Comparison of probiotics and clay detoxifier on the growth performance and enterotoxic markers of broilers fed diets contaminated with aflatoxin B1

Comparison of probiotics and clay detoxifier on the growth performance and enterotoxic markers of... Abstract This study aimed to investigate the effects of probiotics and clay detoxifier on the growth performance, enterotoxigenic bacteria and endotoxins, mucosal barrier, and visceral lesions of broilers fed diets contaminated with aflatoxin B1 (AFB1). One-day-old Arbor Acres broilers (n = 480) were randomly allocated into 4 groups with 6 replicates of 20 chicks each. Treatments included control, AFB1 (40 μg/kg), probiotics (AFB1 + probiotics 3 × 1010 cfu/kg), and clay (AFB1 + clay 3.0 g/kg). The trial lasted for 21 days. Results showed that AFB1 depressed (P < 0.05) feed intake and body weight gain, and the probiotics and clay detoxifier recovered (P < 0.05) the growth performance. Also, the AFB1 increased (P < 0.05) ileal counts of Clostridium perfringen, Escherichia coli, and Gram-negative bacteria, serum endotoxin and diamine oxidase, and hepatic and intestinal lesions, but decreased (P < 0.05) jejunal mRNA expressions of claudin-1, secretory IgA, and polymeric Ig receptors. Both probiotics and clay detoxifier ameliorated (P < 0.05) these negative effects, except the effects of clay detoxifier on Clostridium perfringen count and intestinal lesion scores, and the beneficial effect of probiotics was greater than that of clay detoxifier. The results suggest that the probiotics are capable of restoring growth performance and ameliorating enterotoxicity in broilers fed diets with AFB1 contamination. DESCRIPTION OF PROBLEM Aflatoxins are fungal toxins that commonly contaminate maize and other types of crops during production, harvest, storage, or processing, of which aflatoxin B1 (AFB1) is the most toxic. Exposure to AFB1 is known to cause both chronic and acute cellular injury in liver or epithelial tissue, and further causes poor health and productivity in broilers [1–2]. Traditionally, non-nutritive absorbents, such as clay detoxifiers, are used against AFB1, which is a heuristic method. However, given its mechanism of detoxification, these absorbents have certain limitations in the aspects of nutrient loss, reduced palatability, and AFB1 absorbed in the feces causing secondary pollution in the environment [3]. Studies have shown that probiotics not only absorb but also degrade AFB1 in vitro [4] and in mice [5]. So, adopting microbial degradation as a palliative to decontaminate aflatoxins can be a cost-effective strategy [6]. In farm animals, Zeng et al. [7] found that Lactobacillus plantarum promoted gastrointestinal tract microbial homeostasis of broilers exposed to AFB1. Fan et al. [8] reported that Bacillus subtilis reduced the damage of AFB1 on serum parameters, function, and histopathological changes of liver in broilers. However, little is known about how probiotics counteract enterotoxicity of AFB1 in farm animals. The present study compared the effects of probiotics and clay detoxifier on the growth performance, enterotoxigenic bacteria and endotoxins, mucosal barrier, and visceral lesions of broilers fed diets contaminated with AFB1. MATERIALS AND METHODS Probiotic Strains, AFB1, Clay Detoxifier, and Diets Probiotic strains included Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430), which are authorized as feed additives by the Announcement of Ministry of Agriculture of China (No. 2045-2013). The probiotic strains were obtained from Hongxiang Biological Feed Laboratory at Henan University of Science and Technology (Luoyang, China) and combined equally to reach a supplementing dose of 3 × 1010 colony-forming units (cfu)/kg of feed. The AFB1 was produced using Aspergillus flavus from the China General Microbiological Culture Collection Center (Beijing, China). A total of 40.0 kg of corn meal (mesh size 2.00 mm) was placed in a 200 L container, with 20.0 L of distilled water, and then autoclaved. The medium was inoculated with 1 L of Aspergillus flavus and incubated at 28 ± 1°C for 7 days. The incubated corn meal was autoclaved to inactivate Aspergillus flavus, dried, and ground (mesh size 0.425 mm) for the animal feeding experiments. The AFB1 concentration in the moldy corn meal was detected as 3,982 μg/kg. Uncontaminated control corn was replaced by the moldy corn to yield an AFB1 concentration of 40 μg/kg of diet. The clay detoxifier was hydrated sodium calcium aluminosilicate and was added at 3.0 g/kg at the expense of corn in the formulation [9]. The nutritive values of diet were recommended by Arbor Acres Broiler Management Handbook in China, and diets were stored in a cool, dry, dark, and well-ventilated place and fed as a dry mash. No antibiotics were offered to broilers via either feed or water throughout the trial. The formulation of the basal diet is listed in Table 1. Table 1 Ingredients and nutrient levels of basal diet.1 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: Vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database, version 25, 2014. View Large Table 1 Ingredients and nutrient levels of basal diet.1 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: Vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database, version 25, 2014. View Large Animals and Samples All the experimental procedures were approved by the Animal Ethics Committee of the Henan University of Science and Technology (Luoyang, China). A total of 480 female Arbor Acres broilers at one d old was randomly distributed into 4 groups with 6 cages of 20 chicks each. The treatment groups included control, AFB1 (40 μg/kg), probiotics (AFB1 + probiotics 3 × 1010 cfu/kg), and clay (AFB1 + clay 3.0 g/kg). All chicks were reared in 3-layered cages and given ad libitum access to diets and water throughout the study. The temperature, ventilation, and light regime of the chicken house were managed according to the Arbor Acres broiler management handbook. Birds and feeds in each cage were weighed weekly, and feed conversion ratio (FCR) was adjusted for mortality on a cage basis. All the birds were monitored for general health at least twice a day. At d 21 of the trial, 6 birds per replicate were randomly selected, weighed, euthanized by CO2, and then dissected. Blood was immediately drawn from the heart with a syringe and aliquoted into sterile vials for serum preparation as described by Liu et al. [10]. The liver, duodenum, jejunum, and ileum were collected and scored for lesions on a scale of 0 to 3 [11]. Next, the jejunum was doubled back, and an approximately 1-cm segment from the middle of the jejunum was dissected and stored in RNAlater [12] for gene expression analysis [10]. Approximately 2 g of ileal digesta were collected and stored at −40°C for gut microflora analysis. Chemical and Biological Analysis The concentrations of AFB1 in the moldy corn and feed were detected according to the Standard of China (GB/T 5009.22-2003) with an enzyme-linked immunosorbent assay kit [13]. The enumeration of ileal bacteria was carried out according to the method by Wu et al. [14] with minor modifications. Briefly, approximately 1 g of each ileal digesta