Clonal spread and azole-resistant mechanisms of non-susceptible Candida albicans isolates from vulvovaginal candidiasis patients in three Shanghai maternity hospitals

Clonal spread and azole-resistant mechanisms of non-susceptible Candida albicans isolates from... Abstract In our multicenter study, 43 fluconazole non-susceptible and 45 fluconazole-susceptible isolates were collected from vulvovaginal candidiasis (VVC) patients from three Shanghai maternity hospitals to analyze their molecular epidemiological features and fluconazole resistant mechanisms. Cross-resistance to fluconazole, itraconazole and voriconazole was observed in 53.5% of the nonsusceptible isolates. Though we acquired 12 clonal complexes (CCs) of diploid sequence types (DSTs) in clinical isolates by a multilocus sequence typing method, fluconazole nonsusceptible isolates all belonged to CC69 with a predominant genotype of DST 79. Increased expressions of efflux pump genes (CDR1, CDR2, and MDR1) were observed only in minor fluconazole non-susceptible isolates by real-time quantitative polymerase chain reaction (PCR). However, ERG11 genes of fluconazole SDD and resistant isolates had significantly higher expression levels than fluconazole-susceptible isolates. Moreover, 13 distinct amino acid substitutions in Erg11p were found in clinical isolates. Three of the substitutions were novel amino acid substitutions (T123I, P98S, and Y286D), which were not in the susceptible isolates. Only two heterozygous amino acid substitutions (A18P/A and R365G/R) in Erg3p were found in two isolates with cross-resistance to fluconazole, itraconazole, and voriconazole. Taken together, we observed the clonal spread of CC69 in fluconazole non-susceptible isolates of Candida albicans from VVC patients with the dominant genotype DST79. ERG11 gene mutations and overexpression predominantly contributed to fluconazole resistance instead of the more common increased expressions of efflux pump genes (CDR1, CDR2, and MDR1). Candida albicans, vulvovaginal candidiasis, multilocus sequence typing, azole resistance, molecular mechanism Introduction Vulvovaginal candidiasis (VVC) is a common disease that affects 75% of all women at least once during their lifetime because of an overgrowth of the Candida species. Misdiagnosis and subsequent inadequate treatment of VVC can lead to treatment failure and recurrent infection, such as recurrent VVC, which affects about 5–8% young women of childbearing age.1Candida albicans accounts for between 85% and 95% of Candida species isolated from the vagina.1 Candida albicans is the most significant fungus of candidiasis. The extensive and prolonged use of fungistatic azoles, especially fluconazole for chronic infections, has resulted in an increase in azole resistance. Our previous study indicated that 85.2% of 135 clinical isolates obtained from VVC patients were C. albicans, and 17% of the C. albicans isolates were not susceptible to fluconazole.2 Several molecular mechanisms that contribute to fluconazole resistance in C. albicans have been illuminated, including mutations or over-expression of the ERG11 gene and constitutive over-expressions of efflux pumps, such as increased expressions of specific trans-membrane transporters encoded by CDR1, CDR2, and MDR1 genes. These transporters can decrease the intracellular accumulation of therapeutic drugs by rapid extrusion, helping the yeast cells to survive.3–6 Recently, one study reported that defective sterol Δ5,6-desaturase activity caused by ERG3 mutations could confer azole resistance, which demonstrates that both ERG11 and other genes involved in the ergosterol biosynthetic pathway are associated with azole resistance.7 Only limited information is available about molecular epidemiology and azole resistance mechanisms of Candida albicans strains isolated from VVC patients in China. Therefore, we used the multilocus sequence typing (MLST) method to analysis the phylogenetic relationships among azole resistant and azole susceptible isolates from VVC patients in three Shanghai maternity hospitals. In addition, we evaluated the multiple resistance mechanisms of fluconazole resistant isolates of Candida albicans. We concentrated on mutations of ERG3 and ERG11; and messenger RNA (mRNA) expressions of the ERG11, CDR1, CDR2, MDR1 genes. Methods Identification of clinical isolates A total of 2185 Candida species isolates (including 1650 susceptible Candida albicans and 338 nonsusceptible C. albicans) were collected from VVC patients in the Obstetrics and Gynecology Hospital of Fudan University, the International Peace Maternity and Child Health Hospital and the Shanghai First Maternity and Infant Hospital (Shanghai, China) from August 2015 to February 2016. In addition, 45 fluconazole susceptible C. albicans isolates and 43 non-susceptible isolates were selected randomly for molecular epidemiology and azole-resistant mechanisms analyses (Supplementary S1). All isolates were obtained by vaginal swab. Swabs were cultured on CHROMagar Candida (CHROMagar, Paris, France) for green colonies, and then on Yeast Extract Peptone Dextrose Medium (ShengGong, Shanghai, China). All C. albicans isolates were finally identified by API 20C AUX (Biomerieux, Lyon, France). Antifungal susceptibility testing The azole minimum inhibitory concentrations (MICs) of 88 clinical isolates were determined using the broth microdilution method established by the CLSI M27-A3 standard guideline (2008). The MIC breakpoints for fluconazole, itraconazole, and voriconazole were determined as follows: fluconazole-susceptible = ≤ 8 μg/ml, susceptible-dose dependent (SDD) = 16–32 μg/ml, and resistant = ≥ 64 μg/ml; itraconazole-susceptible = ≤ 0.125 μg/ml, susceptible-dose dependent (SDD) = 0.25–0.5 μg/ml, and resistant = ≥ 1 μg/ml; and voriconazole-susceptible = ≤ 1 μg/ml, susceptible-dose dependent (SDD) = 2 μg/ml, and resistant = ≥ 4 μg/ml. Candida albicans (ATCC 90028) and Candida krusei (ATCC 6258) were used as quality controls in each test, and all of the tests were repeated a total of three times. Multilocus sequence typing analysis and phylogenetic analysis Genomic DNA of Candida albicans was extracted according to the manufacturer's instructions provided in the E.Z.N.ATM yeast DNA kit (Yeasen, Shanghai, China). Polymerase chain reaction (PCR) amplification of the seven housekeeping genes AAT1a, ACC1, ADP1, MPIb, SYA1, VPS13, and ZWF1b were performed using the primers and conditions described by Bougnoux et al.8 The PCR products were sent to the Shanghai branch of the Beijing Genomics Institute (Shanghai, China) to be purified and sequenced on ABI 3730 sequencing instruments in both directions. Sequencing data were checked manually for positions of heterozygotic or homozygotic polymorphisms. All alleles and diploid sequence types (DSTs) were double checked in both forward and reverse sequences by using the online MLST database (http://calbicans.mlst.net/). The eBURST v3 (http://calbicans.mlst.net/eburst/) analysis was used to determine the relationships among our isolates and those available DSTs (n = 3114) in the MLST database (accessed 2016.08.01) by placing clinical isolates into clonal complexes (CCs) and groups. In order to assign our isolates from VVC patients into clades, we performed a phylogenetic analysis of our isolates together with 1005 reference strains with known clades retrieved from the MLST database (http://pubmlst.org/calbicans/) by MEGA version 6. Clade numbers of all isolates were determined by the unweighted pair-group method using arithmetic averages (UPGMA) based on MLST data. The p-distance threshold of 0.04 was used to define clades as described previously.9,10 ERG3, ERG11 genes amplification and sequencing Candida albicans genomic DNA was extracted according to the manufacturer's instructions provided in the E.Z.N.ATM yeast DNA kit (Yeasen, Shanghai, China), and then was used as template for amplification of the full-length ERG3 and ERG11 genes. The primers used for PCR amplification and sequencing are shown in Table 1. The PCR products were sequenced by the Shanghai branch of the Beijing Genomics Institute (Shanghai, China) and compared with the sequences published in GenBank for ERG3 (accession number XM708519) and ERG11 (accession number XM711668). Table 1. Oligonucleotides used in this study. Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC *These primers were used for ERG11 and ERG3 genes sequencing. View Large Table 1. Oligonucleotides used in this study. Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC *These primers were used for ERG11 and ERG3 genes sequencing. View Large Quantitative RT-PCR for gene expressions RNA was extracted from YPD broth cultures in the mid-log exponential growth phase according to the manufacturer's recommendations provided in the Yeast RNAiso Kit (TaKaRa, Tokyo, Japan). First strand complementary DNA (cDNA) was quantitatively synthesized from 500 ng of total RNA using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Tokyo, Japan). Expression levels of related resistance genes ERG11, CDR1, CDR2, MDR1, and 18S rRNA (250 times dilution of the same genomic DNA) were determined by qRT-PCR using a 7900HTFast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), with SYBR Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa, Japan). All primers and cycling conditions were described in previous study,11 and primers are listed in Table 1. Each sample was performed in triplicate technical replicates. The mRNA expression levels of ERG11, CDR1, CDR2, and MDR1 were calculated using the 2−ΔΔCt method.12 The mRNA expression levels for each isolate were compared with the average expression level of 10 collected fluconazole susceptible isolates after normalization to an 18S rRNA control, which was amplified at the same time with each target gene. RNA transcript levels with a measured ΔCt value below the 3.0 standard deviations (SD) range measured in fluconazole susceptible isolates were considered significant overexpression.13 Statistical analysis Statistical analyses were performed with GraphPad Prism version 5.0 for Windows (GraphPad Software, La Jolla, CA, USA). P < .05 was considered to be statistically significant. Results Antifungal susceptibility to other antifungal agents All 45 fluconazole susceptible isolates exhibited susceptibility to itraconazole and voriconazole. In 13 fluconazole susceptible dose-dependent (S-DD) isolates, three (23.1%) and seven (53.8%) isolates were S-DD to itraconazolele and voriconazole, respectively, while three3 isolates were susceptible to voriconazole. In 30 fluconazole resistant isolates of the total number, all isolates were resistant to itraconazole, while 23 (76.7%) isolates were resistant to voriconazole. In addition, 23/43 (53.5%) isolates were cross-resistance to fluconazole, itraconazole, and voriconazole. More details are shown in Supplementary S1. MLST genotyping and phylogenetic analysis A multicenter study was enforced at three Shanghai maternity hospitals over a 6-month period. Twenty-two unique DSTs were found among all 88 clinical Candia albicans isolates. Most isolates (94.3%) belonged to previously described sequence types (17 DSTs), but we found five novel DSTs that have been added to the MLST database. Interestingly, 74.4% (32/43) isolates that were fluconazole nonsusceptible belonged to DST 79 (Table 2), but only 40% (18/45) of the susceptible isolates were the same DST (DST 79), especially only 20% in the Obstetrics and Gynecology Hospital of Fudan University. The proportions of different DSTs of fluconazole nonsusceptible isolates in these hospitals are almost the same. Table 2. Distribution of DSTs in fluconazole susceptible and non-susceptible isolates. DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 View Large Table 2. Distribution of DSTs in fluconazole susceptible and non-susceptible isolates. DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 View Large The eBURST analysis assigned the 88 clinical isolates into 12 CCs of DSTs and one singleton DST. Interestingly, all isolates of fluconazole nonsusceptibility belonged to CC69 and were placed in group 1. There were only five DSTs in those isolates, and we observed their phylogenetic relationships by eBURST analysis (Fig. 1). However, there were 12 eBURST groups in susceptible isolates. In addition, all strains were grouped into 17 clades and some singletons by defining the clades as outlined in a previous study.10 Of these strains, our isolates were clustered into nine known clades and two singletons. All fluconazole non-susceptible isolates belonged to clade 1, but 45 susceptible isolates were grouped into nine clades and two singletons (Fig. 2). Figure 1. View largeDownload slide Phylogenetic relationships of DSTs of fluconazole non-susceptible isolates in the eBURST group one. The eBURST defined group one snapshot is based on available Candida albicans DSTs in the MLST database (http://pubmlst.org/calbicans/). Five DSTs of fluconazole non-susceptible isolates are circles colored as green. And the predicted founder in the red circle is DST 79. This Figure is reproduced in color in the online version of Medical Mycology. Figure 1. View largeDownload slide Phylogenetic relationships of DSTs of fluconazole non-susceptible isolates in the eBURST group one. The eBURST defined group one snapshot is based on available Candida albicans DSTs in the MLST database (http://pubmlst.org/calbicans/). Five DSTs of fluconazole non-susceptible isolates are circles colored as green. And the predicted founder in the red circle is DST 79. This Figure is reproduced in color in the online version of Medical Mycology. Figure 2. View largeDownload slide UPGMA dendrogram of the 88 clinical isolates. The black dots indicate fluconazole nonsusceptible isolates, and the others are susceptible isolates. The scale bar indicates p-distances. This Figure is reproduced in color in the online version of Medical Mycology. Figure 2. View largeDownload slide UPGMA dendrogram of the 88 clinical isolates. The black dots indicate fluconazole nonsusceptible isolates, and the others are susceptible isolates. The scale bar indicates p-distances. This Figure is reproduced in color in the online version of Medical Mycology. ERG11 and ERG3 mutations in fluconazole non-susceptible and susceptible isolates Bidirectional sequencing of PCR products of the full-length ERG11 genes from all fluconazole non-susceptible isolates and 10 fluconazole susceptible isolates revealed 13 distinct amino acid substitutions (T123I, Y132H, A114S, D116E, K128T, G465S, Y257H, G448E, P98S, Y286D, E266D, V437I, and V488I) (Supplementary S1). T123I, P98S, and Y286D were novel amino acid substitutions, and P98S was a result of heterozygous mutation. Interestingly, 26 (60%) of the fluconazole nonsusceptible isolates contained novel T123I homozygous substitution, which did not occur in fluconazole susceptible isolates. In sum, 36 (83.7%) fluconazole nonsusceptible isolates contained a Y132H amino acid substitution. Moreover, the combination of T123I and Y132H substitutions were detected in a total of 27 isolates, of which 16 were cross-resistance to fluconazole, itraconazole, and voriconazole. None of these isolates currently occurred in any azole susceptible strains. Five amino acid substitutions occurred in azole susceptible isolates, including homozygous substitutions (D116E, V437I, E266D, and V488I) and heterozygous substitutions (D116E/D and K128T/K). In addition, only two heterozygous amino acid substitutions (A18P/A and R365G/R) in Erg3p occurred in the two isolates with cross-resistance to fluconazole, itraconazole and voriconazole (Supplementary S1). Four distinct ERG11 sequences containing novel amino acid substitutions were submitted to GeneBank database for accession numbers (KX631421, KX631422, KX631423, and KX631424). Analysis of gene expressions associated with fluconazole resistance The levels of expression of efflux transporters and the ERG11 gene in fluconazole susceptible, SDD and resistant strains were assessed by quantitative RT-PCR (Supplementary S1). Fluconazole SDD and resistant isolates had significantly higher expression levels of ERG11 than fluconazole susceptible isolates (P < .05). The ERG11 gene expression levels in susceptible, S-DD, and resistant isolates are shown in Figure 3. However, there were no statistically significant differences in the expression levels