Clostridium butyricum regulates visceral hypersensitivity of irritable bowel syndrome by inhibiting colonic mucous low grade inflammation through its action on NLRP6

Clostridium butyricum regulates visceral hypersensitivity of irritable bowel syndrome by... Abstract Visceral hypersensitivity induced by stress is quite common in irritable bowel syndrome (IBS) patients. Probiotics play an important role in reducing visceral hypersensitivity in IBS patients. However, the mechanism has not been clearly elucidated. In this study, we investigated the role of nod-like receptor pyrin domain-containing protein 6 (NLRP6) in Clostridium butyricum-regulated IBS induced by stress. Our results showed that NLRP6 was down-regulated in IBS group colon tissues. In addition, IL-18, IL-1β, myeloperoxidase (MPO), d-lactic acid (D-LA), and CD172a were up-regulated in the IBS group of colonic mucous. IL-18 and IL-1β were also increased after the NLRP6 gene was silenced. Pathological score suggested low inflammation of colonic mucous rather than terminal ileum. Water-avoidance stress (WAS) showed visceral hypersensitivity to colonic distension. However, treatment with Clostridium butyricum reversed these results, exerting a beneficial effect. In conclusion, Clostridium butyricum may exert a beneficial action on visceral hypersensitivity of IBS by inhibiting low grade inflammation of colonic mucous through its action on NLRP6. irritable bowel syndrome, nod-like receptor pyrin domain-containing protein 6, Clostridium butyricum, low grade mucosal inflammation, inflammatory factors Introduction Irritable bowel syndrome (IBS) is the most common type of functional gastrointestinal disease characterized by abdominal intermittent or continuous pain, abdominal discomfort, and changes in bowel evacuation habits. Brain–gut communication dysfunction, integrity of mucosa, and inflammation, as well as psychosocial factors, may play roles in IBS pathogenesis [1]. In recent years, more and more studies have revealed that IBS patients are also affected by low grade mucosal inflammation (LGMI) [2]. Gastrointestinal responses to stress include alterations in motility, visceral hypersensitivity, and intestinal permeability. In addition, psychosocial stress alters brain–gut interactions and may intensify a wide range of disorders, including IBS [3]. Nod-like receptor pyrin domain-containing protein 6 (NLRP6) is the first member of the NLR protein family that inhibits the innate immune response-related signaling pathways [4], thus inhibiting inflammation, promoting intestinal lesions healing, and modulating intestinal flora. A recent study [5] has shown that NLRP6 plays an important role in repairing intestinal mucosa, avoiding the spread of epithelial cell damage, and promoting goblet cell autophagy and mucus secretion, so as to maintain the stability of the intestinal internal environment. Furthermore, NLRP6 inflammasome plays a significant role in the intestinal flora and intestinal immune system. Indeed, chemical-induced colitis becomes more severe after NLRP6 silencing in mice and the intestinal flora composition is also significantly altered [6]. Healthy microbiota maintenance requires nucleotide binding oligomerization domain protein-like receptors, containing pyrin domain NLRP6 inflammasomes. Alterations in the intestinal microbiota have been associated with IBS. IBS patients show a significant reduction in intestinal beneficial bacteria, such as latic acid bacteria and bifidobacteria, which disturb the balance of the normal intestinal microbiota, leading to bacterial infection, intestinal flora imbalance, and consequent disease [7]. Therefore, probiotics play an important role in supplementing normal intestinal flora, correcting flora imbalance and maintaining intestinal stability, significantly reducing intestinal sensitivity and restoring normal intestinal function in IBS patients. However, the mechanism of action of probiotics against intestinal sensitivity has not been clarified yet [8]. Some studies [9,10] have shown that LGMI could activate visceral hypersensitivity, which underlies that IBS and NLRP6 [11] inflammasome plays a significant role in inhibiting inflammation. Hence, the objective of this study was to investigate whether Clostridium butyricum could modulate visceral hypersensitivity, as well as to understand its effect on NLRP6 to evaluate the benefits of probiotic therapy. To reach the above goal, the expression of NLRP6 and its downstream factors, intestinal mucosa inflammation, and visceral hypersensitivity were evaluated in stress-associated gastrointestinal disorders. Overall, our results demonstrated that Clostridium butyricum might play a beneficial role in the visceral hypersensitivity of IBS by inhibiting LGMI through its action on NLRP6. Materials and Methods Animals and IBS mice model Thirty C57BL/6 female mice (BK Experimental Animal Co., Ltd, Shanghai, China) weighing 15–20 g, 5–6 weeks old, were individually housed under controlled conditions (22°C ± 1°C, 65%–70% humidity) with a 12-h light/dark cycle for a week in the animal maintenance facility at the Zhejiang Chinese Medical University (Hangzhou, China). Water and food were provided ad libitum. All experimental protocols were performed according to the requirements of the China State Authority for Animal Research Conduct. Mice were randomly divided into three groups, eight mice per group: control group, IBS group, and Clostridium butyricum group. IBS group and Clostridium butyricum group mice were placed on a platform (3 × 3 × 6 cm) into a container (56 × 50 cm) containing approximately 5 cm of water (25°C) for 1 h daily (8 AM–9 AM, to decrease the circadian rhythmicity of sleep, thus modifying the nocturnal-diurnal difference) for 10 consecutive days [12]. The control group was not subject to any of these treatments. The Clostridium butyricum group received an intragastric administration of Clostridium butyricum (1.25 × 109 CFU/ml, 0.4 ml, provided by Shandong Kexing Bioproducts Co, Ltd, Jinan, China) once a day for 7 days, while the control and IBS groups were treated with an equal volume of saline once a day for the same number of days. To evaluate colorectal distension (CRD), a cervical catheter balloon was slowly placed 2 cm into the mice rectum and secured by taping the attached tube to the tail. Mice underwent CRD at a pressure from 20 to 80 mm Hg for 20 s, with 4-min pause between distensions. Each measurement was taken five times to ensure accuracy. The success of the model was determined by recording the abdominal withdrawal reflex (AWR). Using the semi-quantitative AWR test, mice AWR was evaluated as follows: 0, no behavioral response to CRD; 1, brief head movement only; 2, contraction of abdominal muscles; 3, abdomen lifting; 4, arching of the body and pelvis lifting. The stimulus intensity evoking visually identifiable contraction of the abdominal wall was recorded as CRD threshold intensity [13]. Tissue and blood collection Mice were euthanized after colorectal distension. Blood from the orbital venous plexus and tissues from the terminal ileum (2–3 cm length) and the colon close to the ileocecal portion (2–3 cm length) were collected under sterile conditions. Mice intestines were cut, washed with PBS to remove the fecal contents, opened longitudinally, placed immediately in 10% formaldehyde, and stored at room temperature or in liquid nitrogen at −80°C, respectively, until further use. Cell culture and cell transfection In order to determine the effect of NLRP6 inhibition on IL-18 and IL-1β, human epithelial colorectal adenocarcinoma cell Caco-2 (Cell Bank of the Chinese Academy of Sciences, Shanhai, China) was cultured in MEM with 10% fetal bovine serum (Gibco, Grand Island, USA) and 2 mM L-glutamine and incubated at 37°C, 5% CO2 for 48 h in 6-well plates at 1 × 106 cells per ml per well. Next, Caco-2 cells were transiently transfected with NLRP6 siRNA (sense: GCAGAUUGGUUGCUGCGCA dTdT, antisense: UGCGCAGCAACCAAUCUGC dTdT) and scrambled siRNA into 6-well plates using riboFECT™ CP transfection reagent (Ribobio, Guangzhou, China) according to the manufacturer’s instruction. Cells transfected with scrambled siRNA were used as control. About 48 h after transfection, cells were collected from each well and subject to protein analysis and ELISA. Western blot analysis Western blot analysis was used to determine NLRP6, cysteinyl aspartate specific proteinase-1 (caspase-1), activating signal cointegrator (ASC), caspase recruitment domain 8 (CARD8), signal regulatory protein alpha (SIRP alpha, designated CD172a), interleukin-18 (IL-18), and interleukin-1 beta (IL-1β) expression in mice colon and terminal ileum tissue. In brief, protein samples were separated using 10% SDS-PAGE and transferred onto PVDF membranes. Membranes were blocked with 5% nonfat milk in PBS containing 0.1% Tween-20 (Sigma, St Louis, USA) at 4°C overnight under gentle rocking and incubated with primary antibodies at 4°C. Membranes were washed three times and probed with goat anti-rabbit secondary antibody (1:4000; Dawen, Hangzhou, China) for 2 h at room temperature. Immunoblots were visualized using an ECL detection kit (Amersham Biosciences, Pittsburgh, USA) and exposed to X-ray films. The primary antibodies (Abs) used in this study were as follows: rabbit polyclonal anti-mouse NLRP6 Ab (1:500; Sigma); rabbit monoclonal anti-Caspase-1 Ab (1:5000; Abcam, Cambridge, UK); rabbit monoclonal anti-ASC Ab (1:1000; CST, Boston, USA); rabbit polyclonal anti-NLRP6 Ab (1:400; Abcam); rabbit polyclonal anti-Caspase-1 Ab (1:500; CST); rabbit monoclonal anti-ASC Ab (1:200; CST); rabbit polyclonal anti-pre-IL-18 Ab (1:1000; Proteintech, Wuhan, China); rabbit monoclonal anti-IL-1 beta Ab (1:200; Abcam); rabbit polyclonal anti-SIRP alpha Ab (CD172a, 1:800; Proteintech); rabbit polyclonal anti-CARD8 Ab (1:1000; Abcam). RT-PCR Total RNA was extracted from tissues and cells using Takara Minibest Universal RNA Extraction kit (Takara, Dalian, China) following the manufacturer’s instructions. PrimeScript™RT Master mix (Takara) was used for reverse transcription reactions with 0.5 μg of total RNA. Amplification was performed on a GeneAmp PCR system (Bio-Rad Laboratories, Hercules, USA). Quantitative polymerase chain reaction (qPCR) solution contained 5 μl of 2 × SYBR Premix Ex Taq II (Takara), 0.4 μl of each PCR primer (Sangon, Shanghai, China) designed by Primer Premier 6.0 and Beacon designer 7.8 software (Table 1), 0.2 μl of Rox reference dye, 1 μl of cDNA template, and 3 μl of dH2O, for a total of 10 μl reaction volume. Cycling conditions were as follows: pre-denaturation at 95°C for 30 s, followed by 40 cycles consisting of denaturation at 95°C for 5 s and annealing at 60°C for 34 s, and eventually