0.001 by Student t test. n.s., no significance. TSPO was involved in STAR protein mitochondrial import/function, which was correlated with reduced Δψm in TSPO-deficient cells Immunoblot analysis showed the induction of STAR immunoreactive proteins in control G1 and HH cells after treatment with dbcAMP for 2 hours (Fig. 7A‒7D), but to a lesser extent than that seen in the TSPO-deficient nG1 and G2G cells (Fig. 7B and 7D). The presence of increased levels of the 37-kDa cytosolic STAR and cleaved STAR protein before dbcAMP stimulation in nG1 cells suggests that although most STAR is not processed, some is imported and processed in the mitochondria (Fig. 7B). The lack of change in the pattern of STAR before and after dbcAMP treatment in G2G cells indicates that STAR accumulated outside the mitochondria (Fig. 7D); no processing occurred. These observations are most likely due to the fact that STAR can be processed only by the mitochondrial Lon protease after mitochondrial import (44). These data also suggest that STAR is imported into mitochondria in a TSPO-dependent fashion. Confocal imaging of STAR-DsRed protein was used to track the STAR mitochondrial import. STAR-DsRed was found to be imported into mitochondria in control G1 cells in response to dbcAMP treatment, whereas nG1 TSPO-deficient cells showed a notable amount of protein outside the mitochondria (Fig. 7E–7L). Similar results were obtained using HH control and G2G TSPO-deficient cells (Supplemental Fig. 6). Both the immunoblot analysis and confocal imaging suggest that the mitochondrial import of STAR depends on the presence of TSPO and polarized mitochondria (i.e., maintenance of its Δψm). Figure 7. View largeDownload slide TSPO is involved in the function and/or mitochondrial import of STAR. (A, C) Immunoblot analyses for TSPO in cell lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Robust TSPO expression is seen in G1 and HH cells. No TSPO expression is seen in nG1 cells; weak TSPO expression is seen in G2G cells. (B, D) Immunoblot analyses of STAR in lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Immunoreactive STAR proteins were induced by depletion of TSPO in nG1 cells. Anti‒glyceraldehyde-3-phosphate dehydrogenase (36 kDa) was used for reprobing the same membrane used for TSPO, whereas anti-Cox IV (16 kDa) was used to reprobe the same membrane used for anti-STAR. The gel photos were taken using the Bio-Rad Gel Imager. (E‒J) Confocal images of the STAR-DsRed fusion protein used for validation of the STAR protein mitochondrial import. Insets in panel (E) identify the areas shown in (F) and (G), and insets in panel (H) identify the areas shown in panels (I) and (J). STAR-DsRed protein is (G) localized remarkably outside the mitochondria in control G1 cells but (J) localized more within the mitochondria and less outside the mitochondria in nG1 TSPO-deficient cells, in comparison with mitochondria-targeted blue fluorescent protein and Mitotracker Deep Red Fm staining. (K) After 1-mM dbcAMP treatment, the STAR-DsRed was imported into the mitochondria in control G1 cells; (L) however, a still remarkable amount of the protein stayed outside the mitochondria in the mutant nG1 cells. The STAR mitochondrial import may be correlated with the Δψm (45, 46). White arrows indicate the distribution of STAR-DsRed fusion protein (red) (F, G, I and J) on the surface or (K) inside mitochondria. Scale bar: 5 μm. M, protein ladder. Figure 7. View largeDownload slide TSPO is involved in the function and/or mitochondrial import of STAR. (A, C) Immunoblot analyses for TSPO in cell lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Robust TSPO expression is seen in G1 and HH cells. No TSPO expression is seen in nG1 cells; weak TSPO expression is seen in G2G cells. (B, D) Immunoblot analyses of STAR in lysates from controls (G1 and HH cells) and TSPO-deficient cells (nG1 and G2G) treated with and without dbcAMP (1 mM) for 2 hours. Immunoreactive STAR proteins were induced by depletion of TSPO in nG1 cells. Anti‒glyceraldehyde-3-phosphate dehydrogenase (36 kDa) was used for reprobing the same membrane used for TSPO, whereas anti-Cox IV (16 kDa) was used to reprobe the same membrane used for anti-STAR. The gel photos were taken using the Bio-Rad Gel Imager. (E‒J) Confocal images of the STAR-DsRed fusion protein used for validation of the STAR protein mitochondrial import. Insets