was diluted with 9 mL of ice-cold sterile buffered peptone water (0.1%) and homogenized. The suspension of each sample was serially diluted between 10−1 to 10−7 dilutions, and 100 μL of each diluted sample were subsequently spread onto duplicate selective agar plates for bacterial counting. The number of cfu was expressed as a logarithmic (log10) transformation per gram of intestinal digesta. Media [15] including Escherichia coli Chromogenic Medium (HB7001), Clostridium perfringens Sulfite Polymixin Sulphadiazine Agar Base (HB0256), and Gram-negative Selection Medium (HB8643) were purchased for the cultivation and numeration of ileal bacteria. The concentrations of serum endotoxin were measured using a limulus amoebocyte lysate (LAL)-based kit [16]. Briefly, samples and standards were incubated for 10 min at 37°C with LAL and then for another 6 min with the colorimetric substrate. The internal control for recovery calculation was included in the assessment. The reaction was stopped with 25% acetic acid, and then the absorbance was read at 405 nm. Diamine oxidase activity (1 mL) in serum was examined by a spectrophotometric assay. The diamine oxidase standard (D7876-250) was purchased from Sigma-Aldrich [17]. Total mRNA isolation, cDNA synthesis, primers synthesis, and qPCR reagents for intestinal samples were carried out using commercial kits according to the description of manuals [13]. The mRNA concentration was determined by the OD reading at 260 nm, and the purity was checked using A260/A280 ratio (1.8 to 2.0) and A260/A230 ratio (> 1.5) on a NanoDrop™ 2000 Spectrophotometer [18]. The mRNA profiles of target genes were expressed as the relative expression to the beta-actin gene. Primer information for qPCR is listed in Table 2. The qPCR reactions were set at 10 μL with 5 μL of SYBR Green Master Mix, 1 μL of primer, and 4 μL of 10 × diluted cDNA. All qPCR were run in triplicate on the same thermal cycles (50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min) on the ABI Prism 7900HT Fast Real-Time PCR System [19]. No amplification signal was detected in water or no-RT RNA samples. Table 2 Information on primers for quantitative real-time PCR primers. Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 1sIgA, secretory IgA; pIgR, polymeric Ig receptor. View Large Table 2 Information on primers for quantitative real-time PCR primers. Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 1sIgA, secretory IgA; pIgR, polymeric Ig receptor. View Large Statistics Data were analyzed using Univariate ANOVA of the General Linear Model procedure of SAS [20]. Cage and pooled digesta per cage were the experimental unit for growth performance and gut bacteria counting, respectively. The mean of 6 birds per cage was the statistical unit for blood samples and gene expression. Lesions in the liver or intestine were compared using total lesion scores of 6 birds per cage. Differences of variables were separated using the Duncan test at P < 0.05 level of significance, and the Tamhane T2 test was used in the case of equal variances not assumed. Values in tables were means and root MSE. RESULTS AND DISCUSSION Growth Performance and Mortality Compared to the control diet, AFB1 contamination decreased (P < 0.05) feed intake (FI) and body weight gain (BWG) and increased (P < 0.05) FCR of broilers (Table 3). These findings were consistent with reports that broilers fed the diet containing AFB1 showed poor growth performance or carcass weight [1–2, 21]. The effect of clay detoxifier in the present study further evidenced that clay as one of physical detoxifiers is effective against aflatoxins in the animal feed industry. Table 3 Effects of probiotics and clay detoxifier on the growth performance and mortality of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; FI, feed intake; BWG, body weight gain; FCR, FI/BWG. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Table 3 Effects of probiotics and clay detoxifier on the growth performance and mortality of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; FI, feed intake; BWG, body weight gain; FCR, FI/BWG. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Absorption coupled with biodegradation of AFB1 by microbes has been shown to be more advantageous than the physical absorption alone in vitro or in mice [4, 5]. However, in the present study, the probiotics showed similar effects with the clay detoxifier on the growth performance of broilers. Although both detoxifiers ameliorated (P < 0.05) the negative effects of AFB1 on FI, BWG, and FCR, they did not reach (P < 0.05) the levels of the control diet. Additionally, the AFB1, probiotics, and clay detoxifier did not significantly affect the mortality of broilers in the present study. Enterotoxigenic Bacteria and Enterotoxicity As shown in Table 4, broilers fed the AFB1 diet showed the highest (P < 0.05) counts of Clostridium perfringen, Escherichia coli, and Gram-negative bacteria in the ileal digesta. Also, the AFB1 enhanced (P < 0.05) the levels of serum endotoxins and diamine oxidase, indicating that AFB1, to some extent, caused enterotoxicity. The AFB1 in the gut can affect gut microbiota disequilibration, rapid proliferation of pathogenic microorganisms and increased toxin secretion, and toxin cytotoxicity and genotoxicity in broilers [22–24]. Table 4 Effects of probiotics and clay detoxifier on the enterotoxic markers of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Table 4 Effects of probiotics and clay detoxifier on the enterotoxic markers of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large The endotoxin is mainly derived from gut enterotoxigenic bacteria, Gram-negative microbacteria, Clostridium perfringen, and Escherichia coli [25]. The elevated endotoxin level can lead to vital organ and circulatory system failure [26, 27]. Diamine oxidase is a sensitive indicator of intestinal barrier function, and its elevated level indicates that the mucosal system is suffering from some injuries [28]. In the present study, the findings that higher endotoxin and diamine oxidase in the AFB1 diet than the control demonstrated the mucosal damage by AFB1, either via bacterial toxins or toxic secondary metabolites. Importantly, in the present study, the probiotics diet decreased (P < 0.05) the counts of Clostridium perfringen, Escherichia coli, and Gram-negative bacteria, especially for Clostridium perfringen, which was lower (P < 0.05) than that in the control diet. Also, the clay detoxifier reduced (P < 0.05) the counts of Escherichia coli and Gram-negative bacteria, but had no effect on Clostridium perfringen, compared to the AFB1 diet. Similarly, the probiotics and clay showed protection of enterocytes due to decreasing (P < 0.05) levels of endotoxin and diamine oxidase. The more significant effect of the probiotics on Clostridium perfringen indicated it is a better detoxifier against AFB1 in contrast to the clay absorbent. Probiotic bacteria have been purported to do many things, including inhibiting proliferation of harmful bacteria and improving gastrointestinal barrier function [29]. Xue et al. [30] found that probiotics restored the gut microbiota structure and decreased endotoxin secretion