of any CDR1, CDR2, and MDR1 genes among the fluconazole susceptible, SDD, and resistant isolates. Only one fluconazole resistant isolate had a higher expression level of CDR1. There were only five isolates overexpressing CDR2, one of which was cross-resistance to fluconazole, itraconazole, and voriconazole. Similarly, among 43 fluconazole S-DD and resistant isolates, only three isolates had increased expressions of MDR1, of which one was cross-resistance to fluconazole, itraconazole and voriconazole. Figure 3. View largeDownload slide Relative fold expression levels of ERG11 genes in susceptible, S-DD and resistant isolates. Figure 3. View largeDownload slide Relative fold expression levels of ERG11 genes in susceptible, S-DD and resistant isolates. Discussion In our multicenter study, we used the multilocus sequence typing method to analyze the genotype distribution and genetic characterization of azole susceptible and nonsusceptible Candida albicans strains isolated from vulvovaginal candidiasis patients from three maternity hospitals in Shanghai, China. All susceptible isolates (21 DSTs) presented genotypic diversity, all of which were assigned to 12 groups by eBURST analysis. The majority belonged to clade 1. In a previous study, phylogenetic analysis of 1410 DSTs revealed that the most prevalent clades globally were clade 1 to clade 4.14 Recently, some researchers revealed the diversity of the genotype geographical distribution of C. albicans isolates from vulvovaginal candidiasis patients. In China, 71.6% of the C. albicans isolates from VVC were located in clade 1, and the majority of the VVC isolates cantered on a cluster of clade 1 with DST1867 and DST79 as the dominant genotypes.15 This distribution is similar to genotype distribution patterns of azole susceptible isolates in this study. In England, the predominant isolates from vaginal samples were clade 1, but clade 3 strains were the dominant isolates in the United States. In addition, there were wider clades (5–17) in Japan.16 Moreover, Candida albicans isolates obtained from different body sites exhibited the diversity of the genotype distribution patterns.17,18 In this study, however, we found the indications of clonal spread in fluconazole nonsusceptible isolates from VVC patients with the dominant genotype DST79. All isolates of fluconazole non-susceptibility belonged to CC69 and were assigned to clade 1. One study showed that only 40.6% of the vaginal isolates from healthy volunteers were found in the same clade of the isolates from VVC patients in China, whose genotypes were concentrated in DST1867 and DST79.15 From normal vaginal isolates to fluconazole resistant isolates from VVC patients, DST 79 gradually demonstrates the enhanced propensity to become the dominant genotype. In accordance with a previous study, Candida albicans can rapidly acquire the selective advantage of resistance phenotype since it contains huge clonal populations, which translates into large scale genetic plasticity.19 It is reasonable to speculate that changes in microenvironment promote the pattern of genotype distribution with specific enriched genotypes. Further comparative study might be needed to reveal the adaptive changes of C. albicans as the result of changes in the host environment. Moreover, these hospitals locate in the center of Shanghai and cover the majority population of Shanghai, China. And these hospitals are the largest maternity hospitals in Shanghai. These hospitals all are tertiary referral centers, but we cannot acquire the statistics of transfer of patients among these three hospitals. There is no evidence for the role of patients’ dynamics and the referral in clonal spread. In addition, we evaluated the most common molecular mechanisms including mutations of the ERG11 gene and the expressions of efflux pumps involved in fluconazole resistance in clinical isolates from VVC patients in China. Lower affinity of the azole drug to the target sites caused by amino acid substitutions of cytochrome P450 14a-demethylase (Erg11p) has been demonstrated to be one of the most important mechanisms for azole resistance.20 Most amino acid substitutions detected in the Erg11p were reported in the three hot spot regions (ranging from amino acids 105 to 165, 266 to 287, and 405 to 488),21 though we found a novel amino acid substitution P98S that fell outside these regions. In our study, 83.7% of fluconazole non-susceptible isolates contained a Y132H amino acid substitution, 17 of which were cross-resistance to fluconazole, itraconazole, and voriconazole. Y132H substitution, which occurred concurrently with N136Y, was previously confirmed to be involved in azole resistance by causing the modified heme environment in the active site.22,23 Interestingly, Y132H substitution in the majority of clinical isolates, 59% of which was cross-resistance to fluconazole, itraconazole, and voriconazole, occurred simultaneously with T123I substitution in this study. This combination may exhibit a synergistic effect in the Erg11p spatial conformation and requires further study. In addition, A114S, Y257H, and G448E substitutions in this study also were reported only in azole nonsusceptible isolates, and their contribution to fluconazole resistance were confirmed.21,24,25 Single substitution of D116E, K128T, E266D, V437I, or V488I may not be associated with azole resistance as they were found in both azole susceptible and azole resistant isolates.26 In addition, some researchers revealed that ERG3 mutations could confer azole resistance since ERG3 mutations could deprive the function of sterol Δ5,6-desaturase and then resulted in accumulation of 14a-methylfecosterol to maintain proliferation that could withstand azole treatment.7,27 However, only two heterozygous mutations in ERG3 were found, and no homozygous mutation was observed in this study. The overexpression of relevant genes expressions also played a role in azole resistance of C. albicans. The constitutive overexpression of ERG11 gene involved in azole resistance has been previously reported.28–30 In accordance with these reports, overexpression of ERG11 gene was observed as dominant in S-DD and resistant isolates in our study. Moreover, overexpression of the ATP-binding cassette (ABC) transporters CDR1 and CDR2, and the major facilitator superfamily (MFS) transporter MDR1, are all involved in fluconazole resistance by reducing drug accumulation in yeast cells.5,31,32 Interestingly, though overexpressions of ABC transporters CDR1 and CDR2 were generally observed in clinical resistant isolates according to many reports,11,33,34 only one of five fluconazole nonsusceptible isolates exhibited overexpressions of CDR1 or CDR2, respectively, in our study. Similarly, only three fluconazole resistant isolates exhibited overexpressions of MDR1. So maybe ERG11 mutations and overexpression or other molecular mechanisms predominantly contribute to fluconazole resistance of isolates from VVC patients. In conclusion, our MLST analysis revealed a phenomenon of clonal spread of CC69 in fluconazole nonsusceptible isolates from VVC patients in China with the dominant genotype DST79. Genetic and phenotypic further study of DST79 strains may help improve the efficacy of the treatment of vulvovaginal candidiasis. In addition, our work demonstrates that ERG11 mutations, especially T394C (Y132H), and overexpression may be the primarily molecular mechanisms of fluconazole resistance in these isolates from VVC patients in three Shanghai maternity hospitals. Our work may give people a better understanding of molecular mechanisms of the azole resistance of clinical isolates from VVC patients and help to develop the new antifungal drugs targeting these mutations. Supplementary material Supplementary data are available at MMYCOL online. Acknowledgements This study is one of the Capacity Building projects, which are supported by the Shanghai Shen Kang Hospital Development Center for clinical ancillary departments in municipal hospitals (grant SHDC22014016). Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper. References 1. Sobel JD . Vulvovaginal candidosis . Lancet . 