into the dissociation stage. Each sample was measured three times and RNA relative expression was calculated using the 2−ΔΔCt method. Table 1. Sequences of primers used in this study Symbols  mRNA sequence  Forward primers  Reverse primers  hβ-actin  GACTTAGTTGCGTTACACCCTTTC  GCTGTCACCTTCACCGTTCC  hNLRP6  CAGTTCTCAAGGCACCACAA  TCACTCAGCATACGCAGTCC  hCaspase-1  AGGCATGACAATGCTGCTAC  TGGGACTTGCTCAGAGTGTTTC  hAscF  AAGCCAGGCCTGCACTTTATAGAC  CCAGGCTGGTGTGAAACTGA  mGAPDH  AGGTCGGTGTGAACGGATTTG  TGTAGACCATGTAGTTGAGGTCA  mNLRP6  TGACCAGAGCTTCCAGGAGT  TTTAGCAGGCCAAAGAGGAA  mCaspase-1  CACAGCTCTGGAGATGGTGA  CTTTCAAGCTTGGGCACTTC  mASC  ACAGAAGTGGACGGAGTGCT  CTCCAGGTCCATCACCAAGT  Symbols  mRNA sequence  Forward primers  Reverse primers  hβ-actin  GACTTAGTTGCGTTACACCCTTTC  GCTGTCACCTTCACCGTTCC  hNLRP6  CAGTTCTCAAGGCACCACAA  TCACTCAGCATACGCAGTCC  hCaspase-1  AGGCATGACAATGCTGCTAC  TGGGACTTGCTCAGAGTGTTTC  hAscF  AAGCCAGGCCTGCACTTTATAGAC  CCAGGCTGGTGTGAAACTGA  mGAPDH  AGGTCGGTGTGAACGGATTTG  TGTAGACCATGTAGTTGAGGTCA  mNLRP6  TGACCAGAGCTTCCAGGAGT  TTTAGCAGGCCAAAGAGGAA  mCaspase-1  CACAGCTCTGGAGATGGTGA  CTTTCAAGCTTGGGCACTTC  mASC  ACAGAAGTGGACGGAGTGCT  CTCCAGGTCCATCACCAAGT  Immunohistochemistry assay Mice paraffin-embedded intestines were cut into 4-μm thick sections, mounted on gelatin-coated slides, and heated at 60°C for 2 h. Paraffin was removed by an automatic dyeing machine program and samples were rehydrated. To heat repair the antigen, tissue sections were soaked in citrate buffer (0.01 M, pH 6.0) for 3 min until cooling. Endogenous peroxidase activity was blocked using 3% hydrogen peroxidase solution for 10–15 min, then the slides were washed and incubated with goat polyclonal anti-NLRP6 Ab (1:500; Santa Cruz, Santa Cruz, USA) in complete medium overnight at 4°C. The slides were rinsed with 0.01 M PBS three times for 5 min. Next, sections were incubated with secondary Ab donkey anti-goat IgG (H+L) (Abcam, Cambridge, UK) at 37°C for 1 h, followed by three times of wash with 0.01 M PBS for 5 min. DAB developing solution was used for 1–20 min to stain the slides. Sections were dehydrated in a graded alcohol series, and covered with a cover slip. Five fields at high magnification were randomly selected from the images of each mouse intestinal tissue and the average integral optical density value (IOD/Area) was calculated, reflecting the expression of the corresponding protein. Hematoxylin and eosin staining Mice paraffin-embedded intestines were cut into 5-μm thick sections. Hematoxylin and eosin (H&E) staining was performed using a standard protocol. The colon and terminal ileum mucosal pathology score was evaluated as follows [14]: cryptal architecture changes, 3–6 points; number of round-cell infiltrates in the lamina propria mucosae, 0–3 points; goblet cell death, 1 point; submucosal fibrous tissue hyperplasia, 1 point; granuloma, 1 point. Total score: 0: inflammation, 1–4: low inflammation, 5–8: inflammation, 9–12: severe inflammation. ELISA Blood was collected from the orbital venous plexus, while Caco-2 cells were transfected with NLRP6 siRNA as described in the above. Both blood and cell samples were centrifuged at low temperature. The concentration of IL-18, IL-1β, myeloperoxidase (MPO), d-lactic acid (D-LA) (all of them in serum and only IL-18 and IL-1β in cell samples) was measured using commercially available ELISA kits (Xitang Biological Technology Company, Shanghai, China). The OD value was measured on a microplate reader and sample concentration was obtained using a standard curve. Samples were assayed in duplicate according to the product specification. Statistical analysis Statistical analyses were performed using SPSS19.0 software. Data were expressed as mean ± SD and compared using the independent samples t-test after determination of normal distribution and equal variance. Mann–Whitney U was performed for rating information. P < 0.05 was considered statistically significant. Results Reliability of the IBS model The AWR score of the IBS group was significantly higher than that of the control group at 20, 40, and 60 mm Hg pressure dilation (P < 0.05; Fig. 1 and Table 2), while no difference was observed between the two groups at 80 mm Hg (Fig. 1 and Table 2). This result was indicative of visceral hypersensitivity in the IBS model mice; therefore the IBS model was successfully established. The AWR score of the Clostridium butyricum group was lower than that of the IBS group at 20, 40, and 60 mm Hg pressure dilation (P < 0.05; Fig. 1 and Table 2), suggesting that Clostridium butyricum could effectively reduce the degree of intestinal sensitivity and restore intestinal physiological function. Table 2. AWR scores at pressure from 20 to 80 mm Hg Groups  Mice number  Pressure/mm Hg  20  40  60  80  Control  8  0.88 ± 0.33  1.58 ± 0.55  2.40 ± 0.50  3.30 ± 0.56  IBS  8  1.40 ± 0.50a  2.28 ± 0.45a  3.28 ± 0.51a  3.48 ± 0.51b  Clostridium  8  1.15 ± 0.36c  2.02 ± 0.42c  2.80 ± 0.61c  3.43 ± 0.51d  Groups  Mice number  Pressure/mm Hg  20  40  60  80  Control  8  0.88 ± 0.33  1.58 ± 0.55  2.40 ± 0.50  3.30 ± 0.56  IBS  8  1.40 ± 0.50a  2.28 ± 0.45a  3.28 ± 0.51a  3.48 ± 0.51b  Clostridium  8  1.15 ± 0.36c  2.02 ± 0.42c  2.80 ± 0.61c  3.43 ± 0.51d  aP < 0.05 vs. control group. bP > 0.05 vs. control group. cP < 0.05 vs. IBS group. dP > 0.05 vs. IBS group. Figure 1. View largeDownload slide AWR scores at pressure from 20 to 80 mm Hg IBS group intestinal sensitivity increased significantly compared with the control group, as shown by the enhanced degree of abdominal contractions (*P < 0.05). The degree of abdominal contraction was remarkably lower in the Clostridium butyricum group compared with the IBS group (*P < 0.05), and the intestinal sensitivity was decreased after seven continuous days of intragastrical Clostridium butyricum adminstration. n.s. P > 0.05. Figure 1. View largeDownload slide AWR scores at pressure from 20 to 80 mm Hg IBS group intestinal sensitivity increased significantly compared with the control group, as shown by the enhanced degree of abdominal contractions (*P < 0.05). The degree of abdominal contraction was remarkably lower in the Clostridium butyricum group compared with the IBS group (*P < 0.05), and the intestinal sensitivity was decreased after seven continuous days of intragastrical Clostridium butyricum adminstration. n.s. P > 0.05. Expression of NLRP6 inflammasomes, CD172a, IL-18, and IL-1β protein NLRP6 protein expression was remarkably decreased in the colon of IBS group mice compared with control group (0.55 ± 0.06 and 1.00 ± 0.08, respectively, P < 0.05). CD172a, IL-18, and IL-1β protein expressions were increased in the colon of IBS group mice at the same time (1.52 ± 0.18 vs. 1.00 ± 0.12, 1.83 ± 0.22 vs. 1.00 ± 0.16, and 1.70 ± 0.21 vs. 1.00 ± 0.09, respectively, P < 0.05), while no difference was observed in Caspase-1, ASC, and CARD8 protein expressions between the above groups (Fig. 2 and Table 3). However, NLRP6 expression was higher in the Clostridium butyricum group than that in the IBS group (0.81 ± 0.09 vs. 0.55 ± 0.06, P < 0.05). Meanwhile, CD172a, IL-18, and IL-1β protein expressions were decreased in the Clostridium butyricum group (Fig. 2 and Table 3). NLRP6 protein expression in the terminal ileum of IBS group mice was increased compared with that in the control group (1.83 ± 0.16 vs. 1.00 ± 0.06, P < 0.05; Fig. 3 and Table 3). NLRP6, Caspase-1, and ASC protein expressions were significantly decreased after the NLRP6 gene was silenced compared with the blank group (P < 0.05; Fig. 4), which implied a successful transfection. Table 3. The relative protein expression in colon and terminal ileum tissue Protein  Control  IBS  Clostridium  NLRP6 (colon)  1.00 ± 0.08  0.55 ± 0.06a  0.81 ± 0.09b  Caspase-1 (colon)  1.00 ± 0.11  1.12 ± 0.14c  1.13 ± 0.12d  Asc (colon)  1.00 ± 0.12  1.20 ± 0.17c  1.04 ± 0.13d  CARD8 (colon)  1.00 ± 0.12  1.11 ± 0.14c  1.13 ± 0.15d  CD172a (colon)  1.00 ± 0.12  1.52 ± 0.18a  1.04 ± 0.11b  IL-18 (colon)  1.00 ± 0.16  1.83 ± 0.22a  1.19 ± 0.19b  IL-1β (colon)  1.00 ± 0.09  1.70 ± 0.21a  1.12 ± 0.09b  NLRP6 (terminal ileum)  1.00 ± 0.06  1.83 ± 0.16e  1.61 ± 0.17f  Caspase-1 (terminal ileum)  1.00 ± 0.07  1.40 ± 0.12e  1.32 ± 0.09f  Asc (terminal ileum)  1.00 ± 0.15  1.74 ± 0.26e  1.43 ± 0.22f  CARD8 (terminal ileum)  1.00 ± 0.11  1.73 ± 0.19e  1.67 ± 0.20f  CD172a (terminal ileum)  1.00 ± 0.11  1.04 ± 0.11g  1.03 ± 0.11f  IL-18 (terminal ileum)  1.00 ± 0.17  0.99 ± 0.17g  1.01 ± 0.16f  IL-1β (terminal ileum)  1.00 ± 0.15  0.88 ± 0.13g  0.88 ± 0.11f  Protein  Control  IBS  Clostridium  NLRP6 (colon)  1.00 ± 0.08  0.55 ± 0.06a  0.81 ± 0.09b  Caspase-1 (colon)  1.00 ± 0.11  1.12 ± 0.14c  1.13 ± 0.12d  Asc (colon)  1.00 ± 0.12  1.20 ± 0.17c  1.04 ± 0.13d  CARD8 (colon)  1.00 ± 0.12  1.11 ± 0.14c  1.13 ± 0.15d  CD172a (colon)  1.00 ± 0.12  1.52 ± 0.18a  1.04 ± 0.11b  IL-18 (colon)  1.00 ± 0.16  1.83 ± 0.22a  1.19 ± 0.19b  IL-1β (colon)  1.00 ± 0.09  1.70 ± 0.21a  1.12 ± 0.09b  NLRP6 (terminal ileum)  1.00 ± 0.06  1.83 ± 0.16e  1.61 ± 0.17f  Caspase-1 (terminal ileum)  1.00 ± 0.07  1.40 ± 0.12e  1.32 ± 0.09f  Asc (terminal ileum)  1.00 ± 0.15  1.74 ± 0.26e  1.43 ± 0.22f  CARD8 (terminal ileum)  1.00 ± 0.11  1.73 ± 0.19e  1.67 ± 0.20f  CD172a (terminal ileum)  1.00 ± 0.11  1.04 ± 0.11g  1.03 ± 0.11f  IL-18 (terminal ileum)  1.00 ± 0.17  0.99 ± 0.17g  1.01 ± 0.16f  IL-1β (terminal ileum)  1.00 ± 0.15  0.88 ± 0.13g  0.88 ± 0.11f  aP < 0.05 vs. control group. bP < 0.05 vs. IBS group. cP > 0.05 vs. control group. dP > 0.05 vs. IBS group. eP < 0.05 vs. IBS group. fP > 0.05 vs. IBS group. gP > 0.05 vs. control group. Figure 2. View largeDownload slide Relative expression of proteins in colon tissue (A) Changes of the expressions of inflammasome proteins and inflammatory factors in mice colon. (B) Statistical analysis of protein expression. *P < 0.05, n.s. P > 0.05. Figure 2. View largeDownload slide Relative expression of proteins in colon tissue (A) Changes of the expressions of inflammasome proteins and inflammatory factors in mice colon. (B) Statistical analysis of protein expression. *P < 0.05, n.s. P > 0.05. Figure 3. View largeDownload slide Relative expression proteins in terminal ileum tissue (A) Changes of the expression of inflammasome proteins and inflammatory factors in mice terminal ileum. (B) Statistical analysis of protein expression. *P < 0.05. Figure 3. View largeDownload slide Relative expression proteins in terminal ileum tissue (A) Changes of the expression of inflammasome proteins and inflammatory factors in mice terminal ileum. (B) Statistical analysis of protein expression. *P < 0.05. Figure 4. View largeDownload slide Effect of NLRP6 silencing on the expression of proteins (A) Changes of the expression of inflammasome proteins