Comparative genetic characterization of third-generation cephalosporin-resistant Escherichia coli from chicken meat produced by integrated broiler operations in South Korea

Comparative genetic characterization of third-generation cephalosporin-resistant Escherichia coli... Abstract Vertical integration of the broiler industry allows producers to combine different biosecurity and sanitation practices, housing technologies, and feeding regimens to improve food safety. The objectives of this study were to determine the antimicrobial resistance pattern of β-lactamase-producing E. coli and to compare the characteristics of E. coli recovered from 7 different integrated broiler operations in South Korea. Among 200 chicken meat samples, 101 were observed to be positive for E. coli. However, the prevalence varied from 37.5% to 75.0% in chicken meats from different operations, indicating variation in E. coli occurrence among the operations. Among 101 isolated E. coli from chicken meat, 59 were identified third-generation cephalosporin-resistant E. coli and recovered from 7 different operations. A high proportion of the E. coli isolates were resistant to penicillins (89.8%), quinolones (81.4%). Among 59 third-generation cephalosporin-resistant E. coli isolates, 29 showed phenotypic and genotypic characteristics of β-lactamase-producing E. coli. Prevalence of bla gene, blaCTX-M-1, blaCTX-M-14, blaCMY-2, and blaTEM-1, were identified in 2, 4, 8, and 16 E. coli isolates respectively and only one E. coli had both genes, blaTEM-1 and blaCTX-M-1. Pulsed-field gel electrophoresis (PFGE) analysis was performed on 29 β-lactamase-producing E. coli isolates. In PFGE, E. coli included 7 PFGE patterns showing the same operation and an accorded both resistance to β-lactam antibiotics and presence of the bla-gene. Our findings suggest that E. coli with resistance to third-generation cephalosporins can now be found in association with integrated broiler operations, providing the data to support the development of monitoring and preventing program in integrated operations. INTRODUCTION Escherichia coli (E. coli) are ubiquitous bacteria found in the environment, foods, and the intestines of humans and animals. Even though commensal E. coli are usually non-pathogenic, it is one of the most opportunistic pathogens and is responsible for a wide range of infections (Mellata, 2013). In particular, concern has been raised that commensal E. coli in animals may serve as a reservoir of resistance determinants that could be transferred to pathogenic bacteria in either humans or animals (Szmolka and Nagy, 2013). A large number of antimicrobials are used in modern food animal production including broiler production, resulting in the emergence of antimicrobial resistance, which is a cause of concern worldwide (Silbergeld et al., 2008; Aarestrup et al., 2008). In recent years, clinical isolates including E. coli isolates of animal origin, have shown multi-drug resistance (Dolejská et al., 2008; Rzewuska et al., 2015). Antibiotic resistance rates in E. coli are rapidly rising, especially with regard to fluoroquinolones, and third and fourth-generation cephalosporins (Kim et al., 2017). Beta-lactam antibiotics are widely used for treatment of bacterial infections in humans and also in veterinary medicine (Moulin et al., 2008). Extended-spectrum β-lactamase (ESBL) and plasmid-mediated AmpC β-lactamases are plasmid-encoded enzymes, which are capable of inactivating a large number of β-lactam antibiotics, including extended-spectrum and very-broad-spectrum cephalosporins. E. coli that produce ESBL and/or pAmpC β-lactamases have been of particular concern because of their implications for both human and food animal health (Livermore, 2012). These strains encode β-lactamases that mediate resistance to β-lactam antimicrobials including penicillins and extended-spectrum cephalosporins such as third and fourth-generation cephalosporins (Carattoli, 2009). The broiler chicken industry operates largely through vertical integration, with company ownership of breeding farms, multiplication farms, hatcheries, feed mills, some broiler growing farms and processing plants. In South Korea, several large integrated companies supply about 80% of marketed broiler chickens (KAPE, 2015). The livestock on the integrated farms, which includes chicken, is reared intensively, and antimicrobial agents are used as growth promoters and for prophylactic and therapeutic treatment. The Korea Animal Health Products Association reported that around 1500 tons of antimicrobials were sold each year during 2003–2007, but less than 1000 tons were sold for the four consecutive years from 2011 to 2015. However, the sales of cephalosporins have increased by five-fold from 2007 to 2015 (QIA, 2015). The objectives of this study were to determine the antimicrobial resistance pattern of β-lactamase-producing E. coli and to compare the characteristics of E. coli recovered from 7 different integrated broiler operations in South Korea. MATERIALS AND METHODS Bacterial Isolation A total of 200 chicken meats were collected at 4 retail markets visiting 3 or more times during the year 2016. These meats were produced by 50 broiler farms and divided into 7 different integrated broiler operations which supplied about 80% of the broiler chickens in South Korea. Four meats from each farm origin were sampled and tested for this study. Each meat was aseptically placed into a vacuum bag (Sealed Air, Elmwood Park, NJ, USA), and 400 mL of sterile buffered peptone water (BD Biosciences, Sparks, MD, USA) was added. The bag was shaken 50 times, and approximately 25 mL of meat rinse was added to 225 mL of mEC (Merck, Darmstadt, Germany) and incubated at 37°C for 20–24 hours. After enrichment, mEC (Merck) was streaked onto MacConkey agar (BD) plates and incubated at 37°C for 24 hours. Two typical colonies from a single meat sample were selected. If two isolates from the same origin showed the same antimicrobial susceptibility patterns, only one isolate was randomly chosen and included in this study. Antimicrobial Susceptibility Test All E. coli isolates were investigated for their antimicrobial resistance with the disc diffusion test using the following discs (BD): amoxicillin-clavulanate (20/10 μg), ampicillin (10 μg), cefadroxil (CFR, 30 μg), cefalexin (CL, 30 μg), cefazolin (CZ, 30 μg), cefepime (FEP, 30 μg), cefotaxime (CTX, 30 μg), cefovecin (CVN, 30 μg), cefoxitin (FOX, 30 μg), ceftazidime (CAZ, 30 μg), ceftiofur (EFT, 30 μg), cefuroxime (CXM, 30 μg), cephalothin (CF, 30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), gentamicin (10 μg), imipenem (10 μg), nalidixic acid (30 μg), tetracycline (30 μg), and trimethoprim-sulfamethoxazole (1.25/23.75 μg). Results were interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2013). The minimum inhibitory concentrations (MICs) to CZ, CTX, CVN, FOX, CAZ, CF, and EFT were determined by standard agar dilution methods with Mueller-Hinton agar (BD) according to the recommendations of the CLSI (2013). E. coli ATCC 25,922 and Pseudomonas aeruginosa ATCC 27,853 were used as quality control organisms in the antimicrobial susceptibility tests. A double disc diffusion method was performed with CTX (30 μg)/CTX-clavulanate (30 μg/10 μg; BD) and CAZ (30 μg)/CAZ-clavulanate (30 μg/10 μg; BD) to detect ESBL production according to CLSI guidelines (CLSI, 2013). Detection of β-Lactamase-Encoding Genes PCR amplification was conducted with primers for blaCTX-M (Pitout et al., 2004), blaTEM (Briñas et al., 2002), blaSHV (Briñas et al., 2002), blaOXA (Briñas et al., 2002), and pAmpC β-lactamase genes (Pérez-Pérez and Hanson, 2002) (Table 1). PCR products were sequenced with an automatic sequencer (Cosmogenetech, Seoul, Korea). The sequences were confirmed to those in the GenBank nucleotide database using the Basic Local Alignment Search Tool (BLAST) program available through the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST). Table 1. Primers used for PCR and DNA sequencing. Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG View Large Table 1. Primers used for PCR and DNA sequencing. Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG View Large Conjugation Assay To determine the transferability of β-lactamase resistance genes, conjugation assays were performed by using the broth mating method, and E. coli J53 was used as the recipient as previously described in Tamang et al. (2012). Transconjugants were selected on MacConkey agar (BD) plates containing sodium azide (100 μg/mL; Sigma, ST Louis, MO, USA) and cefotaxime (2 μg/mL). All transconjugants were tested for antimicrobial susceptibility and the presence of β-lactamase genes, as described above. Pulsed-field Gel Electrophoresis (PFGE) PFGE analysis was performed on 29 β-lactamase-producing E. coli isolates by digesting genomic DNA using the XbaI (Takara Bio Inc., Shiga, Japan) enzyme according to a standard protocol from the Center for Disease Control and Prevention (CDC), using a CHEF-MAPPER apparatus (Bio-Rad Laboratories, Hercules, CA), as previously described (Liu et al., 2007). Analysis of gel images was performed using InfoQuest FP software ver. 4.5 (Bio-Rad). The dice coefficient was used for similarity calculation, and the similarity matrix was expressed graphically by an unweighted average linkage (UPGMA). RESULTS Prevalence of E. coli The prevalence of E. coli in the chicken meat collected from retail markets is shown in Table 2. Among the 200 chicken meat samples, 101 (50.5%) were observed to be positive for E. coli. Among the meats originating from 7 integrated broiler chicken operations, meats from operations F and G had the highest prevalence of E. coli (75%, 9 of 12 samples), and operation D showed the lowest prevalence (37.5%, 12 of 32 samples). Table 2. Prevalence of E. coli isolates in chicken meat originated from 7 integrated broiler operations. Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 1If two isolates from same origin showed the same antimicrobial susceptibility patterns, only one isolate was included. View Large Table 2. Prevalence of E. coli isolates in chicken meat originated from 7 integrated broiler operations. Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 1If two isolates from same origin showed the same antimicrobial susceptibility patterns, only one isolate was included. View Large Distribution of Antimicrobial Resistance The distribution of cephalosporins-resistant and multi-drug resistant E. coli is shown in Figure 1. CFR, CL, CZ, and CF were first-generation cepha-losporins, FOX and CXM were second-generation cephalosporins, CTX, CVN, CAZ, and EFT were third-generation cephalosporins and FEP was fourth-generation cephalosporins. E. coli from the 7 integrated broiler chicken operations showed resistance to first-, second-, and third-generation cephalosporins, with ranges of 62.5% to 100%, 0% to 31.2%, and 18.7% to 68.7%, respectively. Moreover, resistance to fourth-generation cephalosporins was observed only in E. coli originating from the operation B (4.8%). Multi-drug resistance was observed in all E. coli, without any differences based on the operation showed, with the high proportion of 75.5% to 100%. Figure 1. View largeDownload slide Distribution of antimicrobial resistance of E. coli originated from 7 integrated broiler operations. Multi-drug resistance was defined as resistance to three or more antimicrobial classes. Figure 1. View largeDownload slide Distribution of antimicrobial resistance of E. coli originated from 7 integrated broiler operations. Multi-drug resistance was defined as resistance to three or more antimicrobial classes. Characteristics of Third -Generation Cephalosporins-Resistant E. coli The characteristics of 59 third-generation cephalosporin-resistant E. coli is shown in Table 3. Among the 7 integrated broiler operations, third-generation cephalosporin-resistant E. coli isolates from operation G had the highest prevalence (68.8%, 11 of 16 samples), and operation F showed the lowest prevalence (18.8%, 3 of 16 samples). All isolates showed first-generation cephalosporin-resistance and multi-drug resistance against 3–9 classes of antimicrobial agents tested in this study. Resistance against non-cephalosporins antimicrobial classes were as follows: penicillins (89.8%), quinolones (81.4%), folate pathway inhibitors (74.6%), β-lactam/β-lactamase inhibitor combinations (69.5%), fluoroquinolones (66.1%), tetracyclines (61.0%), phenicols (57.6%), carbapenems (45.8%), and aminoglycoside (27.1%). Table 3. Antimicrobial resistant patterns of 59 third -generation cephalosporin-resistant E. coli. Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs 1AMGs, aminoglycosides; BL/BLICs, β-lactam/β-lactamase inhibitor combinations; CARs, carbapenems; FPIs, folate pathway inhibitors; FQs, fluoroquinolones; PCNs, penicillins; PHs, phenicols; Qs, quionolones; TETs, tetracyclines. View Large Table 3. Antimicrobial resistant patterns of 59 third -generation cephalosporin-resistant E. coli. Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs 1AMGs, aminoglycosides; BL/BLICs, β-lactam/β-lactamase inhibitor combinations; CARs, carbapenems; FPIs, folate pathway inhibitors; FQs, fluoroquinolones; PCNs, penicillins; PHs, phenicols; Qs, quionolones; TETs, tetracyclines. View Large Characteristics of β-Lactamase-Producing E. coli The phenotypic and genotypic characteristics of the 29 β-lactamase-producing E. coli among the 59 third- generation cephalosporin-resistant E. coli are shown in Table 4. A total of 14 E. coli were designated as ESBL and pAmpC producers. Two ESBL genes, blaCTX-M-1 and blaCTX-M-14, were identified in 2 and 4 E. coli isolates, respectively. One pAmpC β-lactamase gene, blaCMY-2, was present in 8 E. coli. Additionally, a non-ESBL/pAmpC gene, blaTEM-1, was found in 16 E. coli. Only one isolate among the 29 E. coli had both genes, blaTEM-1 and blaCTX-M-1. In transferability, only 10 transconjugants (34.5%) showed a transferability with blaCTX-M-1, blaCTX-M-14 and blaCMY-2 genes and similar resistance to cephalosporins. Table 4. Characteristics of the 29 β-lactamase producing E. coli isolated from chicken meat of 7 integrated broiler operations. MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 1CZ, cefazolin; CF, cephalothin; FOX, Cefoxitin; CTX, cefotaxime; CVN, cefovecin; CAZ, ceftazidime; EFT, ceftiofur, NA, nalidixic acid; CIP, ciprofloxacin, C, chloramphenicol; G, gentamicin; IPM, imipenem; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline. 2Donor. 3Transconjugant. View Large Table 4. Characteristics of the 29 β-lactamase producing E. coli isolated from chicken meat of 7 integrated broiler operations. MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 1CZ, cefazolin; CF, cephalothin; FOX, Cefoxitin; CTX, cefotaxime; CVN, cefovecin; CAZ, ceftazidime; EFT, ceftiofur, NA, nalidixic acid; CIP, ciprofloxacin, C, chloramphenicol; G, gentamicin; IPM, imipenem; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline. 2Donor. 3Transconjugant. View Large PFGE Analysis The epidemiological genetic relationships of the 29 β-lactamase-producing E. coli are shown in Figure 2. Among the 21 PFGE patterns (PT001 to PT021) divided by 85% similarity, E. coli included 7 PFGE patterns (PT003, PT005, PT008, PT014, PT016, PT017, and PT018) showing the same operation and accorded both resistance to β-lactam antibiotics and presence of the bla-gene. Figure 2. View largeDownload slide Pulsed-field gel electrophoresis (PFGE) patterns of XbaI-digested total DNA of 29 β-lactamase producing E. coli. AM, ampicillin; AmC, amoxicillin-clavulanic acid; CZ, cefazolin; CL, cephalexin; CFR, cefadroxil; CF, cephalothin; FOX, Cefoxitin; CXM, cefuroxime; CAZ, ceftazidime; CTX, cefotaxime; CVN, cefovecin; EFT, ceftiofur, FEP, cefepime; NA, nalidixic acid; CIP, ciprofloxacin, G, gentamicin; C, chloramphenicol; TE, tetracycline SXT, sulfamethoxazole/trimethoprim; IPM, imipenem. Figure 2. View largeDownload slide Pulsed-field gel electrophoresis (PFGE) patterns of XbaI-digested total DNA of 29 β-lactamase producing E. coli. AM, ampicillin; AmC, amoxicillin-clavulanic acid; CZ, cefazolin; CL, cephalexin; CFR, cefadroxil; CF, cephalothin; FOX, Cefoxitin; CXM, cefuroxime; CAZ, ceftazidime; CTX, cefotaxime; CVN, cefovecin; EFT, ceftiofur, FEP, cefepime; NA, nalidixic acid; CIP, ciprofloxacin, G, gentamicin; C, chloramphenicol; TE, tetracycline SXT, sulfamethoxazole/trimethoprim; IPM, imipenem. DISCUSSION The poultry industry is a vertically integrated production, processing and distribution system, and vertical integration of the broiler industry allows producers to combine different biosecurity and sanitation practices, housing technologies and feeding regimens to improve food safety. Research on antimicrobial use and resistance in integrated operation in South Korea remains a relatively new field. However, further research is urgently needed given the projected large-scale increase in poultry production and antimicrobial use in the poultry sector (Van Boeckel et al., 2015). The present study indicates that the prevalence of E. coli in chicken meats from 7 different integrated practices during 2016 was 50.5%. However, E. coli prevalence in chicken meat varied from 37.5 to 75.0%, revealing that variation in E. coli levels occurs among the different operations. Although there was a difference in the sample size number, the prevalence of E. coli might be associated with differences in the hygiene and sanitation levels of each operation. In previous studies, the frequency of E. coli in chicken meats was found to be 77.8% in South Korea, 31.3% in Brazil, and 38.7% in USA (Zhao et al., 2001a; Botelho et al., 2015; Jo and woo, 2016). The number of E. coli isolates obtained in this study was higher than in the other countries, and this difference may also have resulted from the production techniques used, as well as in personal hygiene, slaughterhouse hygiene, and other practices through to the food chain. Cephalosporins are antibiotics classified by the World Health Organization as “critically important in human medicine” owing to their importance for treating infections caused by Campylobacter, Salmonella and E. coli (WHO, 2015). In this study, 157 E. coli isolates were obtained from 7 different operation systems and evaluated for their resistance to cephalosporins. The first-generation cephalosporins showed a resistance range from 62.5% to 100%, whereas the second- and third-generation cephalosporins were from 0% to 31.2% and 18.7% to 68.7%, respectively. In general, cephalosporins resistance occurs when bacteria change in response to the use of these medicines (Juayang et al., 2015). This study indicates that mass medication with cephalosporins has been continuously used in operations in South Korea, and therefore, similar to the other countries, regulation on the use of cephalosporins in livestock is required in South Korea (Dutil et al., 2010; Schmidt, 2012). According to the annual report by the European Antimicrobial Resistance Surveillance System, the prevalence concerning third-generation cephalosporins resistance has recently increased (ECDC, 2014). Since the introduction of third-generation cephalosporin, a large number of ESBL and pAmpC β-lactamase producers have emerged in gram-negative bacteria, particularly in Enterobacteriaceae such as E. coli. In Japan, the distribution of CTX-M type ESBL in E. coli isolated from broilers was reported (Ishiguro et al., 2010; Hiroi et al., 2011; Hiroi et al., 2012), and pAmpC β-lactamase, especially CMY-2-type, has also been detected (Ahmed et al., 2009; Kojima et al., 2009; Asai et al., 2011). In Europe, CTX-M type ESBL as well as plasmid-mediated CMY-2 pAmpC β-lactamases have been detected in cephalosporin-resistant E. coli from broiler chickens and their products (Smet et al., 2008; Bergenholtz et al., 2009). In this study, two different CTX-M types, blaCTX-M-1 and blaCTX-M-14, and one pAmpC β-lactamase gene, blaCMY-2, were detected. CTX-M-1, in particular, was observed in 2 E. coli cultures and had never previously been identified in chicken meats from South Korea, although it has been documented in other livestock (Lee et al., 2009; Kang et al., 2013b; Tamang et al., 2013). However, CTX-M-1 is the major CTX-M type among Enterobacteriaceae isolates from chicken meat in the European countries such as France (Casella et al., 2017), Germany (Kola et al., 2012), and the Netherlands (Overdevest et al., 2011); therefore, it is expected to be continuously reported in South Korea in the future. CTX-M-14 found in this study has previously been observed in E. coli isolated from livestock, including in the South Korean chicken industry (Tamang et al., 2014; Jo and woo, 2016; Shin et al., 2017), and from healthy food animals in Hong Kong (Ho et al., 2011) and China (Zheng et al., 2012), as well as from pets in China (Sun et al., 2010). The other enzyme conferring β-lactam resistance detected in 26% of isolates tested in this study was a TEM-1 gene. The TEM-1 gene was previously identified in clinical E. coli isolates from companion animals in Europe (Féria et al., 2002; Costa et al., 2006; Pomba et al., 2009). In this study, ESBL and pAmpC β-lactamase genes were detected in E. coli from 4 operations, and these isolates also showed higher levels of resistance to cephalosporins and multi-drug resistance than that in other E. coli cultures. This is consistent with previous studies that ESBL and pAmpC β-lactamase genes increase resistance to cephalosporin and cause multi-drug resistance (Zhao et al., 2001b; Liu et al., 2013; Mehdipour et al., 2015). In this study, transconjugants expressed similar resistance patterns to first-, second-, and third-generation cephalosporins and revealed the presence of blaCTX-M-1, blaCTX-M-14, and blaCMY-2. This is also consistent with a previous study that transconjugants have the same genes and similar antibiotic resistance patterns of the donor strains (Shaheen et al., 2011). It indicates that the high rate occurrence of E. coli harboring blaCTX-M-1, blaCTX-M-14, and blaCMY-2 in poultry and their food products