2007 ; 369 : 1961 – 1971 . Google Scholar CrossRef Search ADS PubMed 2. Ying C , Zhang H , Tang Z et al. Antifungal susceptibility and molecular typing of 115 Candida albicans isolates obtained from vulvovaginal candidiasis patients in 3 Shanghai maternity hospitals . Med Mycol . 2016 ; 54 : 394 – 399 . Google Scholar CrossRef Search ADS PubMed 3. Sanglard D , Ischer F , Parkinson T , Falconer D , Bille J . Candida albicans mutations in the ergosterol biosynthetic pathway and resistance to several antifungal agents . Antimicrob Agents Chemother . 2003 ; 47 : 2404 – 2412 . Google Scholar CrossRef Search ADS PubMed 4. Flowers SA , Colon B , Whaley SG , Schuler MA , Rogers PD . Contribution of clinically derived mutations in ERG11 to azole resistance in Candida albicans . Antimicrob Agents Chemother . 2015 ; 59 : 450 – 460 . Google Scholar CrossRef Search ADS PubMed 5. Prasad R , Rawal MK . Efflux pump proteins in antifungal resistance . Front Pharmacol . 2014 ; 5 : 202 – 216 . Google Scholar CrossRef Search ADS PubMed 6. Schneider S , Morschhauser J . Induction of Candida albicans drug resistance genes by hybrid zinc cluster transcription factors . Antimicrob Agents Chemother . 2015 ; 59 : 558 – 569 . Google Scholar CrossRef Search ADS PubMed 7. Morio F , Pagniez F , Lacroix C , Miegeville M , Le Pape P . Amino acid substitutions in the Candida albicans sterol Delta5,6-desaturase (Erg3p) confer azole resistance: characterization of two novel mutants with impaired virulence . J Antimicrob Chemother . 2012 ; 67 : 2131 – 2138 . Google Scholar CrossRef Search ADS PubMed 8. Bougnoux ME , Tavanti A , Bouchier C et al. Collaborative consensus for optimized multilocus sequence typing of Candida albicans . J Clin Microbiol . 2003 ; 41 : 5265 – 5266 . Google Scholar CrossRef Search ADS PubMed 9. Shin JH , Bougnoux M , D’Enfert C et al. Genetic diversity among Korean Candida albicans bloodstream isolates: assessment by multilocus sequence typing and restriction endonuclease analysis of genomic DNA by use of BssHII. J Clin Microbiol . 2011 ; 49 : 2572 – 2577 . Google Scholar CrossRef Search ADS PubMed 10. Odds FC , Bougnoux ME , Shaw DJ et al. Molecular phylogenetics of Candida albicans . Eukaryot Cell . 2007 ; 6 : 1041 – 1052 . Google Scholar CrossRef Search ADS PubMed 11. Liu JY , Shi C , Wang Y et al. Mechanisms of azole resistance in Candida albicans clinical isolates from Shanghai, China. Res Microbiol . 2015 ; 166 : 153 – 161 . Google Scholar CrossRef Search ADS PubMed 12. Livak KJ , Schmittgen TD . Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method . Methods . 2001 ; 25 : 402 – 408 . Google Scholar CrossRef Search ADS PubMed 13. Chau AS , Mendrick CA , Sabatelli FJ , Loebenberg D , McNicholas PM . Application of real-time quantitative PCR to molecular analysis of Candida albicans strains exhibiting reduced susceptibility to azoles . Antimicrob Agents Chemother . 2004 ; 48 : 2124 – 2131 . Google Scholar CrossRef Search ADS PubMed 14. Odds FC . Molecular phylogenetics and epidemiology of Candida albicans . Future Microbiol . 2010 ; 5 67 – 79 . Google Scholar CrossRef Search ADS PubMed 15. Ge S , Xie J , Xu J et al. Prevalence of specific and phylogenetically closely related genotypes in the population of Candida albicans associated with genital candidiasis in China. Fungal Genet Biol . 2012 ; 49 : 86 – 93 . Google Scholar CrossRef Search ADS PubMed 16. Takakura S , Ichiyama S , Bain JM et al. Comparison of Candida albicans strain types among isolates from three countries . Int J Med Microbiol . 2008 ; 298 : 663 – 668 . Google Scholar CrossRef Search ADS PubMed 17. McManus BA , Coleman DC . Molecular epidemiology, phylogeny and evolution of Candida albicans . Infect Genet Evol . 2014 ; 21 : 166 – 178 . Google Scholar CrossRef Search ADS PubMed 18. Wang S , Shen M , Lin H et al. Molecular epidemiology of invasive Candida albicans at a tertiary hospital in northern Taiwan from 2003 to 2011 . Med Mycol . 2015 ; 53 : 828 – 836 . Google Scholar CrossRef Search ADS PubMed 19. Moorhouse AJ , Rennison C , Raza M , Lilic D , Gow NAR . Clonal strain persistence of Candida albicans isolates from chronic mucocutaneous candidiasis patients . PLoS One . doi:10.1371/journal.pone.0145888 . 20. Morio F , Loge C , Besse B , Hennequin C , Le Pape P . Screening for amino acid substitutions in the Candida albicans Erg11 protein of azole-susceptible and azole-resistant clinical isolates: new substitutions and a review of the literature . Diagn Microbiol Infect Dis . 2010 ; 66 : 373 – 384 . Google Scholar CrossRef Search ADS PubMed 21. Marichal P , Koymans L , Willemsens S et al. Contribution of mutations in the cytochrome P450 14alpha-demethylase (Erg11p, Cyp51p) to azole resistance in Candida albicans . Microbiology . 1999 ; 145 : 2701 – 2713 . Google Scholar CrossRef Search ADS PubMed 22. Alvarez-Rueda N , Fleury A , Logé C et al. The amino acid substitution N136Y in Candida albicans sterol 14alpha-demethylase is involved in fluconazole resistance . Med Mycol . 54 : 764 – 775 . CrossRef Search ADS PubMed 23. Park H , Lee I , Chun Y et al. Heterologous expression and characterization of the sterol 14α-demethylase CYP51F1 from Candida albicans . Arch Biochem Biophys . 2011 ; 509 : 9 – 15 . Google Scholar CrossRef Search ADS PubMed 24. Xu Y , Chen L , Li C . Susceptibility of clinical isolates of Candida species to fluconazole and detection of Candida albicans ERG11 mutations . J Antimicrob Chemother . 2008 ; 61 : 798 – 804 . Google Scholar CrossRef Search ADS PubMed 25 Xiang MJ , Liu JY , Ni PH et al. Erg11 mutations associated with azole resistance in clinical isolates of Candida albicans . Fems Yeast Res . 2013 ; 13 : 386 – 393 . Google Scholar CrossRef Search ADS PubMed 26. Ying Y , Zhao Y , Hu X et al. In vitro fluconazole susceptibility of 1,903 clinical isolates of Candida albicans and the identification of ERG11 mutations . Microb Drug Resist . 2013 ; 19 : 266 – 273 . Google Scholar CrossRef Search ADS PubMed 27. Martel CM , Parker JE , Bader O et al. Identification and characterization of four azole-resistant erg3 mutants of Candida albicans . Antimicrob Agents Chemother . 2010 ; 54 : 4527 – 4533 . Google Scholar CrossRef Search ADS PubMed 28. Hoehamer CF , Cummings ED , Hilliard GM , Morschhauser J , David RP . Upc2p-associated differential protein expression in Candida albicans . Proteomics . 2009 ; 9 : 4726 – 4730 . Google Scholar CrossRef Search ADS PubMed 29. Flowers SA , Barker KS , Berkow EL et al. Gain-of-function mutations in UPC2 are a frequent cause of ERG11 upregulation in azole-resistant clinical isolates of Candida albicans . Eukaryot Cell . 2012 ; 11 : 1289 – 1299 . Google Scholar CrossRef Search ADS PubMed 30. Mane A , Vidhate P , Kusro C et al. Molecular mechanisms associated with fluconazole resistance in clinical Candida albicans isolates from India . Mycoses . 2016 ; 59 : 93 – 100 . Google Scholar CrossRef Search ADS PubMed 31. Cannon RD , Lamping E , Holmes AR et al. Efflux-mediated antifungal drug resistance . Clin Microbiol Rev . 2009 ; 22 : 291 – 321 . Google Scholar CrossRef Search ADS PubMed 32. Prasad R , Banerjee A , Khandelwal NK , Dhamgaye S . The ABCs of Candida albicans multidrug transporter Cdr1 . Eukaryot Cell . 2015 ; 14 : 1154 – 1164 . Google Scholar CrossRef Search ADS PubMed 33. Park S , Perlin DS . Establishing surrogate markers for fluconazole resistance in Candida albicans . Microb Drug Resist . 2005 ; 11 : 232 – 238 . Google Scholar CrossRef Search ADS PubMed 34. Rosana Y , Yasmon A , Lestari DC . Overexpression and mutation as a genetic mechanism of fluconazole resistance in Candida albicans isolated from human immunodeficiency virus patients in Indonesia. J Med Microbiol . 2015 ; 64 : 1046 – 1052 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Medical Mycology Oxford University Press

Clonal spread and azole-resistant mechanisms of non-susceptible Candida albicans isolates from vulvovaginal candidiasis patients in three Shanghai maternity hospitals

Medical Mycology , Volume 56 (6) – Aug 1, 2018

Loading next page...
 
/lp/ou_press/clonal-spread-and-azole-resistant-mechanisms-of-non-susceptible-gJnXW2Sh0m
Publisher
Taylor & Francis
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology.
ISSN
1369-3786
eISSN
1460-2709
D.O.I.