after NLRP6 silencing. (B) Statistical analysis of protein expression. *P < 0.05. Figure 4. View largeDownload slide Effect of NLRP6 silencing on the expression of proteins (A) Changes of the expression of inflammasome proteins after NLRP6 silencing. (B) Statistical analysis of protein expression. *P < 0.05. Expression of NLRP6 inflammasomes RNA The expressions of NLRP6, Caspase-1, and ASC mRNA did not show any significant difference after stress exposure (Table 4). In addition, no significant difference was observed between the Clostridium butyricum group and IBS group in the colon tissue (Table 4). According to the above results, we could deduce that NLRP6 gene expression was regulated at the translation level. Table 4. The relative expression of mRNA in colon tissue Groups  NLRP6  Caspase-1  ASC  Control  1.01 ± 0.06  1.01 ± 0.06  1.00 ± 0.04  IBS  0.96 ± 0.04a  0.98 ± 0.06a  0.98 ± 0.04a  Clostridium  1.09 ± 0.05b  1.02 ± 0.05b  1.07 ± 0.03b  Groups  NLRP6  Caspase-1  ASC  Control  1.01 ± 0.06  1.01 ± 0.06  1.00 ± 0.04  IBS  0.96 ± 0.04a  0.98 ± 0.06a  0.98 ± 0.04a  Clostridium  1.09 ± 0.05b  1.02 ± 0.05b  1.07 ± 0.03b  aP > 0.05 vs. control group. bP > 0.05 vs. IBS group. Expression of NLRP6 in colon and terminal ileum mucosa The number of NLRP6-positive cells in the colon mucous layer was significantly lower in the IBS group mice than in the control group mice (0.22 ± 0.01 vs. 0.31 ± 0.01, P < 0.01; Fig. 5 and Table 5), while it was higher in the Clostridium butyricum group mice than in the IBS group mice (0.29 ± 0.01 vs. 0.22 ± 0.01, P < 0.01; Fig. 5 and Table 5). However, NLRP6 expression in the terminal ileum mucous layer of IBS group mice was increased compared with that in the control group mice (0.36 ± 0.02 vs. 0.30 ± 0.01, P < 0.01; Table 5), and Clostridium butyricum did not work when compared with IBS group (0.34 ± 0.02 vs. 0.36 ± 0.02, Table 5). Table 5. Colon and terminal ileum tissue average integral optical density value Groups  NLRP6 (colon)  NLRP6 (terminal ileum)  Control  0.31 ± 0.01  0.30 ± 0.01  IBS  0.22 ± 0.01a  0.36 ± 0.02c  Clostridium  0.29 ± 0.01b  0.34 ± 0.02d  Groups  NLRP6 (colon)  NLRP6 (terminal ileum)  Control  0.31 ± 0.01  0.30 ± 0.01  IBS  0.22 ± 0.01a  0.36 ± 0.02c  Clostridium  0.29 ± 0.01b  0.34 ± 0.02d  aP < 0.01 vs. control group. bP < 0.01 vs. IBS group. cP < 0.05 vs. control group, dP > 0.05 vs. IBS group. Figure 5. View largeDownload slide NLRP6 expression in mice colon (A) Control group. (B) IBS group. (C) Clostridium butyricum group; × 400-fold. Figure 5. View largeDownload slide NLRP6 expression in mice colon (A) Control group. (B) IBS group. (C) Clostridium butyricum group; × 400-fold. Pathological changes in colon and terminal ileum mucosa Pathological analysis of colon segments from IBS group mice revealed low grade mucosal inflammation (LGMI; Fig. 6B). In contrast, control group mice showed normal pathology (Fig. 6A). Pathology score in IBS group was 1.25 ± 0.16, and in the control group was 0.38 ± 0.18, which showed significant difference (P < 0.01; Table 6). After Clostridium butyricum treatment, inflammatory cell infiltration in mice was alleviated (P < 0.01; Fig. 6C and Table 6). However, mice terminal ileum in the IBS group did not show any change in inflammatory cells infiltration compared with that in the control group (P > 0.05; Table 6). Table 6. Pathology Score of colon and terminal ileum tissue Groups  Pathology score (colon)  Pathology score (terminal ileum)  Control  0.38 ± 0.18  0.33 ± 0.21  IBS  1.25 ± 0.16a  0.50 ± 0.22c  Clostridium  0.50 ± 0.19b  0.50 ± 0.34d  Groups  Pathology score (colon)  Pathology score (terminal ileum)  Control  0.38 ± 0.18  0.33 ± 0.21  IBS  1.25 ± 0.16a  0.50 ± 0.22c  Clostridium  0.50 ± 0.19b  0.50 ± 0.34d  aP < 0.01 vs. control group. bP < 0.01 vs. IBS group. cP > 0.05 vs. control group. dP > 0.05 vs. IBS group. Figure 6. View largeDownload slide Pathological changes in colon mucosa (A) Colonic segment from a control group mouse, showing no pathologies. No clear inflammation and tissue congestion in the control group, mucosal epithelium is intact. (B) Colonic segment from an IBS group mouse, showing LGMI: infiltration of neutrophils in the mucous layer, congested tissue, although glands were neatly arranged, no crypt structure changed, no fibrous tissue hyperplasia, no granulation tissue formation. (C) Colonic segment from a Clostridium butyricum mouse, showing improvement of colon inflammatory cells infiltration. Black arrow: neutrophils; × 400-fold. Figure 6. View largeDownload slide Pathological changes in colon mucosa (A) Colonic segment from a control group mouse, showing no pathologies. No clear inflammation and tissue congestion in the control group, mucosal epithelium is intact. (B) Colonic segment from an IBS group mouse, showing LGMI: infiltration of neutrophils in the mucous layer, congested tissue, although glands were neatly arranged, no crypt structure changed, no fibrous tissue hyperplasia, no granulation tissue formation. (C) Colonic segment from a Clostridium butyricum mouse, showing improvement of colon inflammatory cells infiltration. Black arrow: neutrophils; × 400-fold. Expression of downstream cytokines in cell supernatant and mice serum IL-1β and IL-18 protein levels in Caco-2 cell supernatant was 126.70 and 155.30 pg/ml, respectively, in the NLRP6 silencing group, while it was 73.94 and 88.55 pg/ml, respectively, in the control group, which showed significant difference for both proteins (P < 0.05; Table 7). IL-1β, IL-18, MPO, and D-LA protein expressions in serum between the control and IBS groups were statistically different (P < 0.05; Table 7). Serum IL-1β, IL-18, D-LA, and MPO levels were lower in the Clostridium butyricum group than in the IBS group (all P < 0.05; Table 7). Table 7. Downstream cytokines protein expression in Caco-2 cell supernatant and mice serum (pg/ml) Groups  IL-1β  IL-18  MPO  D-LA  Cell supernatant   Blank  73.94 ± 4.80  88.55 ± 3.58       NLRP6 siRNA  126.70 ± 4.30a  155.30 ± 8.39a      Mice serum   Control  55.41 ± 3.17  148.30 ± 6.78  19.52 ± 0.67  1.69 ± 0.10   IBS  101.40 ± 6.18b  229.70 ± 14.64b  49.41 ± 1.46b  2.95 ± 0.07b   Clostridium  82.92 ± 5.75c  176.10 ± 10.65c  24.01 ± 1.39c  2.24 ± 0.07c  Groups  IL-1β  IL-18  MPO  D-LA  Cell supernatant   Blank  73.94 ± 4.80  88.55 ± 3.58       NLRP6 siRNA  126.70 ± 4.30a  155.30 ± 8.39a      Mice serum   Control  55.41 ± 3.17  148.30 ± 6.78  19.52 ± 0.67  1.69 ± 0.10   IBS  101.40 ± 6.18b  229.70 ± 14.64b  49.41 ± 1.46b  2.95 ± 0.07b   Clostridium  82.92 ± 5.75c  176.10 ± 10.65c  24.01 ± 1.39c  2.24 ± 0.07c  aP < 0.01 vs. control group in cell supernatant. bP < 0.01 vs. control group in mice serum. cP < 0.05 vs. IBS group in mice serum. Disscussion IBS is considered as a brain-intestinal axis of physiological regulation disorders disease. It reflects a connection between brain and intestine, since brain stress can aggravate intestinal disorders due to IBS. Chadwick et al. [15] found that 40% IBS patients’ colorectal biopsy specimens showed non-specific inflammatory manifestations, such as neutrophils, mast cells and T cell infiltration, indicating IBS patients with intestinal mucosal inflammation. It is often referred to as low inflammation. Visceral hypersensitivity is one of the characteristics of IBS [16]. It has also been shown that low grade inflammation of mucous can activate visceral hypersensitivity, which is quite common in IBS patients, and it is considered to play vital roles in IBS pathogenesis [10]. Consistent with a previous study [17], this study also showed that WAS in mice induced visceral hypersensitivity to colonic distension, which is an IBS pathologic feature. In addition, intestinal flora disorders were found in both IBS patients and animal models. Kassinen et al. [18] discovered that the number of Lactobacillus and Bifidobacterium was decreased in the stool of IBS patients, while the amount of facultative anaerobic bacteria, mainly Streptococcus and Escherichia coli, is increased. Intestinal microflora plays an important role in maintaining intestinal stability, reducing intestinal sensitivity in IBS patients and restoring normal intestinal function significantly, but its mechanism has not been clarifyied yet. NLRP6 is the upstream regulatory factor in transferring inflammatory signaling and can connect Caspase-1, ASC and CARD8 to form NLRP6 inflammasome through the function of protein-protein junction of the N-terminal PYD domain [19,20], which can negatively regulate the NF-κB and MAPK signaling pathways [21], adjust and control cells to produce IL-1β, IL-18 and other cytokines [22,23] involved in the inflammatory response and innate immune response. NLRP6 inflammasome plays a vital role in restraining the inflammatory response, promoting intestinal mucosal repair, and preventing the occurrence of intestinal tumors, and is involved in the anti-bacterial immune response. NLRP6-deficient mice showed an inhibition in the activation of NF-κB and MAPK, resulting in apoptosis promotion and inflammation inhibition [4,24]. So far, studies on the relationship between Clostridium butyricum and NLRP6 in IBS visceral hypersensitivity induced by stress are still lacking. In this study, we reported that Clostridium butyricum might play a beneficial role in visceral hypersensitivity of IBS by inhibiting low grade inflammation of colonic mucous through its action on NLRP6. Our present results showed that NLRP6 expression in the IBS group colon was lower than that in the control group, while its ligand Caspase-1, ASC, and CARD8 showed no significant change, indicating that NLRP6 protein was mainly involved in IBS. This study also disclosed that the level of IL-18 and IL-1β, downstream NLRP6 signaling pathway factors, was up-regulated in the IBS group, which was consistent with existing research [25,26]. The higher IL-18 and IL-1β level after NLRP6 gene silencing confirmed the correlation between NLRP6 and IL-18 and IL-1β. CD172a expression, which represented the inflammation degree was increased in the colon mucosa of IBS group. The pathological score suggested low inflammation in colonic mucous, and mice visceral hypersensitivity in the IBS group was higher than that in the control group. We propose that the absence of colon NLRP6 due to WAS may lead to the up-regulation of its downstream effectors IL-18 and IL-1β, resulting in low inflammation of colonic mucous, thus causing high visceral hypersensitivity in IBS. It is worth mentioning that the expression of NLRP6 inflammasomes in the terminal ileum of IBS mice was increased, which is consistent with a previous study by Hou et al. [27]. H&E staining revealed unconspicuous inflammation, with no clear change in IL-18 and IL-1β concentration, indicating