in panel (E) identify the areas shown in (F) and (G), and insets in panel (H) identify the areas shown in panels (I) and (J). STAR-DsRed protein is (G) localized remarkably outside the mitochondria in control G1 cells but (J) localized more within the mitochondria and less outside the mitochondria in nG1 TSPO-deficient cells, in comparison with mitochondria-targeted blue fluorescent protein and Mitotracker Deep Red Fm staining. (K) After 1-mM dbcAMP treatment, the STAR-DsRed was imported into the mitochondria in control G1 cells; (L) however, a still remarkable amount of the protein stayed outside the mitochondria in the mutant nG1 cells. The STAR mitochondrial import may be correlated with the Δψm (45, 46). White arrows indicate the distribution of STAR-DsRed fusion protein (red) (F, G, I and J) on the surface or (K) inside mitochondria. Scale bar: 5 μm. M, protein ladder. Discussion Data from several independent laboratories have shown an important role of TSPO in steroidogenesis (10, 23, 25, 47–51). In addition to the stimulatory effect of numerous TSPO-specific drug ligands on steroid production both in vivo and in vitro, in all steroidogenic cells and tissues tested, the role of TSPO in steroidogenesis is supported strongly by studies of the effects of the specific inhibition of TSPO-specific ligands on steroid formation (5, 52). In particular, several TSPO ligands that bind either to the drug-binding sites or to the cholesterol recognition/interaction amino acid consensus domains of TSPO were shown to block hormone-induced steroid formation in cells both in vitro and in vivo. These ligands include flunitrazepam, 5-androsten-3β,17,19-triol, imidazo[1,2-a]pyridine‒containing and triazol-containing ligands, and peptide antagonists identified through a phage library screening (53–57). However, recent studies in rodents with genetic depletion of TSPO reported results inconsistent with those of many studies reporting a critical role for TSPO in steroid formation (20, 22, 23, 58–60). In the first study of the genetic depletion of TSPO in a mouse model by Amhr2-Cre–mediated Tspo conditional knockout (cKO), the authors concluded that TSPO is not required for steroid biosynthesis (20). However, although the Amhr2-Cre–mediated Tspo cKO approach had been used for the KO of other genes, the early expression of the Amhr2 gene during preimplantation stages of mouse development could lead to a gene’s global KO and/or WT-like animals with a cKO genotype and thus to an animal population with mixed variable genotypes (22). Using CRISPR/Cas9 technology to knock out Tspo in MA-10 cells, the same group of investigators again argued against an intimate relationship between TSPO and steroidogenesis and argued that the effect of the high-affinity TSPO ligand PK 11195 on steroid formation is independent of TSPO (26). If validated, these results would challenge the use of PK 11195 as a diagnostic ligand for the TSPO protein (31, 61). These findings clearly argue for further investigation using the MA-10 system to clarify and extend our understanding of the relationship between TSPO and steroidogenesis. To this end, we used the CRISPR/Cas9 system to create Tspo-specific mutations in MA-10 cells and then examined the effects on steroid formation. Two mutant subcell lines were developed, each carrying a Tspo exon2‒specific genome modification. Similar levels of basal progesterone were seen between the control and Tspo mutant cells. These observations suggest that CYP11A1 and HSD3B1, the enzymes responsible for cholesterol metabolism downstream of TSPO, were functionally intact. Indeed, CYP11A1 expression levels in TSPO-deficient cells were found to be the same as in WT cells. Importantly, in response to dbcAMP, both Tspo mutant cell lines exhibited reduced progesterone formation in comparison with the corresponding control cells, but with different features in terms of the reduction in progesterone production, which are most likely due to cell line‒specific mitochondrial redox conditions (28). These results support the long-held contention of an important role for TSPO in steroid formation. Moreover, we found a buildup of LDs in the cytosol of the mutant cells, suggesting a deficiency in the ability of the cells to translocate lipid into the mitochondria. In addition, we observed that Tspo mutant cells lost the ability to respond to the TSPO drug