Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/ou_press/chronic-stress-exposure-reduces-parvalbumin-expression-in-the-rat-vnuVK62umx
- Publisher
- Oxford University Press
- Copyright
- © The Author(s) 2018. Published by Oxford University Press on behalf of CINP.
- ISSN
- 1461-1457
- eISSN
- 1469-5111
- DOI
- 10.1093/ijnp/pyy046
- Publisher site
- See Article on Publisher Site
Abstract
Background: Psychiatric disorders are associated with altered function of inhibitory neurotransmission within the limbic system, which may be due to the vulnerability of selective neuronal subtypes to challenging environmental conditions, such as stress. In this context, parvalbumin-positive GABAergic interneurons, which are critically involved in processing complex cognitive tasks, are particularly vulnerable to stress exposure, an effect that may be the consequence of dysregulated redox mechanisms. Methods: Adult Male Wistar rats were subjected to the chronic mild stress procedure for 7 weeks. After 2 weeks, both control and stress groups were further divided into matched subgroups to receive chronic administration of vehicle or lurasidone (3 mg/kg/d) for the subsequent 5 weeks. Using real-time RT-PCR and western blot, we investigated the expression of GABAergic interneuron markers and the levels of key mediators of the oxidative balance in the dorsal and ventral hippocampus. Results: Chronic mild stress induced a specific decrease of parvalbumin expression in the dorsal hippocampus, an effect normalized by lurasidone treatment. Interestingly, the regulation of parvalbumin levels was correlated to the modulation of the antioxidant master regulator NRF2 and its chaperon protein KEAP1, which were also modulated by pharmacological intervention. Conclusions: Our findings suggest that the susceptibility of parvalbumin neurons to stress may represent a key mechanism contributing to functional and structural impairments in specific brain regions relevant for psychiatric disorders. Moreover, we provide new insights on the mechanism of action of lurasidone, demonstrating that its chronic treatment normalizes chronic mild stress-induced parvalbumin alterations, possibly by potentiating antioxidant mechanisms, which may ameliorate specific functions that are deteriorated in psychiatric patients. Keywords: stress, hippocampus, parvalbumin, lurasidone, NRF2 Received: February 21, 2018; Revised: May 2, 2018; Accepted: May 15, 2018 © The Author(s) 2018. Published by Oxford University Press on behalf of CINP. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, 883 provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 884 | International Journal of Neuropsychopharmacology, 2018 Significance Statement Our study provides evidence for an association between the stress-induced decrease of parvalbumin, a marker of GABAergic interneurons, and the alterations of key players of the oxidative balance. Of particular interest is the observation that chronic treatment with the antipsychotic drug lurasidone is able to normalize the decrease of parvalbumin in parallel with potential antioxidative effects on the NRF2-KEAP1 system as well as on the enzyme NOX2. Our data suggest a close relationship between the alterations of selected GABAergic interneurons and the redox balance that may represent an important mechanism through which lurasidone may ameliorate brain function in stress-related pathologic conditions. Introduction Psychiatric diseases, such as major depression and schizophre- (Nasrallah et al., 2015) and in bipolar depression (Loebel et al., nia, are highly disabling disorders characterized by complex 2014). We previously demonstrated that chronic lurasidone is etiological mechanisms that lead to functional abnormalities of able to normalize the stress-induced depressive-like behav- different neurotransmitters, including monoamines, GABA and iors as well as the neuroplastic and inflammatory alterations glutamate, as well as a dysregulation of inflammation, neuro- observed in stressed rats (Luoni et al., 2014 Rossetti et ; al., 2016). plasticity, and hormonal signaling (Kupfer et al., 2012 Cala ; brese et al., 2016a; Owen et al., 2016; Begni et al., 2017). The multifac- Methods eted behavioral symptomatology of these disorders involves the perturbation of emotional and cognitive domains of the indi- Animals vidual and, among the others, cognitive symptoms have a dra- matic impact on the everyday life of the patients (Millan et al., Adult male Wistar rats (Charles River) were brought into the 2012). In this context, at the cortical and hippocampal levels, the laboratory 1 month before the start of the experiment. Except as GABAergic inhibitory tone finely regulates the firing of principal described below, the animals were singly housed with food and glutamatergic neurons. In more detail, GABAergic interneurons water freely available and were maintained on a 12-h- light/- synchronize the firing of principal cells controlling the plasticity dark cycle in a constant temperature (22 ± 2°C) and humidity of excitatory synaptic inputs through dendritic inhibition, while (50 ± 5%) conditions. All procedures used in this study conform they inhibit the output with perisomatic inhibition (Freund, to the rules and principles of the 2010/63/EU Directive and were 2003). Among the diverse subtypes of GABAergic interneurons approved by the Local Bioethical Committee at the Institute of populating the hippocampal formation, parvalbumin (PVB), Pharmacology, Polish Academy of Sciences, Krakow, Poland. All somatostatin (SST), calbindin (CALB), and neuropeptide-Y (NPY) efforts were made to minimize animal suffering and to reduce positive cells represent the most sensitive to stress exposure the number of animals used (n = 10 each experimental group). (Filipovic et al. 2013; Czeh et al. 2015). Specifically, the highly energized, fast-spiking, PVB positive (PVB+) interneurons play CMS Procedure and Pharmacological Treatment a pivotal role in the processing of complex information. Their contribution in cognitive decline may be fundamental, espe- After a period of adaptation to laboratory and housing condi- cially when dysregulation of the energy demand and/or of the tions, the animals (220 ± 7 g) were subjected to 7 weeks of CMS in oxidative balance may impair their functions (Kann, 2016). This parallel with a 5-week-long treatment with lurasidone. may occur following exposure to stress, which represents a The stress regimen consisted of 2 periods of food or water major environmental condition for mental disorders (Pittenger deprivation, 2 periods of 45° cage tilt, 2 periods of intermittent and Duman, 2008; Cattaneo and Riva, 2016). Indeed, PVB+ neu- illumination (lights on and off every 2 h), 2 periods of soiled cage rons can be part of a critical loop since, while stress may lead to (250 mL water in sawdust bedding), one period of paired hous- an impairment of this neuronal population (Zaletel et al., 2016), ing, 2 periods of low intensity stroboscopic illumination (150 the suppressed function of PVB+ neurons may reduce resilience flashes/min), and 3 periods of no stress. All stressors were 10 to (Perova et al., 2015). 