Comparative Analysis of Differential Gene Expression Profiling of Sex-Bias Fat Body of Bactrocera dorsalis (Diptera: Tephritidae) Identifying a New Vitellogenin Gene

Comparative Analysis of Differential Gene Expression Profiling of Sex-Bias Fat Body of Bactrocera... Abstract The gene expression patterns between female and male fat bodies differ significantly and may be crucial for their different reproductive roles in dioecious insects. In this study, we used digital gene expression profiling to construct the gene expression profiles of the fat body of male and female adults of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), which is one of the most important agricultural pests worldwide. In total, 452 and 993 unigenes were highly expressed in the female and male fat bodies, respectively. Functional analysis showed 179 sequences assigned to reproduction, 181 sequences responding to stimuli, and 45 involved in immune functions. The expression of a selection of differentially expressed genes was validated by reverse transcription quantitative polymerase chain reaction. We found that the expression patterns of all tested genes were consistent with the digital gene expression profiles. In addition, three vitellogenin (Vg) genes in the female fat body were identified. Interestingly, one among these was a new Vg (Unigene1031) that has not been previously reported in B. dorsalis. We named this BdVg3, with accession number of KY305182 in NCBI GenBank database. Sequence analysis of BdVg3 showed that the deduced amino acid sequence of BdVg3 was highly similar to Vg from Bactrocera tau and Vg3 from Drosophila melanogaster. The high expression of all three BdVg genes specifically in the female fat body indicates their critical role in female reproduction. The insect fat body is a relatively large organ distributed throughout the body, mostly underneath the integument and surrounding the gut and reproductive organs. It plays an essential role in energy storage and utilization. Nutrient reserves accumulated in the fat body modulate several important aspects of an insect’s life such as the rate of growth, timing of metamorphosis, and egg development (Mirth and Riddiford 2007). The fat body also has biosynthetic and metabolic activity and is involved in various physiological and biological processes, including detoxification, immunity, and developmental and reproductive regulation (Arrese and Soulages 2010). The insect fat body can store and release energy in response to a changing physiological status, and can coordinate insect growth with metamorphosis or reproduction by storing or releasing proteins related to these events. Functional proteins, such as storage proteins used as an amino acid reservoir for morphogenesis, lipophorins responsible for lipid transport in circulation, or vitellogenins for egg maturation, are synthesized by the fat body. For instance, the synthesis of vitellogenin in the fat body of Aedes aegypti females is transcriptionally upregulated after a bloodmeal. Previous studies on Drosophila melanogaster (Jiang et al. 2005) and Bombyx mori (Cheng et al. 2006) revealed the multiple functions of the fat body with various transcriptome patterns during different developmental stages. Although some functions are ubiquitous to the entire fat body, others are predominantly localized in certain regions (Haunerland and Shirk 1995). The role of the fat body changes during different life stages, and the cytological appearance of the fat body may be drastically altered (Anand and Lorenz 2008). In adult females, the majority of lipids accumulated in the oocytes originate from the fat body and are transported to the ovaries (Ziegler and Antwerpen 2006). A number of studies have used various tools to decipher gene expression profiles and function of vital genes involved in fat body-related functions (Attardo et al. 2006, Price et al. 2011). Digital gene expression (DGE) profiling is a powerful tool to investigate the complex mechanism of gene and protein function (Audic and Claverie 1997). For example, the sex bias in the responses of Bo. mori fat body to high temperature was determined by DGE (Wang et al. 2014). Moreover, comparative transcriptome analysis was used to investigate differences of Nilaparvata lugens fat body against rice resistance (Yu et al. 2013) and to analyze the response mechanism of Bo. mori to the insecticide phoxim (Gu et al. 2015). The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is an important agricultural pest worldwide (Wei et al. 2015a) and has the ability to infest more than 250 host plant species, including fruits and vegetables (Wang et al. 2013). Previous studies have reported the gene expression profiles of four developmental stages of B. dorsalis by DGE (Shen et al. 2011). Moreover, the transcriptomes of different tissues, including the fat body, midgut, testis, ovary, male accessory gland, and antennae from B. dorsalis, have also been reported (Shen et al. 2013; Yang et al. 2014; Wei et al. 2015b, 2016; Liu et al. 2016). These and other studies provide the necessary genomic information to further investigate the multiple functions of genes in the B. dorsalis fat body. However, differences in gene expression in the fat body relative to sex remain unclear, although some genes, including cytochrome P450, glutathione S-transferase (GST) and cecropin, have been shown to exhibit a male-bias profile (Zuo and Chen 2014). Therefore, in this study, we constructed transcriptome libraries from the fat body of male and female B. dorsalis and sequenced them by DGE profiling. Many differentially expressed genes were identified, and these were involved in energy and detoxification, immune function, and reproduction. Subsequently, tissue-specific expression profiles were validated by reverse real-time quantitative polymerase chain reaction (qPCR). Finally, a new reproductive protein named vitellogenin 3 (Bd Vg3) was identified for the first time in B. dorsalis. Materials and Methods Insects and RNA Extraction The insects for this study were collected as pupae from citrus orchards in Hainan province of China in 2008, and maintained in the laboratory. Larvae and adults were reared on artificial diet as described previously (Wang et al. 2013). Adults were held in 40 × 30 × 30 cm stock cages enclosed with a fine synthetic mesh. All cages were kept under constant conditions: 27.5 ± 0.5°C, 75 ± 5% RH, and 14:10 (L:D) h. Food was supplied ad libitum by inserting a glass vial containing adult diet into absorbent cotton. Food vials were replaced daily (Wei et al. 2015a). Newly emerged adults were separated by sex and transferred to separate cages. Fat bodies were dissected from 5-d-old male and female virgin flies (n = 50 flies/sex) and immersed in RNAstore reagent (Tiangen, Beijing, China). The samples were powdered in liquid nitrogen and total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. The concentration and purity of extracted RNA were measured using a NanoVue UV-Vis spectrophotometer (GE Healthcare Bio-Science, Uppsala, Sweden), and the integrity of RNA was confirmed by separating on a 1% agarose gel by electrophoresis. Construction of the cDNA Libraries and Sequencing The total RNA samples were treated with DNase I (Promega, Madison, WI) to eliminate DNA contamination followed by mRNA purification with magnetic beads. The mRNA was enriched with oligo(dT) magnetic beads (for eukaryotes) and mixed with fragmentation buffer to cut the mRNA into 200 bp fragments. First strand cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Rockford, IL). Double stranded cDNA was purified with magnetic beads, end repaired and ligated to adaptors. Ligated products were selected and purified on Tris-acetate-EDTA-agarose gels. Finally, fragments were enriched by PCR amplification, purified with magnetic beads and dissolved in the appropriate amount of elution buffer. An Agilent 2100 Bioanaylzer was used to quantify the sample library and validate integrity. The library was sequenced on the Ion Proton platform by the Beijing Genomics Institute (BGI, Shenzhen, China). Analysis of the Differentially Expressed Genes The original image data produced by the sequencer was transformed into sequences by a base calling program of real-time analysis (Illumina, San Diego, CA). Data cleaning (or data filtering) was performed to obtain ‘clean reads’ for further analysis. We created a reference gene set by assembling all previously reported B. dorsalis transcriptome raw data available into a NCBI Sequence Read Archive; this included libraries from four developmental stages, egg, larva, pupa and adult (Shen et al. 2011), and tissues of fat body, midgut, testis, male accessory gland, male antennae and female antennae (Shen et al. 2013, Yang et al. 2014, Wei et al. 2015b, Liu et al. 2016, Wei et al. 2016). Re-assembly and annotation was performed as described previously (Wei et al. 2015b), and resulting unigenes were used as the reference gene dataset. Clean reads from the DGE profiling in this study were mapped to the reference sequences using the SOAP aligner tool SOAP2 (Li et al. 2009) with no more than two base mismatches allowed in each alignment. Gene expression levels were calculated with the RPKM method (Reads Per kb per Million reads) (Mortazavi et al. 2008). If there was more than one transcript for a given gene, the longest was used to calculate the expression level and coverage. To identify differentially expressed genes between two samples, the false discovery rate (FDR) was used to determine the threshold of P-value in multiple tests (Audic and Claverie 1997). We used FDR ≤ 0.001 and the absolute value of log2Ratio ≥ 1 as the threshold to judge the significance in gene expression differences. These transcripts were further annotated by Gene Orthology (GO) function analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Gene Ontology Enrichment Analysis of Differentially Expressed Genes Transcripts were mapped to the reference data set by a blast search (E-value ≤ 10−5). Those with suitable matches were used to obtain GO annotation using the Blast2GO program (Conesa et al. 2005). The WEGO software was used to analyze the GO functional classification of differentially expressed transcripts in order to understand the distribution of the genes (Ye et al. 2006). KEGG pathways enrichment analysis identified the pathways represented by these transcripts, to identify significantly enriched metabolic pathways or signal transduction pathways. Reverse Transcription Quantitative PCR Analysis To validate the male/female fat body-specific gene expression, fat body, midgut, Malpighian tubules as well as ovary and testis were dissected from 5-d-old adult male and female (20 flies/sample) B. dorsalis. After isolating total RNA as described above, DNA was digested with RQ1 DNase (Promega). Then, RNA (1 μg/sample) was reverse transcribed into first-strand cDNA using PrimeScript RT reagent Kit (TaKaRa, Dalian, China). Reverse transcription quantitative PCR (RT-qPCR) reactions were performed in a 10 μl reaction volume including 5 μl of GoTaq qPCR Master Mix (Promega), 3.5 μl of nuclease-free water, 0.5 μl of template cDNA, and 0.5 μl of each primer (10 μM). Reactions were performed on a StepOne Plus Real-Time PCR System (Life Technologies, Woodlands, Singapore) under the following conditions: 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. The melting curve was recorded at the end of the procedure from 60 to 95°C to ensure the specificity of each primer pair. Sequences of the primers used in these reactions are listed in Table 1. For reference purposes, a fragment of the B. dorsalis ribosomal protein subunit 3 open reading frame (ORF) was also amplified (Wei et al. 2015b). Three biological replicates of insects from the same colony were performed for each tissue. Relative gene expression levels were calculated using 2−ΔΔCt (Livak and Schmittgen 2001). Data were analyzed with one-way analysis of variance (ANOVA) for tissue sample comparisons with SPSS 19.0 software (IBM, Chicago, IL) and a value of P < 0.05 was considered to be statistically significant. After RT-qPCR determination, semi-quantitative reverse transcription PCR (RT-PCR) was performed to validate the expression of three Vg genes in 25 μl reaction volume. Briefly, the reactions were performed in a 25 μl reaction volume with 15.25 μl of distilled water, 2.5 μl of 10 × PCR buffer (Mg+ free), 2.0 μl of MgCl2 (25 mM), 2.0 μl of dNTP (2.5 mM), 1 μl of cDNA, 1 μl of each primer (10 μM), and 0.25 μl of rTaq polymerase (2.5 U/μl) (Takara). PCR was carried out as follows: 95°C of initial denaturation for 3 min; followed by 27 or 30 cycles of 95°C for 30 s, 56°C of 30 s, and 72°C for 40 s; and 72°C of final extension for 10 min. Products were checked on a 2% agarose gel with GoldView II staining (Solarbio, Shanghai, China). Table 1. Oligonucleotide primers used for real-time quantitative PCR and full-length confirmation Genes  Forward primer (5’→3’)  Reverse primer (5'→3')  RT-qPCR  RPS3  TAAGTTGACCGGAGGTTTGG  TGGATCACCAGAGTGGATCA  Unigene3190  GGAAGAACCCCAAACCCACA  GCACCAACACCTTGTCCAAC  Unigene1031  CCCAGTCCCAGCGATATTCC  ACTTGTCCGTTGTAGGCCTG  Unigene1793  ATTTGGCTCAGGTGGTCGAG  AAGTGGGTTGCCAGTAGACG  Unigene16294  TCTGTGGGGCATTGAAACGA  GCAAAACGACGTAGCCAAGG  Unigene6570  TTGCCCGTGTCCTCTTCTTC  CTTCGGCAACTTCCTCAGGT  Unigene3658  GCTTGGCCAACGAACGAAAT  TCTTCCTTATCATCGGCGGC  Unigene9240  TGGTCGTCAATACAAGCGCT  CATAGCTGCCTCGACGACAT  CL554  CCTCAGGTTTGCGTGCTAAC  CCGGCGATGGACCACTATAT  CL2324  CCGTCATCCAAGTTTGCTGT  GTGGTGGTGTGGAGAGTGTA  Unigene2458  GACGCAAACATTTTCTGCCG  GACCCATGACACGTTTGGTC  Unigene3793  TGGCGTTCGATGAGTTTCCT  TCTGTTTGTGCCCAGTCCAT  CL167  AATGCAAAAGCGTCACCCAC  TGCCTTCAACCACACTTTGC  CL213  AATCTCGTTGGGCAGCATGA  TTTTCCGTGCTCATTGTGGC  Unigene517  CGCGCCTTCCAAGAACAATT  AACCGCCGATTTCAGTTTGC  CL657  TGTTCACCGCTACATTCCGT  TTACGCGTTGCTTTGCTCTC  Unigene1047  ATAAGACGCTGGGCACATGA  GCAAAATGGAAAGAGGGCGT  Full-length confirmation  Unigene1031  CATGAGTCCTTTAAGTATTTTTTGT  TTAGTTGTTCGAAGAGGAGC  Genes  Forward primer (5’→3’)  Reverse primer (5'→3')  RT-qPCR  RPS3  TAAGTTGACCGGAGGTTTGG  TGGATCACCAGAGTGGATCA  Unigene3190  GGAAGAACCCCAAACCCACA  GCACCAACACCTTGTCCAAC  Unigene1031  CCCAGTCCCAGCGATATTCC  ACTTGTCCGTTGTAGGCCTG  Unigene1793  ATTTGGCTCAGGTGGTCGAG  AAGTGGGTTGCCAGTAGACG  Unigene16294  TCTGTGGGGCATTGAAACGA  GCAAAACGACGTAGCCAAGG  Unigene6570  TTGCCCGTGTCCTCTTCTTC  CTTCGGCAACTTCCTCAGGT  Unigene3658  GCTTGGCCAACGAACGAAAT  TCTTCCTTATCATCGGCGGC  Unigene9240  TGGTCGTCAATACAAGCGCT  CATAGCTGCCTCGACGACAT  CL554  CCTCAGGTTTGCGTGCTAAC  CCGGCGATGGACCACTATAT  CL2324  CCGTCATCCAAGTTTGCTGT  GTGGTGGTGTGGAGAGTGTA  Unigene2458  GACGCAAACATTTTCTGCCG  GACCCATGACACGTTTGGTC  Unigene3793  TGGCGTTCGATGAGTTTCCT  TCTGTTTGTGCCCAGTCCAT  CL167  AATGCAAAAGCGTCACCCAC  TGCCTTCAACCACACTTTGC  CL213  AATCTCGTTGGGCAGCATGA  TTTTCCGTGCTCATTGTGGC  Unigene517  CGCGCCTTCCAAGAACAATT  AACCGCCGATTTCAGTTTGC  CL657  TGTTCACCGCTACATTCCGT  TTACGCGTTGCTTTGCTCTC  Unigene1047  ATAAGACGCTGGGCACATGA  GCAAAATGGAAAGAGGGCGT  Full-length confirmation  Unigene1031  CATGAGTCCTTTAAGTATTTTTTGT  TTAGTTGTTCGAAGAGGAGC  View Large Sequence Analysis and Phylogenetic Tree Construction ORF sequence of the newly identified BdVg3 gene was identified with ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and the complete ORF was confirmed by amplifying the genes from the female fat body by RT-PCR using gene-specific primers (Table 1). The PCR conditions and procedures were the same as the above mentioned semi-quantitative RT-PCR but with 35 cycles. Following purification by agarose gel electrophoresis and gel extraction (TaKaRa), amplified products were cloned into the pGEM-T Easy Vector (Promega) and transformed into Escherichia coli DH5α (Vazyme, Nanjing, China). Transformants were screened on Luria-Bertani (LB) agar plates containing 100 μg/ml ampicillin. Plasmids extracted from positive clones were sequenced by Invitrogen. SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP) was used to predict the signal peptide from the deduced amino acids sequence (Petersen et al. 2011). Compute pI/Mw (http://web.expasy.org/compute_pi/) from the Swiss Institute of Bioinformatics was used to estimate the isoelectric point (pI) and molecular weight of the deduced amino acid sequences. Homologous proteins were downloaded from the nonredundant protein sequences (nr) in NCBI using Blastp (http://www.ncbi.nlm.nih.gov). A phylogenetic tree was constructed by MEGA 5 using the neighbor joining (NJ) method (Tamura et al. 2011). Branch support was estimated by bootstrap analysis with 1,000 replicates. Transcriptional Expression Relative to Developmental Stage and Sex The expression of BdVg3 among developmental stages was determined by qRT-PCR as above. Briefly, egg, 7-d-old larva, 7-d-old pupa, 9-d-old virgin female adult and 9-d-old virgin male adult were collected for total RNA isolation and first-strand cDNA. Newly emerged female (0-d-old), and 1- to 10-d-old virgin female were also sampled for qRT-PCR. Results Sequence Assembly and Analysis Re-assembly of seven previously published transcriptome datasets produced 36,243 unigenes with a mean length of 919 bp, which was used as the reference for DGE profiling. In this study, In total 13,740,836 and 15,702,303 reads were obtained from female and male fat bodies, respectively. Of these, we mapped 98.59% and 98.05% clean reads to the reference sequences, respectively. Unmapped reads were not retained for analysis. Mapped reads were assembled into 19,527 and 20,651 unigenes in the female and male fat body samples, respectively. From these, we identified 22,247 unigenes in total and 452 were highly expressed in the female fat body and 993 were highly expressed in the male fat body. In this study, there were 983, 668, and 681 transcripts that were differentially expressed between tissues, and these were annotated in NCBI nr, KEGG, and GO databases, respectively. Functional Annotation The GO category covers 3 domains: cellular component, molecular function and biological process. In our analysis, 410 unigenes were assigned to the cellular component with 15 GO terms, while 544 unigenes were classified to 13 GO terms of the molecular function domain. In the biological process domain, 482 unigenes were assigned to 22 GO terms (Fig. 1). In the biological process category, the predominant groups were associated with ‘cellular process,’ ‘metabolic process,’ and ‘single-organism process,’ which contained more than 300 differentially expressed transcripts. More important is the association of 181 transcripts in the ‘response to stimulus’ and 45 transcripts in the ‘immune system process’ that were expressed differentially between the sex-biased fat body. Particularly, 101 and 78 transcripts were assigned to ‘reproduction’ and ‘reproductive process’ categories, respectively. Regarding the molecular function classification, the main groups were involved in ‘catalytic activity’ and ‘binding.’ Among these, 667 of the annotated genes were annotated to the KEGG pathways with 241 and 426 transcripts highly expressed in the female and male fat body, respectively. The most predominant group was associated with the metabolic pathway. Fig. 1. View largeDownload slide Gene Ontology (GO) classification of unigenes differentially expressed in female and male fat body from B. dorsalis. The green bars represent the molecular function category, the purple bars represent cell component category, and the blue bars represent biological process category. Fig. 1. View largeDownload slide Gene Ontology (GO) classification of unigenes differentially expressed in female and male fat body from B. dorsalis. The green bars represent the molecular function category, the purple bars represent cell component category, and the blue bars represent biological process category. Protein Prediction of Differentially Expressed Genes Some of the differentially expressed transcripts from this study were not annotated in NCBI nr database. Only 363 transcripts in the female fat body and 620 transcripts in male fat body were functionally annotated; these included genes involved in detoxification, development, and immune function. Genes, such as vitellogenin, transformer, and doublesex involved in female reproduction showed a different expression in female fat body. Other genes such as alcohol dehydrogenase, cytochrome P450, defensin, 3-hydroxybutyrate dehydrogenase genes involved in immune and stimuli, were also differentially expressed in fat body. The genes that were highly differentially expressed in each tissue with a log2Ratio ≥ 4 and a RPKM value ≥ 100 are listed in Tables 2 and 3. Table 2. Annotation information of genes highly expressed in the female fat body Gene ID  Length  F-RPKM  M-RPKM  log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  Unigene17585  454  41.534  0.001  −15.342  2.79E-70  1.54E-68  BAA78500  Serine repeat antigen  Plasmodium falciparum  CL3089.Contig2  761  36.594  0.001  −15.159  1.94E-103  1.35E-101  XP_002057902  GJ18385  Drosophila virilis  Unigene16130  479  33.352  0.001  −15.025  1.17E-59  5.83E-58  EJY57929  AAEL011612-PB  Aedes aegypti  Unigene16891  218  30.434  0.001  −14.893  3.26E-25  8.97E-24  XP_001958842  GF12587  Drosophila ananassae  Unigene14291  267  27.791  0.001  −14.762  4.13E-28  1.20E-26  XP_002138762  GA24979  Drosophila pseudoobscura pseudoobscura  Unigene17198  237  10.682  0.001  −13.383  4.40E-10  6.46E-09  AAK53386  Reverse transcriptase-like polymerase  Drosophila melanogaster  Unigene3190  1372  50569.813  12.221  −12.015  0  0  AAM00372  Vitellogenin 1 precursor  Bactrocera dorsalis  Unigene1031  1697  13097.899  4.964  −11.366  0  0  P27587  Vitellogenin-2  Ceratitis capitata  Unigene1793  1068  4369.872  5.804  −9.556  0  0  CAD32739  Alcohol dehydrogenase-2  B. dorsalis  Unigene13873  382  61.017  0.208  −8.196  1.50E-84  9.38E-83  XP_001988793  GH11353  Drosophila grimshawi  Unigene16294  963  212.488  0.825  −8.008  0  0  XP_002064614  GK23731  Drosophila willistoni  Unigene16293  603  173.727  1.318  −7.042  0  0  AFH54206  Cytochrome P450  B. dorsalis  Unigene15983  251  41.388  0.317  −7.03  2.99E-37  1.04E-35  XP_002080590  GD10169  Drosophila simulans  Unigene20852  958  31.62  0.249  −6.989  1.94E-106  1.38E-104  AAC39131  Midgut-specific serine protease 2  Stomoxys calcitrans  Unigene6570  445  443.943  3.75  −6.887  0  0  XP_002736707  Protein kinase-like  Saccoglossus kowalevskii  Unigene3658  1366  6166.376  74.93  −6.363  0  0  XP_001991936  GH24487  D. grimshawi  Unigene16403  583  11.081  0.273  −5.345  1.18E-21  2.88E-20  AAC28744  Envelope-like protein  C. capitata  Unigene15554  292  24.515  0.816  −4.908  5.79E-23  1.48E-21  XP_002049732  GJ20591  D. virilis  Unigene1694  484  28.137  1.314  −4.421  3.90E-40  1.44E-38  AFN61300  Defensin 1  Lutzomyia longipalpis  Unigene9240  1533  16020.299  977.815  −4.034  0  0  AAM00373  Vitellogenin 2 precursor  B. dorsalis  Gene ID  Length  F-RPKM  M-RPKM  log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  Unigene17585  454  41.534  0.001  −15.342  2.79E-70  1.54E-68  BAA78500  Serine repeat antigen  Plasmodium falciparum  CL3089.Contig2  761  36.594  0.001  −15.159  1.94E-103  1.35E-101  XP_002057902  GJ18385  Drosophila virilis  Unigene16130  479  33.352  0.001  −15.025  1.17E-59  5.83E-58  EJY57929  AAEL011612-PB  Aedes aegypti  Unigene16891  218  30.434  0.001  −14.893  3.26E-25  8.97E-24  XP_001958842  GF12587  Drosophila ananassae  Unigene14291  267  27.791  0.001  −14.762  4.13E-28  1.20E-26  XP_002138762  GA24979  Drosophila pseudoobscura pseudoobscura  Unigene17198  237  10.682  0.001  −13.383  4.40E-10  6.46E-09  AAK53386  Reverse transcriptase-like polymerase  Drosophila melanogaster  Unigene3190  1372  50569.813  12.221  −12.015  0  0  AAM00372  Vitellogenin 1 precursor  Bactrocera dorsalis  Unigene1031  1697  13097.899  4.964  −11.366  0  0  P27587  Vitellogenin-2  Ceratitis capitata  Unigene1793  1068  4369.872  5.804  −9.556  0  0  CAD32739  Alcohol dehydrogenase-2  B. dorsalis  Unigene13873  382  61.017  0.208  −8.196  1.50E-84  9.38E-83  XP_001988793  GH11353  Drosophila grimshawi  Unigene16294  963  212.488  0.825  −8.008  0  0  XP_002064614  GK23731  Drosophila willistoni  Unigene16293  603  173.727  1.318  −7.042  0  0  AFH54206  Cytochrome P450  B. dorsalis  Unigene15983  251  41.388  0.317  −7.03  2.99E-37  1.04E-35  XP_002080590  GD10169  Drosophila simulans  Unigene20852  958  31.62  0.249  −6.989  1.94E-106  1.38E-104  AAC39131  Midgut-specific serine protease 2  Stomoxys calcitrans  Unigene6570  445  443.943  3.75  −6.887  0  0  XP_002736707  Protein kinase-like  Saccoglossus kowalevskii  Unigene3658  1366  6166.376  74.93  −6.363  0  0  XP_001991936  GH24487  D. grimshawi  Unigene16403  583  11.081  0.273  −5.345  1.18E-21  2.88E-20  AAC28744  Envelope-like protein  C. capitata  Unigene15554  292  24.515  0.816  −4.908  5.79E-23  1.48E-21  XP_002049732  GJ20591  D. virilis  Unigene1694  484  28.137  1.314  −4.421  3.90E-40  1.44E-38  AFN61300  Defensin 1  Lutzomyia longipalpis  Unigene9240  1533  16020.299  977.815  −4.034  0  0  AAM00373  Vitellogenin 2 precursor  B. dorsalis  View Large Table 3. Annotation information of genes highly expressed in the male fat body Gene ID  Length  F-RPKM  M-RPKM  Log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  CL1321.Contig1  463  0.001  33.812  15.045  4.39E-56  2.11E-54  YP_961388  NADH dehydrogenase subunit 3  Bactrocera dorsalis  Unigene16586  221  0.001  10.428  13.348  7.38E-09  9.89E-08  XP_001866338  conserved hypothetical protein  Culex quinquefasciatus  Unigene15170  314  0.001  10.123  13.305  5.97E-12  9.90E-11  XP_002076610  GD15108  Drosophila simulans  Unigene15162  365  0.478  85.346  7.479  1.20E-106  8.55E-105  ABK91492  CYP6G3  Lucilia cuprina  CL554.Contig3  786  0.666  103.833  7.284  4.20E-276  6.06E-274  XP_001863343  3-hydroxybutyrate dehydrogenase  Cu. quinquefasciatus  CL2324.Contig1  351  0.995  112.748  6.824  1.47E-132  1.18E-130  XP_001991414  GH12070  Drosophila grimshawi  Unigene15893  346  0.252  22.738  6.494  7.55E-27  2.15E-25  XP_002131325  uncharacterized protein LOC100180114  Ciona intestinalis  Unigene11181  459  0.19  14.543  6.257  1.06E-22  2.69E-21  XP_004208375  histone-lysine N-methyltransferase SETMAR-like  Hydra magnipapillata  Unigene2458  1,864  3.606  246.758  6.096  0  0  XP_001357727  GA20850  Drosophila pseudoobscura pseudoobscura  Unigene626  572  0.458  25.702  5.811  1.27E-47  5.37E-46  XP_002038357  GM10785  Drosophila sechellia  Unigene7053  750  0.815  43.654  5.744  3.97E-104  2.80E-102  XP_002073279  GK13242  Drosophila willistoni  Unigene3793  2,250  2.677  133.929  5.645  0  0  XP_002000822  GI22314  Drosophila mojavensis  CL167.Contig2  1,869  19.431  795.82  5.356  0  0  XP_002002750  GI11244  D. mojavensis  CL167.Contig3  1,615  9.297  340.159  5.193  0  0  XP_002002750  GI11244  D. mojavensis  CL213.Contig3  1,366  6.71  226.999  5.08  0  0  XP_001981014  GG23111  Drosophila erecta  Unigene9116  1,085  1.287  37.5  4.864  1.30E-119  1.01E-117  CBA11305  Odorant binding protein 1  Glossina morsitans morsitans  Unigene15628  344  1.015  27.721  4.771  1.01E-28  2.96E-27  XP_001354285  GA11646  D. pseudoobscura pseudoobscura  Unigene21342  205  0.852  23.259  4.771  6.55E-15  1.26E-13  XP_003698913  Uncharacterized protein LOC100865369  Apis florea  Unigene517  825  5.291  130.326  4.623  1.20E-304  1.82E-302  XP_002049652  GJ21709  Drosophila virilis  CL2953.Contig1  1,070  1.55  37.506  4.597  2.63E-114  1.96E-112  XP_002075316  GK17378  D. willistoni  CL657.Contig2  1,737  70.361  1475.108  4.39  0  0  ABK91492  CYP6G3  L. cuprina  Unigene1047  492  5.146  105.149  4.353  4.58E-142  3.89E-140  XP_002063233  GK21500  D. willistoni  CL2433.Contig2  905  0.772  14.488  4.231  2.16E-36  7.40E-35  XP_001972413  GG15517  D. Erecta  CL2386.Contig1  693  4.661  82.793  4.151  1.75E-152  1.58E-150  XP_001991143  GH12229  D. grimshawi  Unigene16852  427  0.613  10.05  4.034  2.45E-12  4.17E-11  XP_002041700  GM16611  D. sechellia  Gene ID  Length  F-RPKM  M-RPKM  Log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  CL1321.Contig1  463  0.001  33.812  15.045  4.39E-56  2.11E-54  YP_961388  NADH dehydrogenase subunit 3  Bactrocera dorsalis  Unigene16586  221  0.001  10.428  13.348  7.38E-09  9.89E-08  XP_001866338  conserved hypothetical protein  Culex quinquefasciatus  Unigene15170  314  0.001  10.123  13.305  5.97E-12  9.90E-11  XP_002076610  GD15108  Drosophila simulans  Unigene15162  365  0.478  85.346  7.479  1.20E-106  8.55E-105  ABK91492  CYP6G3  Lucilia cuprina  CL554.Contig3  786  0.666  103.833  7.284  4.20E-276  6.06E-274  XP_001863343  3-hydroxybutyrate dehydrogenase  Cu. quinquefasciatus  CL2324.Contig1  351  0.995  112.748  6.824  1.47E-132  1.18E-130  XP_001991414  GH12070  Drosophila grimshawi  Unigene15893  346  0.252  22.738  6.494  7.55E-27  2.15E-25  XP_002131325  uncharacterized protein LOC100180114  Ciona intestinalis  Unigene11181  459  0.19  14.543  6.257  1.06E-22  2.69E-21  XP_004208375  histone-lysine N-methyltransferase SETMAR-like  Hydra magnipapillata  Unigene2458  1,864  3.606  246.758  6.096  0  0  XP_001357727  GA20850  Drosophila pseudoobscura pseudoobscura  Unigene626  572  0.458  25.702  5.811  1.27E-47  5.37E-46  XP_002038357  GM10785  Drosophila sechellia  Unigene7053  750  0.815  43.654  5.744  3.97E-104  2.80E-102  XP_002073279  GK13242  Drosophila willistoni  Unigene3793  2,250  2.677  133.929  5.645  0  0  XP_002000822  GI22314  Drosophila mojavensis  CL167.Contig2  1,869  19.431  795.82  5.356  0  0  XP_002002750  GI11244  D. mojavensis  CL167.Contig3  1,615  9.297  340.159  5.193  0  0  XP_002002750  GI11244  D. mojavensis  CL213.Contig3  1,366  6.71  226.999  5.08  0  0  XP_001981014  GG23111  Drosophila erecta  Unigene9116  1,085  1.287  37.5  4.864  1.30E-119  1.01E-117  CBA11305  Odorant binding protein 1  Glossina morsitans morsitans  Unigene15628  344  1.015  27.721  4.771  1.01E-28  2.96E-27  XP_001354285  GA11646  D. pseudoobscura pseudoobscura  Unigene21342  205  0.852  23.259  4.771  6.55E-15  1.26E-13  XP_003698913  Uncharacterized protein LOC100865369  Apis florea  Unigene517  825  5.291  130.326  4.623  1.20E-304  1.82E-302  XP_002049652  GJ21709  Drosophila virilis  CL2953.Contig1  1,070  1.55  37.506  4.597  2.63E-114  1.96E-112  XP_002075316  GK17378  D. willistoni  CL657.Contig2  1,737  70.361  1475.108  4.39  0  0  ABK91492  CYP6G3  L. cuprina  Unigene1047  492  5.146  105.149  4.353  4.58E-142  3.89E-140  XP_002063233  GK21500  D. willistoni  CL2433.Contig2  905  0.772  14.488  4.231  2.16E-36  7.40E-35  XP_001972413  GG15517  D. Erecta  CL2386.Contig1  693  4.661  82.793  4.151  1.75E-152  1.58E-150  XP_001991143  GH12229  D. grimshawi  Unigene16852  427  0.613  10.05  4.034  2.45E-12  4.17E-11  XP_002041700  GM16611  D. sechellia  View Large Expression Profiling of Differentially Expressed Genes in Various Tissues The expression levels of some differentially expressed genes that were highly expressed in the female fat body (RPKM > 100) and annotated in NCBI nr database were validated by RT-qPCR. Six out of seven selected genes were highly expressed in the female fat body compared to the tested tissues (Fig. 2). The seventh gene, Unigene6570, had a maximum expression in the midgut, but also a significantly higher expression in the female fat body than the male fat body (t-test, P = 0.010). These results were consistent with the results of the DGE profiling study. Interestingly, Unigene3190, Unigene1031, Unigene1793, Unigene16294, Unigene3658, and Unigene9240 were highly expressed highly in the female fat body. The predominant expressions of three Vg genes were also validated by semi-quantitative RT-PCR. Fig. 2. View largeDownload slide The quantitative expression of female fat body highly expressed genes among various tissues. Relative gene expression in the midgut (MG), fat body (FB), Malpighian tubules (MT), ovary (OV), and testis (TE) from female and male B. dorsalis was determined by RT-qPCR. Relative expression levels were calculated based on the gene expression in female MG, which was ascribed an arbitrary value of 1. Different letters above the bars indicate significant differences based on LSD test (P < 0.05). The reference gene RPS3 was run with 27 cycles, while three vitellogenin genes 30 cycles in semi-quantitative work. Fig. 2. View largeDownload slide The quantitative expression of female fat body highly expressed genes among various tissues. Relative gene expression in the midgut (MG), fat body (FB), Malpighian tubules (MT), ovary (OV), and testis (TE) from female and male B. dorsalis was determined by RT-qPCR. Relative expression levels were calculated based on the gene expression in female MG, which was ascribed an arbitrary value of 1. Different letters above the bars indicate significant differences based on LSD test (P < 0.05). The reference gene RPS3 was run with 27 cycles, while three vitellogenin genes 30 cycles in semi-quantitative work. The expression levels of nine genes that were highly expressed in the male fat body were also validated by RT-qPCR. The results showed that all the tested genes were highly expressed in the male fat body compared to the female consistent with the DGE results (Fig. 3). Other such as Unigene2458, Unigene517, CL657, and Unigene1047 were expressed maximally in the male fat body compared to all tested tissues. Some other genes including CL554, Unigene2324, and Unigene3793 were most highly expressed in other tissues, such as Malpighian tubules and midgut. No significant difference was observed by multiple comparisons in ANOVA in the expression of CL554 and Unigene2324, but significant differences were observed by a t-test (P < 0.05). Interestingly, CL554, CL657, and Unigene1047 were specifically expressed in male flies, indicating their male-specific function. Fig. 3. View largeDownload slide The quantitative expression of male fat body highly expressed genes among various tissues. Relative gene expression was determined as described in Fig. 2. Fig. 3. View largeDownload slide The quantitative expression of male fat body highly expressed genes among various tissues. Relative gene expression was determined as described in Fig. 2. Sequence Analysis of Newly Identified BdVg3 In this study, three Vg homologous genes were identified: Unigene3190, Unigene1031, and Unigene9240. Unigene3190 and Unigene9240 are two Vg genes in B. dorsalis, which have been reported previously (Zuo and Chen 2014). A BlastP search in GenBank revealed that Unigene1031 was a newly identified Vg homologous gene in its amino acid sequence. Therefore, we cloned the full-length sequence using RT-PCR as described above. The ORF of the newly identified Vg contained 1,272 bp that encoded 423 amino acid residues. We named this sequence BdVg3. Structural analysis of the deduced protein revealed that the amino acid sequence contained a signal peptide with 21 amino acids. The calculated molecular weight and pI of BdVg3 were 45.86 kDa and 6.34, respectively. Moreover, the consensus polyserine cleavage site, RXXR, was present but at the C-terminus (Fig. 4A). A Blast search indicated that BdVg3 exhibited 57% amino acid identity with a Vg from Bactrocera tau and 54% identity with the Vg proteins from Calliphora vicina, Neobellieria bullata, and Lucilia cuprina. BdVg3 also shared 51% and 50% amino acid identity with D. melanogaster Vg3 and Vg2, respectively. This protein also showed similar amino acid identities with the two previously identified BdVg1 (57%) and BdVg2 (54%) proteins. To analyze the sequence homology and phylogenetic relationships of these Vg proteins, 19 insect Vgs were downloaded from GenBank, including 2 vitellogenins, BdVg1 and BdVg2. The constructed tree showed that BdVg3 was most closely related to vitellogenin from B. tau, while BdVg1 and BdVg2 clustered together with Vg from D. melanogaster and Drosophila busckii (Fig. 4B). Fig. 4. View largeDownload slide Nucleotide and deduced amino acid sequences of the newly identified BdVg3 (A) and the phylogenetic analysis of BdVg3 and Vg proteins from other insect species (B). The putative signal peptide is underlined. Putative RXXR cleavage site is shaded in green. The stop codon is indicated by asterisks. Putative polyadenylation signal (AATAAA) in the 3′-untranslated sequence is boxed and shaded in gray. The phylogenetic tree was generated by MEGA 5 using the neighbor joining method. Numbers above the branches indicate bootstrap support values from 1,000 replicates. GenBank accession numbers of all sequences are listed in the tree. Abbreviations: Bt, Bactrocera tau; Cv, Calliphora vicina; Dm, Drosophila melanogaster; Lc, Lucilia cuprina; Db, Drosophila busckii; Nb, Neobellieria bullata; Dv, Drosophila virilis. Fig. 4. View largeDownload slide Nucleotide and deduced amino acid sequences of the newly identified BdVg3 (A) and the phylogenetic analysis of BdVg3 and Vg proteins from other insect species (B). The putative signal peptide is underlined. Putative RXXR cleavage site is shaded in green. The stop codon is indicated by asterisks. Putative polyadenylation signal (AATAAA) in the 3′-untranslated sequence is boxed and shaded in gray. The phylogenetic tree was generated by MEGA 5 using the neighbor joining method. Numbers above the branches indicate bootstrap support values from 1,000 replicates. GenBank accession numbers of all sequences are listed in the tree. Abbreviations: Bt, Bactrocera tau; Cv, Calliphora vicina; Dm, Drosophila melanogaster; Lc, Lucilia cuprina; Db, Drosophila busckii; Nb, Neobellieria bullata; Dv, Drosophila virilis. Transcriptional Expression in Developmental Stages The newly identified BdVg3 was highly expressed in female B. dorsalis showing a stage-specific expression pattern (Fig. 5A). During the sexual-maturation of female adult, the expression of BdVg3 increased, especially during the vitellogenic stage and then decreased in mature females (Fig. 5B). Fig. 5. View largeDownload slide The expression of newly identified BdVg3 in different developmental stages (A), and sex-maturation period of female Bactrocera dorsalis (B). EG represents egg, LA-7 represents 7-d-old larvae, PU-5 represents 5-d-old pupae, VF-9 represents 9-d-old virgin female, VM-9 represents 9-d-old virgin male. Relative expression levels were calculated based on the value in EG and 0-d-old female, respectively, which were ascribed an arbitrary value of 1. Relative gene expressions were determined as described in Fig. 2. Fig. 5. View largeDownload slide The expression of newly identified BdVg3 in different developmental stages (A), and sex-maturation period of female Bactrocera dorsalis (B). EG represents egg, LA-7 represents 7-d-old larvae, PU-5 represents 5-d-old pupae, VF-9 represents 9-d-old virgin female, VM-9 represents 9-d-old virgin male. Relative expression levels were calculated based on the value in EG and 0-d-old female, respectively, which were ascribed an arbitrary value of 1. Relative gene expressions were determined as described in Fig. 2. Discussion It is well-known that the insect fat body contributes significantly to insect reproduction, as well as detoxification and immune response to infection. The fat body in insects plays several roles including synthesis of yolk protein precurors for oocyte maturation, and the storage and release of energy in response to changing physiological states. Differences in gene expression between female and male adults has been studied in B. dorsalis to identify the differentially expressed genes (Zuo and Chen 2014). Some detoxification enzymes, namely CYP, GST, NADH dehydrogenase, and cecropin, were identified in the male fat body. In this study, we identified 1,445 differentially expressed unigenes, and 79 of those were identified to be involved in the reproduction process and immune function including Vg, alcohol dehydrogenase-2, cytochrome P450, and 3-hydroxybutyrate dehydrogenase. In the present study, a new Vg gene was identified for the first time in B. dorsalis and was named BdVg3. The number of Vg genes varies in insect species with most insects having one Vg gene and others such as Dipterans, Hemipterans, and Dictyopterans having two or more (Tufail and Takeda 2008, Tufail et al. 2014). For instance, there are three Vg genes in A. aegypti (Tufail et al. 2014) and D. melanogaster (Isaac and Bownes 1982, Hutson and Bownes 2003) and Musca domestica (White and Bownes 1997). Previous studies reported the presence of two Vg genes in female B. dorsalis, Vg1, and Vg2 (Chen et al. 2012). Using high-throughput transcriptome sequencing, we identified a new Vg gene in the DGE profiles of sex-biased fat body from B. dorsalis. Similar to BdVg1 and BdVg2 proteins, the predicted molecular mass of BdVg3 was much smaller than that of other insects (Chen et al. 2012, Tufail et al. 2014). The similarity in the structure and molecular mass of all three BdVg proteins indicates similar secondary structures and roles involved in female fecundity (Chen et al. 1997). This new BdVg3 gene also showed a tissue-, sex- and stage- specific expression similar to BdVg1 and BdVg2 (Chen et al. 2012). The highest expression of the three BdVgs was observed in 5-d-old females, indicating the high nutritional needs and rapid egg development in the vitellogenic stage of female adult. This period is the beginning of the vitellogenesis process of the ovary development in B. dorsalis. Much Vg was synthesized and taken up into the ovary by the Vg receptor (VgR). In contrast, low expression of Vg was observed in male fat body and testis of B. dorsalis (Fig. 3). The expression of Vg gene in the male has also been investigated in D. melanogaster and Spodoptera littoralis (Bebas et al. 2008, Majewska et al. 2014). Vg protein appeared in the seminal fluid and formed an external coat on the S. littoralis spermatozoa, showing a function in male fertility (Bebas et al. 2008). It was also demonstrated that the function of Vg3 is quite different from Vg2 genes in D. melanogaster (Hutson and Bownes 2003). The function of BdVg3 and the relationship with previously identified Vg genes remain unknown and will be studied in the future. Female-specific transformer, doublesex, and male-specific doublesex, which are involved in the sex determination pathway, were also identified to be highly-expressed in the sex-biased fat body. These genes were previously reported in B. dorsalis (Liu et al. 2015, Peng et al. 2015), B. oleae (Lagos et al. 2007), Ceratitis capitata (Saccone et al. 2011), Drosophila (Salz and Erickson 2010, Arbeitman et al. 2016), and Culex pipiens (Price et al. 2015). More studies have shown that doublesex is expressed under a complex spatiotemporal regulation in the somatic gonad identification (Hempel and Oliver 2007), regulating female receptivity (Zhou et al. 2014) and specifying male courtship behavior (Dauwalder 2011). A recent study demonstrated that the sex differences in gene expression in Drosophila were regulated by the sex-specific doublesex (Arbeitman et al. 2016). The first identification of the transcriptional regulation by doublesex protein came from Vg genes thereby regulating their expression (Burtis et al. 1991). The homologous gene with a similar sex-biased expression in B. dorsalis may play a similar reproductive regulation in sex-determination. The response of fat body to stress in a sex- and time-dependent manner has been well-documented (Neckameyer and Matsuo 2008, Argue and Neckameyer 2014). We identified in this study 226 differentially expressed genes involved in detoxification and immune function, including cytochrome P450 (CYP6A5V2), antigen 5, sapecin, and defensin. P450 genes mostly have a detoxification function and are also involved in development, such as deltamethrin resistance (Zhu et al. 2010) and ecdysone synthesis (Cabrera et al. 2015). Male-specific expression of P450 genes has also been studied and reported in other insects, e.g., Blattella germanica (Wen and Scott 2001) although the function is not clear. In male Ips paraconfusus, the high expression of Cyp9T1 and Cyp9T2 is related to the feeding on host phloem, suggesting their function in the production of male-specific aggregation pheromone (Huber et al. 2007). In this study, we identified a P450 homologous gene CYP6G3 expressed in the male-specific fat body. Another P450 gene named CYP6G2 was also identified to have a male-bias in B. dorsalis, and it is presumed to function in making the insects susceptible to insecticide (Zuo and Chen 2014). Besides, some GSTs and acetylcholinesterases were also differentially expressed in the male fat body, indicating a higher resistance of male B. dorsalis to organophosphates. It has been demonstrated that some epsilon GST genes are expressed in sex-biased adult tissues (Lu et al. 2016). Antibacterial peptides are known to have a predominant expression in the insect fat body, the most important immune tissue. Recently, a newly identified defensin gene was found to be expressed in female B. dorsalis, possibly because of the high expression in the reproductive system, and they may play a role responding to peptidoglycan infection (Liu et al. 2017). Two defensin genes were also identified in the male accessory glands of B. dorsalis, and they showed a high expression in the fat body (Wei et al. 2016). Antigen 5 is a major allergen of venom in vespids, and homologous genes have been identified in other insects (Hawdon et al. 1996). In B. dorsalis, antigen 5 was first identified in male accessory glands (Tian et al. 2017), but the biological function is still unknown. Other genes such as alcohol dehydrogenase and sorbitol dehydrogenase involved in metabolic activities, NADH dehydrogenase 3, odorant binding protein, and lysozyme, were also found to be highly expressed in the male fat body in this study. In conclusion, the gene expression profiles differ in the sex-biased fat body of B. dorsalis and this may be significant to the different reproductive roles of the fat body in the two sexes of males and females. In this study, we evaluated the gene expression profiles of the fat body from female and male B. dorsalis by DGE profiling. While some genes were expressed in both sexes, others especially those involved in reproduction, detoxification and immune had a sex-biased expression. The analyses revealed the presence of a new vitellogenin gene in B. dorsalis. This is the first report of this BdVg3 gene, which has a tissue-, sex- and stage-specific expression pattern, indicating that it could play an important role in female reproduction. Acknowledgments This work was supported in part by the National Natural Science Foundation of China (31601640), Chongqing Research Program of Basic Research and Frontier Technology (CSTC2016jcyjA0019), the earmarked fund for the Modern Agro-industry (Citrus) Technology Research System, and the Foundation Project of Southwest University (SWU114049). References Cited Anand, A. N., and Lorenz M. W. 2008. Age-dependent changes of fat body stores and the regulation of fat body lipid synthesis and mobilisation by adipokinetic hormone in the last larval instar of the cricket, Gryllus bimaculatus. J. Insect Physiol . 54: 1404– 1412. Google Scholar CrossRef Search ADS PubMed  Arbeitman, M. N., New F. N., Fear J. M., Howard T. S., Dalton J. E., and Graze R. M. 2016. Sex differences in Drosophila somatic gene expression: variation and regulation by doublesex. G3-Genes Genom. Genet . 6: 1799– 1808. Argue, K. J., and Neckameyer W. S. 2014. Altering the sex determination pathway in Drosophila fat body modifies sex-specific stress responses. Am. J. Physiol. Regul. Integr. Comp. Physiol . 307: R82– R92. Google Scholar CrossRef Search ADS PubMed  Arrese, E. L., and Soulages J. L. 2010. Insect fat body: energy, metabolism, and regulation. Annu. Rev. Entomol . 55: 207– 225. Google Scholar CrossRef Search ADS PubMed  Attardo, G. M., Strickler-Dinglasan P., Perkin S. A. H., Caler E., Bonaldo M. F., Soares M. B., El-Sayeed N., and Aksoy S. 2006. Analysis of fat body transcriptome from the adult tsetse fly, Glossina morsitans morsitans. Insect Mol. Biol . 15: 411– 424. Google Scholar CrossRef Search ADS PubMed  Audic, S., and Claverie J. M. 1997. The significance of digital gene expression profiles. Genome Res . 7: 986– 995. Google Scholar CrossRef Search ADS PubMed  Bebas, P., Kotwica J., Joachimiak E., and Giebultowicz J. M. 2008. Yolk protein is expressed in the insect testis and interacts with sperm. BMC Dev. Biol . 8: 64. Google Scholar CrossRef Search ADS PubMed  Burtis, K. C., Coschigano K. T., Baker B. S., and Wensink P. C. 1991. The doublesex proteins of Drosophila melanogaster bind directly to a sex-specific yolk protein gene enhancer. EMBO J . 10: 2577. Google Scholar PubMed  Cabrera, A. R., Shirk P. D., Evans J. D., Hung K., Sims J., Alborn H., and Teal P. E. A. 2015. Three Halloween genes from the Varroa mite, Varroa destructor (Anderson & Trueman) and their expression during reproduction. Insect Mol. Biol . 24: 277– 292. Google Scholar CrossRef Search ADS PubMed  Chen, J. S., Sappington T. W., and Raikhel A. S. 1997. Extensive sequence conservation among insect, nematode, and vertebrate vitellogenins reveals ancient common ancestry. J. Mol. Evol . 44: 440– 451. Google Scholar CrossRef Search ADS PubMed  Chen, S. L., Lin C. P., and Lu K. H. 2012. cDNA isolation, expression, and hormonal regulation of yolk protein genes in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). J. Insect Physiol . 58: 763– 770. Google Scholar CrossRef Search ADS PubMed  Cheng, D. J., Xia Q. Y., Zhao P., Wang Z. L., Xu H. F., Li G. R., Lu C., and Xiang Z. H. 2006. EST-based profiling and comparison of gene expression in the silkworm fat body during metamorphosis. Arch. Insect Biochem. Physiol . 61: 10– 23. Google Scholar CrossRef Search ADS PubMed  Conesa, A., Götz S., García-Gómez J. M., Terol J., Talón M., and Robles M. 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics  21: 3674– 3676. Google Scholar CrossRef Search ADS PubMed  Dauwalder, B. 2011. The roles of fruitless and doublesex in the control of male courtship. Int. Rev. Neurobiol . 99: 87– 105. Google Scholar CrossRef Search ADS PubMed  Gu, Z. Y., Li F. C., Wang B. B., Xu K. Z., Ni M., Zhang H., Shen W. D., and Li B. 2015. Differentially expressed genes in the fat body of Bombyx mori in response to phoxim insecticide. Pest. Biochem. Physiol . 117: 47– 53. Google Scholar CrossRef Search ADS   Haunerland, N. H., and Shirk P. D. 1995. Regional and functional differentiation in the insect fat body. Annu. Rev. Entomol . 40: 121– 145. Google Scholar CrossRef Search ADS   Hawdon, J. M., Jones B. F., Hoffman D. R., and Hotez P. J. 1996. Cloning and characterization of Ancylostoma-secreted protein a novel protein associated with the transition to parasitism by infective hookworm larvae. J. Biol. Chem . 271: 6672– 6678. Google Scholar CrossRef Search ADS PubMed  Hempel, L. U., and Oliver B. 2007. Sex-specific DoublesexM expression in subsets of Drosophila somatic gonad cells. BMC Dev. Biol . 7: 113. Google Scholar CrossRef Search ADS PubMed  Huber, D. P. W., Erickson M. L., Leutenegger C. M., Bohlmann J., and Seybold S. J. 2007. Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa. Insect Mol. Biol . 16: 335– 349. Google Scholar CrossRef Search ADS PubMed  Hutson, S. F., and Bownes M. 2003. The regulation of yp3 expression in the Drosophila melanogaster fat body. Dev. Genes Evol . 213: 1– 8. Google Scholar PubMed  Isaac, P. G., and Bownes M. 1982. Ovarian and fat-body vitellogenin synthesis in Drosophila melanogaster. Eur. J. Biochem . 123: 527– 534. Google Scholar CrossRef Search ADS PubMed  Jiang, Z., Wu X. L., Michal J. J., and Mcnamara J. P. 2005. Pattern profiling and mapping of the fat body transcriptome in Drosophila melanogaster. Obes. Res . 13: 1898– 1904. Google Scholar CrossRef Search ADS PubMed  Lagos, D., Koukidou M., Savakis C., and Komitopoulou K. 2007. The transformer gene in Bactrocera oleae: the genetic switch that determines its sex fate. Insect Mol. Biol . 16: 221– 230. Google Scholar CrossRef Search ADS PubMed  Li, R., Yu C., Li Y., Lam T. W., Yiu S. M., Kristiansen K., and Wang J. 2009. SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics  25: 1966– 1967. Google Scholar CrossRef Search ADS PubMed  Liu, G., Wu Q., Li J., Zhang G., and Wan F. 2015. RNAi-mediated knock-down of transformer and transformer 2 to generate male-only progeny in the oriental fruit fly, Bactrocera dorsalis (Hendel). PLoS ONE  10: e0128892. Google Scholar CrossRef Search ADS PubMed  Liu, Z., Smagghe G., Lei Z., and Wang J. J. 2016. Identification of male- and female-specific olfaction genes in antennae of the oriental fruit fly (Bactrocera dorsalis). PLoS ONE  11: e0147783. Google Scholar CrossRef Search ADS PubMed  Liu, S. H., Wei D., Yuan G. R., Jiang H. B., Dou W., and Wang J. J. 2017. Antimicrobial peptide gene cecropin-2 and defensin respond to peptidoglycan infection in the female adult of oriental fruit fly, Bactrocera dorsalis (Hendel). Comp. Biochem. Physiol. B  206: 1– 7. Google Scholar CrossRef Search ADS   Livak, K. J., and Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△Ct method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Lu, X. P., Wang L. L., Huang Y., Dou W., Chen C. T., Wei D., and Wang J. J. 2016. The epsilon glutathione S-transferases contribute to the malathion resistance in the oriental fruit fly, Bactrocera dorsalis (Hendel). Comp. Biochem. Physiol. C  180: 40– 48. Majewska, M. M., Suszczynska A., Kotwica-Rolinska J., Czerwik T., Paterczyk B., Polanska M. A., Bernatowicz P., and Bebas P. 2014. Yolk proteins in the male reproductive system of the fruit fly Drosophila melanogaster: Spatial and temporal patterns of expression. Insect Biochem. Mol. Biol . 47: 23– 35. Google Scholar CrossRef Search ADS PubMed  Mirth, C. K., and Riddiford L. M. 2007. Size assessment and growth control: how adult size is determined in insects. Bioessays  29: 344– 355. Google Scholar CrossRef Search ADS PubMed  Mortazavi, A., Williams B. A., McCue K., Schaeffer L., and Wold B. 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods  5: 621– 628. Google Scholar CrossRef Search ADS PubMed  Neckameyer, W., and Matsuo H. 2008. Distinct neural circuits reflect sex, sexual maturity, and reproductive status in response to stress in Drosophila melanogaster. Neuroscience  156: 841– 856. Google Scholar CrossRef Search ADS PubMed  Peng, W., Zheng W., Handler A. M., and Zhang H. 2015. The role of the transformer gene in sex determination and reproduction in the tephritid fruit fly, Bactrocera dorsalis (Hendel). Genetica  143: 717– 727. Google Scholar CrossRef Search ADS PubMed  Petersen, T. N., Brunak S., von Heijne G., and Nielsen H. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods  8: 785– 786. Google Scholar CrossRef Search ADS PubMed  Price, D. C., Egizi A., and Fonseca D. M. 2015. Characterization of the doublesex gene within the Culex pipiens complex suggests regulatory plasticity at the base of the mosquito sex determination cascade. BMC Evol. Biol . 15: 108. Google Scholar CrossRef Search ADS PubMed  Price, D. P., Nagarajan V., Churbanov A., Houde P., Milligan B., Drake L. L., Gustafson J. E., and Hansen I. A. 2011. The fat body transcriptomes of the yellow fever mosquito Aedes aegypti, pre- and post- blood meal. PLoS ONE  6: e22573. Google Scholar CrossRef Search ADS PubMed  Saccone, G., Salvemini M., and Polito L. 2011. The transformer gene of Ceratitis capitata: a paradigm for a conserved epigenetic master regulator of sex determination in insects. Genetica  139: 99– 111. Google Scholar CrossRef Search ADS PubMed  Salz, H., and Erickson J. W. 2010. Sex determination in Drosophila: the view from the top. Fly  4: 60– 70. Google Scholar CrossRef Search ADS PubMed  Shen, G. M., Dou W., Niu J. Z., Jiang H. B., Yang W. J., Jia F. X., Hu F., Cong L., and Wang J. J. 2011. Transcriptome analysis of the oriental fruit fly (Bactrocera dorsalis). PLoS ONE  6: e29127. Google Scholar CrossRef Search ADS PubMed  Shen, G. M., Dou W., Huang Y., Jiang X. Z., Smagghe G., and Wang J. J. 2013. In silico cloning and annotation of genes involved in the digestion, detoxification and RNA interference mechanism in the midgut of Bactrocera dorsalis [Hendel (Diptera: Tephritidae)]. Insect Mol. Biol . 22: 354– 365. Google Scholar CrossRef Search ADS PubMed  Tamura, K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol . 28: 2731– 2739. Google Scholar CrossRef Search ADS PubMed  Tian, C. B., Wei D., Xiao L. F., Dou W., Liu H., and Wang J. J. 2017. Comparative transcriptome analysis of three Bactrocera dorsalis (Hendel) organs to identify functional genes in male accessory glands and ejaculatory duct. Fla. Entomol . 100: 42– 51. Google Scholar CrossRef Search ADS   Tufail, M., and Takeda M. 2008. Molecular characteristics of insect vitellogenins. J. Insect Physiol . 54: 1447– 1458. Google Scholar CrossRef Search ADS PubMed  Tufail, M., Nagaba Y., Elgendy A. M., and Takeda M. 2014. Regulation of vitellogenin genes in insects. Entomol. Sci . 17: 269– 282. Google Scholar CrossRef Search ADS   Wang, J. J., Wei D., Dou W., Hu F., Liu W. F., and Wang J. J. 2013. Toxicities and synergistic effects of several insecticides against the oriental fruit fly (Diptera: Tephritidae). J. Econ. Entomol . 106: 970– 978. Google Scholar CrossRef Search ADS PubMed  Wang, H., Fang Y., Wang L., Zhu W., Ji H., Wang H., Xu S., and Sima Y. 2014. Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes. Mol. Biol. Rep . 41: 6039– 6049. Google Scholar CrossRef Search ADS PubMed  Wei, D., Feng Y. C., Wei D. D., Yuan G. R., Dou W., and Wang J. J. 2015a. Female remating inhibition and fitness of Bactrocera dorsalis (Diptera: Tephritidae) associated with male accessory glands. Fla. Entomol . 98: 52– 58. Google Scholar CrossRef Search ADS   Wei, D., Li H. M., Yang W. J., Wei D. D., Dou W., Huang Y., and Wang J. J. 2015b. Transcriptome profiling of the testis reveals genes involved in spermatogenesis and marker discovery in the oriental fruit fly, Bactrocera dorsalis. Insect Mol. Biol . 24: 41– 57. Google Scholar CrossRef Search ADS   Wei, D., Tian C. B., Liu S. H., Wang T., Smagghe G., Jia F. X., Dou W., and Wang J. J. 2016. Transcriptome analysis to identify genes for peptides and proteins involved in immunity and reproduction from male accessory glands and ejaculatory duct of Bactrocera dorsalis. Peptides  80: 48– 60. Google Scholar CrossRef Search ADS PubMed  Wen, Z., and Scott J. G. 2001. Cytochrome P450 CYP6L1 is specifically expressed in the reproductive tissues of adult male German cockroaches, Blattella germanica (L.). Insect Biochem. Mol. Biol . 31: 179– 187. Google Scholar CrossRef Search ADS PubMed  White, N. M., and Bownes M. 1997. Cloning and characterization of three Musca domestica yolk protein genes. Insect Mol. Biol . 6: 329– 341. Google Scholar CrossRef Search ADS PubMed  Yang, W. J., Yuan G. R., Cong L., Xie Y. F., and Wang J. J. 2014. De novo cloning and annotation of genes associated with immunity, detoxification and energy metabolism from the fat body of the oriental fruit fly, Bactrocera dorsalis. PLoS ONE  9: e94470. Google Scholar CrossRef Search ADS PubMed  Ye, J., Fang L., Zheng H., Zhang Y., Chen J., Zhang Z., Wang J., Li S., Li R., and Bolund L. 2006. WEGO: a web tool for plotting GO annotations. Nucleic Acids Res . 34: W293– W297. Google Scholar CrossRef Search ADS PubMed  Yu, H., Ji R., Ye W., Chen H., Lai W., Fu Q., and Lou Y. 2013. Transcriptome analysis of fat bodies from two brown planthopper (Nilaparvata lugens) populations with different virulence levels in rice. PLoS ONE  9: e88528. Google Scholar CrossRef Search ADS   Zhou, C., Pan Y. F., Robinett C. C., Meissner G. W., and Baker B. S. 2014. Central brain neurons expressing doublesex regulate female receptivity in Drosophila. Neuron  83: 149– 163. Google Scholar CrossRef Search ADS PubMed  Zhu, F., Parthasarathy R., Bai H., Woithe K., Kaussmann M., Nauen R., Harrison D. A., and Palli S. R. 2010. A brain-specific cytochrome P450 responsible for the majority of deltamethrin resistance in the QTC279 strain of Tribolium castaneum. P. Natl. Acad. Sci. USA  107: 8557– 8562. Google Scholar CrossRef Search ADS   Ziegler, R., and Antwerpen R. V. 2006. Lipid uptake by insect oocytes. Insect Biochem. Mol. Biol . 36: 264– 272. Google Scholar CrossRef Search ADS PubMed  Zuo, Y. H., and Chen M. E. 2014. Differential gene expression in male and female fat body in the oriental fruit fly, Bactrocera dorsalis. Arch. Insect Biochem. Physiol . 85: 48– 59. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of the Entomological Society of America Oxford University Press

Comparative Analysis of Differential Gene Expression Profiling of Sex-Bias Fat Body of Bactrocera dorsalis (Diptera: Tephritidae) Identifying a New Vitellogenin Gene

Loading next page...
 
/lp/ou_press/comparative-analysis-of-differential-gene-expression-profiling-of-sex-nJ5DZLUMXD
Publisher
Entomological Society of America
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
ISSN
0013-8746
eISSN
1938-2901
D.O.I.
10.1093/aesa/sax062
Publisher site
See Article on Publisher Site

Abstract

Abstract The gene expression patterns between female and male fat bodies differ significantly and may be crucial for their different reproductive roles in dioecious insects. In this study, we used digital gene expression profiling to construct the gene expression profiles of the fat body of male and female adults of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), which is one of the most important agricultural pests worldwide. In total, 452 and 993 unigenes were highly expressed in the female and male fat bodies, respectively. Functional analysis showed 179 sequences assigned to reproduction, 181 sequences responding to stimuli, and 45 involved in immune functions. The expression of a selection of differentially expressed genes was validated by reverse transcription quantitative polymerase chain reaction. We found that the expression patterns of all tested genes were consistent with the digital gene expression profiles. In addition, three vitellogenin (Vg) genes in the female fat body were identified. Interestingly, one among these was a new Vg (Unigene1031) that has not been previously reported in B. dorsalis. We named this BdVg3, with accession number of KY305182 in NCBI GenBank database. Sequence analysis of BdVg3 showed that the deduced amino acid sequence of BdVg3 was highly similar to Vg from Bactrocera tau and Vg3 from Drosophila melanogaster. The high expression of all three BdVg genes specifically in the female fat body indicates their critical role in female reproduction. The insect fat body is a relatively large organ distributed throughout the body, mostly underneath the integument and surrounding the gut and reproductive organs. It plays an essential role in energy storage and utilization. Nutrient reserves accumulated in the fat body modulate several important aspects of an insect’s life such as the rate of growth, timing of metamorphosis, and egg development (Mirth and Riddiford 2007). The fat body also has biosynthetic and metabolic activity and is involved in various physiological and biological processes, including detoxification, immunity, and developmental and reproductive regulation (Arrese and Soulages 2010). The insect fat body can store and release energy in response to a changing physiological status, and can coordinate insect growth with metamorphosis or reproduction by storing or releasing proteins related to these events. Functional proteins, such as storage proteins used as an amino acid reservoir for morphogenesis, lipophorins responsible for lipid transport in circulation, or vitellogenins for egg maturation, are synthesized by the fat body. For instance, the synthesis of vitellogenin in the fat body of Aedes aegypti females is transcriptionally upregulated after a bloodmeal. Previous studies on Drosophila melanogaster (Jiang et al. 2005) and Bombyx mori (Cheng et al. 2006) revealed the multiple functions of the fat body with various transcriptome patterns during different developmental stages. Although some functions are ubiquitous to the entire fat body, others are predominantly localized in certain regions (Haunerland and Shirk 1995). The role of the fat body changes during different life stages, and the cytological appearance of the fat body may be drastically altered (Anand and Lorenz 2008). In adult females, the majority of lipids accumulated in the oocytes originate from the fat body and are transported to the ovaries (Ziegler and Antwerpen 2006). A number of studies have used various tools to decipher gene expression profiles and function of vital genes involved in fat body-related functions (Attardo et al. 2006, Price et al. 2011). Digital gene expression (DGE) profiling is a powerful tool to investigate the complex mechanism of gene and protein function (Audic and Claverie 1997). For example, the sex bias in the responses of Bo. mori fat body to high temperature was determined by DGE (Wang et al. 2014). Moreover, comparative transcriptome analysis was used to investigate differences of Nilaparvata lugens fat body against rice resistance (Yu et al. 2013) and to analyze the response mechanism of Bo. mori to the insecticide phoxim (Gu et al. 2015). The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is an important agricultural pest worldwide (Wei et al. 2015a) and has the ability to infest more than 250 host plant species, including fruits and vegetables (Wang et al. 2013). Previous studies have reported the gene expression profiles of four developmental stages of B. dorsalis by DGE (Shen et al. 2011). Moreover, the transcriptomes of different tissues, including the fat body, midgut, testis, ovary, male accessory gland, and antennae from B. dorsalis, have also been reported (Shen et al. 2013; Yang et al. 2014; Wei et al. 2015b, 2016; Liu et al. 2016). These and other studies provide the necessary genomic information to further investigate the multiple functions of genes in the B. dorsalis fat body. However, differences in gene expression in the fat body relative to sex remain unclear, although some genes, including cytochrome P450, glutathione S-transferase (GST) and cecropin, have been shown to exhibit a male-bias profile (Zuo and Chen 2014). Therefore, in this study, we constructed transcriptome libraries from the fat body of male and female B. dorsalis and sequenced them by DGE profiling. Many differentially expressed genes were identified, and these were involved in energy and detoxification, immune function, and reproduction. Subsequently, tissue-specific expression profiles were validated by reverse real-time quantitative polymerase chain reaction (qPCR). Finally, a new reproductive protein named vitellogenin 3 (Bd Vg3) was identified for the first time in B. dorsalis. Materials and Methods Insects and RNA Extraction The insects for this study were collected as pupae from citrus orchards in Hainan province of China in 2008, and maintained in the laboratory. Larvae and adults were reared on artificial diet as described previously (Wang et al. 2013). Adults were held in 40 × 30 × 30 cm stock cages enclosed with a fine synthetic mesh. All cages were kept under constant conditions: 27.5 ± 0.5°C, 75 ± 5% RH, and 14:10 (L:D) h. Food was supplied ad libitum by inserting a glass vial containing adult diet into absorbent cotton. Food vials were replaced daily (Wei et al. 2015a). Newly emerged adults were separated by sex and transferred to separate cages. Fat bodies were dissected from 5-d-old male and female virgin flies (n = 50 flies/sex) and immersed in RNAstore reagent (Tiangen, Beijing, China). The samples were powdered in liquid nitrogen and total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. The concentration and purity of extracted RNA were measured using a NanoVue UV-Vis spectrophotometer (GE Healthcare Bio-Science, Uppsala, Sweden), and the integrity of RNA was confirmed by separating on a 1% agarose gel by electrophoresis. Construction of the cDNA Libraries and Sequencing The total RNA samples were treated with DNase I (Promega, Madison, WI) to eliminate DNA contamination followed by mRNA purification with magnetic beads. The mRNA was enriched with oligo(dT) magnetic beads (for eukaryotes) and mixed with fragmentation buffer to cut the mRNA into 200 bp fragments. First strand cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Rockford, IL). Double stranded cDNA was purified with magnetic beads, end repaired and ligated to adaptors. Ligated products were selected and purified on Tris-acetate-EDTA-agarose gels. Finally, fragments were enriched by PCR amplification, purified with magnetic beads and dissolved in the appropriate amount of elution buffer. An Agilent 2100 Bioanaylzer was used to quantify the sample library and validate integrity. The library was sequenced on the Ion Proton platform by the Beijing Genomics Institute (BGI, Shenzhen, China). Analysis of the Differentially Expressed Genes The original image data produced by the sequencer was transformed into sequences by a base calling program of real-time analysis (Illumina, San Diego, CA). Data cleaning (or data filtering) was performed to obtain ‘clean reads’ for further analysis. We created a reference gene set by assembling all previously reported B. dorsalis transcriptome raw data available into a NCBI Sequence Read Archive; this included libraries from four developmental stages, egg, larva, pupa and adult (Shen et al. 2011), and tissues of fat body, midgut, testis, male accessory gland, male antennae and female antennae (Shen et al. 2013, Yang et al. 2014, Wei et al. 2015b, Liu et al. 2016, Wei et al. 2016). Re-assembly and annotation was performed as described previously (Wei et al. 2015b), and resulting unigenes were used as the reference gene dataset. Clean reads from the DGE profiling in this study were mapped to the reference sequences using the SOAP aligner tool SOAP2 (Li et al. 2009) with no more than two base mismatches allowed in each alignment. Gene expression levels were calculated with the RPKM method (Reads Per kb per Million reads) (Mortazavi et al. 2008). If there was more than one transcript for a given gene, the longest was used to calculate the expression level and coverage. To identify differentially expressed genes between two samples, the false discovery rate (FDR) was used to determine the threshold of P-value in multiple tests (Audic and Claverie 1997). We used FDR ≤ 0.001 and the absolute value of log2Ratio ≥ 1 as the threshold to judge the significance in gene expression differences. These transcripts were further annotated by Gene Orthology (GO) function analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Gene Ontology Enrichment Analysis of Differentially Expressed Genes Transcripts were mapped to the reference data set by a blast search (E-value ≤ 10−5). Those with suitable matches were used to obtain GO annotation using the Blast2GO program (Conesa et al. 2005). The WEGO software was used to analyze the GO functional classification of differentially expressed transcripts in order to understand the distribution of the genes (Ye et al. 2006). KEGG pathways enrichment analysis identified the pathways represented by these transcripts, to identify significantly enriched metabolic pathways or signal transduction pathways. Reverse Transcription Quantitative PCR Analysis To validate the male/female fat body-specific gene expression, fat body, midgut, Malpighian tubules as well as ovary and testis were dissected from 5-d-old adult male and female (20 flies/sample) B. dorsalis. After isolating total RNA as described above, DNA was digested with RQ1 DNase (Promega). Then, RNA (1 μg/sample) was reverse transcribed into first-strand cDNA using PrimeScript RT reagent Kit (TaKaRa, Dalian, China). Reverse transcription quantitative PCR (RT-qPCR) reactions were performed in a 10 μl reaction volume including 5 μl of GoTaq qPCR Master Mix (Promega), 3.5 μl of nuclease-free water, 0.5 μl of template cDNA, and 0.5 μl of each primer (10 μM). Reactions were performed on a StepOne Plus Real-Time PCR System (Life Technologies, Woodlands, Singapore) under the following conditions: 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. The melting curve was recorded at the end of the procedure from 60 to 95°C to ensure the specificity of each primer pair. Sequences of the primers used in these reactions are listed in Table 1. For reference purposes, a fragment of the B. dorsalis ribosomal protein subunit 3 open reading frame (ORF) was also amplified (Wei et al. 2015b). Three biological replicates of insects from the same colony were performed for each tissue. Relative gene expression levels were calculated using 2−ΔΔCt (Livak and Schmittgen 2001). Data were analyzed with one-way analysis of variance (ANOVA) for tissue sample comparisons with SPSS 19.0 software (IBM, Chicago, IL) and a value of P < 0.05 was considered to be statistically significant. After RT-qPCR determination, semi-quantitative reverse transcription PCR (RT-PCR) was performed to validate the expression of three Vg genes in 25 μl reaction volume. Briefly, the reactions were performed in a 25 μl reaction volume with 15.25 μl of distilled water, 2.5 μl of 10 × PCR buffer (Mg+ free), 2.0 μl of MgCl2 (25 mM), 2.0 μl of dNTP (2.5 mM), 1 μl of cDNA, 1 μl of each primer (10 μM), and 0.25 μl of rTaq polymerase (2.5 U/μl) (Takara). PCR was carried out as follows: 95°C of initial denaturation for 3 min; followed by 27 or 30 cycles of 95°C for 30 s, 56°C of 30 s, and 72°C for 40 s; and 72°C of final extension for 10 min. Products were checked on a 2% agarose gel with GoldView II staining (Solarbio, Shanghai, China). Table 1. Oligonucleotide primers used for real-time quantitative PCR and full-length confirmation Genes  Forward primer (5’→3’)  Reverse primer (5'→3')  RT-qPCR  RPS3  TAAGTTGACCGGAGGTTTGG  TGGATCACCAGAGTGGATCA  Unigene3190  GGAAGAACCCCAAACCCACA  GCACCAACACCTTGTCCAAC  Unigene1031  CCCAGTCCCAGCGATATTCC  ACTTGTCCGTTGTAGGCCTG  Unigene1793  ATTTGGCTCAGGTGGTCGAG  AAGTGGGTTGCCAGTAGACG  Unigene16294  TCTGTGGGGCATTGAAACGA  GCAAAACGACGTAGCCAAGG  Unigene6570  TTGCCCGTGTCCTCTTCTTC  CTTCGGCAACTTCCTCAGGT  Unigene3658  GCTTGGCCAACGAACGAAAT  TCTTCCTTATCATCGGCGGC  Unigene9240  TGGTCGTCAATACAAGCGCT  CATAGCTGCCTCGACGACAT  CL554  CCTCAGGTTTGCGTGCTAAC  CCGGCGATGGACCACTATAT  CL2324  CCGTCATCCAAGTTTGCTGT  GTGGTGGTGTGGAGAGTGTA  Unigene2458  GACGCAAACATTTTCTGCCG  GACCCATGACACGTTTGGTC  Unigene3793  TGGCGTTCGATGAGTTTCCT  TCTGTTTGTGCCCAGTCCAT  CL167  AATGCAAAAGCGTCACCCAC  TGCCTTCAACCACACTTTGC  CL213  AATCTCGTTGGGCAGCATGA  TTTTCCGTGCTCATTGTGGC  Unigene517  CGCGCCTTCCAAGAACAATT  AACCGCCGATTTCAGTTTGC  CL657  TGTTCACCGCTACATTCCGT  TTACGCGTTGCTTTGCTCTC  Unigene1047  ATAAGACGCTGGGCACATGA  GCAAAATGGAAAGAGGGCGT  Full-length confirmation  Unigene1031  CATGAGTCCTTTAAGTATTTTTTGT  TTAGTTGTTCGAAGAGGAGC  Genes  Forward primer (5’→3’)  Reverse primer (5'→3')  RT-qPCR  RPS3  TAAGTTGACCGGAGGTTTGG  TGGATCACCAGAGTGGATCA  Unigene3190  GGAAGAACCCCAAACCCACA  GCACCAACACCTTGTCCAAC  Unigene1031  CCCAGTCCCAGCGATATTCC  ACTTGTCCGTTGTAGGCCTG  Unigene1793  ATTTGGCTCAGGTGGTCGAG  AAGTGGGTTGCCAGTAGACG  Unigene16294  TCTGTGGGGCATTGAAACGA  GCAAAACGACGTAGCCAAGG  Unigene6570  TTGCCCGTGTCCTCTTCTTC  CTTCGGCAACTTCCTCAGGT  Unigene3658  GCTTGGCCAACGAACGAAAT  TCTTCCTTATCATCGGCGGC  Unigene9240  TGGTCGTCAATACAAGCGCT  CATAGCTGCCTCGACGACAT  CL554  CCTCAGGTTTGCGTGCTAAC  CCGGCGATGGACCACTATAT  CL2324  CCGTCATCCAAGTTTGCTGT  GTGGTGGTGTGGAGAGTGTA  Unigene2458  GACGCAAACATTTTCTGCCG  GACCCATGACACGTTTGGTC  Unigene3793  TGGCGTTCGATGAGTTTCCT  TCTGTTTGTGCCCAGTCCAT  CL167  AATGCAAAAGCGTCACCCAC  TGCCTTCAACCACACTTTGC  CL213  AATCTCGTTGGGCAGCATGA  TTTTCCGTGCTCATTGTGGC  Unigene517  CGCGCCTTCCAAGAACAATT  AACCGCCGATTTCAGTTTGC  CL657  TGTTCACCGCTACATTCCGT  TTACGCGTTGCTTTGCTCTC  Unigene1047  ATAAGACGCTGGGCACATGA  GCAAAATGGAAAGAGGGCGT  Full-length confirmation  Unigene1031  CATGAGTCCTTTAAGTATTTTTTGT  TTAGTTGTTCGAAGAGGAGC  View Large Sequence Analysis and Phylogenetic Tree Construction ORF sequence of the newly identified BdVg3 gene was identified with ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and the complete ORF was confirmed by amplifying the genes from the female fat body by RT-PCR using gene-specific primers (Table 1). The PCR conditions and procedures were the same as the above mentioned semi-quantitative RT-PCR but with 35 cycles. Following purification by agarose gel electrophoresis and gel extraction (TaKaRa), amplified products were cloned into the pGEM-T Easy Vector (Promega) and transformed into Escherichia coli DH5α (Vazyme, Nanjing, China). Transformants were screened on Luria-Bertani (LB) agar plates containing 100 μg/ml ampicillin. Plasmids extracted from positive clones were sequenced by Invitrogen. SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP) was used to predict the signal peptide from the deduced amino acids sequence (Petersen et al. 2011). Compute pI/Mw (http://web.expasy.org/compute_pi/) from the Swiss Institute of Bioinformatics was used to estimate the isoelectric point (pI) and molecular weight of the deduced amino acid sequences. Homologous proteins were downloaded from the nonredundant protein sequences (nr) in NCBI using Blastp (http://www.ncbi.nlm.nih.gov). A phylogenetic tree was constructed by MEGA 5 using the neighbor joining (NJ) method (Tamura et al. 2011). Branch support was estimated by bootstrap analysis with 1,000 replicates. Transcriptional Expression Relative to Developmental Stage and Sex The expression of BdVg3 among developmental stages was determined by qRT-PCR as above. Briefly, egg, 7-d-old larva, 7-d-old pupa, 9-d-old virgin female adult and 9-d-old virgin male adult were collected for total RNA isolation and first-strand cDNA. Newly emerged female (0-d-old), and 1- to 10-d-old virgin female were also sampled for qRT-PCR. Results Sequence Assembly and Analysis Re-assembly of seven previously published transcriptome datasets produced 36,243 unigenes with a mean length of 919 bp, which was used as the reference for DGE profiling. In this study, In total 13,740,836 and 15,702,303 reads were obtained from female and male fat bodies, respectively. Of these, we mapped 98.59% and 98.05% clean reads to the reference sequences, respectively. Unmapped reads were not retained for analysis. Mapped reads were assembled into 19,527 and 20,651 unigenes in the female and male fat body samples, respectively. From these, we identified 22,247 unigenes in total and 452 were highly expressed in the female fat body and 993 were highly expressed in the male fat body. In this study, there were 983, 668, and 681 transcripts that were differentially expressed between tissues, and these were annotated in NCBI nr, KEGG, and GO databases, respectively. Functional Annotation The GO category covers 3 domains: cellular component, molecular function and biological process. In our analysis, 410 unigenes were assigned to the cellular component with 15 GO terms, while 544 unigenes were classified to 13 GO terms of the molecular function domain. In the biological process domain, 482 unigenes were assigned to 22 GO terms (Fig. 1). In the biological process category, the predominant groups were associated with ‘cellular process,’ ‘metabolic process,’ and ‘single-organism process,’ which contained more than 300 differentially expressed transcripts. More important is the association of 181 transcripts in the ‘response to stimulus’ and 45 transcripts in the ‘immune system process’ that were expressed differentially between the sex-biased fat body. Particularly, 101 and 78 transcripts were assigned to ‘reproduction’ and ‘reproductive process’ categories, respectively. Regarding the molecular function classification, the main groups were involved in ‘catalytic activity’ and ‘binding.’ Among these, 667 of the annotated genes were annotated to the KEGG pathways with 241 and 426 transcripts highly expressed in the female and male fat body, respectively. The most predominant group was associated with the metabolic pathway. Fig. 1. View largeDownload slide Gene Ontology (GO) classification of unigenes differentially expressed in female and male fat body from B. dorsalis. The green bars represent the molecular function category, the purple bars represent cell component category, and the blue bars represent biological process category. Fig. 1. View largeDownload slide Gene Ontology (GO) classification of unigenes differentially expressed in female and male fat body from B. dorsalis. The green bars represent the molecular function category, the purple bars represent cell component category, and the blue bars represent biological process category. Protein Prediction of Differentially Expressed Genes Some of the differentially expressed transcripts from this study were not annotated in NCBI nr database. Only 363 transcripts in the female fat body and 620 transcripts in male fat body were functionally annotated; these included genes involved in detoxification, development, and immune function. Genes, such as vitellogenin, transformer, and doublesex involved in female reproduction showed a different expression in female fat body. Other genes such as alcohol dehydrogenase, cytochrome P450, defensin, 3-hydroxybutyrate dehydrogenase genes involved in immune and stimuli, were also differentially expressed in fat body. The genes that were highly differentially expressed in each tissue with a log2Ratio ≥ 4 and a RPKM value ≥ 100 are listed in Tables 2 and 3. Table 2. Annotation information of genes highly expressed in the female fat body Gene ID  Length  F-RPKM  M-RPKM  log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  Unigene17585  454  41.534  0.001  −15.342  2.79E-70  1.54E-68  BAA78500  Serine repeat antigen  Plasmodium falciparum  CL3089.Contig2  761  36.594  0.001  −15.159  1.94E-103  1.35E-101  XP_002057902  GJ18385  Drosophila virilis  Unigene16130  479  33.352  0.001  −15.025  1.17E-59  5.83E-58  EJY57929  AAEL011612-PB  Aedes aegypti  Unigene16891  218  30.434  0.001  −14.893  3.26E-25  8.97E-24  XP_001958842  GF12587  Drosophila ananassae  Unigene14291  267  27.791  0.001  −14.762  4.13E-28  1.20E-26  XP_002138762  GA24979  Drosophila pseudoobscura pseudoobscura  Unigene17198  237  10.682  0.001  −13.383  4.40E-10  6.46E-09  AAK53386  Reverse transcriptase-like polymerase  Drosophila melanogaster  Unigene3190  1372  50569.813  12.221  −12.015  0  0  AAM00372  Vitellogenin 1 precursor  Bactrocera dorsalis  Unigene1031  1697  13097.899  4.964  −11.366  0  0  P27587  Vitellogenin-2  Ceratitis capitata  Unigene1793  1068  4369.872  5.804  −9.556  0  0  CAD32739  Alcohol dehydrogenase-2  B. dorsalis  Unigene13873  382  61.017  0.208  −8.196  1.50E-84  9.38E-83  XP_001988793  GH11353  Drosophila grimshawi  Unigene16294  963  212.488  0.825  −8.008  0  0  XP_002064614  GK23731  Drosophila willistoni  Unigene16293  603  173.727  1.318  −7.042  0  0  AFH54206  Cytochrome P450  B. dorsalis  Unigene15983  251  41.388  0.317  −7.03  2.99E-37  1.04E-35  XP_002080590  GD10169  Drosophila simulans  Unigene20852  958  31.62  0.249  −6.989  1.94E-106  1.38E-104  AAC39131  Midgut-specific serine protease 2  Stomoxys calcitrans  Unigene6570  445  443.943  3.75  −6.887  0  0  XP_002736707  Protein kinase-like  Saccoglossus kowalevskii  Unigene3658  1366  6166.376  74.93  −6.363  0  0  XP_001991936  GH24487  D. grimshawi  Unigene16403  583  11.081  0.273  −5.345  1.18E-21  2.88E-20  AAC28744  Envelope-like protein  C. capitata  Unigene15554  292  24.515  0.816  −4.908  5.79E-23  1.48E-21  XP_002049732  GJ20591  D. virilis  Unigene1694  484  28.137  1.314  −4.421  3.90E-40  1.44E-38  AFN61300  Defensin 1  Lutzomyia longipalpis  Unigene9240  1533  16020.299  977.815  −4.034  0  0  AAM00373  Vitellogenin 2 precursor  B. dorsalis  Gene ID  Length  F-RPKM  M-RPKM  log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  Unigene17585  454  41.534  0.001  −15.342  2.79E-70  1.54E-68  BAA78500  Serine repeat antigen  Plasmodium falciparum  CL3089.Contig2  761  36.594  0.001  −15.159  1.94E-103  1.35E-101  XP_002057902  GJ18385  Drosophila virilis  Unigene16130  479  33.352  0.001  −15.025  1.17E-59  5.83E-58  EJY57929  AAEL011612-PB  Aedes aegypti  Unigene16891  218  30.434  0.001  −14.893  3.26E-25  8.97E-24  XP_001958842  GF12587  Drosophila ananassae  Unigene14291  267  27.791  0.001  −14.762  4.13E-28  1.20E-26  XP_002138762  GA24979  Drosophila pseudoobscura pseudoobscura  Unigene17198  237  10.682  0.001  −13.383  4.40E-10  6.46E-09  AAK53386  Reverse transcriptase-like polymerase  Drosophila melanogaster  Unigene3190  1372  50569.813  12.221  −12.015  0  0  AAM00372  Vitellogenin 1 precursor  Bactrocera dorsalis  Unigene1031  1697  13097.899  4.964  −11.366  0  0  P27587  Vitellogenin-2  Ceratitis capitata  Unigene1793  1068  4369.872  5.804  −9.556  0  0  CAD32739  Alcohol dehydrogenase-2  B. dorsalis  Unigene13873  382  61.017  0.208  −8.196  1.50E-84  9.38E-83  XP_001988793  GH11353  Drosophila grimshawi  Unigene16294  963  212.488  0.825  −8.008  0  0  XP_002064614  GK23731  Drosophila willistoni  Unigene16293  603  173.727  1.318  −7.042  0  0  AFH54206  Cytochrome P450  B. dorsalis  Unigene15983  251  41.388  0.317  −7.03  2.99E-37  1.04E-35  XP_002080590  GD10169  Drosophila simulans  Unigene20852  958  31.62  0.249  −6.989  1.94E-106  1.38E-104  AAC39131  Midgut-specific serine protease 2  Stomoxys calcitrans  Unigene6570  445  443.943  3.75  −6.887  0  0  XP_002736707  Protein kinase-like  Saccoglossus kowalevskii  Unigene3658  1366  6166.376  74.93  −6.363  0  0  XP_001991936  GH24487  D. grimshawi  Unigene16403  583  11.081  0.273  −5.345  1.18E-21  2.88E-20  AAC28744  Envelope-like protein  C. capitata  Unigene15554  292  24.515  0.816  −4.908  5.79E-23  1.48E-21  XP_002049732  GJ20591  D. virilis  Unigene1694  484  28.137  1.314  −4.421  3.90E-40  1.44E-38  AFN61300  Defensin 1  Lutzomyia longipalpis  Unigene9240  1533  16020.299  977.815  −4.034  0  0  AAM00373  Vitellogenin 2 precursor  B. dorsalis  View Large Table 3. Annotation information of genes highly expressed in the male fat body Gene ID  Length  F-RPKM  M-RPKM  Log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  CL1321.Contig1  463  0.001  33.812  15.045  4.39E-56  2.11E-54  YP_961388  NADH dehydrogenase subunit 3  Bactrocera dorsalis  Unigene16586  221  0.001  10.428  13.348  7.38E-09  9.89E-08  XP_001866338  conserved hypothetical protein  Culex quinquefasciatus  Unigene15170  314  0.001  10.123  13.305  5.97E-12  9.90E-11  XP_002076610  GD15108  Drosophila simulans  Unigene15162  365  0.478  85.346  7.479  1.20E-106  8.55E-105  ABK91492  CYP6G3  Lucilia cuprina  CL554.Contig3  786  0.666  103.833  7.284  4.20E-276  6.06E-274  XP_001863343  3-hydroxybutyrate dehydrogenase  Cu. quinquefasciatus  CL2324.Contig1  351  0.995  112.748  6.824  1.47E-132  1.18E-130  XP_001991414  GH12070  Drosophila grimshawi  Unigene15893  346  0.252  22.738  6.494  7.55E-27  2.15E-25  XP_002131325  uncharacterized protein LOC100180114  Ciona intestinalis  Unigene11181  459  0.19  14.543  6.257  1.06E-22  2.69E-21  XP_004208375  histone-lysine N-methyltransferase SETMAR-like  Hydra magnipapillata  Unigene2458  1,864  3.606  246.758  6.096  0  0  XP_001357727  GA20850  Drosophila pseudoobscura pseudoobscura  Unigene626  572  0.458  25.702  5.811  1.27E-47  5.37E-46  XP_002038357  GM10785  Drosophila sechellia  Unigene7053  750  0.815  43.654  5.744  3.97E-104  2.80E-102  XP_002073279  GK13242  Drosophila willistoni  Unigene3793  2,250  2.677  133.929  5.645  0  0  XP_002000822  GI22314  Drosophila mojavensis  CL167.Contig2  1,869  19.431  795.82  5.356  0  0  XP_002002750  GI11244  D. mojavensis  CL167.Contig3  1,615  9.297  340.159  5.193  0  0  XP_002002750  GI11244  D. mojavensis  CL213.Contig3  1,366  6.71  226.999  5.08  0  0  XP_001981014  GG23111  Drosophila erecta  Unigene9116  1,085  1.287  37.5  4.864  1.30E-119  1.01E-117  CBA11305  Odorant binding protein 1  Glossina morsitans morsitans  Unigene15628  344  1.015  27.721  4.771  1.01E-28  2.96E-27  XP_001354285  GA11646  D. pseudoobscura pseudoobscura  Unigene21342  205  0.852  23.259  4.771  6.55E-15  1.26E-13  XP_003698913  Uncharacterized protein LOC100865369  Apis florea  Unigene517  825  5.291  130.326  4.623  1.20E-304  1.82E-302  XP_002049652  GJ21709  Drosophila virilis  CL2953.Contig1  1,070  1.55  37.506  4.597  2.63E-114  1.96E-112  XP_002075316  GK17378  D. willistoni  CL657.Contig2  1,737  70.361  1475.108  4.39  0  0  ABK91492  CYP6G3  L. cuprina  Unigene1047  492  5.146  105.149  4.353  4.58E-142  3.89E-140  XP_002063233  GK21500  D. willistoni  CL2433.Contig2  905  0.772  14.488  4.231  2.16E-36  7.40E-35  XP_001972413  GG15517  D. Erecta  CL2386.Contig1  693  4.661  82.793  4.151  1.75E-152  1.58E-150  XP_001991143  GH12229  D. grimshawi  Unigene16852  427  0.613  10.05  4.034  2.45E-12  4.17E-11  XP_002041700  GM16611  D. sechellia  Gene ID  Length  F-RPKM  M-RPKM  Log2Ratio (FBM/FBF)  P-value  FDR  Accession number  Blast nr  Homologous species  CL1321.Contig1  463  0.001  33.812  15.045  4.39E-56  2.11E-54  YP_961388  NADH dehydrogenase subunit 3  Bactrocera dorsalis  Unigene16586  221  0.001  10.428  13.348  7.38E-09  9.89E-08  XP_001866338  conserved hypothetical protein  Culex quinquefasciatus  Unigene15170  314  0.001  10.123  13.305  5.97E-12  9.90E-11  XP_002076610  GD15108  Drosophila simulans  Unigene15162  365  0.478  85.346  7.479  1.20E-106  8.55E-105  ABK91492  CYP6G3  Lucilia cuprina  CL554.Contig3  786  0.666  103.833  7.284  4.20E-276  6.06E-274  XP_001863343  3-hydroxybutyrate dehydrogenase  Cu. quinquefasciatus  CL2324.Contig1  351  0.995  112.748  6.824  1.47E-132  1.18E-130  XP_001991414  GH12070  Drosophila grimshawi  Unigene15893  346  0.252  22.738  6.494  7.55E-27  2.15E-25  XP_002131325  uncharacterized protein LOC100180114  Ciona intestinalis  Unigene11181  459  0.19  14.543  6.257  1.06E-22  2.69E-21  XP_004208375  histone-lysine N-methyltransferase SETMAR-like  Hydra magnipapillata  Unigene2458  1,864  3.606  246.758  6.096  0  0  XP_001357727  GA20850  Drosophila pseudoobscura pseudoobscura  Unigene626  572  0.458  25.702  5.811  1.27E-47  5.37E-46  XP_002038357  GM10785  Drosophila sechellia  Unigene7053  750  0.815  43.654  5.744  3.97E-104  2.80E-102  XP_002073279  GK13242  Drosophila willistoni  Unigene3793  2,250  2.677  133.929  5.645  0  0  XP_002000822  GI22314  Drosophila mojavensis  CL167.Contig2  1,869  19.431  795.82  5.356  0  0  XP_002002750  GI11244  D. mojavensis  CL167.Contig3  1,615  9.297  340.159  5.193  0  0  XP_002002750  GI11244  D. mojavensis  CL213.Contig3  1,366  6.71  226.999  5.08  0  0  XP_001981014  GG23111  Drosophila erecta  Unigene9116  1,085  1.287  37.5  4.864  1.30E-119  1.01E-117  CBA11305  Odorant binding protein 1  Glossina morsitans morsitans  Unigene15628  344  1.015  27.721  4.771  1.01E-28  2.96E-27  XP_001354285  GA11646  D. pseudoobscura pseudoobscura  Unigene21342  205  0.852  23.259  4.771  6.55E-15  1.26E-13  XP_003698913  Uncharacterized protein LOC100865369  Apis florea  Unigene517  825  5.291  130.326  4.623  1.20E-304  1.82E-302  XP_002049652  GJ21709  Drosophila virilis  CL2953.Contig1  1,070  1.55  37.506  4.597  2.63E-114  1.96E-112  XP_002075316  GK17378  D. willistoni  CL657.Contig2  1,737  70.361  1475.108  4.39  0  0  ABK91492  CYP6G3  L. cuprina  Unigene1047  492  5.146  105.149  4.353  4.58E-142  3.89E-140  XP_002063233  GK21500  D. willistoni  CL2433.Contig2  905  0.772  14.488  4.231  2.16E-36  7.40E-35  XP_001972413  GG15517  D. Erecta  CL2386.Contig1  693  4.661  82.793  4.151  1.75E-152  1.58E-150  XP_001991143  GH12229  D. grimshawi  Unigene16852  427  0.613  10.05  4.034  2.45E-12  4.17E-11  XP_002041700  GM16611  D. sechellia  View Large Expression Profiling of Differentially Expressed Genes in Various Tissues The expression levels of some differentially expressed genes that were highly expressed in the female fat body (RPKM > 100) and annotated in NCBI nr database were validated by RT-qPCR. Six out of seven selected genes were highly expressed in the female fat body compared to the tested tissues (Fig. 2). The seventh gene, Unigene6570, had a maximum expression in the midgut, but also a significantly higher expression in the female fat body than the male fat body (t-test, P = 0.010). These results were consistent with the results of the DGE profiling study. Interestingly, Unigene3190, Unigene1031, Unigene1793, Unigene16294, Unigene3658, and Unigene9240 were highly expressed highly in the female fat body. The predominant expressions of three Vg genes were also validated by semi-quantitative RT-PCR. Fig. 2. View largeDownload slide The quantitative expression of female fat body highly expressed genes among various tissues. Relative gene expression in the midgut (MG), fat body (FB), Malpighian tubules (MT), ovary (OV), and testis (TE) from female and male B. dorsalis was determined by RT-qPCR. Relative expression levels were calculated based on the gene expression in female MG, which was ascribed an arbitrary value of 1. Different letters above the bars indicate significant differences based on LSD test (P < 0.05). The reference gene RPS3 was run with 27 cycles, while three vitellogenin genes 30 cycles in semi-quantitative work. Fig. 2. View largeDownload slide The quantitative expression of female fat body highly expressed genes among various tissues. Relative gene expression in the midgut (MG), fat body (FB), Malpighian tubules (MT), ovary (OV), and testis (TE) from female and male B. dorsalis was determined by RT-qPCR. Relative expression levels were calculated based on the gene expression in female MG, which was ascribed an arbitrary value of 1. Different letters above the bars indicate significant differences based on LSD test (P < 0.05). The reference gene RPS3 was run with 27 cycles, while three vitellogenin genes 30 cycles in semi-quantitative work. The expression levels of nine genes that were highly expressed in the male fat body were also validated by RT-qPCR. The results showed that all the tested genes were highly expressed in the male fat body compared to the female consistent with the DGE results (Fig. 3). Other such as Unigene2458, Unigene517, CL657, and Unigene1047 were expressed maximally in the male fat body compared to all tested tissues. Some other genes including CL554, Unigene2324, and Unigene3793 were most highly expressed in other tissues, such as Malpighian tubules and midgut. No significant difference was observed by multiple comparisons in ANOVA in the expression of CL554 and Unigene2324, but significant differences were observed by a t-test (P < 0.05). Interestingly, CL554, CL657, and Unigene1047 were specifically expressed in male flies, indicating their male-specific function. Fig. 3. View largeDownload slide The quantitative expression of male fat body highly expressed genes among various tissues. Relative gene expression was determined as described in Fig. 2. Fig. 3. View largeDownload slide The quantitative expression of male fat body highly expressed genes among various tissues. Relative gene expression was determined as described in Fig. 2. Sequence Analysis of Newly Identified BdVg3 In this study, three Vg homologous genes were identified: Unigene3190, Unigene1031, and Unigene9240. Unigene3190 and Unigene9240 are two Vg genes in B. dorsalis, which have been reported previously (Zuo and Chen 2014). A BlastP search in GenBank revealed that Unigene1031 was a newly identified Vg homologous gene in its amino acid sequence. Therefore, we cloned the full-length sequence using RT-PCR as described above. The ORF of the newly identified Vg contained 1,272 bp that encoded 423 amino acid residues. We named this sequence BdVg3. Structural analysis of the deduced protein revealed that the amino acid sequence contained a signal peptide with 21 amino acids. The calculated molecular weight and pI of BdVg3 were 45.86 kDa and 6.34, respectively. Moreover, the consensus polyserine cleavage site, RXXR, was present but at the C-terminus (Fig. 4A). A Blast search indicated that BdVg3 exhibited 57% amino acid identity with a Vg from Bactrocera tau and 54% identity with the Vg proteins from Calliphora vicina, Neobellieria bullata, and Lucilia cuprina. BdVg3 also shared 51% and 50% amino acid identity with D. melanogaster Vg3 and Vg2, respectively. This protein also showed similar amino acid identities with the two previously identified BdVg1 (57%) and BdVg2 (54%) proteins. To analyze the sequence homology and phylogenetic relationships of these Vg proteins, 19 insect Vgs were downloaded from GenBank, including 2 vitellogenins, BdVg1 and BdVg2. The constructed tree showed that BdVg3 was most closely related to vitellogenin from B. tau, while BdVg1 and BdVg2 clustered together with Vg from D. melanogaster and Drosophila busckii (Fig. 4B). Fig. 4. View largeDownload slide Nucleotide and deduced amino acid sequences of the newly identified BdVg3 (A) and the phylogenetic analysis of BdVg3 and Vg proteins from other insect species (B). The putative signal peptide is underlined. Putative RXXR cleavage site is shaded in green. The stop codon is indicated by asterisks. Putative polyadenylation signal (AATAAA) in the 3′-untranslated sequence is boxed and shaded in gray. The phylogenetic tree was generated by MEGA 5 using the neighbor joining method. Numbers above the branches indicate bootstrap support values from 1,000 replicates. GenBank accession numbers of all sequences are listed in the tree. Abbreviations: Bt, Bactrocera tau; Cv, Calliphora vicina; Dm, Drosophila melanogaster; Lc, Lucilia cuprina; Db, Drosophila busckii; Nb, Neobellieria bullata; Dv, Drosophila virilis. Fig. 4. View largeDownload slide Nucleotide and deduced amino acid sequences of the newly identified BdVg3 (A) and the phylogenetic analysis of BdVg3 and Vg proteins from other insect species (B). The putative signal peptide is underlined. Putative RXXR cleavage site is shaded in green. The stop codon is indicated by asterisks. Putative polyadenylation signal (AATAAA) in the 3′-untranslated sequence is boxed and shaded in gray. The phylogenetic tree was generated by MEGA 5 using the neighbor joining method. Numbers above the branches indicate bootstrap support values from 1,000 replicates. GenBank accession numbers of all sequences are listed in the tree. Abbreviations: Bt, Bactrocera tau; Cv, Calliphora vicina; Dm, Drosophila melanogaster; Lc, Lucilia cuprina; Db, Drosophila busckii; Nb, Neobellieria bullata; Dv, Drosophila virilis. Transcriptional Expression in Developmental Stages The newly identified BdVg3 was highly expressed in female B. dorsalis showing a stage-specific expression pattern (Fig. 5A). During the sexual-maturation of female adult, the expression of BdVg3 increased, especially during the vitellogenic stage and then decreased in mature females (Fig. 5B). Fig. 5. View largeDownload slide The expression of newly identified BdVg3 in different developmental stages (A), and sex-maturation period of female Bactrocera dorsalis (B). EG represents egg, LA-7 represents 7-d-old larvae, PU-5 represents 5-d-old pupae, VF-9 represents 9-d-old virgin female, VM-9 represents 9-d-old virgin male. Relative expression levels were calculated based on the value in EG and 0-d-old female, respectively, which were ascribed an arbitrary value of 1. Relative gene expressions were determined as described in Fig. 2. Fig. 5. View largeDownload slide The expression of newly identified BdVg3 in different developmental stages (A), and sex-maturation period of female Bactrocera dorsalis (B). EG represents egg, LA-7 represents 7-d-old larvae, PU-5 represents 5-d-old pupae, VF-9 represents 9-d-old virgin female, VM-9 represents 9-d-old virgin male. Relative expression levels were calculated based on the value in EG and 0-d-old female, respectively, which were ascribed an arbitrary value of 1. Relative gene expressions were determined as described in Fig. 2. Discussion It is well-known that the insect fat body contributes significantly to insect reproduction, as well as detoxification and immune response to infection. The fat body in insects plays several roles including synthesis of yolk protein precurors for oocyte maturation, and the storage and release of energy in response to changing physiological states. Differences in gene expression between female and male adults has been studied in B. dorsalis to identify the differentially expressed genes (Zuo and Chen 2014). Some detoxification enzymes, namely CYP, GST, NADH dehydrogenase, and cecropin, were identified in the male fat body. In this study, we identified 1,445 differentially expressed unigenes, and 79 of those were identified to be involved in the reproduction process and immune function including Vg, alcohol dehydrogenase-2, cytochrome P450, and 3-hydroxybutyrate dehydrogenase. In the present study, a new Vg gene was identified for the first time in B. dorsalis and was named BdVg3. The number of Vg genes varies in insect species with most insects having one Vg gene and others such as Dipterans, Hemipterans, and Dictyopterans having two or more (Tufail and Takeda 2008, Tufail et al. 2014). For instance, there are three Vg genes in A. aegypti (Tufail et al. 2014) and D. melanogaster (Isaac and Bownes 1982, Hutson and Bownes 2003) and Musca domestica (White and Bownes 1997). Previous studies reported the presence of two Vg genes in female B. dorsalis, Vg1, and Vg2 (Chen et al. 2012). Using high-throughput transcriptome sequencing, we identified a new Vg gene in the DGE profiles of sex-biased fat body from B. dorsalis. Similar to BdVg1 and BdVg2 proteins, the predicted molecular mass of BdVg3 was much smaller than that of other insects (Chen et al. 2012, Tufail et al. 2014). The similarity in the structure and molecular mass of all three BdVg proteins indicates similar secondary structures and roles involved in female fecundity (Chen et al. 1997). This new BdVg3 gene also showed a tissue-, sex- and stage- specific expression similar to BdVg1 and BdVg2 (Chen et al. 2012). The highest expression of the three BdVgs was observed in 5-d-old females, indicating the high nutritional needs and rapid egg development in the vitellogenic stage of female adult. This period is the beginning of the vitellogenesis process of the ovary development in B. dorsalis. Much Vg was synthesized and taken up into the ovary by the Vg receptor (VgR). In contrast, low expression of Vg was observed in male fat body and testis of B. dorsalis (Fig. 3). The expression of Vg gene in the male has also been investigated in D. melanogaster and Spodoptera littoralis (Bebas et al. 2008, Majewska et al. 2014). Vg protein appeared in the seminal fluid and formed an external coat on the S. littoralis spermatozoa, showing a function in male fertility (Bebas et al. 2008). It was also demonstrated that the function of Vg3 is quite different from Vg2 genes in D. melanogaster (Hutson and Bownes 2003). The function of BdVg3 and the relationship with previously identified Vg genes remain unknown and will be studied in the future. Female-specific transformer, doublesex, and male-specific doublesex, which are involved in the sex determination pathway, were also identified to be highly-expressed in the sex-biased fat body. These genes were previously reported in B. dorsalis (Liu et al. 2015, Peng et al. 2015), B. oleae (Lagos et al. 2007), Ceratitis capitata (Saccone et al. 2011), Drosophila (Salz and Erickson 2010, Arbeitman et al. 2016), and Culex pipiens (Price et al. 2015). More studies have shown that doublesex is expressed under a complex spatiotemporal regulation in the somatic gonad identification (Hempel and Oliver 2007), regulating female receptivity (Zhou et al. 2014) and specifying male courtship behavior (Dauwalder 2011). A recent study demonstrated that the sex differences in gene expression in Drosophila were regulated by the sex-specific doublesex (Arbeitman et al. 2016). The first identification of the transcriptional regulation by doublesex protein came from Vg genes thereby regulating their expression (Burtis et al. 1991). The homologous gene with a similar sex-biased expression in B. dorsalis may play a similar reproductive regulation in sex-determination. The response of fat body to stress in a sex- and time-dependent manner has been well-documented (Neckameyer and Matsuo 2008, Argue and Neckameyer 2014). We identified in this study 226 differentially expressed genes involved in detoxification and immune function, including cytochrome P450 (CYP6A5V2), antigen 5, sapecin, and defensin. P450 genes mostly have a detoxification function and are also involved in development, such as deltamethrin resistance (Zhu et al. 2010) and ecdysone synthesis (Cabrera et al. 2015). Male-specific expression of P450 genes has also been studied and reported in other insects, e.g., Blattella germanica (Wen and Scott 2001) although the function is not clear. In male Ips paraconfusus, the high expression of Cyp9T1 and Cyp9T2 is related to the feeding on host phloem, suggesting their function in the production of male-specific aggregation pheromone (Huber et al. 2007). In this study, we identified a P450 homologous gene CYP6G3 expressed in the male-specific fat body. Another P450 gene named CYP6G2 was also identified to have a male-bias in B. dorsalis, and it is presumed to function in making the insects susceptible to insecticide (Zuo and Chen 2014). Besides, some GSTs and acetylcholinesterases were also differentially expressed in the male fat body, indicating a higher resistance of male B. dorsalis to organophosphates. It has been demonstrated that some epsilon GST genes are expressed in sex-biased adult tissues (Lu et al. 2016). Antibacterial peptides are known to have a predominant expression in the insect fat body, the most important immune tissue. Recently, a newly identified defensin gene was found to be expressed in female B. dorsalis, possibly because of the high expression in the reproductive system, and they may play a role responding to peptidoglycan infection (Liu et al. 2017). Two defensin genes were also identified in the male accessory glands of B. dorsalis, and they showed a high expression in the fat body (Wei et al. 2016). Antigen 5 is a major allergen of venom in vespids, and homologous genes have been identified in other insects (Hawdon et al. 1996). In B. dorsalis, antigen 5 was first identified in male accessory glands (Tian et al. 2017), but the biological function is still unknown. Other genes such as alcohol dehydrogenase and sorbitol dehydrogenase involved in metabolic activities, NADH dehydrogenase 3, odorant binding protein, and lysozyme, were also found to be highly expressed in the male fat body in this study. In conclusion, the gene expression profiles differ in the sex-biased fat body of B. dorsalis and this may be significant to the different reproductive roles of the fat body in the two sexes of males and females. In this study, we evaluated the gene expression profiles of the fat body from female and male B. dorsalis by DGE profiling. While some genes were expressed in both sexes, others especially those involved in reproduction, detoxification and immune had a sex-biased expression. The analyses revealed the presence of a new vitellogenin gene in B. dorsalis. This is the first report of this BdVg3 gene, which has a tissue-, sex- and stage-specific expression pattern, indicating that it could play an important role in female reproduction. Acknowledgments This work was supported in part by the National Natural Science Foundation of China (31601640), Chongqing Research Program of Basic Research and Frontier Technology (CSTC2016jcyjA0019), the earmarked fund for the Modern Agro-industry (Citrus) Technology Research System, and the Foundation Project of Southwest University (SWU114049). References Cited Anand, A. N., and Lorenz M. W. 2008. Age-dependent changes of fat body stores and the regulation of fat body lipid synthesis and mobilisation by adipokinetic hormone in the last larval instar of the cricket, Gryllus bimaculatus. J. Insect Physiol . 54: 1404– 1412. Google Scholar CrossRef Search ADS PubMed  Arbeitman, M. N., New F. N., Fear J. M., Howard T. S., Dalton J. E., and Graze R. M. 2016. Sex differences in Drosophila somatic gene expression: variation and regulation by doublesex. G3-Genes Genom. Genet . 6: 1799– 1808. Argue, K. J., and Neckameyer W. S. 2014. Altering the sex determination pathway in Drosophila fat body modifies sex-specific stress responses. Am. J. Physiol. Regul. Integr. Comp. Physiol . 307: R82– R92. Google Scholar CrossRef Search ADS PubMed  Arrese, E. L., and Soulages J. L. 2010. Insect fat body: energy, metabolism, and regulation. Annu. Rev. Entomol . 55: 207– 225. Google Scholar CrossRef Search ADS PubMed  Attardo, G. M., Strickler-Dinglasan P., Perkin S. A. H., Caler E., Bonaldo M. F., Soares M. B., El-Sayeed N., and Aksoy S. 2006. Analysis of fat body transcriptome from the adult tsetse fly, Glossina morsitans morsitans. Insect Mol. Biol . 15: 411– 424. Google Scholar CrossRef Search ADS PubMed  Audic, S., and Claverie J. M. 1997. The significance of digital gene expression profiles. Genome Res . 7: 986– 995. Google Scholar CrossRef Search ADS PubMed  Bebas, P., Kotwica J., Joachimiak E., and Giebultowicz J. M. 2008. Yolk protein is expressed in the insect testis and interacts with sperm. BMC Dev. Biol . 8: 64. Google Scholar CrossRef Search ADS PubMed  Burtis, K. C., Coschigano K. T., Baker B. S., and Wensink P. C. 1991. The doublesex proteins of Drosophila melanogaster bind directly to a sex-specific yolk protein gene enhancer. EMBO J . 10: 2577. Google Scholar PubMed  Cabrera, A. R., Shirk P. D., Evans J. D., Hung K., Sims J., Alborn H., and Teal P. E. A. 2015. Three Halloween genes from the Varroa mite, Varroa destructor (Anderson & Trueman) and their expression during reproduction. Insect Mol. Biol . 24: 277– 292. Google Scholar CrossRef Search ADS PubMed  Chen, J. S., Sappington T. W., and Raikhel A. S. 1997. Extensive sequence conservation among insect, nematode, and vertebrate vitellogenins reveals ancient common ancestry. J. Mol. Evol . 44: 440– 451. Google Scholar CrossRef Search ADS PubMed  Chen, S. L., Lin C. P., and Lu K. H. 2012. cDNA isolation, expression, and hormonal regulation of yolk protein genes in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). J. Insect Physiol . 58: 763– 770. Google Scholar CrossRef Search ADS PubMed  Cheng, D. J., Xia Q. Y., Zhao P., Wang Z. L., Xu H. F., Li G. R., Lu C., and Xiang Z. H. 2006. EST-based profiling and comparison of gene expression in the silkworm fat body during metamorphosis. Arch. Insect Biochem. Physiol . 61: 10– 23. Google Scholar CrossRef Search ADS PubMed  Conesa, A., Götz S., García-Gómez J. M., Terol J., Talón M., and Robles M. 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics  21: 3674– 3676. Google Scholar CrossRef Search ADS PubMed  Dauwalder, B. 2011. The roles of fruitless and doublesex in the control of male courtship. Int. Rev. Neurobiol . 99: 87– 105. Google Scholar CrossRef Search ADS PubMed  Gu, Z. Y., Li F. C., Wang B. B., Xu K. Z., Ni M., Zhang H., Shen W. D., and Li B. 2015. Differentially expressed genes in the fat body of Bombyx mori in response to phoxim insecticide. Pest. Biochem. Physiol . 117: 47– 53. Google Scholar CrossRef Search ADS   Haunerland, N. H., and Shirk P. D. 1995. Regional and functional differentiation in the insect fat body. Annu. Rev. Entomol . 40: 121– 145. Google Scholar CrossRef Search ADS   Hawdon, J. M., Jones B. F., Hoffman D. R., and Hotez P. J. 1996. Cloning and characterization of Ancylostoma-secreted protein a novel protein associated with the transition to parasitism by infective hookworm larvae. J. Biol. Chem . 271: 6672– 6678. Google Scholar CrossRef Search ADS PubMed  Hempel, L. U., and Oliver B. 2007. Sex-specific DoublesexM expression in subsets of Drosophila somatic gonad cells. BMC Dev. Biol . 7: 113. Google Scholar CrossRef Search ADS PubMed  Huber, D. P. W., Erickson M. L., Leutenegger C. M., Bohlmann J., and Seybold S. J. 2007. Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa. Insect Mol. Biol . 16: 335– 349. Google Scholar CrossRef Search ADS PubMed  Hutson, S. F., and Bownes M. 2003. The regulation of yp3 expression in the Drosophila melanogaster fat body. Dev. Genes Evol . 213: 1– 8. Google Scholar PubMed  Isaac, P. G., and Bownes M. 1982. Ovarian and fat-body vitellogenin synthesis in Drosophila melanogaster. Eur. J. Biochem . 123: 527– 534. Google Scholar CrossRef Search ADS PubMed  Jiang, Z., Wu X. L., Michal J. J., and Mcnamara J. P. 2005. Pattern profiling and mapping of the fat body transcriptome in Drosophila melanogaster. Obes. Res . 13: 1898– 1904. Google Scholar CrossRef Search ADS PubMed  Lagos, D., Koukidou M., Savakis C., and Komitopoulou K. 2007. The transformer gene in Bactrocera oleae: the genetic switch that determines its sex fate. Insect Mol. Biol . 16: 221– 230. Google Scholar CrossRef Search ADS PubMed  Li, R., Yu C., Li Y., Lam T. W., Yiu S. M., Kristiansen K., and Wang J. 2009. SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics  25: 1966– 1967. Google Scholar CrossRef Search ADS PubMed  Liu, G., Wu Q., Li J., Zhang G., and Wan F. 2015. RNAi-mediated knock-down of transformer and transformer 2 to generate male-only progeny in the oriental fruit fly, Bactrocera dorsalis (Hendel). PLoS ONE  10: e0128892. Google Scholar CrossRef Search ADS PubMed  Liu, Z., Smagghe G., Lei Z., and Wang J. J. 2016. Identification of male- and female-specific olfaction genes in antennae of the oriental fruit fly (Bactrocera dorsalis). PLoS ONE  11: e0147783. Google Scholar CrossRef Search ADS PubMed  Liu, S. H., Wei D., Yuan G. R., Jiang H. B., Dou W., and Wang J. J. 2017. Antimicrobial peptide gene cecropin-2 and defensin respond to peptidoglycan infection in the female adult of oriental fruit fly, Bactrocera dorsalis (Hendel). Comp. Biochem. Physiol. B  206: 1– 7. Google Scholar CrossRef Search ADS   Livak, K. J., and Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△Ct method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Lu, X. P., Wang L. L., Huang Y., Dou W., Chen C. T., Wei D., and Wang J. J. 2016. The epsilon glutathione S-transferases contribute to the malathion resistance in the oriental fruit fly, Bactrocera dorsalis (Hendel). Comp. Biochem. Physiol. C  180: 40– 48. Majewska, M. M., Suszczynska A., Kotwica-Rolinska J., Czerwik T., Paterczyk B., Polanska M. A., Bernatowicz P., and Bebas P. 2014. Yolk proteins in the male reproductive system of the fruit fly Drosophila melanogaster: Spatial and temporal patterns of expression. Insect Biochem. Mol. Biol . 47: 23– 35. Google Scholar CrossRef Search ADS PubMed  Mirth, C. K., and Riddiford L. M. 2007. Size assessment and growth control: how adult size is determined in insects. Bioessays  29: 344– 355. Google Scholar CrossRef Search ADS PubMed  Mortazavi, A., Williams B. A., McCue K., Schaeffer L., and Wold B. 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods  5: 621– 628. Google Scholar CrossRef Search ADS PubMed  Neckameyer, W., and Matsuo H. 2008. Distinct neural circuits reflect sex, sexual maturity, and reproductive status in response to stress in Drosophila melanogaster. Neuroscience  156: 841– 856. Google Scholar CrossRef Search ADS PubMed  Peng, W., Zheng W., Handler A. M., and Zhang H. 2015. The role of the transformer gene in sex determination and reproduction in the tephritid fruit fly, Bactrocera dorsalis (Hendel). Genetica  143: 717– 727. Google Scholar CrossRef Search ADS PubMed  Petersen, T. N., Brunak S., von Heijne G., and Nielsen H. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods  8: 785– 786. Google Scholar CrossRef Search ADS PubMed  Price, D. C., Egizi A., and Fonseca D. M. 2015. Characterization of the doublesex gene within the Culex pipiens complex suggests regulatory plasticity at the base of the mosquito sex determination cascade. BMC Evol. Biol . 15: 108. Google Scholar CrossRef Search ADS PubMed  Price, D. P., Nagarajan V., Churbanov A., Houde P., Milligan B., Drake L. L., Gustafson J. E., and Hansen I. A. 2011. The fat body transcriptomes of the yellow fever mosquito Aedes aegypti, pre- and post- blood meal. PLoS ONE  6: e22573. Google Scholar CrossRef Search ADS PubMed  Saccone, G., Salvemini M., and Polito L. 2011. The transformer gene of Ceratitis capitata: a paradigm for a conserved epigenetic master regulator of sex determination in insects. Genetica  139: 99– 111. Google Scholar CrossRef Search ADS PubMed  Salz, H., and Erickson J. W. 2010. Sex determination in Drosophila: the view from the top. Fly  4: 60– 70. Google Scholar CrossRef Search ADS PubMed  Shen, G. M., Dou W., Niu J. Z., Jiang H. B., Yang W. J., Jia F. X., Hu F., Cong L., and Wang J. J. 2011. Transcriptome analysis of the oriental fruit fly (Bactrocera dorsalis). PLoS ONE  6: e29127. Google Scholar CrossRef Search ADS PubMed  Shen, G. M., Dou W., Huang Y., Jiang X. Z., Smagghe G., and Wang J. J. 2013. In silico cloning and annotation of genes involved in the digestion, detoxification and RNA interference mechanism in the midgut of Bactrocera dorsalis [Hendel (Diptera: Tephritidae)]. Insect Mol. Biol . 22: 354– 365. Google Scholar CrossRef Search ADS PubMed  Tamura, K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol . 28: 2731– 2739. Google Scholar CrossRef Search ADS PubMed  Tian, C. B., Wei D., Xiao L. F., Dou W., Liu H., and Wang J. J. 2017. Comparative transcriptome analysis of three Bactrocera dorsalis (Hendel) organs to identify functional genes in male accessory glands and ejaculatory duct. Fla. Entomol . 100: 42– 51. Google Scholar CrossRef Search ADS   Tufail, M., and Takeda M. 2008. Molecular characteristics of insect vitellogenins. J. Insect Physiol . 54: 1447– 1458. Google Scholar CrossRef Search ADS PubMed  Tufail, M., Nagaba Y., Elgendy A. M., and Takeda M. 2014. Regulation of vitellogenin genes in insects. Entomol. Sci . 17: 269– 282. Google Scholar CrossRef Search ADS   Wang, J. J., Wei D., Dou W., Hu F., Liu W. F., and Wang J. J. 2013. Toxicities and synergistic effects of several insecticides against the oriental fruit fly (Diptera: Tephritidae). J. Econ. Entomol . 106: 970– 978. Google Scholar CrossRef Search ADS PubMed  Wang, H., Fang Y., Wang L., Zhu W., Ji H., Wang H., Xu S., and Sima Y. 2014. Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes. Mol. Biol. Rep . 41: 6039– 6049. Google Scholar CrossRef Search ADS PubMed  Wei, D., Feng Y. C., Wei D. D., Yuan G. R., Dou W., and Wang J. J. 2015a. Female remating inhibition and fitness of Bactrocera dorsalis (Diptera: Tephritidae) associated with male accessory glands. Fla. Entomol . 98: 52– 58. Google Scholar CrossRef Search ADS   Wei, D., Li H. M., Yang W. J., Wei D. D., Dou W., Huang Y., and Wang J. J. 2015b. Transcriptome profiling of the testis reveals genes involved in spermatogenesis and marker discovery in the oriental fruit fly, Bactrocera dorsalis. Insect Mol. Biol . 24: 41– 57. Google Scholar CrossRef Search ADS   Wei, D., Tian C. B., Liu S. H., Wang T., Smagghe G., Jia F. X., Dou W., and Wang J. J. 2016. Transcriptome analysis to identify genes for peptides and proteins involved in immunity and reproduction from male accessory glands and ejaculatory duct of Bactrocera dorsalis. Peptides  80: 48– 60. Google Scholar CrossRef Search ADS PubMed  Wen, Z., and Scott J. G. 2001. Cytochrome P450 CYP6L1 is specifically expressed in the reproductive tissues of adult male German cockroaches, Blattella germanica (L.). Insect Biochem. Mol. Biol . 31: 179– 187. Google Scholar CrossRef Search ADS PubMed  White, N. M., and Bownes M. 1997. Cloning and characterization of three Musca domestica yolk protein genes. Insect Mol. Biol . 6: 329– 341. Google Scholar CrossRef Search ADS PubMed  Yang, W. J., Yuan G. R., Cong L., Xie Y. F., and Wang J. J. 2014. De novo cloning and annotation of genes associated with immunity, detoxification and energy metabolism from the fat body of the oriental fruit fly, Bactrocera dorsalis. PLoS ONE  9: e94470. Google Scholar CrossRef Search ADS PubMed  Ye, J., Fang L., Zheng H., Zhang Y., Chen J., Zhang Z., Wang J., Li S., Li R., and Bolund L. 2006. WEGO: a web tool for plotting GO annotations. Nucleic Acids Res . 34: W293– W297. Google Scholar CrossRef Search ADS PubMed  Yu, H., Ji R., Ye W., Chen H., Lai W., Fu Q., and Lou Y. 2013. Transcriptome analysis of fat bodies from two brown planthopper (Nilaparvata lugens) populations with different virulence levels in rice. PLoS ONE  9: e88528. Google Scholar CrossRef Search ADS   Zhou, C., Pan Y. F., Robinett C. C., Meissner G. W., and Baker B. S. 2014. Central brain neurons expressing doublesex regulate female receptivity in Drosophila. Neuron  83: 149– 163. Google Scholar CrossRef Search ADS PubMed  Zhu, F., Parthasarathy R., Bai H., Woithe K., Kaussmann M., Nauen R., Harrison D. A., and Palli S. R. 2010. A brain-specific cytochrome P450 responsible for the majority of deltamethrin resistance in the QTC279 strain of Tribolium castaneum. P. Natl. Acad. Sci. USA  107: 8557– 8562. Google Scholar CrossRef Search ADS   Ziegler, R., and Antwerpen R. V. 2006. Lipid uptake by insect oocytes. Insect Biochem. Mol. Biol . 36: 264– 272. Google Scholar CrossRef Search ADS PubMed  Zuo, Y. H., and Chen M. E. 2014. Differential gene expression in male and female fat body in the oriental fruit fly, Bactrocera dorsalis. Arch. Insect Biochem. Physiol . 85: 48– 59. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Journal

Annals of the Entomological Society of AmericaOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off