ligand PK 11195 to produce progesterone, unlike control cells. These findings strongly support an important role of TSPO in steroidogenesis, in contrast to previous negative reports (20, 26). The discrepant results are most likely due to the different systems used or the different approaches taken in the interpretation of the results. The current study provides strong evidence of a role for TSPO in regulation of Δψm in MA-10 cell mitochondria. Among the experimental approaches and studies that lead to this conclusion are Δψm-dependent MitoTracker staining with a pattern of predominantly peripheral distribution in mitochondria; OMM morphology; TEM studies of the contact sites between the OMM and the IMM; JC-10 staining indicating a decrease in the red/green fluorescence intensity ratio; the effects of TSPO-specific ligands (PK 11195 and XBD173) on the repolarization of mitochondria; and the association of Δψm with mitochondrial redox homeostasis. However, change in Δψm in MA-10 cells under TSPO deficiency behaves in a reversible manner because PKA inhibition hyperpolarizes the mitochondria, whereas dbcAMP-stimulated PKA activation decreases Δψm. These observations are consistent with the report that cAMP stimulation decreases Δψm but that cAMP inhibition repolarizes the mitochondria (39). The ΔΨM of the mutant cells was significantly reduced compared with that of control cells. This finding is in agreement with a previous report showing a decreased Δψm in fibroblast mitochondria in response to TSPO deficiency (62). These findings suggest a possible role for TSPO in the regulation of Δψm and thus in maintaining normal mitochondrial function. Δψm reflects mitochondrial function in the maintenance of the respiratory chain, generation of adenosine triphosphate, cellular differentiation, and apoptosis. With regard to apoptosis, the lower the Δψm, the more susceptible cells are to apoptotic stimuli (63). However, our results show that the reduced Δψm in TSPO-deficient cells neither affected cell proliferation nor increased apoptosis in response to dbcAMP treatment. In contrast, Tspo deletion led to resistance to apoptosis. This finding is in agreement with previous reports on the Drosophila TSPO ortholog (CG2789/dTSPO) (64) and on the antiapoptotic effects of TSPO-specific ligands (e.g., PK 11195) and Tspo knockdown (65, 66). These results suggest that reduced steroid production by Tspo mutant cells was not due to apoptotic cell death after dbcAMP treatment. It should be noted that TSPO has been thought to regulate Δψmvia its interaction with the mitochondrial membrane permeability transition pore, though this is not without controversy (65, 67, 68). Reduction in ΔΨM of the Tspo mutant cells is most likely attributable to TSPO interactions with the VDAC and tubulin (dimeric and polymerized) at the OMM (Supplemental Fig. 7). This conclusion is based on findings using the tubulin stabilizing reagent paclitaxel (Sigma-Aldrich Canada Ltd.) showing that TSPO interfered with a membrane lipid composition‒dependent VDAC/tubulin interaction (39, 69). Paclitaxel has been shown to bind the interior surface of microtubules (70), and tubulin has been reported to interact with VDAC1 in regulation of mitochondrial respiration as well as Δψm (40, 41). The Δψm depends on the flux of respiratory substrates adenosine triphosphate, adenosine diphosphate, and Pi through the VDAC, whereas the VDAC is controlled by tubulin. Adenine nucleotide translocator also plays a role in maintenance of the Δψm (39, 71). Therefore, TSPO apparently controls cellular and mitochondrial metabolism in MA-10 cells in general via regulation of Δψm, and affects OMM permeability and/or outer and inner membrane contacts/fusion, as hypothesized previously (72). This suggests that the contact sites are essential for dbcAMP-stimulated steroidogenesis. The changes in mitochondrial membranes may be related to TSPO-mediated membrane properties, such as their dynamics, physical properties, and facilitating or impairing of mitochondrial membrane permeabilization with dbcAMP treatment. Indeed, the Δψm is needed for mitochondrial fusion, which in turn is required for steroid biosynthesis (34). STAR, another protein known to be integrally involved in steroid formation, was induced in nG1 cells, suggesting the possible involvement of TSPO in STAR functioning/mitochondrial import. Thus, the