that IBS low grade inflammation occurred in the colon rather than the terminal ileum. We hypothesize that the small intestine has a self-adjusting function in response to stress, which might lead to the increase in NLRP6 expression, so that IL-18 and IL-1β secretion remained in equilibrium, thus weakening the ileal inflammatory response. However, more experiments and investigations are needed to confirm this hypotesis. Probiotics can alleviate IBS symptoms effectively, which may be related to the regulation of intestinal flora, intestinal inflammatory factors, and visceral hypersensitivity [27,28]. Clostridium butyricum affects the intestinal immune homeostasis through regulating the intestinal mucosa Treg cell differentiation. The fermentation product of butyric acid has anti-inflammatory beneficial effects on epithelial cells [29]. This is consistent with our results showing a reducition of intestinal inflammation after Clostridium butyricum treatment. D-LA is the metabolite of bacterial fermentation that reflects intestinal mucosal epithelial cell permeability and intestinal barrier function. Samira et al. [30] found that MPO is elevated in IBS patients with colonic mucosal pathological changes. Thus, MPO level is one of the indicator of peroxidation and inflammation in the intestinal mucosa. Our research revealed that NLRP6 expression was increased, while the levels of IL-18 and IL-1β were remarkably decreased in the colon mucosa of Clostridium butyricum group. Furthermore, we also found that the levels of D-LA, MPO, CD172a in Clostridium butyricum group were decreased and inflammatory infiltration in the colonic mucosal layer was reduced. Mice visceral hypersensitivity in the Clostridium butyricum group was also significantly lower than that in the IBS group, implying that Clostridium butyricum could promote NLRP6 protein expression, further down-regulate the expressions of IL-18 and IL-1β, and inhibit the inflammation to restore the intestinal mucosal barrier function, thus regulating the visceral hypersensitivity of IBS mice. In summary, our findings provided evidence that NLRP6 is involved in IBS pathogenesis. Exposure to stress may inhibit NLRP6 expression and alter the composition of the gut microbiota, leading to intestinal inflammation. Persistent low levels of inflammation may increase intestinal visceral sensitivity, while treatment with Clostridium butyricum may reverse these results, exerting a beneficial effect. An increased attention is nowadays paid on the role of inflammatory factors and intestinal microecology in functional gastrointestinal diseases. As an immune-related gene, NLRP6 acts as a ‘guard’ in inducing intestinal bacterial products or cell damage, which can regulate the production of IL-18, IL-1β to inhibit intestinal inflammation and prevent intestinal microecological imbalance. In conclusion, our findings might explain the benefits of probiotics, especially Clostridium butyricum, in patients with stress-associated gastrointestinal disorders. Confirmation of a causal relationship between NLRP6 and visceral sensitivity in IBS patients may further validate the clinical use of probiotics to treat IBS. Our results suggest that NLRP6 may be an important target in the development of a novel therapy against stressed-induced intestinal disorders. Funding This work was supported by grants from the National Natural Science Foundation of China (Nos. 81470814 and 81400594) and Zhejiang Provincial Natural Science Foundation of China (No. LQ14H160014). References 1 Wang XY, Zarate N, Soderholm JD, Bourgeois JM, Liu LW, Huizinga JD. Ultrastructural injury to interstitial cells of Cajal and communication with mast cells in Crohn’s disease. Neurogastroenterol Motil  2007, 19: 349– 364. Google Scholar CrossRef Search ADS PubMed  2 Tornblom H, Lindberg G, Nyberg B, Veress B. Full-thickness biopsy of the jejunum reveals inflammation and enteric neuropathy in irritable bowel syndrome. Gastroenterology  2002, 123: 1972– 1979. Google Scholar CrossRef Search ADS PubMed  3 Konturek PC, Brzozowski T, Konturek SJ. Stress and the gut: pathophysiology, clinical consequences, diagnostic approach and treatment options. J Physiol Pharmacol  2011, 62: 591– 599. Google Scholar PubMed  4 Chen GY, Liu M, Wang F, Bertin J, Nunez G. A functional role for Nlrp6 in intestinal inflammation and tumorigenesis. J Immunol  2011, 186: 7187– 7194. Google Scholar CrossRef Search ADS PubMed  5 Chen GY, Stappenbeck TS. Mucus, it is not just a static barrier. Sci Signal  2014, 7: pe11. Google Scholar CrossRef Search ADS PubMed  6 Elinav E, Strowig T, Kau AL, Henao-Mejia J, Thaiss CA, Booth CJ, Peaper DR, et al.  . NLRP6 inflammasome regulates colonic microbial ecology and risk for colitis. Cell  2011, 145: 745– 757. Google Scholar CrossRef Search ADS PubMed  7 Round JL, Mazmanian SK. The gut microbiota shapes intestinal immune responses during health and disease. Nat Rev Immunol  2009, 9: 313– 323. Google Scholar CrossRef Search ADS PubMed  8 Hungin AP, Mulligan C, Pot B, Whorwell P, Agreus L, Fracasso P, Lionis C, et al.  . Systematic review: probiotics in the management of lower gastrointestinal symptoms in clinical practice—an evidence-based international guide. Aliment Pharmacol Ther  2013, 38: 864– 886. Google Scholar CrossRef Search ADS PubMed  9 La JH, Kim TW, Sung TS, Kang JW, Kim HJ, Yang IS. Visceral hypersensitivity and altered colonic motility after subsidence of inflammation in a rat model of colitis. World J Gastroenterol  2003, 9: 2791– 2795. Google Scholar CrossRef Search ADS PubMed  10 Wang CD, Zheng XY, Zheng WW, Gastroenterology DO. Dextran sulfate sodium-induced low grade mucosal inflammation activates visceral hypersensitivity in rats. World Chin J Digestol  2009, 17: 1621– 1625. Google Scholar CrossRef Search ADS   11 Baitsch L, Fuertes-Marraco SA, Legat A, Meyer C, Speiser DE. The three main stumbling blocks for anticancer T cells. Trends Immunol  2012, 33: 364– 372. Google Scholar CrossRef Search ADS PubMed  12 Cameron HL, Perdue MH. Stress impairs murine intestinal barrier function: improvement by glucagon-like peptide-2. J Pharmacol Exp Ther  2005, 314: 214– 220. Google Scholar CrossRef Search ADS PubMed  13 Al-Chaer ED, Kawasaki M, Pasricha PJ. A new model of chronic visceral hypersensitivity in adult rats induced by colon irritation during postnatal development. Gastroenterology  2000, 119: 1276– 1285. Google Scholar CrossRef Search ADS PubMed  14 Kruschewski M, Foitzik T, Perez-Cantó A, Hübotter A, Buhr HJ. Changes of colonic mucosal microcirculation and histology in two colitis models: an experimental study using intravital microscopy and a new histological scoring system. Dig Dis Sci  2001, 46: 2336– 2343. Google Scholar CrossRef Search ADS PubMed  15 Chadwick VS, Chen W, Shu D, Paulus B, Bethwaite P, Tie A, Wilson I. Activation of the mucosal immune system in irritable bowel syndrome. Gastroenterology  2002, 122: 1778– 1783. Google Scholar CrossRef Search ADS PubMed  16 Azpiroz F, Bouin M, Camilleri M, Mayer EA, Poitras P, Serra J, Spiller RC. Mechanisms of hypersensitivity in IBS and functional disorders. Neurogastroenterol Motil  2007, 19: 62– 88. Google Scholar CrossRef Search ADS PubMed  17 Larsson MH, Miketa A, Martinez V. Lack of interaction between psychological stress and DSS-induced colitis affecting colonic sensitivity during colorectal distension in mice. Stress  2009, 12: 434– 444. Google Scholar CrossRef Search ADS PubMed  18 Kassinen A, Krogius-Kurikka L, Makivuokko H, Rinttila T, Paulin L, Corander J, Malinen E, et al.  . The fecal microbiota of irritable bowel syndrome patients differs significantly from that of healthy subjects. Gastroenterology  2007, 133: 24– 33. Google Scholar CrossRef Search ADS PubMed  19 Chen GY. Role of Nlrp6 and Nlrp12 in the maintenance of intestinal homeostasis. Eur J Immunol  2014, 44: 321– 327. Google Scholar CrossRef Search ADS PubMed  20 Srinivasula SM, Poyet JL, Razmara M, Datta P, Zhang Z, Alnemri ES. The PYRIN-CARD protein ASC is an activating adaptor for caspase-1. J Biol Chem  2002, 277: 21119– 21122. Google Scholar CrossRef Search ADS PubMed  21 Anand PK, Malireddi RK, Lukens JR, Vogel P, Bertin J, Lamkanfi M, Kanneganti TD. NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens. Nature  2012, 488: 389– 393. Google Scholar CrossRef Search ADS PubMed  22 Kempster SL, Belteki G, Forhead AJ, Fowden AL, Catalano RD, Lam BY, McFarlane I, et al.  . Developmental control of the Nlrp6 inflammasome and a substrate, IL-18, in mammalian intestine. Am J Physiol Gastrointest Liver Physiol  2011, 300: 253– 263. Google Scholar CrossRef Search ADS   23 Lee SH, Stehlik C, Reed JC. Cop, a caspase recruitment domain-containing protein and inhibitor of caspase-1 activation processing. J Biol Chem  2001, 276: 34495– 34500. Google Scholar CrossRef Search ADS PubMed  24 Normand S, Delanoye-Crespin A, Bressenot A, Huot L, Grandjean T, Peyrin-Biroulet L, Lemoine Y, et al.  . Nod-like receptor pyrin domain-containing protein 6 (NLRP6) controls epithelial self-renewal and colorectal carcinogenesis upon injury. Proc Natl Acad Sci USA  2011, 108: 9601– 9606. Google Scholar CrossRef Search ADS PubMed  25 Liang H, Wang S, Yanqing LI, Wang F. Analysis on expression imbalance of peripheral blood inflammatory cytokines in patients with irritable bowel syndrome. Chin J Gastroenterol  2008, 13: 111– 113. 26 Song JZ, Wang QM, Zheng-Xiang WU, Zheng BH, Jia YG, Zhang ML. Changes of serum interleukin-1β,interleukin-10 and cortisol in patients with irritable bowel syndrome. Modern Diagn Treat  2005, 16: 68– 69. 27 Qian W, Liu N, Song J, Hou XH, Gastroenterology DO, Hospital U. Bifidobacterium longum regulates the visceral hypersensitivity of PI-IBS by inhibiting NLRP6 inflammasome. Chin J Clin Gastroenterol  2014, 26: 257– 262. 28 Dai C, Zheng CQ, Jiang M, Ma XY, Jiang LJ. Probiotics and irritable bowel syndrome. World J Gastroenterol  2013, 19: 5973– 5980. Google Scholar CrossRef Search ADS PubMed  29 Furusawa Y, Obata Y, Fukuda S, Endo TA, Nakato G, Takahashi D, Nakanishi Y, et al.  . Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature  2013, 504: 446– 450. Google Scholar CrossRef Search ADS PubMed  30 Khaldi S, Gargala G, Le Goff L, Parey S, Francois A, Fioramonti J, Ballet JJ, et al.  . Cryptosporidium parvum isolate-dependent postinfectious jejunal hypersensitivity and mast cell accumulation in an immunocompetent rat model. Infect Immun  2009, 77: 5163– 5169. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Acta Biochimica et Biophysica Sinica Oxford University Press

Clostridium butyricum regulates visceral hypersensitivity of irritable bowel syndrome by inhibiting colonic mucous low grade inflammation through its action on NLRP6

Loading next page...