in rats. However, in the case of farm animals, literature about probiotics effect on endotoxin is very limited, particularly based on the diet with AFB1 contamination. Zhang et al. [31] demonstrated that the probiotic Clostridium butyricum decreased serum endotoxin and diamine oxidase in broiler chickens challenged with Escherichia coli. Similarly, Aspergillus oryzae- and Bacillus subtilis-based direct-fed bacteria increased ileal trans-epithelial electrical resistance and decreased colon endotoxin permeability in broilers challenged with coccidial vaccine [32]. The results in present study demonstrated that probiotics are a desirable candidate to counteract enterotoxins in farm animals. Intestinal Mucosal Barrier and Lesion Scores The intestinal mucosal barrier markers and lesion scores are shown in Table 5. Compared to the control diet, AFB1 down-regulated (P < 0.05) the mRNA levels of claudin-1, secretory (sIgA), and polymeric immunoglobulin receptor (pIgR) in the jejunum of broilers. The inclusion of probiotics and clay detoxifier up-regulated (P < 0.05) the mRNA profiles of the 3 genes, but did not reach the levels of the control diet. Table 5. Effects of probiotics and clay detoxifier on mucosal barrier and lesion scores of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; sIgA, secretory IgA; pIgR, polymeric Ig receptor. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Table 5. Effects of probiotics and clay detoxifier on mucosal barrier and lesion scores of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; sIgA, secretory IgA; pIgR, polymeric Ig receptor. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Claudin-1 or tight junction represents one mode of cell-to-cell adhesion in epithelial cell sheets, serving as a physical barrier, including to enterotoxin invasion [33]. Research showed that probiotics up-regulated tight junction protein expression in rats [31] and mucin mRNA levels in broilers [33]. Intestinal sIgA reflects the intestinal immunity state [34], and pIgR facilitates the secretion of the soluble polymeric isoforms of IgA and IgM [35], and their levels could be elevated by probiotics in broilers [36] or by prebiotics in mice [37]. In the present study, similar effects were found when supplemented with Lactobacillus acidophilus, Lactobacillus plantarum, and Enterococcus faecium in broilers. Additionally, in the present study, the lesion scores of the liver and intestine were increased (P < 0.05) by the AFB1, and decreased (P < 0.05) by the probiotics. The clay detoxifier decreased (P < 0.05) lesion scores in the liver, but not in the intestine, indicating that the probiotics are more effective than clay detoxifier in reducing the incidence of necrotic lesions of broilers. It has shown that AFB1 plays an important role in predisposing broilers to necrotic enteritis [38], and the physical detoxifier is protective from necrotic enteritis for broilers exposed to aflatoxins [39]. Some probiotic strains seem to be a natural guardian for the gut to defend against necrotic enteritis. Jayaraman et al. [40] observed that Bacillus subtilis not only controlled Clostridium perfringens-induced necrotic enteritis, but also improved intestinal health in the broiler birds. Also, Cao et al. [41] reported that Lactobacillus fermentum reduced lesions in chickens with Clostridium perfringens-induced necrotic enteritis. When Clostridium perfringens and AFB1 are concurrent, the literature about the effect of probiotics on necrotic enteritis is very limited. Compared to clay detoxifier, the fewer lesions in the probiotics group may imply that AFB1 is partially biodegraded by the probiotics, and this needs further study. It should be noted that probiotics are tools that can be used to modulate necrotic enteritis, but it is largely a secondary bacterial issue with many causes, and there is certainly not a single preventive measure. CONCLUSIONS AND APPLICATIONS Both probiotics and clay detoxifier showed beneficial regulation in intestinal flora equilibration and enterotoxigenic bacteria, endotoxin secretory, barrier function, and necrotic lesions caused by dietary AFB1. The probiotic are more capable than clay detoxifier to counteract enterotoxicity and keep gut health in broilers fed AFB1 contaminated diets. Footnotes Primary Audience: Researchers, Live Production Managers REFERENCES AND NOTES 1. Oguz H. , Hadimli H. H. , Kurtoglu V. , Erganis O. . 2003 . Evaluation of humoral immunity of broilers during chronic aflatoxin (50 and 100 ppb) and clinoptilolite exposure . Rev. Med. Vet. 154 : 483 – 486 . 2. Alam S. , Shah H. U. , Afzal M. , Magan N. . 2014 . Influence of calcium propionate, water activity and storage time on mold incidence and aflatoxins production in broiler starter feed . Anim. Feed Sci. Technol. 188 : 137 – 144 . Google Scholar CrossRef Search ADS 3. Andretta I. , Kipper M. , Lehnen C. R. , Hauschild L. , Vale M. M. , Lovatto P. A. . 2011 . Meta-analytical study of productive and nutritional interactions of mycotoxins in broilers . Poult. Sci. 90 : 1934 – 1940 . Google Scholar CrossRef Search ADS PubMed 4. Roger T. , Leopold T. N. . 2015 . Effect of selected lactic acid bacteria on growth of Aspergillus flavus and aflatoxin B1 production in kutukutu . J. Microbiol. Res. 5 : 84 – 94 . 5. Abbes S. , Salah-Abbes J. B. , Jebali R. , Younes R. B. , Oueslati R. . 2016 . Interaction of aflatoxin B1 and fumonisin B1 in mice causes immunotoxicity and oxidative stress: Possible protective role using lactic acid bacteria . J. Immunotoxicol. 13 : 46 – 54 . Google Scholar CrossRef Search ADS PubMed 6. Adebo O. A. , Njobeh P. B. , Gbashi S. , Nwinyi O. C. , Mavumengwana V. . 2017 . Review on microbial degradation of aflatoxins . Crit. Rev. Food Sci. Nutr. 57 : 3208 – 3217 . Google Scholar CrossRef Search ADS PubMed 7. Zeng Y. , Zeng D. , Zhang Y. , Ni X. Q. , Wang J. , Jian P. , Zhou Y. , Li Y. , Yin Z. Q. , Pan K. C. , Jing B. . 2017 . Lactobacillus plantarum BS22 promotes gut microbial homeostasis in broiler chickens exposed to aflatoxin B1 . J. Anim. Physiol. Anim. Nutr. In press . 8. Fan Y. , Zhao L. , Ji C. , Li X. , Jia R. , Xi L. , Zhang J. , Ma Q. . 2015 . Protective effects of Bacillus subtilis ANSB060 on serum biochemistry, histopathological changes and antioxidant enzyme activities of broilers fed moldy peanut meal naturally contaminated with aflatoxins . Toxins 7 : 3330 – 3343 . Google Scholar CrossRef Search ADS PubMed 9. Hydrated sodium calcium aluminosilicate, Kemin Industries, Zhuhai, China . 10. Liu N. , Ru Y. , Cowieson A. J. , Li F. , Cheng X. . 2008 . Effects of phytate and phytase on the performance and immune function of broilers fed nutritionally marginal diets . Poult. Sci. 87 : 1105 – 1111 . Google Scholar CrossRef Search ADS PubMed 11. Gholamiandehkordi A. R. , Timbermont L. , Lanckriet A. , Broeck Van Den W. , Pedersen K. , Dewulf J. , Pasmans F. , Haesebrouck F. , Ducatelle R. , Van Immerseel F. . 2007 . Quantification of gut lesions in a subclinical necrotic enteritis model . Avian Pathol . 36 : 375 – 382 . Google Scholar CrossRef Search ADS PubMed 12. RNAlater, primer synthesis, cDNA and real-time PCR reagents, TaKaRa Co., Ltd, Dalian, China . 