Δψm is necessary for STAR protein mitochondrial import in Leydig cells in steroidogenesis (45, 73). Our immunoblot analysis and confocal imaging results are consistent with the concept that the STAR protein works on the mitochondrial surface rather than inside the mitochondria (74). However, whether STAR is inside mitochondria (nG1 cells) or outside mitochondria (G2G cells), it acts functionally with TSPO, an OMM protein, during hormone-stimulated steroidogenesis. How STAR functions in relationship to TSPO to deliver cholesterol into the mitochondria remains to be elucidated (72). Nevertheless, these observations are in agreement with previous findings that TSPO is involved in STAR import into mitochondria and processing either directly or indirectly via changes in Δψm (24, 53, 75). Taken together, these results provide further compelling evidence for a critical role of TSPO in steroid biosynthesis and suggest that it may function at least in part via its regulation of ΔΨm and effects on STAR synthesis and/or processing. Abbreviations: Ab antibody cAMP cyclic adenosine monophosphate cKO conditional knockout dbcAMP dibutyryl–cyclic adenosine monophosphate DMSO dimethyl sulfoxide Ex/Em excitation/emission FACS fluorescence-activated cell sorting FCCP carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone gRNA guide RNA IMM inner mitochondrial membrane LD lipid droplet Mito-roGFP mitochondrial reduction-oxidation sensitive green fluorescent protein 1 OFP orange fluorescent protein OMM outer mitochondrial membrane PBS phosphate-buffered saline PKA cyclic adenosine monophosphate–dependent protein kinase Q quarter STAR steroidogenic acute regulatory protein TEM transmission electron microscopy TMRE tetramethylrhodamine ethyl ester TSPO translocator protein VDAC voltage-dependent anion channel WT wild-type ΔΨm mitochondrial membrane potential. Acknowledgments We thank Dr. Mario Ascoli (University of Iowa, Iowa City, IA) for supplying the MA-10 cell line, and Ms. Jeannie Mui for performing the TEM at the Facility for Electron Microscopy Research, McGill University. We also thank the Immunophenotyping and Molecular Imaging Platforms of the Research Institute of the McGill University Health Centre. Financial Support: This work was supported by Canadian Institutes of Health Research Grants MOP125983 and PJT148659 (to V.P.), a Canada Research Chair in Biochemical Pharmacology (to V.P.), the John Stauffer Dean’s Chair in Pharmaceutical Sciences (University of Southern California; to V.P.), and National Institutes of Health Grants R37 AG021092 and R21 AG051259 (to B.Z.). Disclosure Summary: The authors have nothing to disclose. References 1. Kraemer FB, Shen WJ, Azhar S. SNAREs and cholesterol movement for steroidogenesis. Mol Cell Endocrinol . 2017; 441: 17– 21. Google Scholar CrossRef Search ADS PubMed 2. Fan J, Papadopoulos V. Evolutionary origin of the mitochondrial cholesterol transport machinery reveals a universal mechanism of steroid hormone biosynthesis in animals. PLoS One . 2013; 8( 10): e76701. Google Scholar CrossRef Search ADS PubMed 3. Stocco DM, Zhao AH, Tu LN, Morohaku K, Selvaraj V. A brief history of the search for the protein(s) involved in the acute regulation of steroidogenesis. Mol Cell Endocrinol . 2017; 441: 7– 16. Google Scholar CrossRef Search ADS PubMed 4. Shen WJ, Azhar S, Kraemer FB. Lipid droplets and steroidogenic cells. Exp Cell Res . 2016; 340( 2): 209– 214. Google Scholar CrossRef Search ADS PubMed 5. Papadopoulos V, Aghazadeh Y, Fan J, Campioli E, Zirkin B, Midzak A. Translocator protein-mediated pharmacology of cholesterol transport and steroidogenesis. Mol Cell Endocrinol . 2015; 408: 90– 98. Google Scholar CrossRef Search ADS PubMed 6. Miller WL. Mechanism of StAR’s regulation of mitochondrial cholesterol import. Mol Cell Endocrinol . 2007; 265-266: 46– 50. Google Scholar CrossRef Search ADS PubMed 7. Issop L, Fan J, Lee S, Rone MB, Basu K, Mui J, Papadopoulos V. Mitochondria-associated membrane formation in hormone-stimulated Leydig cell steroidogenesis: role of ATAD3. Endocrinology . 2015; 156( 1): 334– 345. Google Scholar CrossRef Search ADS PubMed 8. Lin Y, Hou X, Shen WJ, Hanssen R, Khor VK, Cortez Y, Roseman AN, Azhar S, Kraemer FB. SNARE-mediated cholesterol movement to mitochondria supports steroidogenesis in rodent cells. Mol Endocrinol . 