14 hours of duration and were applied individually and continu- In the present work we used the chronic mild stress (CMS) ously, day and night. Control animals were housed in separate model (Willner, 2017) to investigate the detrimental effects of rooms and had no contact with the stressed animals. They were stress on PVB+ cells in rat hippocampus and the potential con- deprived of food and water for 14 hours preceding each sucrose tribution of a dysregulation in redox mechanisms, which have test, but otherwise food and water were freely available in the also been associated with the pathophysiology of several psy- home cage. chiatric disorders (Moniczewski et al., 2015Sma ; ga et al., 2015; Animals were subjected to the stress procedure for 7 weeks. Steullet et al., 2017). We have previously shown that CMS is able Following the first 2 weeks of stress, both control and stress to induce depressive-like behaviors such as anhedonia (Rossetti groups were further divided into matched subgroups, and for et al., 2016) as well as cognitive impairment (Calabrese et al., the subsequent 5 weeks they received oral administration (by 2017), which are associated with alterations in key molecular gavage) of vehicle (hydroxy-ethyl-cellulose 1%) or lurasidone players for psychiatric disorders (Luoni et al., 2014 Cala ; brese (3 mg/kg daily). Our experimental design included 4 groups of et al., 2016b; Molteni et al., 2016). We also investigated the animals: unstressed rats that received the vehicle, used as ref- effect of a chronic treatment with lurasidone in counteracting erence control group (“No Stress/Vehicle”, =n 10); unstressed the CMS-induced alterations in rat hippocampus. Lurasidone rats that received the drug (No Stress/Lurasidone, n = 10); is a multi-receptor antipsychotic drug (Tarazi and Riva, 2013) stressed rats that received the vehicle (Stress/Vehicle= , n 10); with demonstrated clinical efficacy for cognitive deficits in and stressed rats that received the drug (Stress/Lurasidone, schizophrenia (Harvey et al., 2013) and in bipolar disorder n = 10). After 5 weeks, the treatments were terminated, and (Yatham et al., 2017) and depressive symptoms in schizophrenia all control and stressed animals were killed by decapitation Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 Rossetti et al. | 885 24 hours after the last drug administration. The brains were fluoride in presence of a complete set of proteases [Roche] and removed and dissected for prefrontal cortex, dorsal, and ven- phosphatase [Sigma-Aldrich] inhibitors) and then sonicated tral hippocampus as fresh tissues. All samples were then rap- for 10 seconds at a maximum power of 10% to 15% (Bandelin idly frozen in dry ice/isopentane and stored at −80°C for further Sonoplus). The homogenate was clarified (1000 g; 10 minutes), molecular analyses. obtaining a pellet (P1) enriched in nuclear components, which was resuspended in a buffer (1 mM HEPES, 0.1mM dithiothreitol, 0.1 mM EGTA) supplemented with protease and phosphatase RNA Preparation and Quantitative Real-Time PCR inhibitors. The supernatant (S1) was then centrifuged (13 000g; Analyses 15 minutes) to obtain a clarified fraction of cytosolic proteins Total RNA was isolated by single step guanidinium isothio- (S2). The pellet (P2), corresponding to the crude membrane frac- cyanate/phenol extraction using PureZol RNA isolation reagent tion, was resuspended in the same buffer used for the nuclear (Bio-Rad Laboratories S.r.l.) according to the manufacturer’s fraction. Total protein content was measured according to the instructions and quantified by spectrophotometric analysis. Bradford Protein Assay procedure (Bio-Rad Laboratories), using The samples were processed for PCR as previously described bovine serum albumin as calibration standard. (Rossetti et al., 2016) to measure the mRNA expression of Pvb, Sst, Protein analyses were performed in the whole homogenate Calb, Npy, NADPH oxygenase 2 (Nox2), nuclear factor (erythroid- (for PVB), in the cytosolic fraction (for NRF2 and KEAP1), and in derived 2)-like 2 (Nrf2), sulfiredoxin (Srxn), hemeoxigenase-1 (Ho- the crude membrane fraction (for NOX2). Equal amounts of pro- 1), NAD(P)H dehydrogenase [quinone]1 (Nqo1), and catalase (Cat). tein (10 μg for the homogenate, 30 μg for the S2, and 15 μg for the Primer and probe sequences are listed in Table 1. P2) were run under reducing conditions on polyacrylamide gels Specifically, RNA aliquots of each sample were treated with and then electrophoretically transferred onto polyvinylidene DNase to avoid DNA contamination and then analyzed by fluoride or nitrocellulose membranes. Unspecific binding sites TaqMan qRT-PCR instrument (CFX384 real-time system, Bio-Rad were blocked with 10% nonfat dry milk; then the membranes Laboratories) using the iScript one-step RT-PCR kit for probes were incubated overnight with the primary antibodies and for (Bio-Rad Laboratories). The samples were run in 384-well for - 1 hour at room temperature with a peroxidase-conjugated anti- mats in triplicate as multiplexed reactions with a normalizing rabbit or anti-mouse IgG (Table ). 2 Immunocomplexes were vis- internal control (β-Actin). ualized by chemiluminescence using the ECL Star (Euroclone), Thermal cycling was initiated with an incubation at 50°C ECL Plus (Euroclone), or ECL Clarity (Bio-Rad Laboratories). for 10 minutes (RNA retro-transcription) and then at 95°C for 5 Results were standardized using β-actin as the internal control, minutes (TaqMan polymerase activation). After this initial step, which was detected by evaluating the band density at 43 kDa. 39 cycles of PCR were performed. Each PCR cycle consisted of Protein levels were calculated by measuring the optical density heating the samples at 95°C for 10 seconds to enable the melt- of the immunocomplexes using chemiluminescence (Chemidoc ing process and then for 30 seconds at 60°C for the annealing MP Imaging System, Bio-Rad Laboratories). To ensure that auto- and extension reaction. A comparative cycle threshold (Ct) radiographic bands would be in the linear range of intensity, dif- method was used to calculate the relative target gene expres- ferent exposure times were used. sion vs the control group. Specifically, fold change for each tar - get gene relative to β-actin was determined by the 2-∆(∆CT) Statistical Analyses method, where ∆CT = CT(target)-CT(β-actin); ∆(∆CT) = ∆CT(exp. The effects of drug treatment (lurasidone) and chronic stress group)-∆CT(control group); CT is the threshold cycle. For graph- ical clarity, the obtained data were then expressed as percentage exposure on the mRNA or protein levels of our molecular tar - gets were analyzed by 2-way ANOVA followed, when appro- vs control group, which has been set at 100%. priate, by Fisher’s Least Significant Difference (LSD) posthoc comparisons. In addition, to evaluate the association between Protein Extraction and Western-Blot Analyses the modulation of the NRF2-KEAP1 system and the protein lev- Brain samples were manually homogenized using a glass-glass els of PVB, Pearson product-moment correlation coefficients (r) potter in a pH 7.4 cold buffer (containing 0.32 M sucrose, 0.1 mM were calculated between NRF2 or KEAP1 protein and PVB lev- EGTA, 1 mM HEPES solution, and 0.1 mM phenylmethylsulfonyl els. Significance for all tests was assumed for P < .05. Data are Table 1. Sequences of Forward and Reverse Primers and Probes used in qRT-PCR Analysis Gene Forward Primer Reverse Primer Probe Pvalb* CTGGACAAAGACAAAAGTGGC GACAAGTCTCTGGCATCTGAG CCTTCAGAATGGACCCCAGCTCA Sst* ACTCCGTCAGTTTCTGCAG CAGGGCATCGTTCTCTGTC AGTTCCTGTTTCCCGGTGGCA Calb* AGAACTTGATCCAGGAGCTTC CTTCGGTGGGTAAGACATGG TGGGCAGAGAGATGATGGGAAAATAGGA Npy* GACAGAGATATGGCAAGAGATCC CTAGGAAAAGTCAGGAGAGCAAG CCCCAGAACAAGGCTTGAAGACCC Nrf2** Rn00582415_m1 Keap1** Rn01448220_m1 Nox2** Rn00675098_m1 Srnx** Rn04337926_g1 Ho-1** Rn00561387_m1 Nqo1** Rn00566528_m1 Cat** Rn00560930_m1 ß Actin* CACTTTCTACAATGAGCTGCG CTGGATGGCTACGTACATGG TCTGGGTCATCTTTTCACGGTTGGC Purchased from Eurofins MWG Operon (Germany)* and Applied Biosystem (Italy)**. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 886 | International Journal of Neuropsychopharmacology, 2018 Table 2. Primary and Secondary Antibodies Used in Western-Blot Analyses Primary Antibody Primary Antibody Condition Secondary Antibody Condition PVB, 10 kDa (Abcam) 1:2500 in 5% nonfat dry milk 1:2500, anti-rabbit (Cell Signaling) 4°C o/n 5% nonfat dry milk, 1h, RT NRF2, 110 kDa (R&D System) 1:500 in 5% BSA 1:500, anti-mouse (Sigma-Aldrich) 4°C o/2n 5% BSA, 1h, RT KEAP1, 66 kDa (R&D System) 1:250 3% nonfat dry milk 1:500, anti-mouse (Sigma-Aldrich) 4°C o/n 5% nonfat dry milk, 1h, RT NOX2, 58 kDa (BD) 1:500 3% nonfat dry milk 1:500, anti-mouse (Sigma-Aldrich) 4°C o/n 3% nonfat dry milk, 1h, RT β-ACTIN 43 kDa (Sigma-Aldrich) 1:2000 in 3% nonfat dry milk 1:20 000, anti-mouse (Sigma-Aldrich) 1h, RT 3% nonfat dry milk, 1h, RT Abbreviations: BSA, bovine serum albumin; o/n, overnight; o/2n, over 2 nights; RT, room temperature. presented as means± SEM. SPSS (Release 24.0.0.0) was used to Analysis of PVB Protein Levels in the Hippocampus perform the statistical analyses. of Animals Exposed to CMS and Treated with Lurasidone RESULTS Based on the gene expression analyses of different inter - neuron markers, we decided to focus on PVB and analyzed its Analysis of the mRNA Levels for Different Subtypes protein levels in D-HIP and V-HIP of rats exposed to CMS, with of GABAergic Interneurons in Rats Exposed to CMS or without lurasidone treatment. Within D-HIP, as depicted in and Treated with Lurasidone Figure 2A, we found a main effect of CMS exposure (F = 12.164, 3,35 P < .001) and lurasidone treatment (F = 19.860, P < .001) as well 3,35 We first investigated the mRNA levels of the GABAergic markers as a significant CMS x treatment interaction (F = 7.710, P < .01). 3,35 Pvb, Sst, Npy, and Calb in the dorsal (D-HIP) and ventral (V-HIP) Indeed, the levels of PVB were markedly reduced in rats exposed hippocampus of animals exposed to CMS and treated, or not, to CMS and treated with vehicle (-58% vs No Stress/Vehicle, with the antipsychotic drug lurasidone. P < .001; Figure 2A), whereas chronic lurasidone treatment was The analysis of Pvb gene expression in the D-HIP showed a able to normalize the CMS-induced changes of PVB levels (+67% significant interaction between CMS and lurasidone treatment vs Stress/Vehicle, P < .001; Figure 2A). (F = 11.755, P < .01). Indeed, stress exposure led to a signifi- 3,32 In line with the gene expression data, these alterations show cant decrease of Pvb mRNA levels (-18% vs No Stress/Vehicle, anatomical selectivity. Indeed, within the V-HIP (Figure 2B), des- P < .05; Figure 1A), which was normalized by pharmacological pite a main effect of CMS exposure (F = 9.486, P < .01), we only 3,35 intervention (+19% vs Stress/Vehicle, P < .05; Figure 1A). Of found a trend toward a decrease of PVB levels in stressed ani- note, lurasidone administration per se produced a signifi- mals (-16% vs No Stress/Vehicle P = .054), which was not influ- cant decrease of Pvb compared with control rats (-16% vs No enced by the pharmacological treatment. Stress/Vehicle, P < .05; Figure 1A). These changes appeared to be specific for the dorsal part of the hippocampus, since no significant changes were found in the ventral counterpart Analysis of NADPH Oxidase-2 Gene and Protein (Figure 1E). Expression in the Dorsal Hippocampus of Animals When investigating Sst expression in the D-HIP, we found Exposed to CMS and Treated with Lurasidone a significant effect of CMS exposure (F = 10.023, P < .01) as 3,35 well as of pharmacological treatment (F = 33.850, P < .001). As PVB neurons show a sustained firing activity that requires a 3,35 high demand of energy, which may expose them to an increased shown in Figure 1B, Sst levels were increased in rats subjected to CMS (+58% vs No Stress/Vehicle, P < .01; Figure 1B), whereas susceptibility toward the detrimental effects of oxidative stress. On these bases, we investigated if the effects of CMS exposure in chronic lurasidone treatment upregulated Sst expression in nonstressed rats (+98% vs No Stress/Vehicle, P < .001; D-HIP could be associated with alterations of molecules involved in the complex machinery regulating the oxidative balance in Figure 1B) as well as in stressed animals (+75% vs Stress/ Vehicle, P < .001; Figure 1B). In the V-HIP, we found a main the brain. We analyzed the gene expression of Nox2, an enzyme responsible for the production of reactive oxygen species by acti- effect of CMS on Sst mRNA levels (F = 6.687, P < .05) that led 3,36 to a significant decrease of this marker in stressed rats com- vated macrophages, including microglia. The analysis of Nox2 mRNA levels in D-HIP revealed a significant interaction between pared with control animals (-21% vs No Stress/Vehicle, P < .05; Figure 1F), an effect that was not modulated by the pharma- stress and lurasidone administration (F = 4.521, P < .05). Indeed, 37,3 the direct comparisons between groups showed that Nox2 gene cological treatment. Conversely, the expression of the other GABAergic mark- expression increased in rats exposed to CMS (+33% vs No Stress/ Vehicle, P < .05; Figure 3A), an effect that was not present in CMS ers, namely Npy (Figure 1C, G) and Calb (Figure 1D, H), was not significantly modulated in the dorsal or ventral portion of the rats chronically treated with lurasidone. We then investigated PHOX the protein levels of gp91 , the main membrane-bound sub- hippocampus following CMS exposure or lurasidone treatment, providing further support to the selectivity exerted by CMS unit of the enzyme. As depicted in Figure 3B , stress exposure had a main effect on NOX2 protein levels (F = 7,121 P < .05), since exposure on specific subpopulations of GABAergic neurons. 33,3 No significant changes were observed in the prefrontal cor - CMS rats showed an increase of NOX2 compared with control animals (+98% vs No Stress/Vehicle, P < .01; Figure 3B), an effect tex of stressed rats treated or not with chronic pharmacological treatment (Table 3). that was attenuated by chronic lurasidone administration. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 Rossetti et al. | 887 Figure 1. Gene expression analysis of interneuron markers parvalbumin (Pvb), somatostatin (Sst), neuropeptide y (), N and calbindin ( py Calb) in the dorsal and ventral hippocampus of rats exposed to chronic mild stress (CMS): modulation by lurasidone treatment. The mRNA levels of Sst Pvb , N , py, and Calb were measured in the dorsal (A–D) and ventral (E–H) hippocampus of rats exposed to CMS in combination with chronic treatment with vehicle or lurasidone. The data, expressed as a percentage of unstressed rats treated with vehicle (No Stress/Vehicle set at 100%), are the mean +/- SEM of at least 7 independent determinations. *P < .05, **P < .01, ***P < .001 vs No Stress/Vehicle; ##P < .01, ###P < .001 vs Stress/Vehicle (2-way ANOVA with PLSD). Table 3. Gene Expression Analysis of Interneuron Markers PvbSst , , elements) to promote the transcription of several enzymes Calb, and Npy in the Prefrontal Cortex of Rats Exposed to CMS involved in the cellular mechanisms of detoxification. The tran- scription factor interacts in the cytosol with KEAP1, a chaperon No Stress Lurasidone Stress Lurasidone/Stress protein that prevents its translocation into the nucleus, thus inhibiting its transcriptional antioxidant activity. Pvb 100 ± 5 92 ± 6 95 ± 5 90 ± 3 Sst 100 ± 6 117 ± 8 103 ± 5 110 ± 8 When considering the expression of the transcription Calb 100 ± 5 99 ± 8 97 ± 4 99 ± 3 factor Nrf2, we found a statistically significant interaction Npy 100 ± 4 96 ± 3 96 ± 6 97 ± 4 between CMS and lurasidone treatment (F = 11.616, P < .01). 3,36 Indeed, as shown in Figure 4A, while CMS exposure produced The mRNA levels of parvalbumin (Pvb), somatostatin (Sst) neuropeptide y (N) py a slight, non-significant decrease of the transcription factor and calbindin (Calb) were measured in the prefrontal cortex of rats exposed (-11% vs No Stress/Vehicle, P > 0.05), lurasidone was able to to CMS, in combination with chronic treatment with vehicle or lurasidone. increase its mRNA levels only when administered to CMS ani- The data expressed as a percentage of unstressed rats treated with vehicle mals (+24% vs Stress/Vehicle, P < .01). Based on gene expres- (No Stress/Vehicle set at 100%) are the mean +/- SEM of at least 7 independent determinations. sion analyses, we decided to deepen our investigation by assessing the protein levels of NRF2 as well as of its inhibitor KEAP1 in the D-HIP. Analysis of the NRF2-KEAP1 Antioxidant System The analysis of the protein levels of NRF2 revealed a signifi- in the Dorsal Hippocampus of Animals Exposed to cant stress*lurasidone interaction (F= 4.195, P < .05). Indeed, as 3,32 CMS and Treated with Lurasidone shown in Figure 4B, the protein levels of NRF2 were decreased The NRF2 and the Kelch-like ECH-associated protein 1 (KEAP1) by CMS (-40% vs No Stress/Vehicle, P < .05), an effect that was, at least in part, restored by lurasidone treatment considering that have a pivotal role in the control of the cellular antioxidant response. Indeed, upon nuclear translocation NRF2 binds to the levels of NRF2 protein in Stress/Lurasidone group did not differ from sham rats. its consensus sequences (the so-called antioxidant responsive Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 888 | International Journal of Neuropsychopharmacology, 2018 Figure 2. Protein expression of parvalbumin (PVB) in the hippocampus of rats exposed to chronic mild stress (CMS): modulation by lurasidone treatment. The protein levels of PVB were measured in the dorsal (A) and ventral (B) hippocampus of rats exposed to CMS in combination with chronic treatment with vehicle or lurasidone. The data, expressed as a percentage of unstressed rats treated with vehicle (No Stress/Vehicle, set at 100%), are the mean +/- SEM of at least 6 independent determi- nations. Representative western blot bands of PVB are shown under the respective graphs. ***P < .001 vs No Stress/Vehicle; ###P < .001 vs Stress/Vehicle (2-way ANOVA with PLSD). Figure 3. Gene expression and protein analyses of NADH oxidase-2 (NOX2) in the dorsal hippocampus of rats exposed to chronic mild stress (CMS): modulation by lurasidone treatment. The mRNA (A) and the protein levels (B) of NOX2 were measured in the dorsal hippocampus of rats exposed to CMS in combination with chronic treatment with vehicle or lurasidone. The data, expressed as a percentage of unstressed rats treated with vehicle (No Stress/Vehicle, set at 100%), are the mean +/- SEM of at least 8 independent determinations. Representative western-blot bands of NOX2 are shown under the respective graph. *P < .05, **P < .01 vs No Stress/Vehicle (2-way ANOVA with PLSD). Interestingly, KEAP1 levels were strongly modulated by Pearson Correlation Analysis between NRF2/KEAP1 chronic lurasidone treatment (F = 15.226, P < .001). Indeed, Protein Levels and PVB in the Dorsal Hippocampus of 3,30 although CMS exposure did not affect KEAP1 levels, chronic lur - Animals Exposed to CMS and Treated with Lurasidone asidone administration significantly reduced its protein levels Next, to establish a potential relationship between the effects in sham (-48% vs No Stress/Vehicle, P < .01; Figure 4C) as well as of stress exposure and pharmacological treatment on PVB in CMS rats (-55% vs Stress/Vehicle, P < .05; Figure 4C). Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 Rossetti et al. | 889 Figure 4. Analysis of nuclear factor-E2-related factor-2 (NRF2)-kelch like ECH associated protein-1 (KEAP1) expression in the dorsal hippocampus of rats exposed to chronic mild stress: modulation by lurasidone treatment. The mRNA (A) and protein levels (B) of NRF2 and the protein levels of the chaperon protein KEAP1 (C) were measured in the cytosolic fraction of the dorsal hippocampus of rats exposed to chronic mild stress (CMS) in combination with chronic treatment with vehicle or lurasidone. The data, expressed as a percentage of unstressed rats treated with vehicle (No Stress/Vehicle, set at 100%), are the mean +/- SEM of at least 7 independent determinations. Representative western-blot bands of NRF2 and KEAP1 are shown under the respective graphs. *P < .05, **P < .01 vs No Stress/Vehicle; ##P < .01 vs Stress/ Vehicle (2-way ANOVA with PLSD). expression with the levels of NRF2/KEAP1 antioxidant system, expression may be mediated by the drug-mediated regulation of we performed a Pearson product-moment correlation coefficient the oxidative balance within the brain. analysis between the protein levels of NRF2 or KEAP1 and the Most PVB-expressing cells are present in the central nerv- protein levels of PVB in the D-HIP. As presented in Figure 5, NRF2 ous system as interneurons, particularly within selected brain showed a significant positive correlation with the GABAergic structures, including cerebral cortex, hippocampus, cerebel- marker (r = 0.414,P < .05; Figure 5A), while a negative correlation lum, and spinal cord (Zaletel et al., 2016). In the hippocampus, was observed between the chaperone protein KEAP1 and PVB a critical brain area involved in the control of emotional states, (r = -0.501, P < .01; Figure 5B). stress response, and cognitive function (Fanselow and Dong, 2010), PVB+ cells are mostly fast-spiking GABAergic interneu- rons that control the circuitry activity of pyramidal cells Analysis of the Transcriptional Effects of NRF2 in the through their inhibitory activity. The reduction of PVB expres- Dorsal Hippocampus of Animals Exposed to CMS sion found in the D-HIP of CMS exposed rats is in line with the and Treated with Lurasidone detrimental effects of stress or other adverse manipulations on Based on the changes in the functional interplay between NRF2 the GABAergic system reported in other preclinical studies. For and KEAP1 after CMS exposure and/or lurasidone treatment, example, Czeh and collaborators have shown that 5 weeks of we decided to investigate the expression of some genes down- psychosocial stress were able to impair PVB expression in spe- stream from the transcriptional activity of NRF2, namely the cific subregions of treeshrew hippocampus (Czeh et al., 2005). enzymes Srnx1, Ho-1, Nqo1, and Cat. Similar results were obtained with other stress paradigms in As depicted in Figure 6, the expression of Srxn1 (A) and Ho-1 rats, such as chronic immobilization (Hu et al., 2010) and social (B) were not modulated by CMS exposure or chronic lurasidone isolation (Filipovi ćet al., 2013). Interestingly, in our experimen- treatment. However, we found that the mRNA levels of Nqo1 tal setting, the D-HIP appears to be more vulnerable to the showed a significant stress x treatment interaction (F = 7.806, impact of CMS, an effect that is in line with the results of Czeh 3,37 P < .01). Indeed, chronic treatment with lurasidone was able and co-workers (Czéh et al., 2015). Considering that functional to upregulate its expression, only when administered to CMS alterations of this hippocampal subregion have a major role animals (+23% vs Stress/Vehicle, P < .01; Figure 6C). Moreover, in cognitive dysfunctions, we hypothesize that reduced PVB we found a significant main effect of lurasidone treatment expression may contribute to the impaired cognitive function (F = 6.334, P < .05) on Cat gene expression. Specifically, the we have recently shown in rats exposed to the CMS paradigm 3,38 pharmacological treatment increased the levels of the enzyme, (Calabrese et al., 2017). It is likely that the expression of PVB but only when it was administered to sham animals (+21% vs No may be due to a decrease of protein expression instead of to Stress/Vehicle, P < .05; Figure 6D). cell loss. Indeed, as demonstrated by others, chronic stress exposure does not increase caspase-3 expression in GABAergic interneurons (Filipovi et ć al., 2013). Interestingly, we found Discussion a strong induction of SST expression in the D-HIP following In recent years the interest in GABAergic interneurons has stress exposure. In both hippocampus and neocortex, PVB+ interneurons target the soma and the perisomatic dendrites gained much attention due to their key role in functions that are altered in different psychiatric disorders, including major of pyramidal neurons, controlling the output signaling of prin- cipal excitatory neurons. In parallel, SST interneurons gen- depression and schizophrenia (Luscher and Fuchs, 2015; Owen et al., 2016). Within this context, our data point out that erally target the more distal dendrites, gating the excitatory signals (Horn and Nicoll, 2018). Moreover, the activity of PVB the restorative effect of pharmacological treatment on PVB Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 890 | International Journal of Neuropsychopharmacology, 2018 setting this enzyme is differentially modulated in the diverse interneuron subpopulations. While the precise detrimental mechanisms triggered by stress exposure on PVB interneurons are not well clarified, the selective vulnerability of PVB+ interneurons to chronic stress may be due to their peculiar fast spiking activity. The firing of PVB interneurons requires a high amount of energy, and the increased metabolic activity under certain conditions, such as stress, may expose PVB neurons to potentially toxic effects of reactive oxygen and nitrogen species, which alter the redox bal- ance of the cell (Kann, 2016). In this respect, the NOX family represents a very important group of enzymes that, especially in the injured nervous sys- tem, is a major source of reactive oxygen species (Cooney et al., 2013). The upregulation of NOX2 expression after stress suggests an increase of the prooxidative activity in rats exposed to CMS. Increased levels of NOX2 have also been observed in brain areas of animals exposed to prolonged social isolation from weaning (Schiavone et al. 2009) as well as in a model of posttraumatic stress disorder, where NOX2 upregulation was paralleled by a decrease of PVB expression (Sun et al., 2016). Considering that NOX2 has been reported as the primary phagocytic oxidase (Bermudez et al., 2016), its altered expression may be associated with the increased activity of microglial cells under stressful conditions. In parallel, the production of prooxidative agents from NOX2 induces the activation of microglia, triggering a det- rimental inflammatory loop, potentially harmful for neurons (Vilhardt et al., 2017). This hypothesis is supported by previous data from our laboratory showing increased expression of hip- pocampal CD11b, a marker of microglia activation, in animals exposed to 7 weeks of CMS (Rossetti et al., 2016). Although in PHOX the present study we measured the levels of gp190 , the prin- cipal membrane subunit of NOX2 enzyme, without evaluating other subunits of the enzymatic complex, we believe that the expression of the fundamental enzymatic subunit may reflect an increased response of the prooxidative system within the hippocampus. The detrimental effects of oxidative stress on Figure 5. Pearson correlation analysis between nuclear factor-E2-related fac- PVB expression observed in response to CMS may also be the tor-2 (NRF2) or kelch like ECH associated protein-1 (KEAP1) and parvalbumin result of a glucocorticoid receptor (GR)-dependent extragen- (PVB) protein levels in the dorsal hippocampus. The Pearson moment-product omic mechanism, which may affect the firing activity of these correlation (r) between NRF2 (A), KEAP1 (B), and PVB protein levels were meas- ured in the dorsal hippocampus of rats exposed to chronic mild stress (CMS) in interneurons. Indeed, it has been proposed that the activation of combination with chronic treatment with vehicle or lurasidone. The statistical membrane bound GR may induce the production of nitric oxide significance was assumed with P < .05. (NO), a small neurotransmitter responsible of the activation of PVB positive interneurons (Hu et al., 2010). The sustained acti- and SST interneurons is strictly interconnected as part of com- vation of GR during chronic stressful condition may decrease PVB expression by sensitizing interneuron activation and, pos- plex inhibitory microcircuits involved in the control of behav- ior and learning (Caroni, 2015). Considering that SST decrease sibly, through a toxic effect due to NO release. Indeed, NO may be converted in different reactive nitrogen species, thus lead- has been causally related to anxiety/depression-like behaviors (Lin and Sibille, 2015), our result may seem counterintuitive. ing to oxidative damage of proteins, lipids, and DNA that are able to alter neuronal homeostasis (Moniczewski et al., 2015). However, the increased expression of SST may represent a compensatory mechanism to limit the impaired somato-den- We also showed that prolonged stress exposure alters the NRF2- KEAP-antioxidant responsive element system, a master regu- dritic inhibition of pyramidal neurons after CMS-induced PVB loss. In parallel, the increase of SST observed after lurasidone lator of the antioxidative response (Sandberg et al., 2014), with a decrease of NRF2 expression that may impair the activation treatment may be related to a specific mechanism induced by the drug, which is independent from the model analyzed. of antioxidant mechanisms. Our results are in line with pre- vious studies showing the negative effects of stress on NRF2. Indeed, we have previously shown a similar effect in serotonin transporter knockout rats treated with lurasidone (Luoni et al., For example, a decreased expression of NRF2, with a parallel increase of oxidative stress, was found in social defeat-vulner - 2013). In this sense, further functional studies are needed to better clarify the impact of pharmacological treatment witha ble animals exposed to chronic stress (Bouvier et al., 2017) as well as in rats exposed to 4 weeks of chronic stress (Omar and psychotropic drugs on these interneuron populations. The opposite effects of CMS on these two markers may also Tash, 2017). Chronic treatment with lurasidone, an antipsychotic drug explain why the protein levels of the glutamic acid decarboxyl- ase 67 were not modulated by stress exposure in the D-HIP (data approved for the treatment of schizophrenia and bipolar depression, was able to normalize CMS-induced decrease of not shown). Indeed, we may speculate that in our experimental Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 Rossetti et al. | 891 Figure 6. Analysis of nuclear factor-E2-related factor-2 (NRF2)-induced transcriptional response in the dorsal hippocampus of rats exposed to chronic mild stress (CMS): modulation by lurasidone treatment. The mRNA levels of Sufiredoxin (Srxn1, A), Heme oxigenase-1 (Ho-1, B), NAD(P)H dehydrogenase [quinone]-1 (Nqo1, C), and Catalase (Cat, D) were measured in the dorsal hippocampus of rats exposed to CMS in combination with chronic treatment with vehicle or lurasidone. The data, expressed as a percentage of unstressed rats treated with vehicle (No Stress/Vehicle, set at 100%), are the mean +/- SEM of at least 8 independent determinations. *P < .01 vs No Stress/Vehicle; ##P < .01 vs Stress/Vehicle (2-way ANOVA with PLSD). PVB expression in D-HIP. In this sense, other studies support the the CMS-induced decrease of NRF2 was partially normalized idea that antipsychotic drugs, such as clozapine (Filipovic et al., in animals treated with the antipsychotic drug. Interestingly 2017) and risperidone (Piontkewitz et al., 2012), may regulate the lurasidone is also able to regulate KEAP1, a chaperone protein function of GABAergic interneurons through the modulation that segregates NRF2 into the cytosol and promotes its proteas- of specific markers. While these drugs share high affinity for ome-mediated degradation (Sandberg et al., 2014). Indeed, while 5-HT7 receptors, it is difficult to ascertain if this is the unique KEAP1 protein levels in the cytosolic fraction were not altered by mechanism through which these agents modulate GABAergic CMS exposure, we found that lurasidone treatment was able to function, considering the vast heterogeneity in their receptor reduce its levels, suggesting that the drug not only increases the profiles. Indeed, we believe that the observed effects represent expression of NRF2 but may also promote its activity through a adaptive mechanisms following prolonged drug administration negative modulation of KEAP1. regulating complex neuronal circuits that will eventually lead Our results suggest that, in addition to synaptic and neuro- to changes in selective GABAergic subtypes. Lastly, the effect of plastic mechanisms (Tarazi and Riva, 2013Luoni et ; al., 2014), lurasidone closely resembles what we have recently observed lurasidone is able to modulate the brain oxidative balance, in the hippocampus of adult mice exposed to prenatal immune which may contribute to its therapeutic effects and eventu- challenge (Luoni et al., 2017). ally enhance neuronal resiliency. Interestingly, similar mecha- Due to the peculiar receptor profile of lurasidone, it is dif- nisms have also been described for other psychotropic drugs, ficult to enlighten a molecular mechanism responsible for including antidepressants (Martín-Hernández et al., 2016 Omar ; the effects of the pharmacological treatment on GABAergic and Tash, 2017) and antipsychotics (MacDowell et al., 2016). It interneurons. Our results, however, suggest that the ability of is interesting to note that the modulation of NRF2 and KEAP1 lurasidone to modulate the oxidative stress balance may be part showed a significant Pearson correlation (positive and negative, of its restorative effect. Indeed, chronic lurasidone treatment respectively) with PVB protein levels, providing further support was able to induce the gene expression of NRF2 only in stressed to the notion that the alterations of the GABAergic system fol- animals, suggesting an antioxidative effect of the pharmacologi- lowing CMS exposure may be causally linked to a dysregulation cal treatment only under adverse conditions. The positive effect of the oxidative balance in the D-HIP. In addition, the pharma- of lurasidone was also found at the translational level, since cological treatment with lurasidone was able to induce the Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 892 | International Journal of Neuropsychopharmacology, 2018 expression of key antioxidant enzymes related to NRF2 tran- Calabrese F, Savino E, Papp M, Molteni R, Riva MA (2016b) Chronic scriptional activity. The specific increased levels of Nqo1 and mild stress-induced alterations of clock gene expression in Catalase support the idea of an antioxidative activity of the rat prefrontal cortex: modulatory effects of prolonged lurasi- drug. This is in line with previously published data showing done treatment. Pharmacol Res 104:140–150. that, although stress exposure did not impair the transcription Calabrese F, Brivio P, Gruca P, Lason-Tyburkiewicz M, Papp M, of antioxidant enzyme, the administration of an atypical anti- Riva MA (2017) Chronic mild stress-induced alterations of psychotic increased antioxidant response in stressed animals local protein synthesis: a role for cognitive impairment. ACS (MacDowell et al., 2016). Chem Neurosci 8:817–825. In summary, the susceptibility of PVB neurons to stress may Caroni P (2015) Inhibitory microcircuit modules in hippocampal represent a key mechanism contributing to functional and learning. Curr Opin Neurobiol 35:66–73. structural deterioration in specific brain regions, such as the Cattaneo A, Riva MA (2016) Stress-induced mechanisms in D-HIP, associated with psychiatric illness. The ability to coun- mental illness: a role for glucocorticoid signalling. J Steroid teract PVB alterations, for example with antioxidants/redox Biochem Mol Biol 160:169–174. regulators (Steullet et al., 2017), or to promote the activity of PVB Chen CC, Lu J, Yang R, Ding JB, Zuo Y (2017) Selective activation neurons (Chen et al., 2017) may represent a novel and important of parvalbumin interneurons prevents stress-induced syn- strategy to promote resilience. In this respect, our data provide apse loss and perceptual defects. Mol Psychiatry doi: 10.1038/ new insights on the mechanism of action of lurasidone in the mp.2017.159. context of stress-related hippocampal dysfunction, suggesting Cooney SJ, Bermudez-Sabogal SL, Byrnes KR (2013) Cellular and that its pharmacological profile, which can improve neuronal/ temporal expression of NADPH oxidase (NOX) isotypes after synaptic plasticity in hippocampus and cortex through both brain injury. J Neuroinflammation 10:155. protective (antioxidant) and functional (BDNF) (Luoni et al., Czeh B, Simon M, van der Hart MG, Schmelting B, Hesselink MB, 2014) mechanisms, should support clinical efficacy reported in Fuchs E (2005) Chronic stress decreases the number of par - schizophrenia and bipolar disorder. valbumin-immunoreactive interneurons in the hippocam- pus: prevention by treatment with a substance P receptor (NK1) antagonist. Neuropsychopharmacology 30:67–79. Acknowledgments Czéh B, Varga ZK, Henningsen K, Kovács GL, Miseta A, Wiborg We thank Francesca Nirella for her scientific support for part of O (2015) Chronic stress reduces the number of gabaergic interneurons in the adult rat hippocampus, dorsal-ventral the work. We are grateful to Sumitomo Dainippon Pharma Co. Ltd for the generous gift of lurasidone. and region-specific differences. Hippocampus 25:393–405. Fanselow MS, Dong HW (2010) Are the dorsal and ventral hippo- This work was supported by the Italian Ministry of Instruction, University and Research (PRIN grant no. 2015SKN9YT to M.A.R.), campus functionally distinct structures? Neuron 65:7–19. Filipović D, Zlatković J, Gass P, Inta D (2013) The differential Progetto Eccellenza, and Sumitomo Dainippon Pharma Co. Ltd. (to M.A.R.). Part of this work was supported by the statutory effects of acute vs Chronic stress and their combination on hippocampal parvalbumin and inducible heat shock protein activity of the Institute of Pharmacology, Polish Academy of Sciences (Krakow, Poland) (to M.P.). All funding bodies had no 70 expression. Neuroscience 236:47–54. Filipović D, Stanisavljević A, Jasnić N, Bernardi RE, Inta D, Perić I, role in designing the study. Gass P (2017) Chronic treatment with fluoxetine or clozapine of socially iso- Statement of Interest lated rats prevents subsector-specific reduction of parvalbu- min immunoreactive cells in the hippocampus. Neuroscience M.A.R. received compensation as speaker/consultant from 371:384–394. Lundbeck, Otzuka, Sumitomo Dainippon Pharma, and Sunovion, Freund TF (2003) Interneuron diversity series: rhythm and mood and he has received research grants from Lundbeck, Sumitomo in perisomatic inhibition. Trends Neurosci 26:489–495. Dainippon Pharma, and Sunovion. All other authors declare no Harvey PD, Siu CO, Hsu J, Cucchiaro J, Maruff P, Loebel A (2013) financial interest or potential conflict of interest. Effect of lurasidone on neurocognitive performance in patients with schizophrenia: a short-term placebo- and References active-controlled study followed by a 6-month double-blind extension. Eur Neuropsychopharmacol 23:1373–1382. Begni V, Riva MA, Cattaneo A (2017) Cellular and molecular mechanisms of the brain-derived neurotrophic factor in Horn ME, Nicoll RA (2018) Somatostatin and parvalbumin inhibi- tory synapses onto hippocampal pyramidal neurons are physiological and pathological conditions. Clin Sci (Lond) 131:123–138. regulated by distinct mechanisms. Proc Natl Acad Sci U S A 115:589–594. Bermudez S, Khayrullina G, Zhao Y, Byrnes KR (2016) NADPH oxidase isoform expression is temporally regulated and may Hu W, Zhang M, Czéh B, Flügge G, Zhang W (2010) Stress impairs gabaergic network function in the hippocampus by activat- contribute to microglial/macrophage polarization after spi- nal cord injury. Mol Cell Neurosci 77:53–64. ing nongenomic glucocorticoid receptors and affecting the integrity of the parvalbumin-expressing neuronal network. Bouvier E, Brouillard F, Molet J, Claverie D, Cabungcal JH, Cresto N, Doligez N, Rivat C, Do KQ, Bernard C, Benoliel JJ, Becker C Neuropsychopharmacology 35:1693–1707. Kann O (2016) The interneuron energy hypothesis: implications (2017) Nrf2-dependent persistent oxidative stress results in stress-induced vulnerability to depression. Mol Psychiatry for brain disease. Neurobiol Dis 90:75–85. Kupfer DJ, Frank E, Phillips ML (2012) Major depressive disorder: 22:1795. Calabrese F, Riva MA, Molteni R (2016a) Synaptic alterations new clinical, neurobiological, and treatment perspectives. Lancet 379:1045–1055. associated with depression and schizophrenia: poten- tial as a therapeutic target. Expert Opin Ther Targets Lin LC, Sibille E (2015) Somatostatin, neuronal vulnerability and behavioral emotionality. Mol Psychiatry 20:377–387. 20:1195–1207. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/9/883/4999322 by Ed 'DeepDyve' Gillespie user on 04 September 2018 Rossetti et al. | 893 Loebel A, Cucchiaro J, Silva R, Kroger H, Hsu J, Sarma K, Sachs G Piontkewitz Y, Bernstein HG, Dobrowolny H, Bogerts B, Weiner (2014) Lurasidone monotherapy in the treatment of bipolar I, Keilhoff G (2012) Effects of risperidone treatment in ado- I depression: a randomized, double-blind, placebo-controlled lescence on hippocampal neurogenesis, parvalbumin study. Am J Psychiatry 171:160–168. expression, and vascularization following prenatal immune Luoni A, Hulsken S, Cazzaniga G, Racagni G, Homberg JR, Riva activation in rats. Brain Behav Immun 26:353–363. MA (2013) Behavioural and neuroplastic properties of chronic Pittenger C, Duman RS (2008) Stress, depression, and neuroplasti- lurasidone treatment in serotonin transporter knockout rats. city: a convergence of mechanisms. Neuropsychopharmacology Int J Neuropsychopharmacol 16:1319–1330. 33:88–109. Luoni A, Macchi F, Papp M, Molteni R, Riva MA (2014) Lurasidone Rossetti AC, Papp M, Gruca P, Paladini MS, Racagni G, Riva MA, exerts antidepressant properties in the chronic mild Molteni R (2016) Stress-induced anhedonia is associated stress model through the regulation of synaptic and neu- with the activation of the inflammatory system in the rat roplastic mechanisms in the rat prefrontal cortex. Int J brain: restorative effect of pharmacological intervention. Neuropsychopharmacol 18. doi: 10.1093/ijnp/pyu061. Pharmacol Res 103:1–12. Luoni A, Richetto J, Longo L, Riva MA (2017) Chronic lurasidone Sandberg M, Patil J, D’Angelo B, Weber SG, Mallard C (2014) NRF2- treatment normalizes gabaergic marker alterations in the regulation in brain health and disease: implication of cere- dorsal hippocampus of mice exposed to prenatal immune bral inflammation. Neuropharmacology 79:298–306. activation. Eur Neuropsychopharmacol 27:170–179. Schiavone S, Sorce S, Dubois-Dauphin M, Jaquet V, Colaianna M, Luscher B, Fuchs T (2015) Gabaergic control of depression-related Zotti M, Cuomo V, Trabace L, Krause KH (2009) Involvement of brain states. Adv Pharmacol 73:97–144. NOX2 in the development of behavioral and pathologic alter - MacDowell KS, Caso JR, Martín-Hernández D, Moreno BM, ations in isolated rats. Biol Psychiatry 66:384–392. Madrigal JLM, Micó JA, Leza JC, García-Bueno B (2016) The atyp- Smaga I, Niedzielska E, Gawlik M, Moniczewski A, Krzek J, ical antipsychotic paliperidone regulates endogenous antioxi- Przegaliński E, Pera J, Filip M (2015) Oxidative stress as an etio- dant/anti-inflammatory pathways in rat models of acute and logical factor and a potential treatment target of psychiatric chronic restraint stress. Neurotherapeutics 13:833–843. disorders. Part 2. Depression, anxiety, schizophrenia and aut- Martín-Hernández D, Bris ÁG, MacDowell KS, García-Bueno B, ism. Pharmacol Rep 67:569–580. Madrigal JL, Leza JC, Caso JR (2016) Modulation of the antioxi- Steullet P, Cabungcal JH, Coyle J, Didriksen M, Gill K, Grace AA, dant nuclear factor (erythroid 2-derived)-like 2 pathway by Hensch TK, LaMantia AS, Lindemann L, Maynard TM, Meyer antidepressants in rats. Neuropharmacology 103:79–91. U, Morishita H, O’Donnell P, Puhl M, Cuenod M, Do KQ (2017) Millan MJ, et al. (2012) Cognitive dysfunction in psychiatric disor - Oxidative stress-driven parvalbumin interneuron impair - ders: characteristics, causes and the quest for improved ther - ment as a common mechanism in models of schizophrenia. apy. Nat Rev Drug Discov 11:141–168. Mol Psychiatry 22:936–943. Molteni R, Rossetti AC, Savino E, Racagni G, Calabrese F (2016) Sun XR, Zhang H, Zhao HT, Ji MH, Li HH, Wu J, Li KY, Yang JJ (2016) Chronic mild stress modulates activity-dependent tran- Amelioration of oxidative stress-induced phenotype loss of scription of BDNF in rat hippocampal slices. Neural Plast parvalbumin interneurons might contribute to the beneficial 2016:2592319. effects of environmental enrichment in a rat model of post- Moniczewski A, Gawlik M, Smaga I, Niedzielska E, Krzek J, traumatic stress disorder. Behav Brain Res 312:84–92. Przegaliński E, Pera J, Filip M (2015) Oxidative stress as an etio- Tarazi FI, Riva MA (2013) The preclinical profile of lurasidone: logical factor and a potential treatment target of psychiatric clinical relevance for the treatment of schizophrenia. Expert disorders. Part 1. Chemical aspects and biological sources of Opin Drug Discov 8:1297–1307. oxidative stress in the brain. Pharmacol Rep 67:560–568. Vilhardt F, Haslund-Vinding J, Jaquet V, McBean G (2017) Microglia Nasrallah HA, Cucchiaro JB, Mao Y, Pikalov AA, Loebel AD (2015) antioxidant systems and redox signalling. Br J Pharmacol Lurasidone for the treatment of depressive symptoms in 174:1719–1732. schizophrenia: analysis of 4 pooled, 6-week, placebo-con- Willner P (2017) The chronic mild stress (CMS) model of trolled studies. CNS Spectr 20:140–147. depression: history, evaluation and usage. Neurobiol Stress Omar NN, Tash RF (2017) Fluoxetine coupled with zinc in a 6:78–93. chronic mild stress model of depression: providing a reser - Yatham LN, Mackala S, Basivireddy J, Ahn S, Walji N, Hu C, Lam voir for optimum zinc signaling and neuronal remodeling. RW, Torres IJ (2017) Lurasidone versus treatment as usual Pharmacol Biochem Behav 160:30–38. for cognitive impairment in euthymic patients with bipo- Owen MJ, Sawa A, Mortensen PB (2016) Schizophrenia. Lancet lar I disorder: a randomised, open-label, pilot study. Lancet 388:86–97. Psychiatry 4:208–217. Perova Z, Delevich K, Li B (2015) Depression of excitatory synapses Zaletel I, Filipović D, Puškaš N (2016) Chronic stress, hippocam- onto parvalbumin interneurons in the medial prefrontal cor - pus and parvalbumin-positive interneurons: what do we tex in susceptibility to stress. J Neurosci 35:3201–3206. know so far? Rev Neurosci 27:397–409.
Journal
International Journal of Neuropsychopharmacology – Oxford University Press
Published: Sep 1, 2018