13. Aflatoxin B1 enzyme-linked immunosorbent assay kit, detection limit 2 μg/kg, Longke Fangzhou Biotech, Beijing, China . 14. Wu S. , Stanley D. , Rodgers N. , Swick R. A. , Moore R. J. . 2014 . Two necrotic enteritis predisposing factors, dietary fishmeal and Eimeria infection, induce large changes in the caecal microbiota of broiler chickens . Vet. Microbiol. 169 : 188 – 197 . Google Scholar CrossRef Search ADS PubMed 15. Microbial media products, Qingdao Hope Bio-Technology Co., Ltd., Shandong, China . 16. Limulus amoebocyte lysate-based kit, LALQCL-1000, Lonza, Walkersville, MD . 17. The diamine oxidase standard (D7876-250), Sigma-Aldrich Co., Ltd, Beijing, China . 18. NanoDrop™ 2000 Spectrophotometer, Thermo Fisher Scientific Inc., Waltham, MA . 19. ABI Prism 7900HT Fast Real-Time PCR System, Applied Biosystems Inc., Waltham, MA . 20. SAS software, SAS Inst. Inc., Cary, NC . 21. Magnoli A. P. , Rodriguez M. C. , Pereyra M. G. , Poloni V. L. , Peralta M. F. , Nilson A. J. , Miazzo R. D. , Bagnis G. , Chiacchiera S. M. , Cavaglieri L. R. . 2017 . Use of yeast (Pichia kudriavzevii) as a novel feed additive to ameliorate the effects of aflatoxin B1 on broiler chicken performance . Mycotoxin Res . 8 : 273 – 283 . Google Scholar CrossRef Search ADS 22. He Y. , Fang J. , Peng X. , Cui H. , Zuo Z. , Deng J. , Chen Z. , Lai W. , Shu G. , Tang L. . 2014 . Effects of sodium selenite on aflatoxin B1-induced decrease of ileac T cell and the mRNA contents of IL-2, IL-6, and TNF-α in broilers . Biol. Trace Elem. Res. 159 : 167 – 173 . Google Scholar CrossRef Search ADS PubMed 23. Jahanian E. , Mahdavi A. H. , Asgary S. , Jahanian R. . 2017 . Effects of dietary inclusion of silymarin on performance, intestinal morphology and ileal bacterial count in aflatoxin-challenged broiler chicks . J. Anim. Physiol. Anim. Nutr. 101 : e43 – e54 . Google Scholar CrossRef Search ADS 24. Mughal M. J. , Peng X. , Kamboh A. A. , Zhou Y. , Fang J. . 2017 . Aflatoxin B1 induced systemic toxicity in poultry and rescue effects of selenium and zinc . Biol. Trace Elem. Res. 7 : 1 – 9 . 25. Kulp A. , Kuehn M. J. . 2010 . Biological functions and biogenesis of secreted bacterial outer membrane vesicles . Annu. Rev. Microbiol. 64 : 163 – 184 . Google Scholar CrossRef Search ADS PubMed 26. Yamasaki R. , Kerwood D. E. , Schneider H. , Quinn K. P. , Griffiss J. M. , Mandrell R. E. . 1994 . The structure of lipooligosaccharide produced by Neisseria gonorrhoeae, strain 15253, isolated from a patient with disseminated infection. Evidence for a new glycosylation pathway of the gonococcal lipooligosaccharide . J. Biol. Chem. 269 : 30345 – 30351 . Google Scholar PubMed 27. Stephens D. S. , Greenwood B. , Brandtzaeg P. . 2007 . Epidemic meningitis, meningococcaemia, and Neisseria meningitidis . Lancet 369 : 2196 – 2210 . Google Scholar CrossRef Search ADS PubMed 28. Meng Y. , Zhang Y. , Liu M. , Huang Y. K. , Zhang J. , Yao Q. , Zhao Y. L. , Xiong J. J. . 2016 . Evaluating intestinal permeability by measuring plasma endotoxin and diamine oxidase in children with acute lymphoblastic leukemia treated with high-dose methotrexate . Anti-Canc. Agents Med. Chem. 16 : 387 – 392 . Google Scholar CrossRef Search ADS 29. Nava G. M. , Bielke L. R. , Callaway T. R. , Castaneda M. P. . 2005 . Probiotic alternatives to reduce gastrointestinal infections: The poultry experience . Anim. Health Res. Rev. 6 : 105 – 118 . Google Scholar CrossRef Search ADS PubMed 30. Xue L. , He J. , Gao N. , Lu X. , Li M. , Wu X. , Liu Z. , Jin Y. , Liu J. , Xu J. , Geng Y. . 2017 . Probiotics may delay the progression of nonalcoholic fatty liver disease by restoring the gut microbiota structure and improving intestinal endotoxemia . Sci. Rep. 7 : 45176 . Google Scholar CrossRef Search ADS PubMed 31. Zhang L. , Zhang L. , Zeng X. , Zhou L. , Cao G. , Yang C. . 2016 . Effects of dietary supplementation of probiotic, Clostridium butyricum, on growth performance, immune response, intestinal barrier function, and digestive enzyme activity in broiler chickens challenged with Escherichia coli K88 . J. Anim. Sci. Biotechnol. 7 : 3 . Google Scholar CrossRef Search ADS PubMed 32. Murugesan G. R. , Gabler N. K. , Persia M. E. . 2014 . Effects of direct-fed microbial supplementation on broiler performance, intestinal nutrient transport and integrity under experimental conditions with increased microbial challenge . Br. Poult. Sci. 55 : 89 – 97 . Google Scholar CrossRef Search ADS PubMed 33. Buckley A. , Turner J. R. . 2017 . Cell biology of tight junction barrier regulation and mucosal disease . CSH Perspect. Biol. 15 : a029314 . 34. Corthesy B. 2013 . Role of secretory IgA in infection and maintenance of homeostasis . Autoimmun. Rev. 12 : 661 – 665 . Google Scholar CrossRef Search ADS PubMed 35. Hood L. , Kronenberg M. , Hunkapiller T. . 1985 . T cell antigen receptors and the immunoglobulin supergene family . Cell 40 : 225 – 229 . Google Scholar CrossRef Search ADS PubMed 36. Wang S. , Peng Q. , Jia H. M. , Zeng X. F. , Zhu J. L. , Hou C. L. , Liu X. T. , Yang F. J. , Qiao S. Y. . 2017 . Prevention of Escherichia coli infection in broiler chickens with Lactobacillus plantarum B1 . Poult. Sci. 96 : 2576 – 2586 . Google Scholar CrossRef Search ADS PubMed 37. Nakamura Y. , Nosaka S. , Suzuki M. , Nagafuchi S. , Takahashi T. , Yajima T. , takenouchi-ohkubo N. , Iwase T. , Moro I. . 2004 . Dietary fructooligosaccharides up-regulate immunoglobulin A response and polymeric immunoglobulin receptor expression in intestines of infant mice . Clin. Exp. Immunol. 137 : 52 – 58 . Google Scholar CrossRef Search ADS PubMed 38. Cravens R. L. , Goss G. R. , Chi F. , De Boer E. D. , Davis S. W. , Hendrix S. M. , Richardson J. A. , Johnston S. L. . 2013 . The effects of necrotic enteritis, aflatoxin B1, and virginiamycin on growth performance, necrotic enteritis lesion scores, and mortality in young broilers . Poult. Sci. 92 : 1997 – 2004 . Google Scholar CrossRef Search ADS PubMed 39. Huff W. E. , Kubena L. F. , Harvey R. B. , Philips T. D. . 1992 . Efficacy of HSCAS to reduce individual and combined toxicity of aflatoxin and ochratoxin A . Poult. Sci. 71 : 64 – 69 . Google Scholar CrossRef Search ADS PubMed 40. Jayaraman S. , Thangavel G. , Kurian H. , Mani R. , Mukkalil R. , Chirakkal H. . 2013 . Bacillus subtilis PB6 improves intestinal health of broiler chickens challenged with Clostridium perfringens-induced necrotic enteritis . Poult. Sci. 92 : 370 – 374 . Google Scholar CrossRef Search ADS PubMed 41. Cao L. , Yang X. J. , Li Z. J. , Sun F. F. , Wu X. H. , Yao J. H. . 2012 . Reduced lesions in chickens with Clostridium perfringens-induced necrotic enteritis by Lactobacillus fermentum 1.2029 1 2 . Poult. Sci. 91 : 3065 – 3071 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Applied Poultry Research Oxford University Press

Comparison of probiotics and clay detoxifier on the growth performance and enterotoxic markers of broilers fed diets contaminated with aflatoxin B1

Loading next page...
 
/lp/ou_press/comparison-of-probiotics-and-clay-detoxifier-on-the-growth-performance-C1JkxZ9Yke
Publisher
Applied Poultry Science, Inc.
Copyright
© 2018 Poultry Science Association Inc.
ISSN
1056-6171
eISSN
1537-0437
D.O.I.