2016; 30( 2): 234– 247. Google Scholar CrossRef Search ADS PubMed 9. Arakane F, Kallen CB, Watari H, Stayrook SE, Lewis M, Strauss JF III. Steroidogenic acute regulatory protein (StAR) acts on the outside of mitochondria to stimulate steroidogenesis. Endocr Res . 1998; 24( 3-4): 463– 468. Google Scholar CrossRef Search ADS PubMed 10. Papadopoulos V, Baraldi M, Guilarte TR, Knudsen TB, Lacapère JJ, Lindemann P, Norenberg MD, Nutt D, Weizman A, Zhang MR, Gavish M. Translocator protein (18kDa): new nomenclature for the peripheral-type benzodiazepine receptor based on its structure and molecular function. Trends Pharmacol Sci . 2006; 27( 8): 402– 409. Google Scholar CrossRef Search ADS PubMed 11. Rone MB, Midzak AS, Issop L, Rammouz G, Jagannathan S, Fan J, Ye X, Blonder J, Veenstra T, Papadopoulos V. Identification of a dynamic mitochondrial protein complex driving cholesterol import, trafficking, and metabolism to steroid hormones. Mol Endocrinol . 2012; 26( 11): 1868– 1882. Google Scholar CrossRef Search ADS PubMed 12. Li H, Papadopoulos V. Peripheral-type benzodiazepine receptor function in cholesterol transport: identification of a putative cholesterol recognition/interaction amino acid sequence and consensus pattern. Endocrinology . 1998; 139( 12): 4991– 4997. Google Scholar CrossRef Search ADS PubMed 13. Jamin N, Neumann JM, Ostuni MA, Vu TK, Yao ZX, Murail S, Robert JC, Giatzakis C, Papadopoulos V, Lacapère JJ. Characterization of the cholesterol recognition amino acid consensus sequence of the peripheral-type benzodiazepine receptor. Mol Endocrinol . 2005; 19( 3): 588– 594. Google Scholar CrossRef Search ADS PubMed 14. Li F, Liu J, Zheng Y, Garavito RM, Ferguson-Miller S. Crystal structures of translocator protein (TSPO) and mutant mimic of a human polymorphism. Science . 2015; 347( 6221): 555– 558. Google Scholar CrossRef Search ADS PubMed 15. Aghazadeh Y, Zirkin BR, Papadopoulos V. Pharmacological regulation of the cholesterol transport machinery in steroidogenic cells of the testis. Vitam Horm . 2015; 98: 189– 227. Google Scholar CrossRef Search ADS PubMed 16. Midzak A, Zirkin B, Papadopoulos V. Translocator protein: pharmacology and steroidogenesis. Biochem Soc Trans . 2015; 43( 4): 572– 578. Google Scholar CrossRef Search ADS PubMed 17. Elustondo P, Martin LA, Karten B. Mitochondrial cholesterol import. Biochim Biophys Acta . 2017; 1862( 1): 90– 101. Google Scholar CrossRef Search ADS PubMed 18. Rone MB, Fan J, Papadopoulos V. Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states. Biochim Biophys Acta . 2009; 1791( 7): 646– 658. Google Scholar CrossRef Search ADS PubMed 19. Marí M, Morales A, Colell A, García-Ruiz C, Fernández-Checa JC. Mitochondrial glutathione, a key survival antioxidant. Antioxid Redox Signal . 2009; 11( 11): 2685– 2700. Google Scholar CrossRef Search ADS PubMed 20. Morohaku K, Pelton SH, Daugherty DJ, Butler WR, Deng W, Selvaraj V. Translocator protein/peripheral benzodiazepine receptor is not required for steroid hormone biosynthesis. Endocrinology . 2014; 155( 1): 89– 97. Google Scholar CrossRef Search ADS PubMed 21. Tu LN, Morohaku K, Manna PR, Pelton SH, Butler WR, Stocco DM, Selvaraj V. Peripheral benzodiazepine receptor/translocator protein global knock-out mice are viable with no effects on steroid hormone biosynthesis. J Biol Chem . 2014; 289( 40): 27444– 27454. Google Scholar CrossRef Search ADS PubMed 22. Fan J, Campioli E, Midzak A, Culty M, Papadopoulos V. Conditional steroidogenic cell-targeted deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation. Proc Natl Acad Sci USA . 2015; 112( 23): 7261– 7266. Google Scholar CrossRef Search ADS PubMed 23. Papadopoulos V, Fan J, Zirkin B. Translocator protein (18 kDa): an update on its function in steroidogenesis [published online ahead of print July 1, 2017]. J Neuroendocrinol . doi: 10.1111/jne.12500. 24. Hauet T, Yao ZX, Bose HS, Wall CT, Han Z, Li W, Hales DB, Miller WL, Culty M, Papadopoulos V. Peripheral-type benzodiazepine receptor-mediated action of steroidogenic acute regulatory protein on cholesterol entry into Leydig cell mitochondria. Mol Endocrinol . 2005; 19( 2): 540– 554. Google Scholar CrossRef Search ADS PubMed 25. Kelly-Hershkovitz E, Weizman R, Spanier I, Leschiner S, Lahav M, Weisinger G, Gavish M. Effects of peripheral-type benzodiazepine receptor antisense knockout on MA-10 Leydig cell proliferation and steroidogenesis. J Biol Chem . 