can contribute to the transmission of these genes to humans. PFGE is a useful method for characterization of epidemiologically unrelated bacterial strains (Arbeit et al., 1990). In this study, E. coli included 7 PFGE patterns showing the same operation and an accorded both resistance to β-lactam antibiotics and presence of the bla-gene. It indicates that the dissemination of the blaCTX-M, blaTEM-1, and blaCMY-2 genes in E. coli isolates from integrated broiler operations may mainly result from horizontal transmission as suggest in previous studies (Tamang et al., 2014; Jo and woo, 2016). In South Korea, ESBL-producing E. coli has been increasingly recognized as a cause of community-onset infections, and the proportion of ESBL producers continues to increase in patients at both secondary- and tertiary-care hospitals (Park et al., 2011; Kang et al., 2013a). For example, Lee at al. (Lee et al., 2014) reported the rate of third-generation cephalosporin-resistance among E. coli and K. pneumoniae causing community-onset bacteremia at a secondary-care hospital. These studies support the hypothesis that bacterial pathogens, including resistant isolates, can be transmitted from chicken meat to humans (Thorsteinsdottir et al., 2010; Vincent et al., 2010; Overdevest et al. 2011). To our best knowledge, this study is the first to investigate the characteristics of third-generation cephalosporin-resistant E. coli isolates from different integrated chicken operations in South Korea. Our findings suggest that E. coli with resistance to third-generation cephalosporins can now be found in association with integrated broiler operations, providing the data to support the development of monitoring and preventing program in integrated operations. Acknowledgements This work was supported by Korea Institute of Planning and Evaluation for Technology iRn Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002-7). REFERENCES Aarestrup F. M. , Wegener H. C. , Collignon P. . 2008 . Resistance in bacteria of the food chain: epidemiology and control strategies . Expert Rev. Anti Infect. Ther . 6 : 305 – 310 . Google Scholar CrossRef Search ADS Ahmed A. M. , Shimabukuro H. , Shimamoto T. . 2009 . Isolation and molecular characterization of multidrug-resistant strains of Escherichia coli and Salmonella from retail chicken meat in Japan . J. Food Sci . 74 : M405 – M410 . Google Scholar CrossRef Search ADS PubMed Animal and Plant Quarantine Agency (QIA) . 2015 . National antimicrobial resistance monitoring program . Anyang , Republic of Korea . Arbeit R. D. , Arthur M. , Dunn R. , Kim C. , Selander R. K. , Goldstein R. . 1990 . Resolution of recent evolutionary divergence among Escherichia coli from related lineages: the application of pulsed field electrophoresis to molecular epidemiology . J. Infect. Dis. 161 : 230 – 235 . Google Scholar CrossRef Search ADS PubMed Asai T. , Masani K. , Sato C. , Hiki M. , Usui M. , Baba K. , Ozawa M. , Harada K. , Aoki H. , Sawada T. . 2011 . Phylogenetic groups and cephalosporin resistance genes of Escherichia coli from diseased food-producing animals in Japan . Acta Vet Scand . 53 : 52 . Google Scholar CrossRef Search ADS PubMed Bergenholtz R. D. , Jørgensen M. S. , Hansen L. H. , Jensen L. B. , Hasman H. . 2009 . Characterization of genetic determinants of extended-spectrum cephalosporinases (ESCs) in Escherichia coli isolates from Danish and imported poultry meat . J. Antimicrob. Chemother. 64 : 207 – 209 . Google Scholar CrossRef Search ADS PubMed Botelho L. A. , Kraychete G. B. , Costa e Silva J. L. , Regis D. V. , Picão R. C. , Moreira B. M. , Bonelli R. R. . 2015 . Widespread distribution of CTX-M and plasmid-mediated AmpC β-lactamases in Escherichia coli from Brazilian chicken meat . Mem. Inst. Oswaldo Cruz . 110 : 249 – 254 . Google Scholar CrossRef Search ADS PubMed Briñas L. , Zarazaga M. , Sáenz Y. , Ruiz-Larrea F. , Torres C. . 2002 . -Lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob. Agents Chemother. 46 : 3156 – 3163 . CrossRef Search ADS PubMed Carattoli A. 2009 . Resistance plasmid families in Enterobacteriaceae . Antimicrob. Agents Chemother. 53 : 2227 – 2238 . Google Scholar CrossRef Search ADS PubMed Casella T. , Nogueira M. C. L. , Saras E. , Haenni M. , Madec J. Y. . 2017 . High prevalence of ESBLs in retail chicken meat despite reduced use of antimicrobials in chicken production, France . Int. J. Food Microbiol. 257 : 271 – 275 . Google Scholar CrossRef Search ADS PubMed Clinical and Laboratory Standards Institute (CLSI) . 2013 . Performance standards for antimicrobial susceptibility testing, M100-S23 . Clinical and Laboratory Standards Institute , Wayne, PA . Costa D. , Poeta P. , Sáenz Y. , Vinué L. , Rojo-Bezares B. , Jouini A. , Zarazaga M. , Rodrigues J. , Torres C. . 2006 . Detection of Escherichia coli harbouring extended-spectrum beta-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal . J. Antimicrob. Chemother. 58 : 1311 – 1312 . Google Scholar CrossRef Search ADS PubMed Dolejská M. , Senk D. , Cízek A. , Rybaríková J. , Sychra O. , Literák I. . 2008 . Antimicrobial resistant Escherichia coli isolates in cattle and house sparrows on two Czech dairy farms . Res. Vet. Sci. 85 : 491 – 494 . Google Scholar CrossRef Search ADS PubMed Dutil L. , Irwin R. , Finley R. , Ng L. K. , Avery B. , Boerlin P. , Bourgault A. M. , Cole L. , Daignault D. , Desruisseau A. , Demczuk W. , Hoang L. , Horsman G. B. , Ismail J. , Jamieson F. , Maki A. , Pacagnella A. , Pillai D. R. . 2010 . Ceftiofur resistance in Salmonella enterica serovar Heidelberg from chicken meat and humans, Canada . Emerg. Infect. Dis. 16 : 48 – 54 . Google Scholar CrossRef Search ADS PubMed European Centre for Disease Prevention and Control . Surveillance Report: Antimicrobial resistance surveillance in Europe 2014 . Online available: https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/antimicrobial-resistance-europe-2014.pdf . Féria C. , Ferreira E. , Correia J. D. , Gonçalves J. , Caniça M. . 2002 . Patterns and mechanisms of resistance to beta-lactams and beta-lactamase inhibitors in uropathogenic Escherichia coli isolated from dogs in Portugal . J. Antimicrob. Chemother. 49 : 77 – 85 . Google Scholar CrossRef Search ADS PubMed Hiroi M. , Harada T. , Kawamori F. , Takahashi N. , Kanda T. , Sugiyama K. , Masuda T. , Yoshikawa Y. , Ohashi N. . 2011 . A survey of β-lactamase-producing Escherichia coli in farm animals and raw retail meat in Shizuoka Prefecture, Japan . Jpn. J. Infect Dis. 64 : 153 – 155 . Google Scholar PubMed Hiroi M. , Yamazaki F. , Harada T. , Takahashi N. , Iida N. , Noda Y. , Yagi M. , Nishio T. , Kanda T. , Kawamori F. , Sugiyama K. , Masuda T. , Hara-Kudo Y. , Ohashi N. . 2012 . Prevalence of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in food-producing animals . J. Vet. Med. Sci. 74 : 189 – 195 . Google Scholar CrossRef Search ADS PubMed Ho P. L. , Chow K. H. , Lai E. L. , Lo W. U. , Yeung M. K. , Chan J. , Chan P. Y. , Yuen K. Y. . 2011 . Extensive dissemination of CTX-M-producing Escherichia coli with multidrug resistance to 'critically important' antibiotics among food animals in Hong Kong, 2008-10 . J. Antimicrob. Chemother. 66 : 765 – 768 . Google Scholar CrossRef Search ADS PubMed Ishiguro F. , Nagata A. , Suzuki S. , Yamazaki F. , Mochizuki M. , Arakawa Y. . 2010 . Molecular epidemiological analyses of extended-spectrum β-lactamase-producing Escherichia coli isolated from sporadic diarrheal human cases and chicken meats in Fukui prefecture . J. Jpn. Vet. Med. Assoc. 63 : 883 – 887 . Google Scholar CrossRef Search ADS Jo S. J. , Woo G. J. . 2016 . Molecular characterization of plasmids encoding CTX-M β-lactamases and their associated addiction systems circulating among Escherichia coli from retail chickens, chicken farms, and slaughterhouses in Korea . J. Microbiol. Biotechnol. 26 : 270 – 276 . Google Scholar CrossRef Search ADS PubMed Juayang A. C. , Maestral D. G. , de Los Reyes G. B. , Acosido M. A. , Gallega C. T . 2015 . Review on the antimicrobial resistance of pathogens from tracheal and endotracheal aspirates of patients with clinical manifestations of pneumonia in Bacolod City in 2013 . International Journal of Bacteriology 2015 : 1 – 5 . Google Scholar CrossRef Search ADS Kang C. I. , Cha M. K. , Kim S. H. , Ko K. S. , Wi Y. M. , Chung D. R. , Peck K. R. , Lee N. Y. , Song J. H. . 2013a . Clinical and molecular epidemiology of community-onset bacteremia caused by extended-spectrum β-lactamase-producing Escherichia coli over a 6-year period . J Korean Med Sci . 28 : 998 – 1004 . Google Scholar CrossRef Search ADS Kang M. S. , Kwon Y. K. , Oh J. Y. , Kim M. J. , Call D. R. , An B. K. , Shin E. G. , Song E. A. , Kwon J. H. . 2013b . Evidence for recent acquisition and successful transmission of blaCTX-M-15 in Salmonella enterica in South Korea . Antimicrob. Agents Chemother. 57 : 2383 – 2387 . Google Scholar CrossRef Search ADS Kim D. , Ahn J. Y. , Lee C. H. , Jang S. J. , Lee H. , Yong D. , Jeong S. H. , Lee K. W. . 2017 . Increasing resistance to extended-spectrum cephalosporins, fluoroquinolone, and carbapenem in gram-negative Bacilli and the emergence of carbapenem non-susceptibility in Klebsiella pneumoniae: Analysis of Korean antimicrobial resistance monitoring system (KARMS) data from 2013 to 2015 . Ann Lab Med . 37 : 231 – 239 . Google Scholar CrossRef Search ADS PubMed Kojima A. , Asai T. , Ishihara K. , Morioka A. , Akimoto K. , Sugimoto Y. , Sato T. , Tamura Y. , Takahashi T. . 2009 . National monitoring for antimicrobial resistance among indicator bacteria isolated from food-producing animals in Japan . J. Vet. Med. Sci. 71 : 1301 – 1308 . Google Scholar CrossRef Search ADS PubMed Kola A. , Kohler C. , Pfeifer Y. , Schwab F. , Ku¨hn K. , Schulz K. , Balau V. , Breitbach K. , Bast A. , Witte W. , Gastmeier P. , Steinmetz I. . 2012 . High prevalence of extended-spectrum-β-lactamase-producing enterobacteriaceae in organic and conventional retail chicken meat, Germany . J. Antimicrob. Chemother. 67 : 2631 – 2634 . Google Scholar CrossRef Search ADS PubMed Korea Institute for Animal Products Quality Evaluation (KAPE) . 2015 . Research on the actual conditions of livestock distribution system 2015 . Bundang , Republic of Korea . Lee S. G. , Jeong S. H. , Lee H. , Kim C. K. , Lee Y. , Koh E. , Chong Y. , Lee K. . 2009 . Spread of CTX-M-type extended-spectrum β-lactamases among bloodstream isolates of Escherichia coli and Klebsiella pneumoniae from a Korean hospital . Diagn. Microbiol. Infect. Dis. 63 : 76 – 80 . Google Scholar CrossRef Search ADS PubMed Lee S. , Han S. W. , Kim K. W. , Song D. Y. , Kwon K. T. . 2014 . Third-generation cephalosporin resistance of community-onset Escherichia coli and Klebsiella pneumoniae bacteremia in a secondary hospital . Korean J Intern Med . 29 : 49 – 56 . Google Scholar CrossRef Search ADS PubMed Liu J. H. , Wei S. Y. , Ma J. Y. , Zeng Z. L. , Lü D. H. , Yang G. X. , Chen Z. L. . 2007 . Detection and characterisation of CTX-M and CMY-2 beta-lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China . Int. J. Antimicrob. Agents . 29 : 576 – 581 . Google Scholar CrossRef Search ADS PubMed Liu L. T. , Wan L. H. , Song X. H. , Xiong Y. , Jin S. J. , Zhou L. M. . 2013 . Relevance of class 1 integrons and extended-spectrum β-lactamases in drug-resistant Escherichia coli . Mol. Med. Rep. 8 : 1251 – 1255 . Google Scholar CrossRef Search ADS PubMed Livermore D. M. 2012 . Current epidemiology and growing resistance of gram-negative pathogens . Korean J Intern Med . 27 : 128 – 142 . Google Scholar CrossRef Search ADS PubMed Mehdipour M. M. J. , Mirbagheri A. A. , Salehi Z. , Habibzade S. M. . 2015 . Prevalence of class 1 integrons and extended spectrum beta lactamases among multi-drug resistant Escherichia coli isolates from North of Iran . Iran. Biomed. J . 19 : 233 – 239 . Google Scholar PubMed Mellata M. 2013 . Human and avian extraintestinal pathogenic Escherichia coli: Infections, zoonotic risks, and antibiotic resistance trends . Foodborne Pathogens and Disease . 10 : 916 – 932 . Google Scholar CrossRef Search ADS PubMed Moulin G. , Cavalié P. , Pellanne I. , Chevance A. , Laval A. , Millemann Y. , colin P. , Chauvin C. . 2008 . A comparison of antimicrobial usage in human and veterinary medicine in France from 1999 to 2005 . J. Antimicrob. Chemother. 62 : 617 – 625 . Google Scholar CrossRef Search ADS PubMed Overdevest I. , Willemsen I. , Rijnsburger M. , Eustace A. , Xu L. , Hawkey P. , Heck M. , Savelkoul P. , Vandenbroucke-Grauls C. , Zwaluw K. , Huijsdens X. , Kluytmans J. . 2011 . Extended-spectrum B-lactamase genes of Escherichia coli in chicken meat and humans, the Netherlands . Emerg. Infect. Dis. 17 : 1216 – 1222 . Google Scholar CrossRef Search ADS PubMed Park S. H. , Choi S. M. , Lee D. G. , Kim J. , Choi J. H. , Kim S. H. , Kwon J. C. , Yoo J. H. . 2011 . Emergence of extended-spectrum β-lactamase-producing Escherichia coli as a cause of community-onset bacteremia in South Korea: risk factors and clinical outcomes . Microb. Drug Resist. 17 : 537 – 544 . Google Scholar CrossRef Search ADS PubMed Pérez-Pérez F. J. , Hanson N. D. . 2002 . Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR . J. Clin. Microbiol. 40 : 2153 – 2162 . Google Scholar CrossRef Search ADS PubMed Pitout J. D. , Hossain A. , Hanson N. D. . 2004 . Phenotypic and molecular detection of CTX-M-β-lactamases produced by Escherichia coli and Klebsiella spp. J. Clin. Microbiol. 42 : 5715 – 5721 . Google Scholar CrossRef Search ADS PubMed Pomba C. , da Fonseca J. D. , Baptista B. C. , Correia J. D. , Martínez-Martínez L. . 2009 . Detection of the pandemic O25-ST131 human virulent Escherichia coli CTX-M-15-producing clone harboring the qnrB2 and aac(6')-Ib-cr genes in a Dog . Antimicrob. Agents Chemother. 53 : 327 – 328 . Google Scholar CrossRef Search ADS PubMed Rzewuska M. , Czopowicz M. , Kizerwetter-Świda M. , Chrobak D. , Błaszczak B. , Binek M. . 2015 . Multidrug resistance in Escherichia coli strains isolated from infections in dogs and cats in Poland (2007–2013) . The Scientific World Journal . 2015 : 1 – 8 . Google Scholar CrossRef Search ADS Schmidt C. W. 2012 . FDA proposes to ban cephalosporins from livestock feed . Environ Health Perspect . 120 : a106 . Google Scholar CrossRef Search ADS PubMed Shaheen B. W. , Nayak R. , Foley S. L. , Kweon O. , Deck J. , Park M. , Rafii F. , Boothe D. M. . 2011 . Molecular characterization of resistance to extended-spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States . Antimicrob. Agents Chemother. 55 : 5666 – 5675 . Google Scholar CrossRef Search ADS PubMed Shin S. W. , Jung M. , Won H. G. , Belaynehe K. M. , Yoon I. J. , Yoo H. S. . 2017 . Characteristics of transmissible CTX-M- and CMY-type β-lactamase-producing Escherichia coli isolates collected from pig and chicken farms in South Korea . J. Microbiol. Biotechnol. 27 : 1716 – 1723 . Google Scholar PubMed Silbergeld E. K. , Davis M. , Leibler J. H. , Peterson A. E. . 2008 . One reservoir: redefining the community origins of antimicrobial-resistant infections . Med. Clin. North Am. 92 : 1391 – 1407 . Google Scholar CrossRef Search ADS PubMed Smet A. , Martle A. , Persoons D. , Dewulf J. , Heyndrickx M. , Catry B. , Herman L. , Haesebrouck F. , Butaye P. . 2008 . Diversity of extended-spectrum -lactamases and class C β-lactamases among cloacal Escherichia coli isolates in Belgian broiler farms . Antimicrob. Agents Chemother. 52 : 1238 – 1243 . Google Scholar CrossRef Search ADS PubMed Sun Y. , Zeng Z. , Chen S. , Ma J. , He L. , Liu Y. , Deng Y. , Lei T. , Zhao J. , Liu J. H. . 2010 . High prevalence of blaCTX-M extended-spectrum β-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China . Clin. Microbiol. Infect. 16 : 1475 – 1481 . Google Scholar CrossRef Search ADS PubMed Szmolka A. , Nagy B. . 2013 . Multidrug resistant commensal Escherichia coli in animals and its impact for public health . Front. Microbiol. 4 : 258 . Google Scholar CrossRef Search ADS PubMed Tamang M. D. , Nam H. M. , Jang G. C. , Kim S. R. , Chae M. H. , Jung S. C. , Byun J. W. , Park Y. H. , Lim S. K. . 2012 . Molecular characterization of extended-spectrum-β-lactamase-producing and plasmid-mediated AmpC β-lactamase-producing Escherichia coli isolated from stray dogs in South Korea . Antimicrob. Agents Chemother. 56 : 2705 – 2712 . Google Scholar CrossRef Search ADS PubMed Tamang M. D. , Nam H. M. , Gurung M. , Jang G. C. , Kim S. R. , Jung S. C. , Park Y. H. , Lim S. K. . 2013 . Molecular characterization of CTX-M β-lactamase and associated addiction systems in Escherichia coli circulating among cattle, farm workers, and the farm environment . Appl. Environ. Microbiol. 79 : 3898 – 3905 . Google Scholar CrossRef Search ADS PubMed Tamang M. D. , Gurung M. , Kang M. S. , Nam H. M. , Moon D. C. , Jang G. C. , Jung S. C. , Park Y. H. , Lim S. K. . 2014 . Characterization of plasmids encoding CTX-M β-lactamase and their addiction systems in Escherichia coli isolates from animals . Vet. Microbiol. 174 : 456 – 462 . Google Scholar CrossRef Search ADS PubMed Thorsteinsdottir T. R. , Haraldsson G. , Fridriksdottir V. , Kristinsson K. G. , Gunnarsson E. . 2010 . Broiler chickens as source of human fluoroquinolone-resistant Escherichia coli, Iceland . Emerg. Infect. Dis. 16 : 133 – 135 . Google Scholar CrossRef Search ADS PubMed Van Boeckel T. P. , Brower C. , Gilbert M. , Grenfell B. T. , Levin S. A. , Robinson T. P. , Teillant A. , Laxminarayan R. . 2015 . Global trends in antimicrobial use in food animals . Proc. Natl. Acad. Sci. USA . 112 : 5649 – 5654 . Google Scholar CrossRef Search ADS Vincent C. , Boerlin P. , Daignault D. , Dozois C. M. , Dutil L. , Galanakis C. , Reid-Smith R. J. , Tellier P. P. , Tellis P. A. , Ziebell K. , Manges A. R. . 2010 . Food reservoir for Escherichia coli causing urinary tract infections . Emerg. Infect. Dis. 16 : 88 – 95 . Google Scholar CrossRef Search ADS PubMed World Health Organization (WHO) . 2015 . 19th WHO model list of essential medicines. World health organization essential medicines and health products . Geneva . Zhao C. , Ge B. , De Villena J. , Sudler R. , Yeh E. , Zhao S. , White D. G. , Wagner D. , Meng J. . 2001a . Prevalence of Campylobacter spp., Escherichia coli, and Salmonella Serovars in retail chicken, Turkey, Pork, and Beef from the Greater Washington, D.C., area . Appl. Environ. Microbiol. 67 : 5431 – 5436 . Google Scholar CrossRef Search ADS Zhao S. , White D. G. , McDermott P. F. , Friedman S. , English L. , Ayers S. , Meng J. , Maurer J. J. , Holland R. , Walker R. D. . 2001b . Identification and expression of cephamycinase blaCMY genes in Escherichia coli and Salmonella isolates from food animals and ground meat . Antimicrob. Agents Chemother. 45 : 3647 – 3650 . Google Scholar CrossRef Search ADS Zheng H. , Zeng Z. , Chen S. , Liu Y. , Yao Q. , Deng Y. , Chen X. , Lv L. , Zhuo C. , Chen Z. , Liu J. H. . 2012 . Prevalence and characterisation of CTX-M β-lactamases amongst Escherichia coli isolates from healthy food animals in China . Int. J. Antimicrob. Agents . 39 : 305 – 310 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Comparative genetic characterization of third-generation cephalosporin-resistant Escherichia coli from chicken meat produced by integrated broiler operations in South Korea

Loading next page...
 
/lp/ou_press/comparative-genetic-characterization-of-third-generation-cephalosporin-BDIFNmYzPI
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey127
Publisher site
See Article on Publisher Site

Abstract

Abstract Vertical integration of the broiler industry allows producers to combine different biosecurity and sanitation practices, housing technologies, and feeding regimens to improve food safety. The objectives of this study were to determine the antimicrobial resistance pattern of β-lactamase-producing E. coli and to compare the characteristics of E. coli recovered from 7 different integrated broiler operations in South Korea. Among 200 chicken meat samples, 101 were observed to be positive for E. coli. However, the prevalence varied from 37.5% to 75.0% in chicken meats from different operations, indicating variation in E. coli occurrence among the operations. Among 101 isolated E. coli from chicken meat, 59 were identified third-generation cephalosporin-resistant E. coli and recovered from 7 different operations. A high proportion of the E. coli isolates were resistant to penicillins (89.8%), quinolones (81.4%). Among 59 third-generation cephalosporin-resistant E. coli isolates, 29 showed phenotypic and genotypic characteristics of β-lactamase-producing E. coli. Prevalence of bla gene, blaCTX-M-1, blaCTX-M-14, blaCMY-2, and blaTEM-1, were identified in 2, 4, 8, and 16 E. coli isolates respectively and only one E. coli had both genes, blaTEM-1 and blaCTX-M-1. Pulsed-field gel electrophoresis (PFGE) analysis was performed on 29 β-lactamase-producing E. coli isolates. In PFGE, E. coli included 7 PFGE patterns showing the same operation and an accorded both resistance to β-lactam antibiotics and presence of the bla-gene. Our findings suggest that E. coli with resistance to third-generation cephalosporins can now be found in association with integrated broiler operations, providing the data to support the development of monitoring and preventing program in integrated operations. INTRODUCTION Escherichia coli (E. coli) are ubiquitous bacteria found in the environment, foods, and the intestines of humans and animals. Even though commensal E. coli are usually non-pathogenic, it is one of the most opportunistic pathogens and is responsible for a wide range of infections (Mellata, 2013). In particular, concern has been raised that commensal E. coli in animals may serve as a reservoir of resistance determinants that could be transferred to pathogenic bacteria in either humans or animals (Szmolka and Nagy, 2013). A large number of antimicrobials are used in modern food animal production including broiler production, resulting in the emergence of antimicrobial resistance, which is a cause of concern worldwide (Silbergeld et al., 2008; Aarestrup et al., 2008). In recent years, clinical isolates including E. coli isolates of animal origin, have shown multi-drug resistance (Dolejská et al., 2008; Rzewuska et al., 2015). Antibiotic resistance rates in E. coli are rapidly rising, especially with regard to fluoroquinolones, and third and fourth-generation cephalosporins (Kim et al., 2017). Beta-lactam antibiotics are widely used for treatment of bacterial infections in humans and also in veterinary medicine (Moulin et al., 2008). Extended-spectrum β-lactamase (ESBL) and plasmid-mediated AmpC β-lactamases are plasmid-encoded enzymes, which are capable of inactivating a large number of β-lactam antibiotics, including extended-spectrum and very-broad-spectrum cephalosporins. E. coli that produce ESBL and/or pAmpC β-lactamases have been of particular concern because of their implications for both human and food animal health (Livermore, 2012). These strains encode β-lactamases that mediate resistance to β-lactam antimicrobials including penicillins and extended-spectrum cephalosporins such as third and fourth-generation cephalosporins (Carattoli, 2009). The broiler chicken industry operates largely through vertical integration, with company ownership of breeding farms, multiplication farms, hatcheries, feed mills, some broiler growing farms and processing plants. In South Korea, several large integrated companies supply about 80% of marketed broiler chickens (KAPE, 2015). The livestock on the integrated farms, which includes chicken, is reared intensively, and antimicrobial agents are used as growth promoters and for prophylactic and therapeutic treatment. The Korea Animal Health Products Association reported that around 1500 tons of antimicrobials were sold each year during 2003–2007, but less than 1000 tons were sold for the four consecutive years from 2011 to 2015. However, the sales of cephalosporins have increased by five-fold from 2007 to 2015 (QIA, 2015). The objectives of this study were to determine the antimicrobial resistance pattern of β-lactamase-producing E. coli and to compare the characteristics of E. coli recovered from 7 different integrated broiler operations in South Korea. MATERIALS AND METHODS Bacterial Isolation A total of 200 chicken meats were collected at 4 retail markets visiting 3 or more times during the year 2016. These meats were produced by 50 broiler farms and divided into 7 different integrated broiler operations which supplied about 80% of the broiler chickens in South Korea. Four meats from each farm origin were sampled and tested for this study. Each meat was aseptically placed into a vacuum bag (Sealed Air, Elmwood Park, NJ, USA), and 400 mL of sterile buffered peptone water (BD Biosciences, Sparks, MD, USA) was added. The bag was shaken 50 times, and approximately 25 mL of meat rinse was added to 225 mL of mEC (Merck, Darmstadt, Germany) and incubated at 37°C for 20–24 hours. After enrichment, mEC (Merck) was streaked onto MacConkey agar (BD) plates and incubated at 37°C for 24 hours. Two typical colonies from a single meat sample were selected. If two isolates from the same origin showed the same antimicrobial susceptibility patterns, only one isolate was randomly chosen and included in this study. Antimicrobial Susceptibility Test All E. coli isolates were investigated for their antimicrobial resistance with the disc diffusion test using the following discs (BD): amoxicillin-clavulanate (20/10 μg), ampicillin (10 μg), cefadroxil (CFR, 30 μg), cefalexin (CL, 30 μg), cefazolin (CZ, 30 μg), cefepime (FEP, 30 μg), cefotaxime (CTX, 30 μg), cefovecin (CVN, 30 μg), cefoxitin (FOX, 30 μg), ceftazidime (CAZ, 30 μg), ceftiofur (EFT, 30 μg), cefuroxime (CXM, 30 μg), cephalothin (CF, 30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), gentamicin (10 μg), imipenem (10 μg), nalidixic acid (30 μg), tetracycline (30 μg), and trimethoprim-sulfamethoxazole (1.25/23.75 μg). Results were interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2013). The minimum inhibitory concentrations (MICs) to CZ, CTX, CVN, FOX, CAZ, CF, and EFT were determined by standard agar dilution methods with Mueller-Hinton agar (BD) according to the recommendations of the CLSI (2013). E. coli ATCC 25,922 and Pseudomonas aeruginosa ATCC 27,853 were used as quality control organisms in the antimicrobial susceptibility tests. A double disc diffusion method was performed with CTX (30 μg)/CTX-clavulanate (30 μg/10 μg; BD) and CAZ (30 μg)/CAZ-clavulanate (30 μg/10 μg; BD) to detect ESBL production according to CLSI guidelines (CLSI, 2013). Detection of β-Lactamase-Encoding Genes PCR amplification was conducted with primers for blaCTX-M (Pitout et al., 2004), blaTEM (Briñas et al., 2002), blaSHV (Briñas et al., 2002), blaOXA (Briñas et al., 2002), and pAmpC β-lactamase genes (Pérez-Pérez and Hanson, 2002) (Table 1). PCR products were sequenced with an automatic sequencer (Cosmogenetech, Seoul, Korea). The sequences were confirmed to those in the GenBank nucleotide database using the Basic Local Alignment Search Tool (BLAST) program available through the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST). Table 1. Primers used for PCR and DNA sequencing. Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG View Large Table 1. Primers used for PCR and DNA sequencing. Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG Group Target Primer Sequence (5΄→3΄) Size (bp) Reference ESBL genes CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al., 2004 CTXM1-R2 AGCCGCCGACGCTAATACA CTX-M group II TOHO1–2F GCGACCTGGTTAACTACAATCC 351 Pitout et al., 2004 TOHO1–1R CGGTAGTATTGCCCTTAAGCC CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al., 2004 CTXM825R GCTCAGTACGATCGAGCC CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al., 2004 CTXM914R GTAAGCTGACGCAACGTCTG TEM TEM-F TTCTTGAAGACGAAAGGGC 1159 Briñas et al., 2002 TEM-R ACGCTCAGTGGAACGAAAAC SHV SHV-F CACTCAAGGATGTATTGTG 885 Briñas et al., 2002 SHV-R TTAGCGTTGCCAGTGCTCG OXA OXA-F TTCAAGCCAAAGGCACGATAG 814 Briñas et al., 2002 OXA-R TCCGAGTTGACTGCCGGGTTG pAmpC genes MOXM MOXMF GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson, 2002 MOXMR CACATTGACATAGGTGTGGTGC CITM CITMF TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson, 2002 CITMR TTTCTCCTGAACGTGGCTGGC DHAM DHAMF AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson, 2002 DHAMR CCGTACGCATACTGGCTTTGC ACCM ACCMF AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson, 2002 ACCMR TTCGCCGCAATCATCCCTAGC EBCM EBCMF TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson, 2002 EBCMR CTTCCACTGCGGCTGCCAGTT FOXM FOXMF AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson, 2002 FOXMR CAAAGCGCGTAACCGGATTGG View Large Conjugation Assay To determine the transferability of β-lactamase resistance genes, conjugation assays were performed by using the broth mating method, and E. coli J53 was used as the recipient as previously described in Tamang et al. (2012). Transconjugants were selected on MacConkey agar (BD) plates containing sodium azide (100 μg/mL; Sigma, ST Louis, MO, USA) and cefotaxime (2 μg/mL). All transconjugants were tested for antimicrobial susceptibility and the presence of β-lactamase genes, as described above. Pulsed-field Gel Electrophoresis (PFGE) PFGE analysis was performed on 29 β-lactamase-producing E. coli isolates by digesting genomic DNA using the XbaI (Takara Bio Inc., Shiga, Japan) enzyme according to a standard protocol from the Center for Disease Control and Prevention (CDC), using a CHEF-MAPPER apparatus (Bio-Rad Laboratories, Hercules, CA), as previously described (Liu et al., 2007). Analysis of gel images was performed using InfoQuest FP software ver. 4.5 (Bio-Rad). The dice coefficient was used for similarity calculation, and the similarity matrix was expressed graphically by an unweighted average linkage (UPGMA). RESULTS Prevalence of E. coli The prevalence of E. coli in the chicken meat collected from retail markets is shown in Table 2. Among the 200 chicken meat samples, 101 (50.5%) were observed to be positive for E. coli. Among the meats originating from 7 integrated broiler chicken operations, meats from operations F and G had the highest prevalence of E. coli (75%, 9 of 12 samples), and operation D showed the lowest prevalence (37.5%, 12 of 32 samples). Table 2. Prevalence of E. coli isolates in chicken meat originated from 7 integrated broiler operations. Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 1If two isolates from same origin showed the same antimicrobial susceptibility patterns, only one isolate was included. View Large Table 2. Prevalence of E. coli isolates in chicken meat originated from 7 integrated broiler operations. Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 Integrated broiler operations No. of farms No. of meat tested No. of meat positive for E. coli (%) No. of E. coli isolates1 A 14 56 23 (41.1) 33 B 11 44 26 (59.1) 41 C 8 32 15 (46.9) 24 D 8 32 12 (37.5) 18 E 3 12 7 (58.3) 9 F 3 12 9 (75.0) 16 G 3 12 9 (75.0) 16 Total 50 200 101 (50.5) 157 1If two isolates from same origin showed the same antimicrobial susceptibility patterns, only one isolate was included. View Large Distribution of Antimicrobial Resistance The distribution of cephalosporins-resistant and multi-drug resistant E. coli is shown in Figure 1. CFR, CL, CZ, and CF were first-generation cepha-losporins, FOX and CXM were second-generation cephalosporins, CTX, CVN, CAZ, and EFT were third-generation cephalosporins and FEP was fourth-generation cephalosporins. E. coli from the 7 integrated broiler chicken operations showed resistance to first-, second-, and third-generation cephalosporins, with ranges of 62.5% to 100%, 0% to 31.2%, and 18.7% to 68.7%, respectively. Moreover, resistance to fourth-generation cephalosporins was observed only in E. coli originating from the operation B (4.8%). Multi-drug resistance was observed in all E. coli, without any differences based on the operation showed, with the high proportion of 75.5% to 100%. Figure 1. View largeDownload slide Distribution of antimicrobial resistance of E. coli originated from 7 integrated broiler operations. Multi-drug resistance was defined as resistance to three or more antimicrobial classes. Figure 1. View largeDownload slide Distribution of antimicrobial resistance of E. coli originated from 7 integrated broiler operations. Multi-drug resistance was defined as resistance to three or more antimicrobial classes. Characteristics of Third -Generation Cephalosporins-Resistant E. coli The characteristics of 59 third-generation cephalosporin-resistant E. coli is shown in Table 3. Among the 7 integrated broiler operations, third-generation cephalosporin-resistant E. coli isolates from operation G had the highest prevalence (68.8%, 11 of 16 samples), and operation F showed the lowest prevalence (18.8%, 3 of 16 samples). All isolates showed first-generation cephalosporin-resistance and multi-drug resistance against 3–9 classes of antimicrobial agents tested in this study. Resistance against non-cephalosporins antimicrobial classes were as follows: penicillins (89.8%), quinolones (81.4%), folate pathway inhibitors (74.6%), β-lactam/β-lactamase inhibitor combinations (69.5%), fluoroquinolones (66.1%), tetracyclines (61.0%), phenicols (57.6%), carbapenems (45.8%), and aminoglycoside (27.1%). Table 3. Antimicrobial resistant patterns of 59 third -generation cephalosporin-resistant E. coli. Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs 1AMGs, aminoglycosides; BL/BLICs, β-lactam/β-lactamase inhibitor combinations; CARs, carbapenems; FPIs, folate pathway inhibitors; FQs, fluoroquinolones; PCNs, penicillins; PHs, phenicols; Qs, quionolones; TETs, tetracyclines. View Large Table 3. Antimicrobial resistant patterns of 59 third -generation cephalosporin-resistant E. coli. Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs Resistance pattern Integrated broiler operations No. of isolates Generation of cephalosporins Class of non-cephalosporins1 A (n = 12) 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st, 2nd PCNs, BL/BLICs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, PHs, CARs, FPIs, TETs 1 1st PCNs, FQs, PHs, AMGs, FPIs, TETs 1 1st Qs, FQs, PHs, CARs B (n = 17) 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st, 2nd, 4th PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, CARs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st, 2nd PCNs, BL/BLICs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, Qs, FQs, PHs, FPIs, TETs 2 1st PCNs, Qs, PHs, FPIs, TETs 2 1st Qs, FQs, FPIs C (n = 7) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, FQs, CARs, FPIs 1 1st PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st PCNs, BL/BLICs, AMGs, FPIs 1 1st Qs, FQs, FPIs, TETs 1 1st Qs, AMGs, FPIs D (n = 5) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs 1 1st, 2nd PCNs, BL/BLICs, PHs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st Qs, FQs, CARs, FPIs, TETs E (n = 4) 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, FQs, PHs, CARs, FPIs, TETs 1 1st PCNs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, PHs, AMGs, FPIs, TETs F (n = 3) 1 1st, 2nd BL/BLICs, Qs, FQs, PHs 1 1st PCNs, BL/BLICs, Qs, PHs, FPIs, TETs 1 1st PCNs, BL/BLICs, PHs, FPIs, TETs G (n = 11) 1 1st, 2nd PCNs, BL/BLICs, Qs, CARs, FPIs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, TETs 1 1st, 2nd PCNs, BL/BLICs, Qs, FQs, PHs 1 1st, 2nd PCNs, PHs, AMGs, FPIs, TETs 1 1st, 2nd PCNs, Qs, FQs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs, PHs, AMGs, CARs 1 1st PCNs, BL/BLICs, Qs, FQs, AMGs, TETs 1 1st BL/BLICs, Qs, PHs, AMGs, FPIs, TETs 1 1st PCNs, BL/BLICs, Qs, FQs 1 1st PCNs, FQs, PHs, CARs 1 1st PCNs, Qs, FQs 1AMGs, aminoglycosides; BL/BLICs, β-lactam/β-lactamase inhibitor combinations; CARs, carbapenems; FPIs, folate pathway inhibitors; FQs, fluoroquinolones; PCNs, penicillins; PHs, phenicols; Qs, quionolones; TETs, tetracyclines. View Large Characteristics of β-Lactamase-Producing E. coli The phenotypic and genotypic characteristics of the 29 β-lactamase-producing E. coli among the 59 third- generation cephalosporin-resistant E. coli are shown in Table 4. A total of 14 E. coli were designated as ESBL and pAmpC producers. Two ESBL genes, blaCTX-M-1 and blaCTX-M-14, were identified in 2 and 4 E. coli isolates, respectively. One pAmpC β-lactamase gene, blaCMY-2, was present in 8 E. coli. Additionally, a non-ESBL/pAmpC gene, blaTEM-1, was found in 16 E. coli. Only one isolate among the 29 E. coli had both genes, blaTEM-1 and blaCTX-M-1. In transferability, only 10 transconjugants (34.5%) showed a transferability with blaCTX-M-1, blaCTX-M-14 and blaCMY-2 genes and similar resistance to cephalosporins. Table 4. Characteristics of the 29 β-lactamase producing E. coli isolated from chicken meat of 7 integrated broiler operations. MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 1CZ, cefazolin; CF, cephalothin; FOX, Cefoxitin; CTX, cefotaxime; CVN, cefovecin; CAZ, ceftazidime; EFT, ceftiofur, NA, nalidixic acid; CIP, ciprofloxacin, C, chloramphenicol; G, gentamicin; IPM, imipenem; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline. 2Donor. 3Transconjugant. View Large Table 4. Characteristics of the 29 β-lactamase producing E. coli isolated from chicken meat of 7 integrated broiler operations. MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 MIC (μg/mL)1 Isolate Integrated broiler operations CZ CF FOX CTX CVN CAZ EFT Pattern of non-β-lactam resistance1 β-lactamase gene(s) detected EC 64–12 A ≥512 ≥512 8 ≥512 512 2 ≥512 CIP, C, G, SXT, TE blaCTX-M-14 Trans-64–13 - ≥512 ≥512 8 256 512 2 ≥512 C, SXT blaCTX-M-14 EC 138–1 A 4 64 8 0.25 2 1 4 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 138–2 A 2 64 8 0.25 4 1 2 NA, CIP, C, G, IPM, SXT blaTEM-1 EC 140–1 A ≥512 ≥512 128 2 64 4 32 TE blaCMY-2 EC 140–2 A ≥512 ≥512 128 16 64 4 64 SXT blaCMY-2 EC 157–2 A 16 128 8 0.25 4 1 1 NA, CIP, C, G, IPM, SXT, TE blaTEM-1 EC 159–2 A 32 128 32 0.5 2 1 1 NA, CIP, C, G, SXT, TE blaTEM-1 EC 30–2 B 4 128 2 1 1 1 2 NA, CIP, C, SXT, TE blaTEM-1 EC 95–12 B ≥512 ≥512 128 512 256 ≥512 2 NA, IPM, TE blaCMY-2 Trans-95–13 - 512 512 128 128 256 256 2 TE blaCMY-2 EC 95–22 B ≥512 512 128 512 256 ≥512 2 NA, CIP, TE blaCMY-2 Trans-95–23 - ≥512 512 128 256 256 512 2 TE blaCMY-2 EC 101–22 B ≥512 ≥512 32 ≥512 ≥512 32 ≥512 NA, CIP, C, IPM, SXT, TE blaCTX-M-1+blaTEM-1 Trans-101–23 - ≥512 ≥512 32 256 ≥512 32 ≥512 C, TE blaCTX-M-1 EC 113–22 B ≥512 ≥512 8 ≥512 ≥512 2 ≥512 NA, CIP, C, G, IPM, SXT, TE blaCTX-M-14 Trans-113–23 - ≥512 64 8 256 ≥512 2 ≥512 C blaCTX-M-14 EC 115–2 B 32 128 16 0.5 1 1 2 NA, CIP, IPM, SXT, TE blaTEM-1 EC 116–12 B ≥512 ≥512 8 ≥512 512 4 ≥512 NA, CIP, SXT, TE blaCTX-M-1 Trans-116–13 - ≥512 128 8 256 512 4 ≥512 SXT, TE blaCTX-M-1 EC 75–1 C 2 16 8 1 1 2 2 NA, CIP, SXT, TE blaTEM-1 EC 112–1 C 4 64 8 0.25 4 1 1 NA, CIP, C, IPM, SXT blaTEM-1 EC 134–1 D ≥512 ≥512 128 1 128 4 8 NA, IPM blaCMY-2 EC 193–1 F 256 16 32 0.125 4 0.5 1 NA, CIP, C blaTEM-1 EC 193–2 F 2 64 8 1 4 4 1 C, SXT, TE blaTEM-1 EC 181–1 G 4 16 16 1 4 4 1 NA, CIP, TE blaTEM-1 EC 181–2 G 4 16 8 1 4 4 1 NA, CIP, G, TE blaTEM-1 EC 182–1 G 4 16 8 0.25 4 1 1 NA, CIP, C, G, IPM blaTEM-1 EC 183–2 G 2 64 8 0.25 4 0.5 1 CIP, C, IPM blaTEM-1 EC 184–1 G 4 16 8 0.25 4 0.5 1 NA, CIP blaTEM-1 EC 184–2 G 4 512 8 0.5 4 1 1 NA, C, G, SXT, TE blaCMY-2 EC 190–12 G ≥512 ≥512 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 Trans-190–13 - ≥512 256 8 ≥512 512 4 ≥512 C, G, SXT, TE blaCTX-M-14 EC 190–22 G ≥512 ≥512 4 ≥512 512 1 ≥512 NA, CIP, SXT, TE blaCTX-M-14 Trans-190–23 - ≥512 ≥512 8 ≥512 512 1 ≥512 SXT, TE blaCTX-M-14 EC 192–12 G 4 16 8 1 128 4 1 NA, CIP blaCMY-2 Trans-192–13 - 4 16 8 1 128 2 1 - blaCMY-2 EC 192–22 G 2 16 8 1 128 4 1 NA, CIP, C blaCMY-2 Trans-192–23 - 2 16 4 1 128 2 1 - blaCMY-2 1CZ, cefazolin; CF, cephalothin; FOX, Cefoxitin; CTX, cefotaxime; CVN, cefovecin; CAZ, ceftazidime; EFT, ceftiofur, NA, nalidixic acid; CIP, ciprofloxacin, C, chloramphenicol; G, gentamicin; IPM, imipenem; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline. 2Donor. 3Transconjugant. View Large PFGE Analysis The epidemiological genetic relationships of the 29 β-lactamase-producing E. coli are shown in Figure 2. Among the 21 PFGE patterns (PT001 to PT021) divided by 85% similarity, E. coli included 7 PFGE patterns (PT003, PT005, PT008, PT014, PT016, PT017, and PT018) showing the same operation and accorded both resistance to β-lactam antibiotics and presence of the bla-gene. Figure 2. View largeDownload slide Pulsed-field gel electrophoresis (PFGE) patterns of XbaI-digested total DNA of 29 β-lactamase producing E. coli. AM, ampicillin; AmC, amoxicillin-clavulanic acid; CZ, cefazolin; CL, cephalexin; CFR, cefadroxil; CF, cephalothin; FOX, Cefoxitin; CXM, cefuroxime; CAZ, ceftazidime; CTX, cefotaxime; CVN, cefovecin; EFT, ceftiofur, FEP, cefepime; NA, nalidixic acid; CIP, ciprofloxacin, G, gentamicin; C, chloramphenicol; TE, tetracycline SXT, sulfamethoxazole/trimethoprim; IPM, imipenem. Figure 2. View largeDownload slide Pulsed-field gel electrophoresis (PFGE) patterns of XbaI-digested total DNA of 29 β-lactamase producing E. coli. AM, ampicillin; AmC, amoxicillin-clavulanic acid; CZ, cefazolin; CL, cephalexin; CFR, cefadroxil; CF, cephalothin; FOX, Cefoxitin; CXM, cefuroxime; CAZ, ceftazidime; CTX, cefotaxime; CVN, cefovecin; EFT, ceftiofur, FEP, cefepime; NA, nalidixic acid; CIP, ciprofloxacin, G, gentamicin; C, chloramphenicol; TE, tetracycline SXT, sulfamethoxazole/trimethoprim; IPM, imipenem. DISCUSSION The poultry industry is a vertically integrated production, processing and distribution system, and vertical integration of the broiler industry allows producers to combine different biosecurity and sanitation practices, housing technologies and feeding regimens to improve food safety. Research on antimicrobial use and resistance in integrated operation in South Korea remains a relatively new field. However, further research is urgently needed given the projected large-scale increase in poultry production and antimicrobial use in the poultry sector (Van Boeckel et al., 2015). The present study indicates that the prevalence of E. coli in chicken meats from 7 different integrated practices during 2016 was 50.5%. However, E. coli prevalence in chicken meat varied from 37.5 to 75.0%, revealing that variation in E. coli levels occurs among the different operations. Although there was a difference in the sample size number, the prevalence of E. coli might be associated with differences in the hygiene and sanitation levels of each operation. In previous studies, the frequency of E. coli in chicken meats was found to be 77.8% in South Korea, 31.3% in Brazil, and 38.7% in USA (Zhao et al., 2001a; Botelho et al., 2015; Jo and woo, 2016). The number of E. coli isolates obtained in this study was higher than in the other countries, and this difference may also have resulted from the production techniques used, as well as in personal hygiene, slaughterhouse hygiene, and other practices through to the food chain. Cephalosporins are antibiotics classified by the World Health Organization as “critically important in human medicine” owing to their importance for treating infections caused by Campylobacter, Salmonella and E. coli (WHO, 2015). In this study, 157 E. coli isolates were obtained from 7 different operation systems and evaluated for their resistance to cephalosporins. The first-generation cephalosporins showed a resistance range from 62.5% to 100%, whereas the second- and third-generation cephalosporins were from 0% to 31.2% and 18.7% to 68.7%, respectively. In general, cephalosporins resistance occurs when bacteria change in response to the use of these medicines (Juayang et al., 2015). This study indicates that mass medication with cephalosporins has been continuously used in operations in South Korea, and therefore, similar to the other countries, regulation on the use of cephalosporins in livestock is required in South Korea (Dutil et al., 2010; Schmidt, 2012). According to the annual report by the European Antimicrobial Resistance Surveillance System, the prevalence concerning third-generation cephalosporins resistance has recently increased (ECDC, 2014). Since the introduction of third-generation cephalosporin, a large number of ESBL and pAmpC β-lactamase producers have emerged in gram-negative bacteria, particularly in Enterobacteriaceae such as E. coli. In Japan, the distribution of CTX-M type ESBL in E. coli isolated from broilers was reported (Ishiguro et al., 2010; Hiroi et al., 2011; Hiroi et al., 2012), and pAmpC β-lactamase, especially CMY-2-type, has also been detected (Ahmed et al., 2009; Kojima et al., 2009; Asai et al., 2011). In Europe, CTX-M type ESBL as well as plasmid-mediated CMY-2 pAmpC β-lactamases have been detected in cephalosporin-resistant E. coli from broiler chickens and their products (Smet et al., 2008; Bergenholtz et al., 2009). In this study, two different CTX-M types, blaCTX-M-1 and blaCTX-M-14, and one pAmpC β-lactamase gene, blaCMY-2, were detected. CTX-M-1, in particular, was observed in 2 E. coli cultures and had never previously been identified in chicken meats from South Korea, although it has been documented in other livestock (Lee et al., 2009; Kang et al., 2013b; Tamang et al., 2013). However, CTX-M-1 is the major CTX-M type among Enterobacteriaceae isolates from chicken meat in the European countries such as France (Casella et al., 2017), Germany (Kola et al., 2012), and the Netherlands (Overdevest et al., 2011); therefore, it is expected to be continuously reported in South Korea in the future. CTX-M-14 found in this study has previously been observed in E. coli isolated from livestock, including in the South Korean chicken industry (Tamang et al., 2014; Jo and woo, 2016; Shin et al., 2017), and from healthy food animals in Hong Kong (Ho et al., 2011) and China (Zheng et al., 2012), as well as from pets in China (Sun et al., 2010). The other enzyme conferring β-lactam resistance detected in 26% of isolates tested in this study was a TEM-1 gene. The TEM-1 gene was previously identified in clinical E. coli isolates from companion animals in Europe (Féria et al., 2002; Costa et al., 2006; Pomba et al., 2009). In this study, ESBL and pAmpC β-lactamase genes were detected in E. coli from 4 operations, and these isolates also showed higher levels of resistance to cephalosporins and multi-drug resistance than that in other E. coli cultures. This is consistent with previous studies that ESBL and pAmpC β-lactamase genes increase resistance to cephalosporin and cause multi-drug resistance (Zhao et al., 2001b; Liu et al., 2013; Mehdipour et al., 2015). In this study, transconjugants expressed similar resistance patterns to first-, second-, and third-generation cephalosporins and revealed the presence of blaCTX-M-1, blaCTX-M-14, and blaCMY-2. This is also consistent with a previous study that transconjugants have the same genes and similar antibiotic resistance patterns of the donor strains (Shaheen et al., 2011). It indicates that the high rate occurrence of E. coli harboring blaCTX-M-1, blaCTX-M-14, and blaCMY-2 in poultry and their food products can contribute to the transmission of these genes to humans. PFGE is a useful method for characterization of epidemiologically unrelated bacterial strains (Arbeit et al., 1990). In this study, E. coli included 7 PFGE patterns showing the same operation and an accorded both resistance to β-lactam antibiotics and presence of the bla-gene. It indicates that the dissemination of the blaCTX-M, blaTEM-1, and blaCMY-2 genes in E. coli isolates from integrated broiler operations may mainly result from horizontal transmission as suggest in previous studies (Tamang et al., 2014; Jo and woo, 2016). In South Korea, ESBL-producing E. coli has been increasingly recognized as a cause of community-onset infections, and the proportion of ESBL producers continues to increase in patients at both secondary- and tertiary-care hospitals (Park et al., 2011; Kang et al., 2013a). For example, Lee at al. (Lee et al., 2014) reported the rate of third-generation cephalosporin-resistance among E. coli and K. pneumoniae causing community-onset bacteremia at a secondary-care hospital. These studies support the hypothesis that bacterial pathogens, including resistant isolates, can be transmitted from chicken meat to humans (Thorsteinsdottir et al., 2010; Vincent et al., 2010; Overdevest et al. 2011). To our best knowledge, this study is the first to investigate the characteristics of third-generation cephalosporin-resistant E. coli isolates from different integrated chicken operations in South Korea. Our findings suggest that E. coli with resistance to third-generation cephalosporins can now be found in association with integrated broiler operations, providing the data to support the development of monitoring and preventing program in integrated operations. Acknowledgements This work was supported by Korea Institute of Planning and Evaluation for Technology iRn Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002-7). REFERENCES Aarestrup F. M. , Wegener H. C. , Collignon P. . 2008 . Resistance in bacteria of the food chain: epidemiology and control strategies . Expert Rev. Anti Infect. Ther . 6 : 305 – 310 . Google Scholar CrossRef Search ADS Ahmed A. M. , Shimabukuro H. , Shimamoto T. . 2009 . Isolation and molecular characterization of multidrug-resistant strains of Escherichia coli and Salmonella from retail chicken meat in Japan . J. Food Sci . 74 : M405 – M410 . Google Scholar CrossRef Search ADS PubMed Animal and Plant Quarantine Agency (QIA) . 2015 . National antimicrobial resistance monitoring program . Anyang , Republic of Korea . Arbeit R. D. , Arthur M. , Dunn R. , Kim C. , Selander R. K. , Goldstein R. . 1990 . Resolution of recent evolutionary divergence among Escherichia coli from related lineages: the application of pulsed field electrophoresis to molecular epidemiology . J. Infect. Dis. 161 : 230 – 235 . Google Scholar CrossRef Search ADS PubMed Asai T. , Masani K. , Sato C. , Hiki M. , Usui M. , Baba K. , Ozawa M. , Harada K. , Aoki H. , Sawada T. . 2011 . Phylogenetic groups and cephalosporin resistance genes of Escherichia coli from diseased food-producing animals in Japan . Acta Vet Scand . 53 : 52 . Google Scholar CrossRef Search ADS PubMed Bergenholtz R. D. , Jørgensen M. S. , Hansen L. H. , Jensen L. B. , Hasman H. . 2009 . Characterization of genetic determinants of extended-spectrum cephalosporinases (ESCs) in Escherichia coli isolates from Danish and imported poultry meat . J. Antimicrob. Chemother. 64 : 207 – 209 . Google Scholar CrossRef Search ADS PubMed Botelho L. A. , Kraychete G. B. , Costa e Silva J. L. , Regis D. V. , Picão R. C. , Moreira B. M. , Bonelli R. R. . 2015 . Widespread distribution of CTX-M and plasmid-mediated AmpC β-lactamases in Escherichia coli from Brazilian chicken meat . Mem. Inst. Oswaldo Cruz . 110 : 249 – 254 . Google Scholar CrossRef Search ADS PubMed Briñas L. , Zarazaga M. , Sáenz Y. , Ruiz-Larrea F. , Torres C. . 2002 . -Lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob. Agents Chemother. 46 : 3156 – 3163 . CrossRef Search ADS PubMed Carattoli A. 2009 . Resistance plasmid families in Enterobacteriaceae . Antimicrob. Agents Chemother. 53 : 2227 – 2238 . Google Scholar CrossRef Search ADS PubMed Casella T. , Nogueira M. C. L. , Saras E. , Haenni M. , Madec J. Y. . 2017 . High prevalence of ESBLs in retail chicken meat despite reduced use of antimicrobials in chicken production, France . Int. J. Food Microbiol. 257 : 271 – 275 . Google Scholar CrossRef Search ADS PubMed Clinical and Laboratory Standards Institute (CLSI) . 2013 . Performance standards for antimicrobial susceptibility testing, M100-S23 . Clinical and Laboratory Standards Institute , Wayne, PA . Costa D. , Poeta P. , Sáenz Y. , Vinué L. , Rojo-Bezares B. , Jouini A. , Zarazaga M. , Rodrigues J. , Torres C. . 2006 . Detection of Escherichia coli harbouring extended-spectrum beta-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal . J. Antimicrob. Chemother. 58 : 1311 – 1312 . Google Scholar CrossRef Search ADS PubMed Dolejská M. , Senk D. , Cízek A. , Rybaríková J. , Sychra O. , Literák I. . 2008 . Antimicrobial resistant Escherichia coli isolates in cattle and house sparrows on two Czech dairy farms . Res. Vet. Sci. 85 : 491 – 494 . Google Scholar CrossRef Search ADS PubMed Dutil L. , Irwin R. , Finley R. , Ng L. K. , Avery B. , Boerlin P. , Bourgault A. M. , Cole L. , Daignault D. , Desruisseau A. , Demczuk W. , Hoang L. , Horsman G. B. , Ismail J. , Jamieson F. , Maki A. , Pacagnella A. , Pillai D. R. . 2010 . Ceftiofur resistance in Salmonella enterica serovar Heidelberg from chicken meat and humans, Canada . Emerg. Infect. Dis. 16 : 48 – 54 . Google Scholar CrossRef Search ADS PubMed European Centre for Disease Prevention and Control . Surveillance Report: Antimicrobial resistance surveillance in Europe 2014 . Online available: https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/antimicrobial-resistance-europe-2014.pdf . Féria C. , Ferreira E. , Correia J. D. , Gonçalves J. , Caniça M. . 2002 . Patterns and mechanisms of resistance to beta-lactams and beta-lactamase inhibitors in uropathogenic Escherichia coli isolated from dogs in Portugal . J. Antimicrob. Chemother. 49 : 77 – 85 . Google Scholar CrossRef Search ADS PubMed Hiroi M. , Harada T. , Kawamori F. , Takahashi N. , Kanda T. , Sugiyama K. , Masuda T. , Yoshikawa Y. , Ohashi N. . 2011 . A survey of β-lactamase-producing Escherichia coli in farm animals and raw retail meat in Shizuoka Prefecture, Japan . Jpn. J. Infect Dis. 64 : 153 – 155 . Google Scholar PubMed Hiroi M. , Yamazaki F. , Harada T. , Takahashi N. , Iida N. , Noda Y. , Yagi M. , Nishio T. , Kanda T. , Kawamori F. , Sugiyama K. , Masuda T. , Hara-Kudo Y. , Ohashi N. . 2012 . Prevalence of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in food-producing animals . J. Vet. Med. Sci. 74 : 189 – 195 . Google Scholar CrossRef Search ADS PubMed Ho P. L. , Chow K. H. , Lai E. L. , Lo W. U. , Yeung M. K. , Chan J. , Chan P. Y. , Yuen K. Y. . 2011 . Extensive dissemination of CTX-M-producing Escherichia coli with multidrug resistance to 'critically important' antibiotics among food animals in Hong Kong, 2008-10 . J. Antimicrob. Chemother. 66 : 765 – 768 . Google Scholar CrossRef Search ADS PubMed Ishiguro F. , Nagata A. , Suzuki S. , Yamazaki F. , Mochizuki M. , Arakawa Y. . 2010 . Molecular epidemiological analyses of extended-spectrum β-lactamase-producing Escherichia coli isolated from sporadic diarrheal human cases and chicken meats in Fukui prefecture . J. Jpn. Vet. Med. Assoc. 63 : 883 – 887 . Google Scholar CrossRef Search ADS Jo S. J. , Woo G. J. . 2016 . Molecular characterization of plasmids encoding CTX-M β-lactamases and their associated addiction systems circulating among Escherichia coli from retail chickens, chicken farms, and slaughterhouses in Korea . J. Microbiol. Biotechnol. 26 : 270 – 276 . Google Scholar CrossRef Search ADS PubMed Juayang A. C. , Maestral D. G. , de Los Reyes G. B. , Acosido M. A. , Gallega C. T . 2015 . Review on the antimicrobial resistance of pathogens from tracheal and endotracheal aspirates of patients with clinical manifestations of pneumonia in Bacolod City in 2013 . International Journal of Bacteriology 2015 : 1 – 5 . Google Scholar CrossRef Search ADS Kang C. I. , Cha M. K. , Kim S. H. , Ko K. S. , Wi Y. M. , Chung D. R. , Peck K. R. , Lee N. Y. , Song J. H. . 2013a . Clinical and molecular epidemiology of community-onset bacteremia caused by extended-spectrum β-lactamase-producing Escherichia coli over a 6-year period . J Korean Med Sci . 28 : 998 – 1004 . Google Scholar CrossRef Search ADS Kang M. S. , Kwon Y. K. , Oh J. Y. , Kim M. J. , Call D. R. , An B. K. , Shin E. G. , Song E. A. , Kwon J. H. . 2013b . Evidence for recent acquisition and successful transmission of blaCTX-M-15 in Salmonella enterica in South Korea . Antimicrob. Agents Chemother. 57 : 2383 – 2387 . Google Scholar CrossRef Search ADS Kim D. , Ahn J. Y. , Lee C. H. , Jang S. J. , Lee H. , Yong D. , Jeong S. H. , Lee K. W. . 2017 . Increasing resistance to extended-spectrum cephalosporins, fluoroquinolone, and carbapenem in gram-negative Bacilli and the emergence of carbapenem non-susceptibility in Klebsiella pneumoniae: Analysis of Korean antimicrobial resistance monitoring system (KARMS) data from 2013 to 2015 . Ann Lab Med . 37 : 231 – 239 . Google Scholar CrossRef Search ADS PubMed Kojima A. , Asai T. , Ishihara K. , Morioka A. , Akimoto K. , Sugimoto Y. , Sato T. , Tamura Y. , Takahashi T. . 2009 . National monitoring for antimicrobial resistance among indicator bacteria isolated from food-producing animals in Japan . J. Vet. Med. Sci. 71 : 1301 – 1308 . Google Scholar CrossRef Search ADS PubMed Kola A. , Kohler C. , Pfeifer Y. , Schwab F. , Ku¨hn K. , Schulz K. , Balau V. , Breitbach K. , Bast A. , Witte W. , Gastmeier P. , Steinmetz I. . 2012 . High prevalence of extended-spectrum-β-lactamase-producing enterobacteriaceae in organic and conventional retail chicken meat, Germany . J. Antimicrob. Chemother. 67 : 2631 – 2634 . Google Scholar CrossRef Search ADS PubMed Korea Institute for Animal Products Quality Evaluation (KAPE) . 2015 . Research on the actual conditions of livestock distribution system 2015 . Bundang , Republic of Korea . Lee S. G. , Jeong S. H. , Lee H. , Kim C. K. , Lee Y. , Koh E. , Chong Y. , Lee K. . 2009 . Spread of CTX-M-type extended-spectrum β-lactamases among bloodstream isolates of Escherichia coli and Klebsiella pneumoniae from a Korean hospital . Diagn. Microbiol. Infect. Dis. 63 : 76 – 80 . Google Scholar CrossRef Search ADS PubMed Lee S. , Han S. W. , Kim K. W. , Song D. Y. , Kwon K. T. . 2014 . Third-generation cephalosporin resistance of community-onset Escherichia coli and Klebsiella pneumoniae bacteremia in a secondary hospital . Korean J Intern Med . 29 : 49 – 56 . Google Scholar CrossRef Search ADS PubMed Liu J. H. , Wei S. Y. , Ma J. Y. , Zeng Z. L. , Lü D. H. , Yang G. X. , Chen Z. L. . 2007 . Detection and characterisation of CTX-M and CMY-2 beta-lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China . Int. J. Antimicrob. Agents . 29 : 576 – 581 . Google Scholar CrossRef Search ADS PubMed Liu L. T. , Wan L. H. , Song X. H. , Xiong Y. , Jin S. J. , Zhou L. M. . 2013 . Relevance of class 1 integrons and extended-spectrum β-lactamases in drug-resistant Escherichia coli . Mol. Med. Rep. 8 : 1251 – 1255 . Google Scholar CrossRef Search ADS PubMed Livermore D. M. 2012 . Current epidemiology and growing resistance of gram-negative pathogens . Korean J Intern Med . 27 : 128 – 142 . Google Scholar CrossRef Search ADS PubMed Mehdipour M. M. J. , Mirbagheri A. A. , Salehi Z. , Habibzade S. M. . 2015 . Prevalence of class 1 integrons and extended spectrum beta lactamases among multi-drug resistant Escherichia coli isolates from North of Iran . Iran. Biomed. J . 19 : 233 – 239 . Google Scholar PubMed Mellata M. 2013 . Human and avian extraintestinal pathogenic Escherichia coli: Infections, zoonotic risks, and antibiotic resistance trends . Foodborne Pathogens and Disease . 10 : 916 – 932 . Google Scholar CrossRef Search ADS PubMed Moulin G. , Cavalié P. , Pellanne I. , Chevance A. , Laval A. , Millemann Y. , colin P. , Chauvin C. . 2008 . A comparison of antimicrobial usage in human and veterinary medicine in France from 1999 to 2005 . J. Antimicrob. Chemother. 62 : 617 – 625 . Google Scholar CrossRef Search ADS PubMed Overdevest I. , Willemsen I. , Rijnsburger M. , Eustace A. , Xu L. , Hawkey P. , Heck M. , Savelkoul P. , Vandenbroucke-Grauls C. , Zwaluw K. , Huijsdens X. , Kluytmans J. . 2011 . Extended-spectrum B-lactamase genes of Escherichia coli in chicken meat and humans, the Netherlands . Emerg. Infect. Dis. 17 : 1216 – 1222 . Google Scholar CrossRef Search ADS PubMed Park S. H. , Choi S. M. , Lee D. G. , Kim J. , Choi J. H. , Kim S. H. , Kwon J. C. , Yoo J. H. . 2011 . Emergence of extended-spectrum β-lactamase-producing Escherichia coli as a cause of community-onset bacteremia in South Korea: risk factors and clinical outcomes . Microb. Drug Resist. 17 : 537 – 544 . Google Scholar CrossRef Search ADS PubMed Pérez-Pérez F. J. , Hanson N. D. . 2002 . Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR . J. Clin. Microbiol. 40 : 2153 – 2162 . Google Scholar CrossRef Search ADS PubMed Pitout J. D. , Hossain A. , Hanson N. D. . 2004 . Phenotypic and molecular detection of CTX-M-β-lactamases produced by Escherichia coli and Klebsiella spp. J. Clin. Microbiol. 42 : 5715 – 5721 . Google Scholar CrossRef Search ADS PubMed Pomba C. , da Fonseca J. D. , Baptista B. C. , Correia J. D. , Martínez-Martínez L. . 2009 . Detection of the pandemic O25-ST131 human virulent Escherichia coli CTX-M-15-producing clone harboring the qnrB2 and aac(6')-Ib-cr genes in a Dog . Antimicrob. Agents Chemother. 53 : 327 – 328 . Google Scholar CrossRef Search ADS PubMed Rzewuska M. , Czopowicz M. , Kizerwetter-Świda M. , Chrobak D. , Błaszczak B. , Binek M. . 2015 . Multidrug resistance in Escherichia coli strains isolated from infections in dogs and cats in Poland (2007–2013) . The Scientific World Journal . 2015 : 1 – 8 . Google Scholar CrossRef Search ADS Schmidt C. W. 2012 . FDA proposes to ban cephalosporins from livestock feed . Environ Health Perspect . 120 : a106 . Google Scholar CrossRef Search ADS PubMed Shaheen B. W. , Nayak R. , Foley S. L. , Kweon O. , Deck J. , Park M. , Rafii F. , Boothe D. M. . 2011 . Molecular characterization of resistance to extended-spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States . Antimicrob. Agents Chemother. 55 : 5666 – 5675 . Google Scholar CrossRef Search ADS PubMed Shin S. W. , Jung M. , Won H. G. , Belaynehe K. M. , Yoon I. J. , Yoo H. S. . 2017 . Characteristics of transmissible CTX-M- and CMY-type β-lactamase-producing Escherichia coli isolates collected from pig and chicken farms in South Korea . J. Microbiol. Biotechnol. 27 : 1716 – 1723 . Google Scholar PubMed Silbergeld E. K. , Davis M. , Leibler J. H. , Peterson A. E. . 2008 . One reservoir: redefining the community origins of antimicrobial-resistant infections . Med. Clin. North Am. 92 : 1391 – 1407 . Google Scholar CrossRef Search ADS PubMed Smet A. , Martle A. , Persoons D. , Dewulf J. , Heyndrickx M. , Catry B. , Herman L. , Haesebrouck F. , Butaye P. . 2008 . Diversity of extended-spectrum -lactamases and class C β-lactamases among cloacal Escherichia coli isolates in Belgian broiler farms . Antimicrob. Agents Chemother. 52 : 1238 – 1243 . Google Scholar CrossRef Search ADS PubMed Sun Y. , Zeng Z. , Chen S. , Ma J. , He L. , Liu Y. , Deng Y. , Lei T. , Zhao J. , Liu J. H. . 2010 . High prevalence of blaCTX-M extended-spectrum β-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China . Clin. Microbiol. Infect. 16 : 1475 – 1481 . Google Scholar CrossRef Search ADS PubMed Szmolka A. , Nagy B. . 2013 . Multidrug resistant commensal Escherichia coli in animals and its impact for public health . Front. Microbiol. 4 : 258 . Google Scholar CrossRef Search ADS PubMed Tamang M. D. , Nam H. M. , Jang G. C. , Kim S. R. , Chae M. H. , Jung S. C. , Byun J. W. , Park Y. H. , Lim S. K. . 2012 . Molecular characterization of extended-spectrum-β-lactamase-producing and plasmid-mediated AmpC β-lactamase-producing Escherichia coli isolated from stray dogs in South Korea . Antimicrob. Agents Chemother. 56 : 2705 – 2712 . Google Scholar CrossRef Search ADS PubMed Tamang M. D. , Nam H. M. , Gurung M. , Jang G. C. , Kim S. R. , Jung S. C. , Park Y. H. , Lim S. K. . 2013 . Molecular characterization of CTX-M β-lactamase and associated addiction systems in Escherichia coli circulating among cattle, farm workers, and the farm environment . Appl. Environ. Microbiol. 79 : 3898 – 3905 . Google Scholar CrossRef Search ADS PubMed Tamang M. D. , Gurung M. , Kang M. S. , Nam H. M. , Moon D. C. , Jang G. C. , Jung S. C. , Park Y. H. , Lim S. K. . 2014 . Characterization of plasmids encoding CTX-M β-lactamase and their addiction systems in Escherichia coli isolates from animals . Vet. Microbiol. 174 : 456 – 462 . Google Scholar CrossRef Search ADS PubMed Thorsteinsdottir T. R. , Haraldsson G. , Fridriksdottir V. , Kristinsson K. G. , Gunnarsson E. . 2010 . Broiler chickens as source of human fluoroquinolone-resistant Escherichia coli, Iceland . Emerg. Infect. Dis. 16 : 133 – 135 . Google Scholar CrossRef Search ADS PubMed Van Boeckel T. P. , Brower C. , Gilbert M. , Grenfell B. T. , Levin S. A. , Robinson T. P. , Teillant A. , Laxminarayan R. . 2015 . Global trends in antimicrobial use in food animals . Proc. Natl. Acad. Sci. USA . 112 : 5649 – 5654 . Google Scholar CrossRef Search ADS Vincent C. , Boerlin P. , Daignault D. , Dozois C. M. , Dutil L. , Galanakis C. , Reid-Smith R. J. , Tellier P. P. , Tellis P. A. , Ziebell K. , Manges A. R. . 2010 . Food reservoir for Escherichia coli causing urinary tract infections . Emerg. Infect. Dis. 16 : 88 – 95 . Google Scholar CrossRef Search ADS PubMed World Health Organization (WHO) . 2015 . 19th WHO model list of essential medicines. World health organization essential medicines and health products . Geneva . Zhao C. , Ge B. , De Villena J. , Sudler R. , Yeh E. , Zhao S. , White D. G. , Wagner D. , Meng J. . 2001a . Prevalence of Campylobacter spp., Escherichia coli, and Salmonella Serovars in retail chicken, Turkey, Pork, and Beef from the Greater Washington, D.C., area . Appl. Environ. Microbiol. 67 : 5431 – 5436 . Google Scholar CrossRef Search ADS Zhao S. , White D. G. , McDermott P. F. , Friedman S. , English L. , Ayers S. , Meng J. , Maurer J. J. , Holland R. , Walker R. D. . 2001b . Identification and expression of cephamycinase blaCMY genes in Escherichia coli and Salmonella isolates from food animals and ground meat . Antimicrob. Agents Chemother. 45 : 3647 – 3650 . Google Scholar CrossRef Search ADS Zheng H. , Zeng Z. , Chen S. , Liu Y. , Yao Q. , Deng Y. , Chen X. , Lv L. , Zhuo C. , Chen Z. , Liu J. H. . 2012 . Prevalence and characterisation of CTX-M β-lactamases amongst Escherichia coli isolates from healthy food animals in China . Int. J. Antimicrob. Agents . 39 : 305 – 310 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Jul 11, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off