 
/lp/ou_press/clostridium-butyricum-regulates-visceral-hypersensitivity-of-irritable-5RJUPsET5G
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
1672-9145
eISSN
1745-7270
D.O.I.
10.1093/abbs/gmx138
Publisher site
See Article on Publisher Site

Abstract

Abstract Visceral hypersensitivity induced by stress is quite common in irritable bowel syndrome (IBS) patients. Probiotics play an important role in reducing visceral hypersensitivity in IBS patients. However, the mechanism has not been clearly elucidated. In this study, we investigated the role of nod-like receptor pyrin domain-containing protein 6 (NLRP6) in Clostridium butyricum-regulated IBS induced by stress. Our results showed that NLRP6 was down-regulated in IBS group colon tissues. In addition, IL-18, IL-1β, myeloperoxidase (MPO), d-lactic acid (D-LA), and CD172a were up-regulated in the IBS group of colonic mucous. IL-18 and IL-1β were also increased after the NLRP6 gene was silenced. Pathological score suggested low inflammation of colonic mucous rather than terminal ileum. Water-avoidance stress (WAS) showed visceral hypersensitivity to colonic distension. However, treatment with Clostridium butyricum reversed these results, exerting a beneficial effect. In conclusion, Clostridium butyricum may exert a beneficial action on visceral hypersensitivity of IBS by inhibiting low grade inflammation of colonic mucous through its action on NLRP6. irritable bowel syndrome, nod-like receptor pyrin domain-containing protein 6, Clostridium butyricum, low grade mucosal inflammation, inflammatory factors Introduction Irritable bowel syndrome (IBS) is the most common type of functional gastrointestinal disease characterized by abdominal intermittent or continuous pain, abdominal discomfort, and changes in bowel evacuation habits. Brain–gut communication dysfunction, integrity of mucosa, and inflammation, as well as psychosocial factors, may play roles in IBS pathogenesis [1]. In recent years, more and more studies have revealed that IBS patients are also affected by low grade mucosal inflammation (LGMI) [2]. Gastrointestinal responses to stress include alterations in motility, visceral hypersensitivity, and intestinal permeability. In addition, psychosocial stress alters brain–gut interactions and may intensify a wide range of disorders, including IBS [3]. Nod-like receptor pyrin domain-containing protein 6 (NLRP6) is the first member of the NLR protein family that inhibits the innate immune response-related signaling pathways [4], thus inhibiting inflammation, promoting intestinal lesions healing, and modulating intestinal flora. A recent study [5] has shown that NLRP6 plays an important role in repairing intestinal mucosa, avoiding the spread of epithelial cell damage, and promoting goblet cell autophagy and mucus secretion, so as to maintain the stability of the intestinal internal environment. Furthermore, NLRP6 inflammasome plays a significant role in the intestinal flora and intestinal immune system. Indeed, chemical-induced colitis becomes more severe after NLRP6 silencing in mice and the intestinal flora composition is also significantly altered [6]. Healthy microbiota maintenance requires nucleotide binding oligomerization domain protein-like receptors, containing pyrin domain NLRP6 inflammasomes. Alterations in the intestinal microbiota have been associated with IBS. IBS patients show a significant reduction in intestinal beneficial bacteria, such as latic acid bacteria and bifidobacteria, which disturb the balance of the normal intestinal microbiota, leading to bacterial infection, intestinal flora imbalance, and consequent disease [7]. Therefore, probiotics play an important role in supplementing normal intestinal flora, correcting flora imbalance and maintaining intestinal stability, significantly reducing intestinal sensitivity and restoring normal intestinal function in IBS patients. However, the mechanism of action of probiotics against intestinal sensitivity has not been clarified yet [8]. Some studies [9,10] have shown that LGMI could activate visceral hypersensitivity, which underlies that IBS and NLRP6 [11] inflammasome plays a significant role in inhibiting inflammation. Hence, the objective of this study was to investigate whether Clostridium butyricum could modulate visceral hypersensitivity, as well as to understand its effect on NLRP6 to evaluate the benefits of probiotic therapy. To reach the above goal, the expression of NLRP6 and its downstream factors, intestinal mucosa inflammation, and visceral hypersensitivity were evaluated in stress-associated gastrointestinal disorders. Overall, our results demonstrated that Clostridium butyricum might play a beneficial role in the visceral hypersensitivity of IBS by inhibiting LGMI through its action on NLRP6. Materials and Methods Animals and IBS mice model Thirty C57BL/6 female mice (BK Experimental Animal Co., Ltd, Shanghai, China) weighing 15–20 g, 5–6 weeks old, were individually housed under controlled conditions (22°C ± 1°C, 65%–70% humidity) with a 12-h light/dark cycle for a week in the animal maintenance facility at the Zhejiang Chinese Medical University (Hangzhou, China). Water and food were provided ad libitum. All experimental protocols were performed according to the requirements of the China State Authority for Animal Research Conduct. Mice were randomly divided into three groups, eight mice per group: control group, IBS group, and Clostridium butyricum group. IBS group and Clostridium butyricum group mice were placed on a platform (3 × 3 × 6 cm) into a container (56 × 50 cm) containing approximately 5 cm of water (25°C) for 1 h daily (8 AM–9 AM, to decrease the circadian rhythmicity of sleep, thus modifying the nocturnal-diurnal difference) for 10 consecutive days [12]. The control group was not subject to any of these treatments. The Clostridium butyricum group received an intragastric administration of Clostridium butyricum (1.25 × 109 CFU/ml, 0.4 ml, provided by Shandong Kexing Bioproducts Co, Ltd, Jinan, China) once a day for 7 days, while the control and IBS groups were treated with an equal volume of saline once a day for the same number of days. To evaluate colorectal distension (CRD), a cervical catheter balloon was slowly placed 2 cm into the mice rectum and secured by taping the attached tube to the tail. Mice underwent CRD at a pressure from 20 to 80 mm Hg for 20 s, with 4-min pause between distensions. Each measurement was taken five times to ensure accuracy. The success of the model was determined by recording the abdominal withdrawal reflex (AWR). Using the semi-quantitative AWR test, mice AWR was evaluated as follows: 0, no behavioral response to CRD; 1, brief head movement only; 2, contraction of abdominal muscles; 3, abdomen lifting; 4, arching of the body and pelvis lifting. The stimulus intensity evoking visually identifiable contraction of the abdominal wall was recorded as CRD threshold intensity [13]. Tissue and blood collection Mice were euthanized after colorectal distension. Blood from the orbital venous plexus and tissues from the terminal ileum (2–3 cm length) and the colon close to the ileocecal portion (2–3 cm length) were collected under sterile conditions. Mice intestines were cut, washed with PBS to remove the fecal contents, opened longitudinally, placed immediately in 10% formaldehyde, and stored at room temperature or in liquid nitrogen at −80°C, respectively, until further use. Cell culture and cell transfection In order to determine the effect of NLRP6 inhibition on IL-18 and IL-1β, human epithelial colorectal adenocarcinoma cell Caco-2 (Cell Bank of the Chinese Academy of Sciences, Shanhai, China) was cultured in MEM with 10% fetal bovine serum (Gibco, Grand Island, USA) and 2 mM L-glutamine and incubated at 37°C, 5% CO2 for 48 h in 6-well plates at 1 × 106 cells per ml per well. Next, Caco-2 cells were transiently transfected with NLRP6 siRNA (sense: GCAGAUUGGUUGCUGCGCA dTdT, antisense: UGCGCAGCAACCAAUCUGC dTdT) and scrambled siRNA into 6-well plates using riboFECT™ CP transfection reagent (Ribobio, Guangzhou, China) according to the manufacturer’s instruction. Cells transfected with scrambled siRNA were used as control. About 48 h after transfection, cells were collected from each well and subject to protein analysis and ELISA. Western blot analysis Western blot analysis was used to determine NLRP6, cysteinyl aspartate specific proteinase-1 (caspase-1), activating signal cointegrator (ASC), caspase recruitment domain 8 (CARD8), signal regulatory protein alpha (SIRP alpha, designated CD172a), interleukin-18 (IL-18), and interleukin-1 beta (IL-1β) expression in mice colon and terminal ileum tissue. In brief, protein samples were separated using 10% SDS-PAGE and transferred onto PVDF membranes. Membranes were blocked with 5% nonfat milk in PBS containing 0.1% Tween-20 (Sigma, St Louis, USA) at 4°C overnight under gentle rocking and incubated with primary antibodies at 4°C. Membranes were washed three times and probed with goat anti-rabbit secondary antibody (1:4000; Dawen, Hangzhou, China) for 2 h at room temperature. Immunoblots were visualized using an ECL detection kit (Amersham Biosciences, Pittsburgh, USA) and exposed to X-ray films. The primary antibodies (Abs) used in this study were as follows: rabbit polyclonal anti-mouse NLRP6 Ab (1:500; Sigma); rabbit monoclonal anti-Caspase-1 Ab (1:5000; Abcam, Cambridge, UK); rabbit monoclonal anti-ASC Ab (1:1000; CST, Boston, USA); rabbit polyclonal anti-NLRP6 Ab (1:400; Abcam); rabbit polyclonal anti-Caspase-1 Ab (1:500; CST); rabbit monoclonal anti-ASC Ab (1:200; CST); rabbit polyclonal anti-pre-IL-18 Ab (1:1000; Proteintech, Wuhan, China); rabbit monoclonal anti-IL-1 beta Ab (1:200; Abcam); rabbit polyclonal anti-SIRP alpha Ab (CD172a, 1:800; Proteintech); rabbit polyclonal anti-CARD8 Ab (1:1000; Abcam). RT-PCR Total RNA was extracted from tissues and cells using Takara Minibest Universal RNA Extraction kit (Takara, Dalian, China) following the manufacturer’s instructions. PrimeScript™RT Master mix (Takara) was used for reverse transcription reactions with 0.5 μg of total RNA. Amplification was performed on a GeneAmp PCR system (Bio-Rad Laboratories, Hercules, USA). Quantitative polymerase chain reaction (qPCR) solution contained 5 μl of 2 × SYBR Premix Ex Taq II (Takara), 0.4 μl of each PCR primer (Sangon, Shanghai, China) designed by Primer Premier 6.0 and Beacon designer 7.8 software (Table 1), 0.2 μl of Rox reference dye, 1 μl of cDNA template, and 3 μl of dH2O, for a total of 10 μl reaction volume. Cycling conditions were as follows: pre-denaturation at 95°C for 30 s, followed by 40 cycles consisting of denaturation at 95°C for 5 s and annealing at 60°C for 34 s, and eventually into the dissociation stage. Each sample was measured three times and RNA relative expression was calculated using the 2−ΔΔCt method. Table 1. Sequences of primers used in this study Symbols  mRNA sequence  Forward primers  Reverse primers  hβ-actin  GACTTAGTTGCGTTACACCCTTTC  GCTGTCACCTTCACCGTTCC  hNLRP6  CAGTTCTCAAGGCACCACAA  TCACTCAGCATACGCAGTCC  hCaspase-1  AGGCATGACAATGCTGCTAC  TGGGACTTGCTCAGAGTGTTTC  hAscF  AAGCCAGGCCTGCACTTTATAGAC  CCAGGCTGGTGTGAAACTGA  mGAPDH  AGGTCGGTGTGAACGGATTTG  TGTAGACCATGTAGTTGAGGTCA  mNLRP6  TGACCAGAGCTTCCAGGAGT  TTTAGCAGGCCAAAGAGGAA  mCaspase-1  CACAGCTCTGGAGATGGTGA  CTTTCAAGCTTGGGCACTTC  mASC  ACAGAAGTGGACGGAGTGCT  CTCCAGGTCCATCACCAAGT  Symbols  mRNA sequence  Forward primers  Reverse primers  hβ-actin  GACTTAGTTGCGTTACACCCTTTC  GCTGTCACCTTCACCGTTCC  hNLRP6  CAGTTCTCAAGGCACCACAA  TCACTCAGCATACGCAGTCC  hCaspase-1  AGGCATGACAATGCTGCTAC  TGGGACTTGCTCAGAGTGTTTC  hAscF  AAGCCAGGCCTGCACTTTATAGAC  CCAGGCTGGTGTGAAACTGA  mGAPDH  AGGTCGGTGTGAACGGATTTG  TGTAGACCATGTAGTTGAGGTCA  mNLRP6  TGACCAGAGCTTCCAGGAGT  TTTAGCAGGCCAAAGAGGAA  mCaspase-1  CACAGCTCTGGAGATGGTGA  CTTTCAAGCTTGGGCACTTC  mASC  ACAGAAGTGGACGGAGTGCT  CTCCAGGTCCATCACCAAGT  Immunohistochemistry assay Mice paraffin-embedded intestines were cut into 4-μm thick sections, mounted on gelatin-coated slides, and heated at 60°C for 2 h. Paraffin was removed by an automatic dyeing machine program and samples were rehydrated. To heat repair the antigen, tissue sections were soaked in citrate buffer (0.01 M, pH 6.0) for 3 min until cooling. Endogenous peroxidase activity was blocked using 3% hydrogen peroxidase solution for 10–15 min, then the slides were washed and incubated with goat polyclonal anti-NLRP6 Ab (1:500; Santa Cruz, Santa Cruz, USA) in complete medium overnight at 4°C. The slides were rinsed with 0.01 M PBS three times for 5 min. Next, sections were incubated with secondary Ab donkey anti-goat IgG (H+L) (Abcam, Cambridge, UK) at 37°C for 1 h, followed by three times of wash with 0.01 M PBS for 5 min. DAB developing solution was used for 1–20 min to stain the slides. Sections were dehydrated in a graded alcohol series, and covered with a cover slip. Five fields at high magnification were randomly selected from the images of each mouse intestinal tissue and the average integral optical density value (IOD/Area) was calculated, reflecting the expression of the corresponding protein. Hematoxylin and eosin staining Mice paraffin-embedded intestines were cut into 5-μm thick sections. Hematoxylin and eosin (H&E) staining was performed using a standard protocol. The colon and terminal ileum mucosal pathology score was evaluated as follows [14]: cryptal architecture changes, 3–6 points; number of round-cell infiltrates in the lamina propria mucosae, 0–3 points; goblet cell death, 1 point; submucosal fibrous tissue hyperplasia, 1 point; granuloma, 1 point. Total score: 0: inflammation, 1–4: low inflammation, 5–8: inflammation, 9–12: severe inflammation. ELISA Blood was collected from the orbital venous plexus, while Caco-2 cells were transfected with NLRP6 siRNA as described in the above. Both blood and cell samples were centrifuged at low temperature. The concentration of IL-18, IL-1β, myeloperoxidase (MPO), d-lactic acid (D-LA) (all of them in serum and only IL-18 and IL-1β in cell samples) was measured using commercially available ELISA kits (Xitang Biological Technology Company, Shanghai, China). The OD value was measured on a microplate reader and sample concentration was obtained using a standard curve. Samples were assayed in duplicate according to the product specification. Statistical analysis Statistical analyses were performed using SPSS19.0 software. Data were expressed as mean ± SD and compared using the independent samples t-test after determination of normal distribution and equal variance. Mann–Whitney U was performed for rating information. P < 0.05 was considered statistically significant. Results Reliability of the IBS model The AWR score of the IBS group was significantly higher than that of the control group at 20, 40, and 60 mm Hg pressure dilation (P < 0.05; Fig. 1 and Table 2), while no difference was observed between the two groups at 80 mm Hg (Fig. 1 and Table 2). This result was indicative of visceral hypersensitivity in the IBS model mice; therefore the IBS model was successfully established. The AWR score of the Clostridium butyricum group was lower than that of the IBS group at 20, 40, and 60 mm Hg pressure dilation (P < 0.05; Fig. 1 and Table 2), suggesting that Clostridium butyricum could effectively reduce the degree of intestinal sensitivity and restore intestinal physiological function. Table 2. AWR scores at pressure from 20 to 80 mm Hg Groups  Mice number  Pressure/mm Hg  20  40  60  80  Control  8  0.88 ± 0.33  1.58 ± 0.55  2.40 ± 0.50  3.30 ± 0.56  IBS  8  1.40 ± 0.50a  2.28 ± 0.45a  3.28 ± 0.51a  3.48 ± 0.51b  Clostridium  8  1.15 ± 0.36c  2.02 ± 0.42c  2.80 ± 0.61c  3.43 ± 0.51d  Groups  Mice number  Pressure/mm Hg  20  40  60  80  Control  8  0.88 ± 0.33  1.58 ± 0.55  2.40 ± 0.50  3.30 ± 0.56  IBS  8  1.40 ± 0.50a  2.28 ± 0.45a  3.28 ± 0.51a  3.48 ± 0.51b  Clostridium  8  1.15 ± 0.36c  2.02 ± 0.42c  2.80 ± 0.61c  3.43 ± 0.51d  aP < 0.05 vs. control group. bP > 0.05 vs. control group. cP < 0.05 vs. IBS group. dP > 0.05 vs. IBS group. Figure 1. View largeDownload slide AWR scores at pressure from 20 to 80 mm Hg IBS group intestinal sensitivity increased significantly compared with the control group, as shown by the enhanced degree of abdominal contractions (*P < 0.05). The degree of abdominal contraction was remarkably lower in the Clostridium butyricum group compared with the IBS group (*P < 0.05), and the intestinal sensitivity was decreased after seven continuous days of intragastrical Clostridium butyricum adminstration. n.s. P > 0.05. Figure 1. View largeDownload slide AWR scores at pressure from 20 to 80 mm Hg IBS group intestinal sensitivity increased significantly compared with the control group, as shown by the enhanced degree of abdominal contractions (*P < 0.05). The degree of abdominal contraction was remarkably lower in the Clostridium butyricum group compared with the IBS group (*P < 0.05), and the intestinal sensitivity was decreased after seven continuous days of intragastrical Clostridium butyricum adminstration. n.s. P > 0.05. Expression of NLRP6 inflammasomes, CD172a, IL-18, and IL-1β protein NLRP6 protein expression was remarkably decreased in the colon of IBS group mice compared with control group (0.55 ± 0.06 and 1.00 ± 0.08, respectively, P < 0.05). CD172a, IL-18, and IL-1β protein expressions were increased in the colon of IBS group mice at the same time (1.52 ± 0.18 vs. 1.00 ± 0.12, 1.83 ± 0.22 vs. 1.00 ± 0.16, and 1.70 ± 0.21 vs. 1.00 ± 0.09, respectively, P < 0.05), while no difference was observed in Caspase-1, ASC, and CARD8 protein expressions between the above groups (Fig. 2 and Table 3). However, NLRP6 expression was higher in the Clostridium butyricum group than that in the IBS group (0.81 ± 0.09 vs. 0.55 ± 0.06, P < 0.05). Meanwhile, CD172a, IL-18, and IL-1β protein expressions were decreased in the Clostridium butyricum group (Fig. 2 and Table 3). NLRP6 protein expression in the terminal ileum of IBS group mice was increased compared with that in the control group (1.83 ± 0.16 vs. 1.00 ± 0.06, P < 0.05; Fig. 3 and Table 3). NLRP6, Caspase-1, and ASC protein expressions were significantly decreased after the NLRP6 gene was silenced compared with the blank group (P < 0.05; Fig. 4), which implied a successful transfection. Table 3. The relative protein expression in colon and terminal ileum tissue Protein  Control  IBS  Clostridium  NLRP6 (colon)  1.00 ± 0.08  0.55 ± 0.06a  0.81 ± 0.09b  Caspase-1 (colon)  1.00 ± 0.11  1.12 ± 0.14c  1.13 ± 0.12d  Asc (colon)  1.00 ± 0.12  1.20 ± 0.17c  1.04 ± 0.13d  CARD8 (colon)  1.00 ± 0.12  1.11 ± 0.14c  1.13 ± 0.15d  CD172a (colon)  1.00 ± 0.12  1.52 ± 0.18a  1.04 ± 0.11b  IL-18 (colon)  1.00 ± 0.16  1.83 ± 0.22a  1.19 ± 0.19b  IL-1β (colon)  1.00 ± 0.09  1.70 ± 0.21a  1.12 ± 0.09b  NLRP6 (terminal ileum)  1.00 ± 0.06  1.83 ± 0.16e  1.61 ± 0.17f  Caspase-1 (terminal ileum)  1.00 ± 0.07  1.40 ± 0.12e  1.32 ± 0.09f  Asc (terminal ileum)  1.00 ± 0.15  1.74 ± 0.26e  1.43 ± 0.22f  CARD8 (terminal ileum)  1.00 ± 0.11  1.73 ± 0.19e  1.67 ± 0.20f  CD172a (terminal ileum)  1.00 ± 0.11  1.04 ± 0.11g  1.03 ± 0.11f  IL-18 (terminal ileum)  1.00 ± 0.17  0.99 ± 0.17g  1.01 ± 0.16f  IL-1β (terminal ileum)  1.00 ± 0.15  0.88 ± 0.13g  0.88 ± 0.11f  Protein  Control  IBS  Clostridium  NLRP6 (colon)  1.00 ± 0.08  0.55 ± 0.06a  0.81 ± 0.09b  Caspase-1 (colon)  1.00 ± 0.11  1.12 ± 0.14c  1.13 ± 0.12d  Asc (colon)  1.00 ± 0.12  1.20 ± 0.17c  1.04 ± 0.13d  CARD8 (colon)  1.00 ± 0.12  1.11 ± 0.14c  1.13 ± 0.15d  CD172a (colon)  1.00 ± 0.12  1.52 ± 0.18a  1.04 ± 0.11b  IL-18 (colon)  1.00 ± 0.16  1.83 ± 0.22a  1.19 ± 0.19b  IL-1β (colon)  1.00 ± 0.09  1.70 ± 0.21a  1.12 ± 0.09b  NLRP6 (terminal ileum)  1.00 ± 0.06  1.83 ± 0.16e  1.61 ± 0.17f  Caspase-1 (terminal ileum)  1.00 ± 0.07  1.40 ± 0.12e  1.32 ± 0.09f  Asc (terminal ileum)  1.00 ± 0.15  1.74 ± 0.26e  1.43 ± 0.22f  CARD8 (terminal ileum)  1.00 ± 0.11  1.73 ± 0.19e  1.67 ± 0.20f  CD172a (terminal ileum)  1.00 ± 0.11  1.04 ± 0.11g  1.03 ± 0.11f  IL-18 (terminal ileum)  1.00 ± 0.17  0.99 ± 0.17g  1.01 ± 0.16f  IL-1β (terminal ileum)  1.00 ± 0.15  0.88 ± 0.13g  0.88 ± 0.11f  aP < 0.05 vs. control group. bP < 0.05 vs. IBS group. cP > 0.05 vs. control group. dP > 0.05 vs. IBS group. eP < 0.05 vs. IBS group. fP > 0.05 vs. IBS group. gP > 0.05 vs. control group. Figure 2. View largeDownload slide Relative expression of proteins in colon tissue (A) Changes of the expressions of inflammasome proteins and inflammatory factors in mice colon. (B) Statistical analysis of protein expression. *P < 0.05, n.s. P > 0.05. Figure 2. View largeDownload slide Relative expression of proteins in colon tissue (A) Changes of the expressions of inflammasome proteins and inflammatory factors in mice colon. (B) Statistical analysis of protein expression. *P < 0.05, n.s. P > 0.05. Figure 3. View largeDownload slide Relative expression proteins in terminal ileum tissue (A) Changes of the expression of inflammasome proteins and inflammatory factors in mice terminal ileum. (B) Statistical analysis of protein expression. *P < 0.05. Figure 3. View largeDownload slide Relative expression proteins in terminal ileum tissue (A) Changes of the expression of inflammasome proteins and inflammatory factors in mice terminal ileum. (B) Statistical analysis of protein expression. *P < 0.05. Figure 4. View largeDownload slide Effect of NLRP6 silencing on the expression of proteins (A) Changes of the expression of inflammasome proteins after NLRP6 silencing. (B) Statistical analysis of protein expression. *P < 0.05. Figure 4. View largeDownload slide Effect of NLRP6 silencing on the expression of proteins (A) Changes of the expression of inflammasome proteins after NLRP6 silencing. (B) Statistical analysis of protein expression. *P < 0.05. Expression of NLRP6 inflammasomes RNA The expressions of NLRP6, Caspase-1, and ASC mRNA did not show any significant difference after stress exposure (Table 4). In addition, no significant difference was observed between the Clostridium butyricum group and IBS group in the colon tissue (Table 4). According to the above results, we could deduce that NLRP6 gene expression was regulated at the translation level. Table 4. The relative expression of mRNA in colon tissue Groups  NLRP6  Caspase-1  ASC  Control  1.01 ± 0.06  1.01 ± 0.06  1.00 ± 0.04  IBS  0.96 ± 0.04a  0.98 ± 0.06a  0.98 ± 0.04a  Clostridium  1.09 ± 0.05b  1.02 ± 0.05b  1.07 ± 0.03b  Groups  NLRP6  Caspase-1  ASC  Control  1.01 ± 0.06  1.01 ± 0.06  1.00 ± 0.04  IBS  0.96 ± 0.04a  0.98 ± 0.06a  0.98 ± 0.04a  Clostridium  1.09 ± 0.05b  1.02 ± 0.05b  1.07 ± 0.03b  aP > 0.05 vs. control group. bP > 0.05 vs. IBS group. Expression of NLRP6 in colon and terminal ileum mucosa The number of NLRP6-positive cells in the colon mucous layer was significantly lower in the IBS group mice than in the control group mice (0.22 ± 0.01 vs. 0.31 ± 0.01, P < 0.01; Fig. 5 and Table 5), while it was higher in the Clostridium butyricum group mice than in the IBS group mice (0.29 ± 0.01 vs. 0.22 ± 0.01, P < 0.01; Fig. 5 and Table 5). However, NLRP6 expression in the terminal ileum mucous layer of IBS group mice was increased compared with that in the control group mice (0.36 ± 0.02 vs. 0.30 ± 0.01, P < 0.01; Table 5), and Clostridium butyricum did not work when compared with IBS group (0.34 ± 0.02 vs. 0.36 ± 0.02, Table 5). Table 5. Colon and terminal ileum tissue average integral optical density value Groups  NLRP6 (colon)  NLRP6 (terminal ileum)  Control  0.31 ± 0.01  0.30 ± 0.01  IBS  0.22 ± 0.01a  0.36 ± 0.02c  Clostridium  0.29 ± 0.01b  0.34 ± 0.02d  Groups  NLRP6 (colon)  NLRP6 (terminal ileum)  Control  0.31 ± 0.01  0.30 ± 0.01  IBS  0.22 ± 0.01a  0.36 ± 0.02c  Clostridium  0.29 ± 0.01b  0.34 ± 0.02d  aP < 0.01 vs. control group. bP < 0.01 vs. IBS group. cP < 0.05 vs. control group, dP > 0.05 vs. IBS group. Figure 5. View largeDownload slide NLRP6 expression in mice colon (A) Control group. (B) IBS group. (C) Clostridium butyricum group; × 400-fold. Figure 5. View largeDownload slide NLRP6 expression in mice colon (A) Control group. (B) IBS group. (C) Clostridium butyricum group; × 400-fold. Pathological changes in colon and terminal ileum mucosa Pathological analysis of colon segments from IBS group mice revealed low grade mucosal inflammation (LGMI; Fig. 6B). In contrast, control group mice showed normal pathology (Fig. 6A). Pathology score in IBS group was 1.25 ± 0.16, and in the control group was 0.38 ± 0.18, which showed significant difference (P < 0.01; Table 6). After Clostridium butyricum treatment, inflammatory cell infiltration in mice was alleviated (P < 0.01; Fig. 6C and Table 6). However, mice terminal ileum in the IBS group did not show any change in inflammatory cells infiltration compared with that in the control group (P > 0.05; Table 6). Table 6. Pathology Score of colon and terminal ileum tissue Groups  Pathology score (colon)  Pathology score (terminal ileum)  Control  0.38 ± 0.18  0.33 ± 0.21  IBS  1.25 ± 0.16a  0.50 ± 0.22c  Clostridium  0.50 ± 0.19b  0.50 ± 0.34d  Groups  Pathology score (colon)  Pathology score (terminal ileum)  Control  0.38 ± 0.18  0.33 ± 0.21  IBS  1.25 ± 0.16a  0.50 ± 0.22c  Clostridium  0.50 ± 0.19b  0.50 ± 0.34d  aP < 0.01 vs. control group. bP < 0.01 vs. IBS group. cP > 0.05 vs. control group. dP > 0.05 vs. IBS group. Figure 6. View largeDownload slide Pathological changes in colon mucosa (A) Colonic segment from a control group mouse, showing no pathologies. No clear inflammation and tissue congestion in the control group, mucosal epithelium is intact. (B) Colonic segment from an IBS group mouse, showing LGMI: infiltration of neutrophils in the mucous layer, congested tissue, although glands were neatly arranged, no crypt structure changed, no fibrous tissue hyperplasia, no granulation tissue formation. (C) Colonic segment from a Clostridium butyricum mouse, showing improvement of colon inflammatory cells infiltration. Black arrow: neutrophils; × 400-fold. Figure 6. View largeDownload slide Pathological changes in colon mucosa (A) Colonic segment from a control group mouse, showing no pathologies. No clear inflammation and tissue congestion in the control group, mucosal epithelium is intact. (B) Colonic segment from an IBS group mouse, showing LGMI: infiltration of neutrophils in the mucous layer, congested tissue, although glands were neatly arranged, no crypt structure changed, no fibrous tissue hyperplasia, no granulation tissue formation. (C) Colonic segment from a Clostridium butyricum mouse, showing improvement of colon inflammatory cells infiltration. Black arrow: neutrophils; × 400-fold. Expression of downstream cytokines in cell supernatant and mice serum IL-1β and IL-18 protein levels in Caco-2 cell supernatant was 126.70 and 155.30 pg/ml, respectively, in the NLRP6 silencing group, while it was 73.94 and 88.55 pg/ml, respectively, in the control group, which showed significant difference for both proteins (P < 0.05; Table 7). IL-1β, IL-18, MPO, and D-LA protein expressions in serum between the control and IBS groups were statistically different (P < 0.05; Table 7). Serum IL-1β, IL-18, D-LA, and MPO levels were lower in the Clostridium butyricum group than in the IBS group (all P < 0.05; Table 7). Table 7. Downstream cytokines protein expression in Caco-2 cell supernatant and mice serum (pg/ml) Groups  IL-1β  IL-18  MPO  D-LA  Cell supernatant   Blank  73.94 ± 4.80  88.55 ± 3.58       NLRP6 siRNA  126.70 ± 4.30a  155.30 ± 8.39a      Mice serum   Control  55.41 ± 3.17  148.30 ± 6.78  19.52 ± 0.67  1.69 ± 0.10   IBS  101.40 ± 6.18b  229.70 ± 14.64b  49.41 ± 1.46b  2.95 ± 0.07b   Clostridium  82.92 ± 5.75c  176.10 ± 10.65c  24.01 ± 1.39c  2.24 ± 0.07c  Groups  IL-1β  IL-18  MPO  D-LA  Cell supernatant   Blank  73.94 ± 4.80  88.55 ± 3.58       NLRP6 siRNA  126.70 ± 4.30a  155.30 ± 8.39a      Mice serum   Control  55.41 ± 3.17  148.30 ± 6.78  19.52 ± 0.67  1.69 ± 0.10   IBS  101.40 ± 6.18b  229.70 ± 14.64b  49.41 ± 1.46b  2.95 ± 0.07b   Clostridium  82.92 ± 5.75c  176.10 ± 10.65c  24.01 ± 1.39c  2.24 ± 0.07c  aP < 0.01 vs. control group in cell supernatant. bP < 0.01 vs. control group in mice serum. cP < 0.05 vs. IBS group in mice serum. Disscussion IBS is considered as a brain-intestinal axis of physiological regulation disorders disease. It reflects a connection between brain and intestine, since brain stress can aggravate intestinal disorders due to IBS. Chadwick et al. [15] found that 40% IBS patients’ colorectal biopsy specimens showed non-specific inflammatory manifestations, such as neutrophils, mast cells and T cell infiltration, indicating IBS patients with intestinal mucosal inflammation. It is often referred to as low inflammation. Visceral hypersensitivity is one of the characteristics of IBS [16]. It has also been shown that low grade inflammation of mucous can activate visceral hypersensitivity, which is quite common in IBS patients, and it is considered to play vital roles in IBS pathogenesis [10]. Consistent with a previous study [17], this study also showed that WAS in mice induced visceral hypersensitivity to colonic distension, which is an IBS pathologic feature. In addition, intestinal flora disorders were found in both IBS patients and animal models. Kassinen et al. [18] discovered that the number of Lactobacillus and Bifidobacterium was decreased in the stool of IBS patients, while the amount of facultative anaerobic bacteria, mainly Streptococcus and Escherichia coli, is increased. Intestinal microflora plays an important role in maintaining intestinal stability, reducing intestinal sensitivity in IBS patients and restoring normal intestinal function significantly, but its mechanism has not been clarifyied yet. NLRP6 is the upstream regulatory factor in transferring inflammatory signaling and can connect Caspase-1, ASC and CARD8 to form NLRP6 inflammasome through the function of protein-protein junction of the N-terminal PYD domain [19,20], which can negatively regulate the NF-κB and MAPK signaling pathways [21], adjust and control cells to produce IL-1β, IL-18 and other cytokines [22,23] involved in the inflammatory response and innate immune response. NLRP6 inflammasome plays a vital role in restraining the inflammatory response, promoting intestinal mucosal repair, and preventing the occurrence of intestinal tumors, and is involved in the anti-bacterial immune response. NLRP6-deficient mice showed an inhibition in the activation of NF-κB and MAPK, resulting in apoptosis promotion and inflammation inhibition [4,24]. So far, studies on the relationship between Clostridium butyricum and NLRP6 in IBS visceral hypersensitivity induced by stress are still lacking. In this study, we reported that Clostridium butyricum might play a beneficial role in visceral hypersensitivity of IBS by inhibiting low grade inflammation of colonic mucous through its action on NLRP6. Our present results showed that NLRP6 expression in the IBS group colon was lower than that in the control group, while its ligand Caspase-1, ASC, and CARD8 showed no significant change, indicating that NLRP6 protein was mainly involved in IBS. This study also disclosed that the level of IL-18 and IL-1β, downstream NLRP6 signaling pathway factors, was up-regulated in the IBS group, which was consistent with existing research [25,26]. The higher IL-18 and IL-1β level after NLRP6 gene silencing confirmed the correlation between NLRP6 and IL-18 and IL-1β. CD172a expression, which represented the inflammation degree was increased in the colon mucosa of IBS group. The pathological score suggested low inflammation in colonic mucous, and mice visceral hypersensitivity in the IBS group was higher than that in the control group. We propose that the absence of colon NLRP6 due to WAS may lead to the up-regulation of its downstream effectors IL-18 and IL-1β, resulting in low inflammation of colonic mucous, thus causing high visceral hypersensitivity in IBS. It is worth mentioning that the expression of NLRP6 inflammasomes in the terminal ileum of IBS mice was increased, which is consistent with a previous study by Hou et al. [27]. H&E staining revealed unconspicuous inflammation, with no clear change in IL-18 and IL-1β concentration, indicating that IBS low grade inflammation occurred in the colon rather than the terminal ileum. We hypothesize that the small intestine has a self-adjusting function in response to stress, which might lead to the increase in NLRP6 expression, so that IL-18 and IL-1β secretion remained in equilibrium, thus weakening the ileal inflammatory response. However, more experiments and investigations are needed to confirm this hypotesis. Probiotics can alleviate IBS symptoms effectively, which may be related to the regulation of intestinal flora, intestinal inflammatory factors, and visceral hypersensitivity [27,28]. Clostridium butyricum affects the intestinal immune homeostasis through regulating the intestinal mucosa Treg cell differentiation. The fermentation product of butyric acid has anti-inflammatory beneficial effects on epithelial cells [29]. This is consistent with our results showing a reducition of intestinal inflammation after Clostridium butyricum treatment. D-LA is the metabolite of bacterial fermentation that reflects intestinal mucosal epithelial cell permeability and intestinal barrier function. Samira et al. [30] found that MPO is elevated in IBS patients with colonic mucosal pathological changes. Thus, MPO level is one of the indicator of peroxidation and inflammation in the intestinal mucosa. Our research revealed that NLRP6 expression was increased, while the levels of IL-18 and IL-1β were remarkably decreased in the colon mucosa of Clostridium butyricum group. Furthermore, we also found that the levels of D-LA, MPO, CD172a in Clostridium butyricum group were decreased and inflammatory infiltration in the colonic mucosal layer was reduced. Mice visceral hypersensitivity in the Clostridium butyricum group was also significantly lower than that in the IBS group, implying that Clostridium butyricum could promote NLRP6 protein expression, further down-regulate the expressions of IL-18 and IL-1β, and inhibit the inflammation to restore the intestinal mucosal barrier function, thus regulating the visceral hypersensitivity of IBS mice. In summary, our findings provided evidence that NLRP6 is involved in IBS pathogenesis. Exposure to stress may inhibit NLRP6 expression and alter the composition of the gut microbiota, leading to intestinal inflammation. Persistent low levels of inflammation may increase intestinal visceral sensitivity, while treatment with Clostridium butyricum may reverse these results, exerting a beneficial effect. An increased attention is nowadays paid on the role of inflammatory factors and intestinal microecology in functional gastrointestinal diseases. As an immune-related gene, NLRP6 acts as a ‘guard’ in inducing intestinal bacterial products or cell damage, which can regulate the production of IL-18, IL-1β to inhibit intestinal inflammation and prevent intestinal microecological imbalance. In conclusion, our findings might explain the benefits of probiotics, especially Clostridium butyricum, in patients with stress-associated gastrointestinal disorders. Confirmation of a causal relationship between NLRP6 and visceral sensitivity in IBS patients may further validate the clinical use of probiotics to treat IBS. Our results suggest that NLRP6 may be an important target in the development of a novel therapy against stressed-induced intestinal disorders. Funding This work was supported by grants from the National Natural Science Foundation of China (Nos. 81470814 and 81400594) and Zhejiang Provincial Natural Science Foundation of China (No. LQ14H160014). References 1 Wang XY, Zarate N, Soderholm JD, Bourgeois JM, Liu LW, Huizinga JD. Ultrastructural injury to interstitial cells of Cajal and communication with mast cells in Crohn’s disease. Neurogastroenterol Motil  2007, 19: 349– 364. Google Scholar CrossRef Search ADS PubMed  2 Tornblom H, Lindberg G, Nyberg B, Veress B. Full-thickness biopsy of the jejunum reveals inflammation and enteric neuropathy in irritable bowel syndrome. Gastroenterology  2002, 123: 1972– 1979. Google Scholar CrossRef Search ADS PubMed  3 Konturek PC, Brzozowski T, Konturek SJ. Stress and the gut: pathophysiology, clinical consequences, diagnostic approach and treatment options. J Physiol Pharmacol  2011, 62: 591– 599. Google Scholar PubMed  4 Chen GY, Liu M, Wang F, Bertin J, Nunez G. A functional role for Nlrp6 in intestinal inflammation and tumorigenesis. J Immunol  2011, 186: 7187– 7194. Google Scholar CrossRef Search ADS PubMed  5 Chen GY, Stappenbeck TS. Mucus, it is not just a static barrier. Sci Signal  2014, 7: pe11. Google Scholar CrossRef Search ADS PubMed  6 Elinav E, Strowig T, Kau AL, Henao-Mejia J, Thaiss CA, Booth CJ, Peaper DR, et al.  . NLRP6 inflammasome regulates colonic microbial ecology and risk for colitis. Cell  2011, 145: 745– 757. Google Scholar CrossRef Search ADS PubMed  7 Round JL, Mazmanian SK. The gut microbiota shapes intestinal immune responses during health and disease. Nat Rev Immunol  2009, 9: 313– 323. Google Scholar CrossRef Search ADS PubMed  8 Hungin AP, Mulligan C, Pot B, Whorwell P, Agreus L, Fracasso P, Lionis C, et al.  . Systematic review: probiotics in the management of lower gastrointestinal symptoms in clinical practice—an evidence-based international guide. Aliment Pharmacol Ther  2013, 38: 864– 886. Google Scholar CrossRef Search ADS PubMed  9 La JH, Kim TW, Sung TS, Kang JW, Kim HJ, Yang IS. Visceral hypersensitivity and altered colonic motility after subsidence of inflammation in a rat model of colitis. World J Gastroenterol  2003, 9: 2791– 2795. Google Scholar CrossRef Search ADS PubMed  10 Wang CD, Zheng XY, Zheng WW, Gastroenterology DO. Dextran sulfate sodium-induced low grade mucosal inflammation activates visceral hypersensitivity in rats. World Chin J Digestol  2009, 17: 1621– 1625. Google Scholar CrossRef Search ADS   11 Baitsch L, Fuertes-Marraco SA, Legat A, Meyer C, Speiser DE. The three main stumbling blocks for anticancer T cells. Trends Immunol  2012, 33: 364– 372. Google Scholar CrossRef Search ADS PubMed  12 Cameron HL, Perdue MH. Stress impairs murine intestinal barrier function: improvement by glucagon-like peptide-2. J Pharmacol Exp Ther  2005, 314: 214– 220. Google Scholar CrossRef Search ADS PubMed  13 Al-Chaer ED, Kawasaki M, Pasricha PJ. A new model of chronic visceral hypersensitivity in adult rats induced by colon irritation during postnatal development. Gastroenterology  2000, 119: 1276– 1285. Google Scholar CrossRef Search ADS PubMed  14 Kruschewski M, Foitzik T, Perez-Cantó A, Hübotter A, Buhr HJ. Changes of colonic mucosal microcirculation and histology in two colitis models: an experimental study using intravital microscopy and a new histological scoring system. Dig Dis Sci  2001, 46: 2336– 2343. Google Scholar CrossRef Search ADS PubMed  15 Chadwick VS, Chen W, Shu D, Paulus B, Bethwaite P, Tie A, Wilson I. Activation of the mucosal immune system in irritable bowel syndrome. Gastroenterology  2002, 122: 1778– 1783. Google Scholar CrossRef Search ADS PubMed  16 Azpiroz F, Bouin M, Camilleri M, Mayer EA, Poitras P, Serra J, Spiller RC. Mechanisms of hypersensitivity in IBS and functional disorders. Neurogastroenterol Motil  2007, 19: 62– 88. Google Scholar CrossRef Search ADS PubMed  17 Larsson MH, Miketa A, Martinez V. Lack of interaction between psychological stress and DSS-induced colitis affecting colonic sensitivity during colorectal distension in mice. Stress  2009, 12: 434– 444. Google Scholar CrossRef Search ADS PubMed  18 Kassinen A, Krogius-Kurikka L, Makivuokko H, Rinttila T, Paulin L, Corander J, Malinen E, et al.  . The fecal microbiota of irritable bowel syndrome patients differs significantly from that of healthy subjects. Gastroenterology  2007, 133: 24– 33. Google Scholar CrossRef Search ADS PubMed  19 Chen GY. Role of Nlrp6 and Nlrp12 in the maintenance of intestinal homeostasis. Eur J Immunol  2014, 44: 321– 327. Google Scholar CrossRef Search ADS PubMed  20 Srinivasula SM, Poyet JL, Razmara M, Datta P, Zhang Z, Alnemri ES. The PYRIN-CARD protein ASC is an activating adaptor for caspase-1. J Biol Chem  2002, 277: 21119– 21122. Google Scholar CrossRef Search ADS PubMed  21 Anand PK, Malireddi RK, Lukens JR, Vogel P, Bertin J, Lamkanfi M, Kanneganti TD. NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens. Nature  2012, 488: 389– 393. Google Scholar CrossRef Search ADS PubMed  22 Kempster SL, Belteki G, Forhead AJ, Fowden AL, Catalano RD, Lam BY, McFarlane I, et al.  . Developmental control of the Nlrp6 inflammasome and a substrate, IL-18, in mammalian intestine. Am J Physiol Gastrointest Liver Physiol  2011, 300: 253– 263. Google Scholar CrossRef Search ADS   23 Lee SH, Stehlik C, Reed JC. Cop, a caspase recruitment domain-containing protein and inhibitor of caspase-1 activation processing. J Biol Chem  2001, 276: 34495– 34500. Google Scholar CrossRef Search ADS PubMed  24 Normand S, Delanoye-Crespin A, Bressenot A, Huot L, Grandjean T, Peyrin-Biroulet L, Lemoine Y, et al.  . Nod-like receptor pyrin domain-containing protein 6 (NLRP6) controls epithelial self-renewal and colorectal carcinogenesis upon injury. Proc Natl Acad Sci USA  2011, 108: 9601– 9606. Google Scholar CrossRef Search ADS PubMed  25 Liang H, Wang S, Yanqing LI, Wang F. Analysis on expression imbalance of peripheral blood inflammatory cytokines in patients with irritable bowel syndrome. Chin J Gastroenterol  2008, 13: 111– 113. 26 Song JZ, Wang QM, Zheng-Xiang WU, Zheng BH, Jia YG, Zhang ML. Changes of serum interleukin-1β,interleukin-10 and cortisol in patients with irritable bowel syndrome. Modern Diagn Treat  2005, 16: 68– 69. 27 Qian W, Liu N, Song J, Hou XH, Gastroenterology DO, Hospital U. Bifidobacterium longum regulates the visceral hypersensitivity of PI-IBS by inhibiting NLRP6 inflammasome. Chin J Clin Gastroenterol  2014, 26: 257– 262. 28 Dai C, Zheng CQ, Jiang M, Ma XY, Jiang LJ. Probiotics and irritable bowel syndrome. World J Gastroenterol  2013, 19: 5973– 5980. Google Scholar CrossRef Search ADS PubMed  29 Furusawa Y, Obata Y, Fukuda S, Endo TA, Nakato G, Takahashi D, Nakanishi Y, et al.  . Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature  2013, 504: 446– 450. Google Scholar CrossRef Search ADS PubMed  30 Khaldi S, Gargala G, Le Goff L, Parey S, Francois A, Fioramonti J, Ballet JJ, et al.  . Cryptosporidium parvum isolate-dependent postinfectious jejunal hypersensitivity and mast cell accumulation in an immunocompetent rat model. Infect Immun  2009, 77: 5163– 5169. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

Acta Biochimica et Biophysica SinicaOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off