1998; 273( 10): 5478– 5483. Google Scholar CrossRef Search ADS PubMed 26. Tu LN, Zhao AH, Stocco DM, Selvaraj V. PK11195 effect on steroidogenesis is not mediated through the translocator protein (TSPO). Endocrinology . 2015; 156( 3): 1033– 1039. Google Scholar CrossRef Search ADS PubMed 27. Ascoli M. Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology . 1981; 108( 1): 88– 95. Google Scholar CrossRef Search ADS PubMed 28. Fan J, Li X, Issop L, Culty M, Papadopoulos V. ACBD2/ECI2-mediated peroxisome-mitochondria interactions in Leydig cell steroid biosynthesis. Mol Endocrinol . 2016; 30( 7): 763– 782. Google Scholar CrossRef Search ADS PubMed 29. Fan J, Rone MB, Papadopoulos V. Translocator protein 2 is involved in cholesterol redistribution during erythropoiesis. J Biol Chem . 2009; 284( 44): 30484– 30497. Google Scholar CrossRef Search ADS PubMed 30. Spyropoulos IC, Liakopoulos TD, Bagos PG, Hamodrakas SJ. TMRPres2D: high quality visual representation of transmembrane protein models. Bioinformatics . 2004; 20( 17): 3258– 3260. Google Scholar CrossRef Search ADS PubMed 31. Jaremko M, Jaremko Ł, Jaipuria G, Becker S, Zweckstetter M. Structure of the mammalian TSPO/PBR protein. Biochem Soc Trans . 2015; 43( 4): 566– 571. Google Scholar CrossRef Search ADS PubMed 32. Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis . 1997; 18( 15): 2714– 2723. Google Scholar CrossRef Search ADS PubMed 33. Khor VK, Ahrends R, Lin Y, Shen WJ, Adams CM, Roseman AN, Cortez Y, Teruel MN, Azhar S, Kraemer FB. The proteome of cholesteryl-ester-enriched versus triacylglycerol-enriched lipid droplets. PLoS One . 2014; 9( 8): e105047. Google Scholar CrossRef Search ADS PubMed 34. Duarte A, Poderoso C, Cooke M, Soria G, Cornejo Maciel F, Gottifredi V, Podestá EJ. Mitochondrial fusion is essential for steroid biosynthesis. PLoS One . 2012; 7( 9): e45829. Google Scholar CrossRef Search ADS PubMed 35. Hanson GT, Aggeler R, Oglesbee D, Cannon M, Capaldi RA, Tsien RY, Remington SJ. Investigating mitochondrial redox potential with redox-sensitive green fluorescent protein indicators. J Biol Chem . 2004; 279( 13): 13044– 13053. Google Scholar CrossRef Search ADS PubMed 36. Reers M, Smiley ST, Mottola-Hartshorn C, Chen A, Lin M, Chen LB. Mitochondrial membrane potential monitored by JC-1 dye. Methods Enzymol . 1995; 260: 406– 417. Google Scholar CrossRef Search ADS PubMed 37. Sirenko O, Hesley J, Rusyn I, Cromwell EF. High-content assays for hepatotoxicity using induced pluripotent stem cell-derived cells. Assay Drug Dev Technol . 2014; 12( 1): 43– 54. Google Scholar CrossRef Search ADS PubMed 38. Li W, Yang C, Lu J, Huang P, Barnstable CJ, Zhang C, Zhang SS. Tetrandrine protects mouse retinal ganglion cells from ischemic injury. Drug Des Devel Ther . 2014; 8: 327– 339. Google Scholar CrossRef Search ADS PubMed 39. Maldonado EN, Patnaik J, Mullins MR, Lemasters JJ. Free tubulin modulates mitochondrial membrane potential in cancer cells. Cancer Res . 2010; 70( 24): 10192– 10201. Google Scholar CrossRef Search ADS PubMed 40. Rostovtseva TK, Sheldon KL, Hassanzadeh E, Monge C, Saks V, Bezrukov SM, Sackett DL. Tubulin binding blocks mitochondrial voltage-dependent anion channel and regulates respiration. Proc Natl Acad Sci USA . 2008; 105( 48): 18746– 18751. Google Scholar CrossRef Search ADS PubMed 41. Rostovtseva TK, Bezrukov SM. VDAC inhibition by tubulin and its physiological implications. Biochim Biophys Acta . 2012; 1818( 6): 1526– 1535. Google Scholar CrossRef Search ADS PubMed 42. Clark MA, Shay JW. The role of tubulin in the steroidogenic response of murine adrenal and rat Leydig cells. Endocrinology . 1981; 109( 6): 2261– 2263. Google Scholar CrossRef Search ADS PubMed 43. Gatliff J, East D, Crosby J, Abeti R, Harvey R, Craigen W, Parker P, Campanella M. TSPO interacts with VDAC1 and triggers a ROS-mediated inhibition of mitochondrial quality control [published correction appears in Autophagy. 2016;12(2):4420]. Autophagy . 2014; 10( 12): 2279– 2296. Google Scholar CrossRef Search ADS PubMed 44. Granot Z, Kobiler O, Melamed-Book N, Eimerl S, Bahat A, Lu B, Braun S, Maurizi MR, Suzuki CK, Oppenheim AB, Orly J. Turnover of mitochondrial steroidogenic acute regulatory (StAR) protein by Lon protease: the unexpected effect of proteasome inhibitors. Mol Endocrinol . 