10.1093/mmy/myx099
Publisher site
See Article on Publisher Site

Abstract

Abstract In our multicenter study, 43 fluconazole non-susceptible and 45 fluconazole-susceptible isolates were collected from vulvovaginal candidiasis (VVC) patients from three Shanghai maternity hospitals to analyze their molecular epidemiological features and fluconazole resistant mechanisms. Cross-resistance to fluconazole, itraconazole and voriconazole was observed in 53.5% of the nonsusceptible isolates. Though we acquired 12 clonal complexes (CCs) of diploid sequence types (DSTs) in clinical isolates by a multilocus sequence typing method, fluconazole nonsusceptible isolates all belonged to CC69 with a predominant genotype of DST 79. Increased expressions of efflux pump genes (CDR1, CDR2, and MDR1) were observed only in minor fluconazole non-susceptible isolates by real-time quantitative polymerase chain reaction (PCR). However, ERG11 genes of fluconazole SDD and resistant isolates had significantly higher expression levels than fluconazole-susceptible isolates. Moreover, 13 distinct amino acid substitutions in Erg11p were found in clinical isolates. Three of the substitutions were novel amino acid substitutions (T123I, P98S, and Y286D), which were not in the susceptible isolates. Only two heterozygous amino acid substitutions (A18P/A and R365G/R) in Erg3p were found in two isolates with cross-resistance to fluconazole, itraconazole, and voriconazole. Taken together, we observed the clonal spread of CC69 in fluconazole non-susceptible isolates of Candida albicans from VVC patients with the dominant genotype DST79. ERG11 gene mutations and overexpression predominantly contributed to fluconazole resistance instead of the more common increased expressions of efflux pump genes (CDR1, CDR2, and MDR1). Candida albicans, vulvovaginal candidiasis, multilocus sequence typing, azole resistance, molecular mechanism Introduction Vulvovaginal candidiasis (VVC) is a common disease that affects 75% of all women at least once during their lifetime because of an overgrowth of the Candida species. Misdiagnosis and subsequent inadequate treatment of VVC can lead to treatment failure and recurrent infection, such as recurrent VVC, which affects about 5–8% young women of childbearing age.1Candida albicans accounts for between 85% and 95% of Candida species isolated from the vagina.1 Candida albicans is the most significant fungus of candidiasis. The extensive and prolonged use of fungistatic azoles, especially fluconazole for chronic infections, has resulted in an increase in azole resistance. Our previous study indicated that 85.2% of 135 clinical isolates obtained from VVC patients were C. albicans, and 17% of the C. albicans isolates were not susceptible to fluconazole.2 Several molecular mechanisms that contribute to fluconazole resistance in C. albicans have been illuminated, including mutations or over-expression of the ERG11 gene and constitutive over-expressions of efflux pumps, such as increased expressions of specific trans-membrane transporters encoded by CDR1, CDR2, and MDR1 genes. These transporters can decrease the intracellular accumulation of therapeutic drugs by rapid extrusion, helping the yeast cells to survive.3–6 Recently, one study reported that defective sterol Δ5,6-desaturase activity caused by ERG3 mutations could confer azole resistance, which demonstrates that both ERG11 and other genes involved in the ergosterol biosynthetic pathway are associated with azole resistance.7 Only limited information is available about molecular epidemiology and azole resistance mechanisms of Candida albicans strains isolated from VVC patients in China. Therefore, we used the multilocus sequence typing (MLST) method to analysis the phylogenetic relationships among azole resistant and azole susceptible isolates from VVC patients in three Shanghai maternity hospitals. In addition, we evaluated the multiple resistance mechanisms of fluconazole resistant isolates of Candida albicans. We concentrated on mutations of ERG3 and ERG11; and messenger RNA (mRNA) expressions of the ERG11, CDR1, CDR2, MDR1 genes. Methods Identification of clinical isolates A total of 2185 Candida species isolates (including 1650 susceptible Candida albicans and 338 nonsusceptible C. albicans) were collected from VVC patients in the Obstetrics and Gynecology Hospital of Fudan University, the International Peace Maternity and Child Health Hospital and the Shanghai First Maternity and Infant Hospital (Shanghai, China) from August 2015 to February 2016. In addition, 45 fluconazole susceptible C. albicans isolates and 43 non-susceptible isolates were selected randomly for molecular epidemiology and azole-resistant mechanisms analyses (Supplementary S1). All isolates were obtained by vaginal swab. Swabs were cultured on CHROMagar Candida (CHROMagar, Paris, France) for green colonies, and then on Yeast Extract Peptone Dextrose Medium (ShengGong, Shanghai, China). All C. albicans isolates were finally identified by API 20C AUX (Biomerieux, Lyon, France). Antifungal susceptibility testing The azole minimum inhibitory concentrations (MICs) of 88 clinical isolates were determined using the broth microdilution method established by the CLSI M27-A3 standard guideline (2008). The MIC breakpoints for fluconazole, itraconazole, and voriconazole were determined as follows: fluconazole-susceptible = ≤ 8 μg/ml, susceptible-dose dependent (SDD) = 16–32 μg/ml, and resistant = ≥ 64 μg/ml; itraconazole-susceptible = ≤ 0.125 μg/ml, susceptible-dose dependent (SDD) = 0.25–0.5 μg/ml, and resistant = ≥ 1 μg/ml; and voriconazole-susceptible = ≤ 1 μg/ml, susceptible-dose dependent (SDD) = 2 μg/ml, and resistant = ≥ 4 μg/ml. Candida albicans (ATCC 90028) and Candida krusei (ATCC 6258) were used as quality controls in each test, and all of the tests were repeated a total of three times. Multilocus sequence typing analysis and phylogenetic analysis Genomic DNA of Candida albicans was extracted according to the manufacturer's instructions provided in the E.Z.N.ATM yeast DNA kit (Yeasen, Shanghai, China). Polymerase chain reaction (PCR) amplification of the seven housekeeping genes AAT1a, ACC1, ADP1, MPIb, SYA1, VPS13, and ZWF1b were performed using the primers and conditions described by Bougnoux et al.8 The PCR products were sent to the Shanghai branch of the Beijing Genomics Institute (Shanghai, China) to be purified and sequenced on ABI 3730 sequencing instruments in both directions. Sequencing data were checked manually for positions of heterozygotic or homozygotic polymorphisms. All alleles and diploid sequence types (DSTs) were double checked in both forward and reverse sequences by using the online MLST database (http://calbicans.mlst.net/). The eBURST v3 (http://calbicans.mlst.net/eburst/) analysis was used to determine the relationships among our isolates and those available DSTs (n = 3114) in the MLST database (accessed 2016.08.01) by placing clinical isolates into clonal complexes (CCs) and groups. In order to assign our isolates from VVC patients into clades, we performed a phylogenetic analysis of our isolates together with 1005 reference strains with known clades retrieved from the MLST database (http://pubmlst.org/calbicans/) by MEGA version 6. Clade numbers of all isolates were determined by the unweighted pair-group method using arithmetic averages (UPGMA) based on MLST data. The p-distance threshold of 0.04 was used to define clades as described previously.9,10 ERG3, ERG11 genes amplification and sequencing Candida albicans genomic DNA was extracted according to the manufacturer's instructions provided in the E.Z.N.ATM yeast DNA kit (Yeasen, Shanghai, China), and then was used as template for amplification of the full-length ERG3 and ERG11 genes. The primers used for PCR amplification and sequencing are shown in Table 1. The PCR products were sequenced by the Shanghai branch of the Beijing Genomics Institute (Shanghai, China) and compared with the sequences published in GenBank for ERG3 (accession number XM708519) and ERG11 (accession number XM711668). Table 1. Oligonucleotides used in this study. Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC *These primers were used for ERG11 and ERG3 genes sequencing. View Large Table 1. Oligonucleotides used in this study. Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC Primer Sequence (5΄-3΄) ERG11-1-F* GAATTCAATCGTTATTCTTTCCA ERG11-1-R* TGGATCAATATCACCACGTTCT ERG11-2-F* CCCTAATTTACCTTTACCTCATTATT ERG11-2-R* ATCCAACTAAGTAACAAAATGAAAAC ERG3-F* AGTTCAATCTTTTTTTCTTTCTTTC ERG3-R* GAAAAATAGTCAATGGTCCAAAAC ERG11-F AACTACTTTTGTTTATAATTTAAGATGGACT ERG11-R AATGATTTCTGCTGGTTCAGTAGGT CDR1-F TTTAGCCAGAACTTTCACTCATGATT CDR1-R TATTTATTTCTTCATGTTCATATGGATTGA CDR2-F GGTATTGGCTGGTCCAATGTGA CDR2-R GCTTGAATCAAATAAGTGAATGGATTAC MDR1-F TTACCTGAAACTTTGGCAAAACA MDR1-R ACTTGTGATTCTGTCGTTACCG 18S-F GAGAAACGGCTACCACAT 18S-R ATTCCAATTACAAGACCC *These primers were used for ERG11 and ERG3 genes sequencing. View Large Quantitative RT-PCR for gene expressions RNA was extracted from YPD broth cultures in the mid-log exponential growth phase according to the manufacturer's recommendations provided in the Yeast RNAiso Kit (TaKaRa, Tokyo, Japan). First strand complementary DNA (cDNA) was quantitatively synthesized from 500 ng of total RNA using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Tokyo, Japan). Expression levels of related resistance genes ERG11, CDR1, CDR2, MDR1, and 18S rRNA (250 times dilution of the same genomic DNA) were determined by qRT-PCR using a 7900HTFast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), with SYBR Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa, Japan). All primers and cycling conditions were described in previous study,11 and primers are listed in Table 1. Each sample was performed in triplicate technical replicates. The mRNA expression levels of ERG11, CDR1, CDR2, and MDR1 were calculated using the 2−ΔΔCt method.12 The mRNA expression levels for each isolate were compared with the average expression level of 10 collected fluconazole susceptible isolates after normalization to an 18S rRNA control, which was amplified at the same time with each target gene. RNA transcript levels with a measured ΔCt value below the 3.0 standard deviations (SD) range measured in fluconazole susceptible isolates were considered significant overexpression.13 Statistical analysis Statistical analyses were performed with GraphPad Prism version 5.0 for Windows (GraphPad Software, La Jolla, CA, USA). P < .05 was considered to be statistically significant. Results Antifungal susceptibility to other antifungal agents All 45 fluconazole susceptible isolates exhibited susceptibility to itraconazole and voriconazole. In 13 fluconazole susceptible dose-dependent (S-DD) isolates, three (23.1%) and seven (53.8%) isolates were S-DD to itraconazolele and voriconazole, respectively, while three3 isolates were susceptible to voriconazole. In 30 fluconazole resistant isolates of the total number, all isolates were resistant to itraconazole, while 23 (76.7%) isolates were resistant to voriconazole. In addition, 23/43 (53.5%) isolates were cross-resistance to fluconazole, itraconazole, and voriconazole. More details are shown in Supplementary S1. MLST genotyping and phylogenetic analysis A multicenter study was enforced at three Shanghai maternity hospitals over a 6-month period. Twenty-two unique DSTs were found among all 88 clinical Candia albicans isolates. Most isolates (94.3%) belonged to previously described sequence types (17 DSTs), but we found five novel DSTs that have been added to the MLST database. Interestingly, 74.4% (32/43) isolates that were fluconazole nonsusceptible belonged to DST 79 (Table 2), but only 40% (18/45) of the susceptible isolates were the same DST (DST 79), especially only 20% in the Obstetrics and Gynecology Hospital of Fudan University. The proportions of different DSTs of fluconazole nonsusceptible isolates in these hospitals are almost the same. Table 2. Distribution of DSTs in fluconazole susceptible and non-susceptible isolates. DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 View Large Table 2. Distribution of DSTs in fluconazole susceptible and non-susceptible isolates. DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 DSTs Susceptible isolates (n = 45) Nonsusceptible isolates (n = 43) P value 79 18 (40%) 32 (74.4%) <.01 435 4 (8.9%) 6 (14%) .517 1867 … 2 (4.7%) .236 365 2 (4.4%) … .495 Other 21 (46.7%) 3 (6.9%) <.01 View Large The eBURST analysis assigned the 88 clinical isolates into 12 CCs of DSTs and one singleton DST. Interestingly, all isolates of fluconazole nonsusceptibility belonged to CC69 and were placed in group 1. There were only five DSTs in those isolates, and we observed their phylogenetic relationships by eBURST analysis (Fig. 1). However, there were 12 eBURST groups in susceptible isolates. In addition, all strains were grouped into 17 clades and some singletons by defining the clades as outlined in a previous study.10 Of these strains, our isolates were clustered into nine known clades and two singletons. All fluconazole non-susceptible isolates belonged to clade 1, but 45 susceptible isolates were grouped into nine clades and two singletons (Fig. 2). Figure 1. View largeDownload slide Phylogenetic relationships of DSTs of fluconazole non-susceptible isolates in the eBURST group one. The eBURST defined group one snapshot is based on available Candida albicans DSTs in the MLST database (http://pubmlst.org/calbicans/). Five DSTs of fluconazole non-susceptible isolates are circles colored as green. And the predicted founder in the red circle is DST 79. This Figure is reproduced in color in the online version of Medical Mycology. Figure 1. View largeDownload slide Phylogenetic relationships of DSTs of fluconazole non-susceptible isolates in the eBURST group one. The eBURST defined group one snapshot is based on available Candida albicans DSTs in the MLST database (http://pubmlst.org/calbicans/). Five DSTs of fluconazole non-susceptible isolates are circles colored as green. And the predicted founder in the red circle is DST 79. This Figure is reproduced in color in the online version of Medical Mycology. Figure 2. View largeDownload slide UPGMA dendrogram of the 88 clinical isolates. The black dots indicate fluconazole nonsusceptible isolates, and the others are susceptible isolates. The scale bar indicates p-distances. This Figure is reproduced in color in the online version of Medical Mycology. Figure 2. View largeDownload slide UPGMA dendrogram of the 88 clinical isolates. The black dots indicate fluconazole nonsusceptible isolates, and the others are susceptible isolates. The scale bar indicates p-distances. This Figure is reproduced in color in the online version of Medical Mycology. ERG11 and ERG3 mutations in fluconazole non-susceptible and susceptible isolates Bidirectional sequencing of PCR products of the full-length ERG11 genes from all fluconazole non-susceptible isolates and 10 fluconazole susceptible isolates revealed 13 distinct amino acid substitutions (T123I, Y132H, A114S, D116E, K128T, G465S, Y257H, G448E, P98S, Y286D, E266D, V437I, and V488I) (Supplementary S1). T123I, P98S, and Y286D were novel amino acid substitutions, and P98S was a result of heterozygous mutation. Interestingly, 26 (60%) of the fluconazole nonsusceptible isolates contained novel T123I homozygous substitution, which did not occur in fluconazole susceptible isolates. In sum, 36 (83.7%) fluconazole nonsusceptible isolates contained a Y132H amino acid substitution. Moreover, the combination of T123I and Y132H substitutions were detected in a total of 27 isolates, of which 16 were cross-resistance to fluconazole, itraconazole, and voriconazole. None of these isolates currently occurred in any azole susceptible strains. Five amino acid substitutions occurred in azole susceptible isolates, including homozygous substitutions (D116E, V437I, E266D, and V488I) and heterozygous substitutions (D116E/D and K128T/K). In addition, only two heterozygous amino acid substitutions (A18P/A and R365G/R) in Erg3p occurred in the two isolates with cross-resistance to fluconazole, itraconazole and voriconazole (Supplementary S1). Four distinct ERG11 sequences containing novel amino acid substitutions were submitted to GeneBank database for accession numbers (KX631421, KX631422, KX631423, and KX631424). Analysis of gene expressions associated with fluconazole resistance The levels of expression of