10.3382/japr/pfy003
Publisher site
See Article on Publisher Site

Abstract

Abstract This study aimed to investigate the effects of probiotics and clay detoxifier on the growth performance, enterotoxigenic bacteria and endotoxins, mucosal barrier, and visceral lesions of broilers fed diets contaminated with aflatoxin B1 (AFB1). One-day-old Arbor Acres broilers (n = 480) were randomly allocated into 4 groups with 6 replicates of 20 chicks each. Treatments included control, AFB1 (40 μg/kg), probiotics (AFB1 + probiotics 3 × 1010 cfu/kg), and clay (AFB1 + clay 3.0 g/kg). The trial lasted for 21 days. Results showed that AFB1 depressed (P < 0.05) feed intake and body weight gain, and the probiotics and clay detoxifier recovered (P < 0.05) the growth performance. Also, the AFB1 increased (P < 0.05) ileal counts of Clostridium perfringen, Escherichia coli, and Gram-negative bacteria, serum endotoxin and diamine oxidase, and hepatic and intestinal lesions, but decreased (P < 0.05) jejunal mRNA expressions of claudin-1, secretory IgA, and polymeric Ig receptors. Both probiotics and clay detoxifier ameliorated (P < 0.05) these negative effects, except the effects of clay detoxifier on Clostridium perfringen count and intestinal lesion scores, and the beneficial effect of probiotics was greater than that of clay detoxifier. The results suggest that the probiotics are capable of restoring growth performance and ameliorating enterotoxicity in broilers fed diets with AFB1 contamination. DESCRIPTION OF PROBLEM Aflatoxins are fungal toxins that commonly contaminate maize and other types of crops during production, harvest, storage, or processing, of which aflatoxin B1 (AFB1) is the most toxic. Exposure to AFB1 is known to cause both chronic and acute cellular injury in liver or epithelial tissue, and further causes poor health and productivity in broilers [1–2]. Traditionally, non-nutritive absorbents, such as clay detoxifiers, are used against AFB1, which is a heuristic method. However, given its mechanism of detoxification, these absorbents have certain limitations in the aspects of nutrient loss, reduced palatability, and AFB1 absorbed in the feces causing secondary pollution in the environment [3]. Studies have shown that probiotics not only absorb but also degrade AFB1 in vitro [4] and in mice [5]. So, adopting microbial degradation as a palliative to decontaminate aflatoxins can be a cost-effective strategy [6]. In farm animals, Zeng et al. [7] found that Lactobacillus plantarum promoted gastrointestinal tract microbial homeostasis of broilers exposed to AFB1. Fan et al. [8] reported that Bacillus subtilis reduced the damage of AFB1 on serum parameters, function, and histopathological changes of liver in broilers. However, little is known about how probiotics counteract enterotoxicity of AFB1 in farm animals. The present study compared the effects of probiotics and clay detoxifier on the growth performance, enterotoxigenic bacteria and endotoxins, mucosal barrier, and visceral lesions of broilers fed diets contaminated with AFB1. MATERIALS AND METHODS Probiotic Strains, AFB1, Clay Detoxifier, and Diets Probiotic strains included Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430), which are authorized as feed additives by the Announcement of Ministry of Agriculture of China (No. 2045-2013). The probiotic strains were obtained from Hongxiang Biological Feed Laboratory at Henan University of Science and Technology (Luoyang, China) and combined equally to reach a supplementing dose of 3 × 1010 colony-forming units (cfu)/kg of feed. The AFB1 was produced using Aspergillus flavus from the China General Microbiological Culture Collection Center (Beijing, China). A total of 40.0 kg of corn meal (mesh size 2.00 mm) was placed in a 200 L container, with 20.0 L of distilled water, and then autoclaved. The medium was inoculated with 1 L of Aspergillus flavus and incubated at 28 ± 1°C for 7 days. The incubated corn meal was autoclaved to inactivate Aspergillus flavus, dried, and ground (mesh size 0.425 mm) for the animal feeding experiments. The AFB1 concentration in the moldy corn meal was detected as 3,982 μg/kg. Uncontaminated control corn was replaced by the moldy corn to yield an AFB1 concentration of 40 μg/kg of diet. The clay detoxifier was hydrated sodium calcium aluminosilicate and was added at 3.0 g/kg at the expense of corn in the formulation [9]. The nutritive values of diet were recommended by Arbor Acres Broiler Management Handbook in China, and diets were stored in a cool, dry, dark, and well-ventilated place and fed as a dry mash. No antibiotics were offered to broilers via either feed or water throughout the trial. The formulation of the basal diet is listed in Table 1. Table 1 Ingredients and nutrient levels of basal diet.1 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: Vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database, version 25, 2014. View Large Table 1 Ingredients and nutrient levels of basal diet.1 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 Items Contents (%) Ingredients  Corn 57.10  Soybean meal 26.70  Corn gluten meal 5.00  Full-fat soybean 5.00  Soybean oil 1.00  Limestone 1.20  L-Lysine 0.20  DL-Methionine 0.15  Salt 0.40  Dicalcium phosphate 2.10  Choline chloride 0.15  Premix2 1.00 Nutrients3  Crude protein 21.46  ME (MJ/kg) 12.38  Ca 1.03  Total P 0.72  Non-phytate P 0.50  Met 0.50  Met + Cys 0.84  Lys 1.21 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: Vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database, version 25, 2014. View Large Animals and Samples All the experimental procedures were approved by the Animal Ethics Committee of the Henan University of Science and Technology (Luoyang, China). A total of 480 female Arbor Acres broilers at one d old was randomly distributed into 4 groups with 6 cages of 20 chicks each. The treatment groups included control, AFB1 (40 μg/kg), probiotics (AFB1 + probiotics 3 × 1010 cfu/kg), and clay (AFB1 + clay 3.0 g/kg). All chicks were reared in 3-layered cages and given ad libitum access to diets and water throughout the study. The temperature, ventilation, and light regime of the chicken house were managed according to the Arbor Acres broiler management handbook. Birds and feeds in each cage were weighed weekly, and feed conversion ratio (FCR) was adjusted for mortality on a cage basis. All the birds were monitored for general health at least twice a day. At d 21 of the trial, 6 birds per replicate were randomly selected, weighed, euthanized by CO2, and then dissected. Blood was immediately drawn from the heart with a syringe and aliquoted into sterile vials for serum preparation as described by Liu et al. [10]. The liver, duodenum, jejunum, and ileum were collected and scored for lesions on a scale of 0 to 3 [11]. Next, the jejunum was doubled back, and an approximately 1-cm segment from the middle of the jejunum was dissected and stored in RNAlater [12] for gene expression analysis [10]. Approximately 2 g of ileal digesta were collected and stored at −40°C for gut microflora analysis. Chemical and Biological Analysis The concentrations of AFB1 in the moldy corn and feed were detected according to the Standard of China (GB/T 5009.22-2003) with an enzyme-linked immunosorbent assay kit [13]. The enumeration of ileal bacteria was carried out according to the method by Wu et al. [14] with minor modifications. Briefly, approximately 1 g of each ileal digesta was diluted with 9 mL of ice-cold sterile buffered peptone water (0.1%) and homogenized. The suspension of each sample was serially diluted between 10−1 to 10−7 dilutions, and 100 μL of each diluted sample were