2007; 21( 9): 2164– 2177. Google Scholar CrossRef Search ADS PubMed 45. King SR, Liu Z, Soh J, Eimerl S, Orly J, Stocco DM. Effects of disruption of the mitochondrial electrochemical gradient on steroidogenesis and the Steroidogenic Acute Regulatory (StAR) protein. J Steroid Biochem Mol Biol . 1999; 69( 1-6): 143– 154. Google Scholar CrossRef Search ADS PubMed 46. Martin J, Mahlke K, Pfanner N. Role of an energized inner membrane in mitochondrial protein import: delta psi drives the movement of presequences. J Biol Chem . 1991; 266( 27): 18051– 18057. Google Scholar PubMed 47. Papadopoulos V. On the role of the translocator protein (18-kDa) TSPO in steroid hormone biosynthesis. Endocrinology . 2014; 155( 1): 15– 20. Google Scholar CrossRef Search ADS PubMed 48. Papadopoulos V, Mukhin AG, Costa E, Krueger KE. The peripheral-type benzodiazepine receptor is functionally linked to Leydig cell steroidogenesis. J Biol Chem . 1990; 265( 7): 3772– 3779. Google Scholar PubMed 49. Mukhin AG, Papadopoulos V, Costa E, Krueger KE. Mitochondrial benzodiazepine receptors regulate steroid biosynthesis. Proc Natl Acad Sci USA . 1989; 86( 24): 9813– 9816. Google Scholar CrossRef Search ADS PubMed 50. Krueger KE, Papadopoulos V. Peripheral-type benzodiazepine receptors mediate translocation of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells. J Biol Chem . 1990; 265( 25): 15015– 15022. Google Scholar PubMed 51. Gavish M, Weizman R. Role of peripheral-type benzodiazepine receptors in steroidogenesis. Clin Neuropharmacol . 1997; 20( 6): 473– 481. Google Scholar CrossRef Search ADS PubMed 52. Lacapère JJ, Papadopoulos V. Peripheral-type benzodiazepine receptor: structure and function of a cholesterol-binding protein in steroid and bile acid biosynthesis. Steroids . 2003; 68( 7-8): 569– 585. Google Scholar CrossRef Search ADS PubMed 53. Gazouli M, Han Z, Papadopoulos V. Identification of a peptide antagonist to the peripheral-type benzodiazepine receptor that inhibits hormone-stimulated Leydig cell steroid formation. J Pharmacol Exp Ther . 2002; 303( 2): 627– 632. Google Scholar CrossRef Search ADS PubMed 54. Midzak A, Akula N, Lecanu L, Papadopoulos V. Novel androstenetriol interacts with the mitochondrial translocator protein and controls steroidogenesis. J Biol Chem . 2011; 286( 11): 9875– 9887. Google Scholar CrossRef Search ADS PubMed 55. Midzak A, Denora N, Laquintana V, Cutrignelli A, Lopedota A, Franco M, Altomare CD, Papadopoulos V. 2-Phenylimidazo[1,2-a]pyridine-containing ligands of the 18-kDa translocator protein (TSPO) behave as agonists and antagonists of steroidogenesis in a mouse leydig tumor cell line. Eur J Pharm Sci . 2015; 76: 231– 237. Google Scholar CrossRef Search ADS PubMed 56. Midzak AS, Akula N, Rone MB, Papadopoulos V. Computational modeling and biological validation of novel non-steroidal ligands for the cholesterol recognition/interaction amino acid consensus (CRAC) motif of the mitochondrial translocator protein (TSPO). Pharmacol Res . 2015; 99: 393– 403. Google Scholar CrossRef Search ADS PubMed 57. Papadopoulos V, Nowzari FB, Krueger KE. Hormone-stimulated steroidogenesis is coupled to mitochondrial benzodiazepine receptors: tropic hormone action on steroid biosynthesis is inhibited by flunitrazepam. J Biol Chem . 1991; 266( 6): 3682– 3687. Google Scholar PubMed 58. Owen DR, Fan J, Campioli E, Venugopal S, Midzak A, Daly E, Harlay A, Issop L, Libri V, Kalogiannopoulou D, Oliver E, Gallego-Colon E, Colasanti A, Huson L, Rabiner EA, Suppiah P, Essagian C, Matthews PM, Papadopoulos V. TSPO mutations in rats and a human polymorphism impair the rate of steroid synthesis. Biochem J . 2017; 474( 23): 3985– 3999. Google Scholar CrossRef Search ADS PubMed 59. Banati RB, Middleton RJ, Chan R, Hatty CR, Kam WW, Quin C, Graeber MB, Parmar A, Zahra D, Callaghan P, Fok S, Howell NR, Gregoire M, Szabo A, Pham T, Davis E, Liu GJ. Positron emission tomography and functional characterization of a complete PBR/TSPO knockout. Nat Commun . 2014; 5: 5452. Google Scholar CrossRef Search ADS PubMed 60. Barron AM, Ji B, Kito S, Suhara T, Higuchi M. Steroidogenic abnormalities in translocator protein knockout mice and significance in the aging male. Biochem J . 2017; BCJ20170645. 61. Rupprecht R, Papadopoulos V, Rammes G, Baghai TC, Fan J, Akula N, Groyer G, Adams D, Schumacher M. Translocator protein (18 kDa) (TSPO) as a therapeutic target for neurological and psychiatric disorders. Nat Rev Drug Discov . 