efflux transporters and the ERG11 gene in fluconazole susceptible, SDD and resistant strains were assessed by quantitative RT-PCR (Supplementary S1). Fluconazole SDD and resistant isolates had significantly higher expression levels of ERG11 than fluconazole susceptible isolates (P < .05). The ERG11 gene expression levels in susceptible, S-DD, and resistant isolates are shown in Figure 3. However, there were no statistically significant differences in the expression levels of any CDR1, CDR2, and MDR1 genes among the fluconazole susceptible, SDD, and resistant isolates. Only one fluconazole resistant isolate had a higher expression level of CDR1. There were only five isolates overexpressing CDR2, one of which was cross-resistance to fluconazole, itraconazole, and voriconazole. Similarly, among 43 fluconazole S-DD and resistant isolates, only three isolates had increased expressions of MDR1, of which one was cross-resistance to fluconazole, itraconazole and voriconazole. Figure 3. View largeDownload slide Relative fold expression levels of ERG11 genes in susceptible, S-DD and resistant isolates. Figure 3. View largeDownload slide Relative fold expression levels of ERG11 genes in susceptible, S-DD and resistant isolates. Discussion In our multicenter study, we used the multilocus sequence typing method to analyze the genotype distribution and genetic characterization of azole susceptible and nonsusceptible Candida albicans strains isolated from vulvovaginal candidiasis patients from three maternity hospitals in Shanghai, China. All susceptible isolates (21 DSTs) presented genotypic diversity, all of which were assigned to 12 groups by eBURST analysis. The majority belonged to clade 1. In a previous study, phylogenetic analysis of 1410 DSTs revealed that the most prevalent clades globally were clade 1 to clade 4.14 Recently, some researchers revealed the diversity of the genotype geographical distribution of C. albicans isolates from vulvovaginal candidiasis patients. In China, 71.6% of the C. albicans isolates from VVC were located in clade 1, and the majority of the VVC isolates cantered on a cluster of clade 1 with DST1867 and DST79 as the dominant genotypes.15 This distribution is similar to genotype distribution patterns of azole susceptible isolates in this study. In England, the predominant isolates from vaginal samples were clade 1, but clade 3 strains were the dominant isolates in the United States. In addition, there were wider clades (5–17) in Japan.16 Moreover, Candida albicans isolates obtained from different body sites exhibited the diversity of the genotype distribution patterns.17,18 In this study, however, we found the indications of clonal spread in fluconazole nonsusceptible isolates from VVC patients with the dominant genotype DST79. All isolates of fluconazole non-susceptibility belonged to CC69 and were assigned to clade 1. One study showed that only 40.6% of the vaginal isolates from healthy volunteers were found in the same clade of the isolates from VVC patients in China, whose genotypes were concentrated in DST1867 and DST79.15 From normal vaginal isolates to fluconazole resistant isolates from VVC patients, DST 79 gradually demonstrates the enhanced propensity to become the dominant genotype. In accordance with a previous study, Candida albicans can rapidly acquire the selective advantage of resistance phenotype since it contains huge clonal populations, which translates into large scale genetic plasticity.19 It is reasonable to speculate that changes in microenvironment promote the pattern of genotype distribution with specific enriched genotypes. Further comparative study might be needed to reveal the adaptive changes of C. albicans as the result of changes in the host environment. Moreover, these hospitals locate in the center of Shanghai and cover the majority population of Shanghai, China. And these hospitals are the largest maternity hospitals in Shanghai. These hospitals all are tertiary referral centers, but we cannot acquire the statistics of transfer of patients among these three hospitals. There is no evidence for the role of patients’ dynamics and the referral in clonal spread. In addition, we evaluated the most common molecular mechanisms including mutations of the ERG11 gene and the expressions of efflux pumps involved in fluconazole resistance in clinical isolates from VVC patients in China. Lower affinity of the azole drug to the target sites caused by amino acid substitutions of cytochrome P450 14a-demethylase (Erg11p) has been demonstrated to be one of the most important mechanisms for azole resistance.20 Most amino acid substitutions detected in the Erg11p were reported in the three hot spot regions (ranging from amino acids 105 to 165, 266 to 287, and 405 to 488),21 though we found a novel amino acid substitution P98S that fell outside these regions. In our study, 83.7% of fluconazole non-susceptible isolates contained a Y132H amino acid substitution, 17 of which were cross-resistance to fluconazole, itraconazole, and voriconazole. Y132H substitution, which occurred concurrently with N136Y, was previously confirmed to be involved in azole resistance by causing the modified heme environment in the active site.22,23 Interestingly, Y132H substitution in the majority of clinical isolates, 59% of which was cross-resistance to fluconazole, itraconazole, and voriconazole, occurred simultaneously with T123I substitution in this study. This combination may exhibit a synergistic effect in the Erg11p spatial conformation and requires further study. In addition, A114S, Y257H, and G448E substitutions in this study also were reported only in azole nonsusceptible isolates, and their contribution to fluconazole resistance were confirmed.21,24,25 Single substitution of D116E, K128T, E266D, V437I, or V488I may not be associated with azole resistance as they were found in both azole susceptible and azole resistant isolates.26 In addition, some researchers revealed that ERG3 mutations could confer azole resistance since ERG3 mutations could deprive the function of sterol Δ5,6-desaturase and then resulted in accumulation of 14a-methylfecosterol to maintain proliferation that could withstand azole treatment.7,27 However, only two heterozygous mutations in ERG3 were found, and no homozygous mutation was observed in this study. The overexpression of relevant genes expressions also played a role in azole resistance of C. albicans. The constitutive overexpression of ERG11 gene involved in azole resistance has been previously reported.28–30 In accordance with these reports, overexpression of ERG11 gene was observed as dominant in S-DD and resistant isolates in our study. Moreover, overexpression of the ATP-binding cassette (ABC) transporters CDR1 and CDR2, and the major facilitator superfamily (MFS) transporter MDR1, are all involved in fluconazole resistance by reducing drug accumulation in yeast cells.5,31,32 Interestingly, though overexpressions of ABC transporters CDR1 and CDR2 were generally observed in clinical resistant isolates according to many reports,11,33,34 only one of five fluconazole nonsusceptible isolates exhibited overexpressions of CDR1 or CDR2, respectively, in our study. Similarly, only three fluconazole resistant isolates exhibited overexpressions of MDR1. So maybe ERG11 mutations and overexpression or other molecular mechanisms predominantly contribute to fluconazole resistance of isolates from VVC patients. In conclusion, our MLST analysis revealed a phenomenon of clonal spread of CC69 in fluconazole nonsusceptible isolates from VVC patients in China with the dominant genotype DST79. Genetic and phenotypic further study of DST79 strains may help improve the efficacy of the treatment of vulvovaginal candidiasis. In addition, our work demonstrates that ERG11 mutations, especially T394C (Y132H), and overexpression may be the primarily molecular mechanisms of fluconazole resistance in these isolates from VVC patients in three Shanghai maternity hospitals. Our work may give people a better understanding of molecular mechanisms of the azole resistance of clinical isolates from VVC patients and help to develop the new antifungal drugs targeting these mutations. Supplementary material Supplementary data are available at MMYCOL online. Acknowledgements This study is one of the Capacity Building projects, which are supported by the Shanghai Shen Kang Hospital Development Center for clinical ancillary departments in municipal hospitals (grant SHDC22014016). Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper. References 1. Sobel JD . Vulvovaginal candidosis . Lancet . 2007 ; 369 : 1961 – 1971 . Google Scholar CrossRef Search ADS PubMed 2. Ying C , Zhang H , Tang Z et al. Antifungal susceptibility and molecular typing of 115 Candida albicans isolates obtained from vulvovaginal candidiasis patients in 3 Shanghai maternity hospitals . Med Mycol . 2016 ; 54 : 394 – 399 . Google Scholar CrossRef Search ADS PubMed 3. Sanglard D , Ischer F , Parkinson T , Falconer D , Bille J . Candida albicans mutations in the ergosterol biosynthetic pathway and resistance to several antifungal agents . Antimicrob Agents Chemother . 2003 ; 47 : 2404 – 2412 . Google Scholar CrossRef Search ADS PubMed 4. Flowers SA , Colon B , Whaley SG , Schuler MA , Rogers PD . Contribution of clinically derived mutations in ERG11 to azole resistance in Candida albicans . Antimicrob Agents Chemother . 2015 ; 59 : 450 – 460 . Google Scholar CrossRef Search ADS PubMed 5. Prasad R , Rawal MK . Efflux pump proteins in antifungal resistance . Front Pharmacol . 2014 ; 5 : 202 – 216 . Google Scholar CrossRef Search ADS PubMed 6. Schneider S , Morschhauser J . Induction of Candida albicans drug resistance genes by hybrid zinc cluster transcription factors . Antimicrob Agents Chemother . 2015 ; 59 : 558 – 569 . Google Scholar CrossRef Search ADS PubMed 7. Morio F , Pagniez F , Lacroix C , Miegeville M , Le Pape P . Amino acid substitutions in the Candida albicans sterol Delta5,6-desaturase (Erg3p) confer azole resistance: characterization of two novel mutants with impaired virulence . J Antimicrob Chemother . 2012 ; 67 : 2131 – 2138 . Google Scholar CrossRef Search ADS PubMed 8. Bougnoux ME , Tavanti A , Bouchier C et al. Collaborative consensus for optimized multilocus sequence typing of Candida albicans . J Clin Microbiol . 2003 ; 41 : 5265 – 5266 . Google Scholar CrossRef Search ADS PubMed 9. Shin JH , Bougnoux M , D’Enfert C et al. Genetic diversity among Korean Candida albicans bloodstream isolates: assessment by multilocus sequence typing and restriction endonuclease analysis of genomic DNA by use of BssHII. J Clin Microbiol . 2011 ; 49 : 2572 – 2577 . Google Scholar CrossRef Search ADS PubMed 10. Odds FC , Bougnoux ME , Shaw DJ et al. Molecular phylogenetics of Candida albicans . Eukaryot Cell . 2007 ; 6 : 1041 – 1052 . Google Scholar CrossRef Search ADS PubMed 11. Liu JY , Shi C , Wang Y et al. Mechanisms of azole resistance in Candida albicans clinical isolates from Shanghai, China. Res Microbiol . 2015 ; 166 : 153 – 161 . Google Scholar CrossRef Search ADS PubMed 12. Livak KJ , Schmittgen TD . Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method . Methods . 2001 ; 25 : 402 – 408 . Google Scholar CrossRef Search ADS PubMed 13. Chau AS , Mendrick CA , Sabatelli FJ , Loebenberg D , McNicholas PM . Application of real-time quantitative PCR to molecular analysis of Candida albicans strains exhibiting reduced susceptibility to azoles . Antimicrob Agents Chemother . 2004 ; 48 : 2124 – 2131 . Google Scholar CrossRef Search ADS PubMed 14. Odds FC . Molecular phylogenetics and epidemiology of Candida albicans . Future Microbiol . 2010 ; 5 67 – 79 . Google Scholar CrossRef Search ADS PubMed 15. Ge S , Xie J , Xu J et al. Prevalence of specific and phylogenetically closely related genotypes in the population of Candida albicans associated with genital candidiasis in China. Fungal Genet Biol . 2012 ; 49 : 86 – 93 . Google Scholar CrossRef Search ADS PubMed 16. Takakura S , Ichiyama S , Bain JM et al. Comparison of Candida albicans strain types among isolates from three countries . Int J Med Microbiol . 2008 ; 298 : 663 – 668 . Google Scholar CrossRef Search ADS PubMed 17. McManus BA , Coleman DC . Molecular epidemiology, phylogeny and evolution of Candida albicans . Infect Genet Evol . 2014 ; 21 : 166 – 178 . Google Scholar CrossRef Search ADS PubMed 18. Wang S , Shen M , Lin H et al. Molecular epidemiology of invasive Candida albicans at a tertiary hospital in northern Taiwan from 2003 to 2011 . Med Mycol . 2015 ; 53 : 828 – 836 . Google Scholar CrossRef Search ADS PubMed 19. Moorhouse AJ , Rennison C , Raza M , Lilic D , Gow NAR . Clonal strain persistence of Candida albicans isolates from chronic mucocutaneous candidiasis patients . PLoS One . doi:10.1371/journal.pone.0145888 . 20. Morio F , Loge C , Besse B , Hennequin C , Le Pape P . Screening for amino acid substitutions in the Candida albicans Erg11 protein of azole-susceptible and azole-resistant clinical isolates: new substitutions and a review of the literature . Diagn Microbiol Infect Dis . 2010 ; 66 : 373 – 384 . Google Scholar CrossRef Search ADS PubMed 21. Marichal P , Koymans L , Willemsens S et al. Contribution of mutations in the cytochrome P450 14alpha-demethylase (Erg11p, Cyp51p) to azole resistance in Candida albicans . Microbiology . 1999 ; 145 : 2701 – 2713 . Google Scholar CrossRef Search ADS PubMed 22. Alvarez-Rueda N , Fleury A , Logé C et al. The amino acid substitution N136Y in Candida albicans sterol 14alpha-demethylase is involved in fluconazole resistance . Med Mycol . 54 : 764 – 775 . CrossRef Search ADS PubMed 23. Park H , Lee I , Chun Y et al. Heterologous expression and characterization of the sterol 14α-demethylase CYP51F1 from Candida albicans . Arch Biochem Biophys . 2011 ; 509 : 9 – 15 . Google Scholar CrossRef Search ADS PubMed 24. Xu Y , Chen L , Li C . Susceptibility of clinical isolates of Candida species to fluconazole and detection of Candida albicans ERG11 mutations . J Antimicrob Chemother . 2008 ; 61 : 798 – 804 . Google Scholar CrossRef Search ADS PubMed 25 Xiang MJ , Liu JY , Ni PH et al. Erg11 mutations associated with azole resistance in clinical isolates of Candida albicans . Fems Yeast Res . 2013 ; 13 : 386 – 393 . Google Scholar CrossRef Search ADS PubMed 26. Ying Y , Zhao Y , Hu X et al. In vitro fluconazole susceptibility of 1,903 clinical isolates of Candida albicans and the identification of ERG11 mutations . Microb Drug Resist . 2013 ; 19 : 266 – 273 . Google Scholar CrossRef Search ADS PubMed 27. Martel CM , Parker JE , Bader O et al. Identification and characterization of four azole-resistant erg3 mutants of Candida albicans . Antimicrob Agents Chemother . 2010 ; 54 : 4527 – 4533 . Google Scholar CrossRef Search ADS PubMed 28. Hoehamer CF , Cummings ED , Hilliard GM , Morschhauser J , David RP . Upc2p-associated differential protein expression in Candida albicans . Proteomics . 2009 ; 9 : 4726 – 4730 . Google Scholar CrossRef Search ADS PubMed 29. Flowers SA , Barker KS , Berkow EL et al. Gain-of-function mutations in UPC2 are a frequent cause of ERG11 upregulation in azole-resistant clinical isolates of Candida albicans . Eukaryot Cell . 2012 ; 11 : 1289 – 1299 . Google Scholar CrossRef Search ADS PubMed 30. Mane A , Vidhate P , Kusro C et al. Molecular mechanisms associated with fluconazole resistance in clinical Candida albicans isolates from India . Mycoses . 2016 ; 59 : 93 – 100 . Google Scholar CrossRef Search ADS PubMed 31. Cannon RD , Lamping E , Holmes AR et al. Efflux-mediated antifungal drug resistance . Clin Microbiol Rev . 2009 ; 22 : 291 – 321 . Google Scholar CrossRef Search ADS PubMed 32. Prasad R , Banerjee A , Khandelwal NK , Dhamgaye S . The ABCs of Candida albicans multidrug transporter Cdr1 . Eukaryot Cell . 2015 ; 14 : 1154 – 1164 . Google Scholar CrossRef Search ADS PubMed 33. Park S , Perlin DS . Establishing surrogate markers for fluconazole resistance in Candida albicans . Microb Drug Resist . 2005 ; 11 : 232 – 238 . Google Scholar CrossRef Search ADS PubMed 34. Rosana Y , Yasmon A , Lestari DC . Overexpression and mutation as a genetic mechanism of fluconazole resistance in Candida albicans isolated from human immunodeficiency virus patients in Indonesia. J Med Microbiol . 2015 ; 64 : 1046 – 1052 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Medical MycologyOxford University Press

Published: Aug 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off