subsequently spread onto duplicate selective agar plates for bacterial counting. The number of cfu was expressed as a logarithmic (log10) transformation per gram of intestinal digesta. Media [15] including Escherichia coli Chromogenic Medium (HB7001), Clostridium perfringens Sulfite Polymixin Sulphadiazine Agar Base (HB0256), and Gram-negative Selection Medium (HB8643) were purchased for the cultivation and numeration of ileal bacteria. The concentrations of serum endotoxin were measured using a limulus amoebocyte lysate (LAL)-based kit [16]. Briefly, samples and standards were incubated for 10 min at 37°C with LAL and then for another 6 min with the colorimetric substrate. The internal control for recovery calculation was included in the assessment. The reaction was stopped with 25% acetic acid, and then the absorbance was read at 405 nm. Diamine oxidase activity (1 mL) in serum was examined by a spectrophotometric assay. The diamine oxidase standard (D7876-250) was purchased from Sigma-Aldrich [17]. Total mRNA isolation, cDNA synthesis, primers synthesis, and qPCR reagents for intestinal samples were carried out using commercial kits according to the description of manuals [13]. The mRNA concentration was determined by the OD reading at 260 nm, and the purity was checked using A260/A280 ratio (1.8 to 2.0) and A260/A230 ratio (> 1.5) on a NanoDrop™ 2000 Spectrophotometer [18]. The mRNA profiles of target genes were expressed as the relative expression to the beta-actin gene. Primer information for qPCR is listed in Table 2. The qPCR reactions were set at 10 μL with 5 μL of SYBR Green Master Mix, 1 μL of primer, and 4 μL of 10 × diluted cDNA. All qPCR were run in triplicate on the same thermal cycles (50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min) on the ABI Prism 7900HT Fast Real-Time PCR System [19]. No amplification signal was detected in water or no-RT RNA samples. Table 2 Information on primers for quantitative real-time PCR primers. Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 1sIgA, secretory IgA; pIgR, polymeric Ig receptor. View Large Table 2 Information on primers for quantitative real-time PCR primers. Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 Primers (5’→3’) Length (bp) Names Accession numbers Forward Reverse Claudin-1 NM_001013611.2 cgtgtttttcatcgcagcca gtcgtacaccttgcactgga 257 sIgA1 S40610 cctactactgcgccaaaggt ctgtagtccaggtgacggtg 222 pIgR1 XM_015298928 caggtggaaatgcagggcta tcttgcattccacgtcaggtt 202 Beta-actin NM_205518 gccgagagagaaattgtgcg cacaggactccatacccaaga 208 1sIgA, secretory IgA; pIgR, polymeric Ig receptor. View Large Statistics Data were analyzed using Univariate ANOVA of the General Linear Model procedure of SAS [20]. Cage and pooled digesta per cage were the experimental unit for growth performance and gut bacteria counting, respectively. The mean of 6 birds per cage was the statistical unit for blood samples and gene expression. Lesions in the liver or intestine were compared using total lesion scores of 6 birds per cage. Differences of variables were separated using the Duncan test at P < 0.05 level of significance, and the Tamhane T2 test was used in the case of equal variances not assumed. Values in tables were means and root MSE. RESULTS AND DISCUSSION Growth Performance and Mortality Compared to the control diet, AFB1 contamination decreased (P < 0.05) feed intake (FI) and body weight gain (BWG) and increased (P < 0.05) FCR of broilers (Table 3). These findings were consistent with reports that broilers fed the diet containing AFB1 showed poor growth performance or carcass weight [1–2, 21]. The effect of clay detoxifier in the present study further evidenced that clay as one of physical detoxifiers is effective against aflatoxins in the animal feed industry. Table 3 Effects of probiotics and clay detoxifier on the growth performance and mortality of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; FI, feed intake; BWG, body weight gain; FCR, FI/BWG. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Table 3 Effects of probiotics and clay detoxifier on the growth performance and mortality of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Growth performance  FI1 (g/bird) 913.55a 864.97c 894.48b 896.64b 3.79 0.000  BWG1 (g/bird) 611.18a 566.00c 593.80b 591.28b 3.21 0.000  FCR1 1.495b 1.528a 1.506a,b 1.517a,b 0.01 0.144  Mortality (%) 1.67 2.50 1.67 1.67 1.07 0.928 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; FI, feed intake; BWG, body weight gain; FCR, FI/BWG. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Absorption coupled with biodegradation of AFB1 by microbes has been shown to be more advantageous than the physical absorption alone in vitro or in mice [4, 5]. However, in the present study, the probiotics showed similar effects with the clay detoxifier on the growth performance of broilers. Although both detoxifiers ameliorated (P < 0.05) the negative effects of AFB1 on FI, BWG, and FCR, they did not reach (P < 0.05) the levels of the control diet. Additionally, the AFB1, probiotics, and clay detoxifier did not significantly affect the mortality of broilers in the present study. Enterotoxigenic Bacteria and Enterotoxicity As shown in Table 4, broilers fed the AFB1 diet showed the highest (P < 0.05) counts of Clostridium perfringen, Escherichia coli, and Gram-negative bacteria in the ileal digesta. Also, the AFB1 enhanced (P < 0.05) the levels of serum endotoxins and diamine oxidase, indicating that AFB1, to some extent, caused enterotoxicity. The AFB1 in the gut can affect gut microbiota disequilibration, rapid proliferation of pathogenic microorganisms and increased toxin secretion, and toxin cytotoxicity and genotoxicity in broilers [22–24]. Table 4 Effects of probiotics and clay detoxifier on the enterotoxic markers of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Table 4 Effects of probiotics and clay detoxifier on the enterotoxic markers of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40 40 40  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Enterotoxigenic bacteria (Log10 cfu/g of ileal digesta)  Clostridium perfringen 2.74b 3.21a 2.27c 3.19a 0.06 0.000  Escherichia coli 6.45c 7.02a 6.82b 6.77b 0.07 0.000  Gram-negative bacteria 6.55c 7.57a 6.92b 7.07b 0.07 0.000 Enterotoxicity  Endotoxin (EU/mL) 0.23c 0.31a 0.21c 0.27b 0.01 0.000  Diamine oxidase (U/mL) 0.79c 1.20a 0.83c 0.97b 0.04 0.000 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large The endotoxin is mainly derived from gut enterotoxigenic bacteria, Gram-negative microbacteria, Clostridium perfringen, and Escherichia coli [25]. The elevated endotoxin level can lead to vital organ and circulatory system failure [26, 27]. Diamine oxidase is a sensitive indicator of intestinal barrier function, and its elevated level indicates that the mucosal system is suffering from some injuries [28]. In the present study, the findings that higher endotoxin and diamine oxidase in the AFB1 diet than the control demonstrated the mucosal damage by AFB1, either via bacterial toxins or toxic secondary metabolites. Importantly, in the present study, the probiotics diet decreased (P < 0.05) the counts of Clostridium perfringen, Escherichia coli, and Gram-negative bacteria, especially for Clostridium perfringen, which was lower (P < 0.05) than that in the control diet. Also, the clay detoxifier reduced (P < 0.05) the counts of Escherichia coli and Gram-negative bacteria, but had no effect on Clostridium perfringen, compared to the AFB1 diet. Similarly, the probiotics and clay showed protection of enterocytes due to decreasing (P < 0.05) levels of endotoxin and diamine oxidase. The more significant effect of the probiotics on Clostridium perfringen indicated it is a better detoxifier against AFB1 in contrast to the clay absorbent. Probiotic bacteria have been purported to do many things, including inhibiting proliferation of harmful bacteria and improving gastrointestinal barrier function [29]. Xue et al. [30] found that probiotics restored the gut microbiota structure and decreased endotoxin secretion in rats. However, in the case of farm animals, literature about probiotics effect on endotoxin is very limited, particularly based on the diet with AFB1 contamination. Zhang et al. [31] demonstrated that the probiotic Clostridium butyricum decreased serum endotoxin and diamine oxidase in broiler chickens challenged with Escherichia coli. Similarly, Aspergillus oryzae- and Bacillus subtilis-based direct-fed bacteria increased ileal trans-epithelial electrical resistance and decreased colon endotoxin permeability in broilers challenged with coccidial vaccine [32]. The results in present study demonstrated that probiotics are a desirable candidate to counteract enterotoxins in farm animals. Intestinal Mucosal Barrier and Lesion Scores The intestinal mucosal barrier markers and lesion scores are shown in Table 5. Compared to the control diet, AFB1 down-regulated (P < 0.05) the mRNA levels of claudin-1, secretory (sIgA), and polymeric immunoglobulin receptor (pIgR) in the jejunum of broilers. The inclusion of probiotics and clay detoxifier up-regulated (P < 0.05) the mRNA profiles of the 3 genes, but did not reach the levels of the control diet. Table 5. Effects of probiotics and clay detoxifier on mucosal barrier and lesion scores of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; sIgA, secretory IgA; pIgR, polymeric Ig receptor. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Table 5. Effects of probiotics and clay detoxifier on mucosal barrier and lesion scores of broilers fed diets contaminated with aflatoxin B1. Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 Treatments Statistics Items Control AFB1 Probiotics Clay SEM P-value Dietary factors  AFB11 (μg/kg) −4 40.0 40.0 40.0  Probiotics2 (cfu/kg) −4 −4 3 × 1010 −4  Clay3 (g/kg) −4 −4 −4 3.0 Relative mRNA expression (2−ΔΔCt) in jejunum  Claudin-1 6.26a 3.83c 5.34b 5.03b 0.16 0.000  sIgA1 4.50a 1.31c 3.21b 3.29b 0.25 0.000  pIgR1 2.83a 0.83c 2.06b 1.67b 0.14 0.000 Visceral lesion scores  Liver 0.67b 1.67a 0.67b 0.83b 0.24 0.022  Intestine 1.67c 3.00a 1.83b,c 2.50a,b 0.25 0.005 a–cMeans (n = 6) within a row not sharing a superscript are significantly different (P < 0.05). 1AFB1, aflatoxin B1; sIgA, secretory IgA; pIgR, polymeric Ig receptor. 2Probiotics included equal amounts of Lactobacillus acidophilus (ACCC11073), Lactobacillus plantarum (CICC21863), and Enterococcus faecium (CICC20430). 3Clay was hydrated sodium calcium aluminosilicate. 4This component was not included. View Large Claudin-1 or tight junction represents one mode of cell-to-cell adhesion in epithelial cell sheets, serving as a physical barrier, including to enterotoxin invasion [33]. Research showed that probiotics up-regulated tight junction protein expression in rats [31] and mucin mRNA levels in broilers [33]. Intestinal sIgA reflects the intestinal immunity state [34], and pIgR facilitates the secretion of the soluble polymeric isoforms of IgA and IgM [35], and their levels could be elevated by probiotics in broilers [36] or by prebiotics in mice [37]. In the present study, similar effects were found when supplemented with Lactobacillus acidophilus, Lactobacillus plantarum, and Enterococcus faecium in broilers. Additionally, in the present study, the lesion scores of the liver and intestine were increased (P < 0.05) by the AFB1, and decreased (P < 0.05) by the probiotics. The clay detoxifier decreased (P < 0.05) lesion scores in the liver, but not in the intestine, indicating that the probiotics are more effective than clay detoxifier in reducing the incidence of necrotic lesions of broilers. It has shown that AFB1 plays an important role in predisposing broilers to necrotic enteritis [38], and the physical detoxifier is protective from necrotic enteritis for broilers exposed to aflatoxins [39]. Some probiotic strains seem to be a natural guardian for the gut to defend against necrotic enteritis. Jayaraman et al. [40] observed that Bacillus subtilis not only controlled Clostridium perfringens-induced necrotic enteritis, but also improved intestinal health in the broiler birds. Also, Cao et al. [41] reported that Lactobacillus fermentum reduced lesions in chickens with Clostridium perfringens-induced necrotic enteritis. When Clostridium perfringens and AFB1 are concurrent, the literature about the effect of probiotics on necrotic enteritis is very limited. Compared to clay detoxifier, the fewer lesions in the probiotics group may imply that AFB1 is partially biodegraded by the probiotics, and this needs further study. It should be noted that probiotics are tools that can be used to modulate necrotic enteritis, but it is largely a secondary bacterial issue with many causes, and there is certainly not a single preventive measure. CONCLUSIONS AND APPLICATIONS Both probiotics and clay detoxifier showed beneficial regulation in intestinal flora equilibration and enterotoxigenic bacteria, endotoxin secretory, barrier function, and necrotic lesions caused by dietary AFB1. The probiotic are more capable than clay detoxifier to counteract enterotoxicity and keep gut health in broilers fed AFB1 contaminated diets. Footnotes Primary Audience: Researchers, Live Production Managers REFERENCES AND NOTES 1. Oguz H. , Hadimli H. H. , Kurtoglu V. , Erganis O. . 2003 . Evaluation of humoral immunity of broilers during chronic aflatoxin (50 and 100 ppb) and clinoptilolite exposure . Rev. Med. Vet. 154 : 483 – 486 . 2. Alam S. , Shah H. U. , Afzal M. , Magan N. . 2014 . Influence of calcium propionate, water activity and storage time on mold incidence and aflatoxins production in broiler starter feed . Anim. Feed Sci. Technol. 188 : 137 – 144 . Google Scholar CrossRef Search ADS 3. Andretta I. , Kipper M. , Lehnen C. R. , Hauschild L. , Vale M. M. , Lovatto P. A. . 2011 . Meta-analytical study of productive and nutritional interactions of mycotoxins in broilers . Poult. Sci. 90 : 1934 – 1940 . Google Scholar CrossRef Search ADS PubMed 4. Roger T. , Leopold T. N. . 2015 . Effect of selected lactic acid bacteria on growth of Aspergillus flavus and aflatoxin B1 production in kutukutu . J. Microbiol. Res. 5 : 84 – 94 . 5. Abbes S. , Salah-Abbes J. B. , Jebali R. , Younes R. B. , Oueslati R. . 2016 . Interaction of aflatoxin B1 and fumonisin B1 in mice causes immunotoxicity and oxidative stress: Possible protective role using lactic acid bacteria . J. Immunotoxicol. 13 : 46 – 54 . Google Scholar CrossRef Search ADS PubMed 6. Adebo O. A. , Njobeh P. B. , Gbashi S. , Nwinyi O. C. , Mavumengwana V. . 2017 . Review on microbial degradation of aflatoxins . Crit. Rev. Food Sci. Nutr. 57 : 3208 – 3217 . Google Scholar CrossRef Search ADS PubMed 7. Zeng Y. , Zeng D. , Zhang Y. , Ni X. Q. , Wang J. , Jian P. , Zhou Y. , Li Y. , Yin Z. Q. , Pan K. C. , Jing B. . 2017 . Lactobacillus plantarum BS22 promotes gut microbial homeostasis in broiler chickens exposed to aflatoxin B1 . J. Anim. Physiol. Anim. Nutr. In press . 8. Fan Y. , Zhao L. , Ji C. , Li X. , Jia R. , Xi L. , Zhang J. , Ma Q. . 2015 . Protective effects of Bacillus subtilis ANSB060 on serum biochemistry, histopathological changes and antioxidant enzyme activities of broilers fed moldy peanut meal naturally contaminated with aflatoxins . Toxins 7 : 3330 – 3343 . Google Scholar CrossRef Search ADS PubMed 9. Hydrated sodium calcium aluminosilicate, Kemin Industries, Zhuhai, China . 10. Liu N. , Ru Y. , Cowieson A. J. , Li F. , Cheng X. . 2008 . Effects of phytate and phytase on the performance and immune function of broilers fed nutritionally marginal diets . Poult. Sci. 87 : 1105 – 1111 . Google Scholar CrossRef Search ADS PubMed 11. Gholamiandehkordi A. R. , Timbermont L. , Lanckriet A. , Broeck Van Den W. , Pedersen K. , Dewulf J. , Pasmans F. , Haesebrouck F. , Ducatelle R. , Van Immerseel F. . 2007 . Quantification of gut lesions in a subclinical necrotic enteritis model . Avian Pathol . 36 : 375 – 382 . Google Scholar CrossRef Search ADS PubMed 12. RNAlater, primer synthesis, cDNA and real-time PCR reagents, TaKaRa Co., Ltd, Dalian, China . 13. Aflatoxin B1 enzyme-linked immunosorbent assay kit, detection limit 2 μg/kg, Longke Fangzhou Biotech, Beijing, China . 14. Wu S. , Stanley D. , Rodgers N. , Swick R. A. , Moore R. J. . 2014 . Two necrotic enteritis predisposing factors, dietary fishmeal and Eimeria infection, induce large changes in the caecal microbiota of broiler chickens . Vet. Microbiol. 169 : 188 – 197 . Google Scholar CrossRef Search ADS PubMed 15. Microbial media products, Qingdao Hope Bio-Technology Co., Ltd., Shandong, China . 16. Limulus amoebocyte lysate-based kit, LALQCL-1000, Lonza, Walkersville, MD . 17. The diamine oxidase standard (D7876-250), Sigma-Aldrich Co., Ltd, Beijing, China . 18. NanoDrop™ 2000 Spectrophotometer, Thermo Fisher Scientific Inc., Waltham, MA . 19. ABI Prism 7900HT Fast Real-Time PCR System, Applied Biosystems Inc., Waltham, MA . 20. SAS software, SAS Inst. Inc., Cary, NC . 21. Magnoli A. P. , Rodriguez M. C. , Pereyra M. G. , Poloni V. L. , Peralta M. F. , Nilson A. J. , Miazzo R. D. , Bagnis G. , Chiacchiera S. M. , Cavaglieri L. R. . 2017 . Use of yeast (Pichia kudriavzevii) as a novel feed additive to ameliorate the effects of aflatoxin B1 on broiler chicken performance . Mycotoxin Res . 8 : 273 – 283 . Google Scholar CrossRef Search ADS 22. He Y. , Fang J. , Peng X. , Cui H. , Zuo Z. , Deng J. , Chen Z. , Lai W. , Shu G. , Tang L. . 2014 . Effects of sodium selenite on aflatoxin B1-induced decrease of ileac T cell and the mRNA contents of IL-2, IL-6, and TNF-α in broilers . Biol. Trace Elem. Res. 159 : 167 – 173 . Google Scholar CrossRef Search ADS PubMed 23. Jahanian E. , Mahdavi A. H. , Asgary S. , Jahanian R. . 2017 . Effects of dietary inclusion of silymarin on performance, intestinal morphology and ileal bacterial count in aflatoxin-challenged broiler chicks . J. Anim. Physiol. Anim. Nutr. 101 : e43 – e54 . Google Scholar CrossRef Search ADS 24. Mughal M. J. , Peng X. , Kamboh A. A. , Zhou Y. , Fang J. . 2017 . Aflatoxin B1 induced systemic toxicity in poultry and rescue effects of selenium and zinc . Biol. Trace Elem. Res. 7 : 1 – 9 . 25. Kulp A. , Kuehn M. J. . 2010 . Biological functions and biogenesis of secreted bacterial outer membrane vesicles . Annu. Rev. Microbiol. 64 : 163 – 184 . Google Scholar CrossRef Search ADS PubMed 26. Yamasaki R. , Kerwood D. E. , Schneider H. , Quinn K. P. , Griffiss J. M. , Mandrell R. E. . 1994 . The structure of lipooligosaccharide produced by Neisseria gonorrhoeae, strain 15253, isolated from a patient with disseminated infection. Evidence for a new glycosylation pathway of the gonococcal lipooligosaccharide . J. Biol. Chem. 269 : 30345 – 30351 . Google Scholar PubMed 27. Stephens D. S. , Greenwood B. , Brandtzaeg P. . 2007 . Epidemic meningitis, meningococcaemia, and Neisseria meningitidis . Lancet 369 : 2196 – 2210 . Google Scholar CrossRef Search ADS PubMed 28. Meng Y. , Zhang Y. , Liu M. , Huang Y. K. , Zhang J. , Yao Q. , Zhao Y. L. , Xiong J. J. . 2016 . Evaluating intestinal permeability by measuring plasma endotoxin and diamine oxidase in children with acute lymphoblastic leukemia treated with high-dose methotrexate . Anti-Canc. Agents Med. Chem. 16 : 387 – 392 . Google Scholar CrossRef Search ADS 29. Nava G. M. , Bielke L. R. , Callaway T. R. , Castaneda M. P. . 2005 . Probiotic alternatives to reduce gastrointestinal infections: The poultry experience . Anim. Health Res. Rev. 6 : 105 – 118 . Google Scholar CrossRef Search ADS PubMed 30. Xue L. , He J. , Gao N. , Lu X. , Li M. , Wu X. , Liu Z. , Jin Y. , Liu J. , Xu J. , Geng Y. . 2017 . Probiotics may delay the progression of nonalcoholic fatty liver disease by restoring the gut microbiota structure and improving intestinal endotoxemia . Sci. Rep. 7 : 45176 . Google Scholar CrossRef Search ADS PubMed 31. Zhang L. , Zhang L. , Zeng X. , Zhou L. , Cao G. , Yang C. . 2016 . Effects of dietary supplementation of probiotic, Clostridium butyricum, on growth performance, immune response, intestinal barrier function, and digestive enzyme activity in broiler chickens challenged with Escherichia coli K88 . J. Anim. Sci. Biotechnol. 7 : 3 . Google Scholar CrossRef Search ADS PubMed 32. Murugesan G. R. , Gabler N. K. , Persia M. E. . 2014 . Effects of direct-fed microbial supplementation on broiler performance, intestinal nutrient transport and integrity under experimental conditions with increased microbial challenge . Br. Poult. Sci. 55 : 89 – 97 . Google Scholar CrossRef Search ADS PubMed 33. Buckley A. , Turner J. R. . 2017 . Cell biology of tight junction barrier regulation and mucosal disease . CSH Perspect. Biol. 15 : a029314 . 34. Corthesy B. 2013 . Role of secretory IgA in infection and maintenance of homeostasis . Autoimmun. Rev. 12 : 661 – 665 . Google Scholar CrossRef Search ADS PubMed 35. Hood L. , Kronenberg M. , Hunkapiller T. . 1985 . T cell antigen receptors and the immunoglobulin supergene family . Cell 40 : 225 – 229 . Google Scholar CrossRef Search ADS PubMed 36. Wang S. , Peng Q. , Jia H. M. , Zeng X. F. , Zhu J. L. , Hou C. L. , Liu X. T. , Yang F. J. , Qiao S. Y. . 2017 . Prevention of Escherichia coli infection in broiler chickens with Lactobacillus plantarum B1 . Poult. Sci. 96 : 2576 – 2586 . Google Scholar CrossRef Search ADS PubMed 37. Nakamura Y. , Nosaka S. , Suzuki M. , Nagafuchi S. , Takahashi T. , Yajima T. , takenouchi-ohkubo N. , Iwase T. , Moro I. . 2004 . Dietary fructooligosaccharides up-regulate immunoglobulin A response and polymeric immunoglobulin receptor expression in intestines of infant mice . Clin. Exp. Immunol. 137 : 52 – 58 . Google Scholar CrossRef Search ADS PubMed 38. Cravens R. L. , Goss G. R. , Chi F. , De Boer E. D. , Davis S. W. , Hendrix S. M. , Richardson J. A. , Johnston S. L. . 2013 . The effects of necrotic enteritis, aflatoxin B1, and virginiamycin on growth performance, necrotic enteritis lesion scores, and mortality in young broilers . Poult. Sci. 92 : 1997 – 2004 . Google Scholar CrossRef Search ADS PubMed 39. Huff W. E. , Kubena L. F. , Harvey R. B. , Philips T. D. . 1992 . Efficacy of HSCAS to reduce individual and combined toxicity of aflatoxin and ochratoxin A . Poult. Sci. 71 : 64 – 69 . Google Scholar CrossRef Search ADS PubMed 40. Jayaraman S. , Thangavel G. , Kurian H. , Mani R. , Mukkalil R. , Chirakkal H. . 2013 . Bacillus subtilis PB6 improves intestinal health of broiler chickens challenged with Clostridium perfringens-induced necrotic enteritis . Poult. Sci. 92 : 370 – 374 . Google Scholar CrossRef Search ADS PubMed 41. Cao L. , Yang X. J. , Li Z. J. , Sun F. F. , Wu X. H. , Yao J. H. . 2012 . Reduced lesions in chickens with Clostridium perfringens-induced necrotic enteritis by Lactobacillus fermentum 1.2029 1 2 . Poult. Sci. 91 : 3065 – 3071 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc.

Journal

Journal of Applied Poultry ResearchOxford University Press

Published: Feb 15, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off