2010; 9( 12): 971– 988. Google Scholar CrossRef Search ADS PubMed 62. Zhao AH, Tu LN, Mukai C, Sirivelu MP, Pillai VV, Morohaku K, Cohen R, Selvaraj V. Mitochondrial translocator protein (TSPO) function is not essential for heme biosynthesis. J Biol Chem . 2016; 291( 4): 1591– 1603. Google Scholar CrossRef Search ADS PubMed 63. Zhang BB, Wang DG, Guo FF, Xuan C. Mitochondrial membrane potential and reactive oxygen species in cancer stem cells. Fam Cancer . 2015; 14( 1): 19– 23. Google Scholar CrossRef Search ADS PubMed 64. Lin R, Angelin A, Da Settimo F, Martini C, Taliani S, Zhu S, Wallace DC. Genetic analysis of dTSPO, an outer mitochondrial membrane protein, reveals its functions in apoptosis, longevity, and Ab42-induced neurodegeneration. Aging Cell . 2014; 13( 3): 507– 518. Google Scholar CrossRef Search ADS PubMed 65. Veenman L, Gavish M. The role of 18 kDa mitochondrial translocator protein (TSPO) in programmed cell death, and effects of steroids on TSPO expression. Curr Mol Med . 2012; 12( 4): 398– 412. Google Scholar PubMed 66. Zeno S, Zaaroor M, Leschiner S, Veenman L, Gavish M. CoCl(2) induces apoptosis via the 18 kDa translocator protein in U118MG human glioblastoma cells. Biochemistry . 2009; 48( 21): 4652– 4661. Google Scholar CrossRef Search ADS PubMed 67. Šileikytė J, Blachly-Dyson E, Sewell R, Carpi A, Menabò R, Di Lisa F, Ricchelli F, Bernardi P, Forte M. Regulation of the mitochondrial permeability transition pore by the outer membrane does not involve the peripheral benzodiazepine receptor (Translocator Protein of 18 kDa (TSPO)). J Biol Chem . 2014; 289( 20): 13769– 13781. Google Scholar CrossRef Search ADS PubMed 68. Šileikytė J, Petronilli V, Zulian A, Dabbeni-Sala F, Tognon G, Nikolov P, Bernardi P, Ricchelli F. Regulation of the inner membrane mitochondrial permeability transition by the outer membrane translocator protein (peripheral benzodiazepine receptor). J Biol Chem . 2011; 286( 2): 1046– 1053. Google Scholar CrossRef Search ADS PubMed 69. Rostovtseva TK, Gurnev PA, Chen MY, Bezrukov SM. Membrane lipid composition regulates tubulin interaction with mitochondrial voltage-dependent anion channel. J Biol Chem . 2012; 287( 35): 29589– 29598. Google Scholar CrossRef Search ADS PubMed 70. Dumontet C, Jordan MA. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nat Rev Drug Discov . 2010; 9( 10): 790– 803. Google Scholar CrossRef Search ADS PubMed 71. Liu Y, Chen XJ. Adenine nucleotide translocase, mitochondrial stress, and degenerative cell death. Oxid Med Cell Longev . 2013 ; 2013: 146860. 72. Thomson M. Does cholesterol use the mitochondrial contact site as a conduit to the steroidogenic pathway? BioEssays . 2003; 25( 3): 252– 258. Google Scholar CrossRef Search ADS PubMed 73. Allen JA, Shankara T, Janus P, Buck S, Diemer T, Hales KH, Hales DB. Energized, polarized, and actively respiring mitochondria are required for acute Leydig cell steroidogenesis. Endocrinology . 2006; 147( 8): 3924– 3935. Google Scholar CrossRef Search ADS PubMed 74. Arakane F, Sugawara T, Nishino H, Liu Z, Holt JA, Pain D, Stocco DM, Miller WL, Strauss JF III. Steroidogenic acute regulatory protein (StAR) retains activity in the absence of its mitochondrial import sequence: implications for the mechanism of StAR action. Proc Natl Acad Sci USA . 1996; 93( 24): 13731– 13736. Google Scholar CrossRef Search ADS PubMed 75. Estabrook RW, Rainey WE. Twinkle, twinkle little StAR, how we wonder what you are. Proc Natl Acad Sci USA . 1996; 93( 24): 13552– 13554. Google Scholar CrossRef Search ADS PubMed Copyright © 2018 Endocrine Society

Journal

Endocrinology – Oxford University Press

Published: Feb 1, 2018

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

CRISPR/Cas9‒Mediated Tspo Gene Mutations Lead to Reduced Mitochondrial Membrane Potential and Steroid Formation in MA-10 Mouse Tumor Leydig Cells

CRISPR/Cas9‒Mediated Tspo Gene Mutations Lead to Reduced Mitochondrial Membrane Potential and Steroid Formation in MA-10 Mouse Tumor Leydig Cells

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

CRISPR/Cas9‒Mediated Tspo Gene Mutations Lead to Reduced Mitochondrial Membrane Potential and Steroid Formation in MA-10 Mouse Tumor Leydig Cells

CRISPR/Cas9‒Mediated Tspo Gene Mutations Lead to Reduced Mitochondrial Membrane Potential and Steroid Formation in MA-10 Mouse Tumor Leydig Cells

References (99)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies