Characterization and Expression Profiles of Juvenile Hormone Epoxide Hydrolase From Lymantria dispar (Lepidoptera: Lymantridae) and RNA Interference by Ingestion

Characterization and Expression Profiles of Juvenile Hormone Epoxide Hydrolase From Lymantria... Juvenile hormone epoxide hydrolase (JHEH) is an important enzyme in the degradation pathways of juvenile hormone (JH) in insects. It converts JH to JH diol and hydrolyses JH acid to JH acid diol. JHEH titers regulate the entire process of insect development. In this study, full length ldjheh cDNA (2101 bp) was cloned from the Asian gypsy moth Lymantria dispar (L.; Lepidoptera: Lymantridae), and provisionally designated ldjheh1. LdJHEH1 was characterized by predicted molecular weight of 52.64  kDa, theoretical isoelectric points of 6.87 and contains a transmembrane domain at the N-terminus. The transcriptional profiles of ldjheh1 were detected by qRT-PCR. The ldjheh1 was found to be expressed throughout all developmental stages with maximum expression levels occurring in fourth instar larvae. The ldjheh1 mRNA was detected in the heads, thoraces, and abdomens of gypsy moth larvae on day 2 of the third instar. The ldjheh1 was also detected in bodies of third instar larvae stage, with the highest peaks occurring at 24 h after ecdysis. The ldjheh1 gene was successfully knocked down by oral delivery dsRNA in the third instar larvae of L. dispar. The dsRNA targeting ldjheh1 was produced in vitro. Ingesting dsRNA for ldjheh1 only slightly delayed larval development. Key words: Asian gypsy moth, JHEH, transcriptional profiles, qRT-PCR, RNAi Juvenile hormones (JHs) are composed of sesquiterpenoids, which JHE is a member of the carboxylesterase family. It hydrolyzes the are synthesized primarily by the insect corpora allata and then methyl ester moiety of JH to juvenile hormone acid (JHa), which can released into the hemolymph. Here, they play multiple and impor- be reverted back to JH (Hammock 1985, Hirai et al. 2002, Tan et al. tant roles in the regulation of larval metamorphosis (Riddiford 1994) 2005), and catalyzes juvenile hormone diol (JHd) to produce juve- and adult insect reproduction, e.g., by regulating pheromone synthe- nile hormone acid diol (JHad) (Share and Roe 1988). As one of the sis and vitellogenesis (Wyatt and Davey 1996). Accurate regulation epoxide hydrolases, JHEH transforms epoxides to compounds with of JH concentration is, therefore, crucial for orderly development decreased chemical reactivity, increased water solubility, and changed in insects. Many studies have shown that JH titers are controlled biological activity (Arand et  al. 2005, Morisseau and Hammock mainly by changing the rates of its synthesis and degradation (Gilbert 2005). In certain organs and tissues, JHEH degrades JHa to JHad et al. 2000, Li et al. 2003). JH synthesis is regulated by neuropep- (Share and Roe 1988), and hydrolyses JH to JHd, which is an irre- tides, such as allatotropins and allatostatins, secreted from the brain versible hydrolysis reaction (Roe and Venkatesh 1990, Wojtasek and (Stay et  al. 1994). JH degradation occurs over a very short period Prestwich 1995, Anspaugh and Roe 2005, Newman et al. 2005). and is mediated by at least three enzymes: juvenile hormone ester- Initially, research about JH degradation concentrated on the ase (JHE) (Hammock and Sparks 1977), juvenile hormone epoxide mechanism of action of JHE (Kamita et al. 2003). However, since a hydrolase (JHEH) (Share and Roe 1988), and juvenile hormone diol specific partition assay was developed to simultaneously determine kinase (JHDK) (Maxwell et al. 2002a,b). In insects, JH is principally the activity of JHE and JHEH in insect tissue (Share and Roe 1988), degraded by JHEs and JHEHs, which have high substrate specificity. rapid progress has been made in determining how JHEH participates © The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 2 Journal of Insect Science, 2018, Vol. 18, No. 1 in JH degradation (Touhara and Prestwich 1993, Wojtasek and library construction using the Illumina HiSeq 2500 sequencing Prestwich 1996, Debernard et al. 1998, Severson et al. 2002). Many platform (Illumina Inc., San Diego, CA). After purity and quality assays had revealed that JHEH plays an important role, as critical as checks, we obtained approximately 20 million clean reads averaging that of JHE, in degrading JH in certain insects (Campbell et al. 1992, 63.40 bp in length. One ldjheh1 gene was identified in this library Halarnkar et al. 1993, Lassiter et al. 1995, Khlebodarova et al. 1996, according to the functional annotations. The ldjheh1 gene was fur- Debernard et al. 1998). The extent of the roles that JHE and JHEH ther amplified using RT-PCR and sequenced for confirmation. All play in JH degradation depends on the species and the developmen- primer sequences are listed in Table  1. The resulting sequence of tal stages of the insect (Keiser et al. 2002, Kamita et al. 2003). Thus, ldjheh1 was submitted to GenBank (accession number MF996338). JHEH inhibitors are considered to be potential insecticides for cer- tain insects in which JHEH plays major function in JH degradation Gene Characterization and Polygenetic Analysis (Severson et al. 2002). This is further supported by findings that higher ExPASy Proteomics Server (http://cn.expasy.org/tools/pi_tool.html) concentrations of norharman could inhibit the activity of JHEH in was used to compute the molecular weights and isoelectric points Reticulitermes speratus (Kolbe; Isoptera: Rhinotermitidae)  (Itakura of the deduced protein sequences. Transmembrane domains were et  al. 2008). In addition, several jheh or jheh-like genes have been predicted by TMHMM 2.0 (www.cbs.dtu.dk/services/TMHMM). cloned from lepidopteran insects, such as Manduca sexta (L. ; JHEH amino acid sequences from other insects were retrieved from Lepidoptera: Sphingidae)  (Wojtasek and Prestwich 1996), Bombyx NCBI and aligned with the predicted LdJHEH1 using ClustalX mori (L. ; Lepidoptera: Bombycidae) (Hirai et al. 2002, Zhang et al. (1.83) (Thompson et  al. 1997). Phylogenetic trees were generated 2005, Seino et  al. 2010, Cheng et  al. 2014) and Danaus plexippus using the neighbor-joining method in MEGA 5.1 software (Tamura (L. ; Lepidoptera: Nymphalidae) (Mackert et al. 2010, Cheng et al. et al. 2007). The reliability of the NJ tree topology was evaluated by 2014). A  jhe gene has been documented in Lymantria dispar (L.; bootstrapping a sample of 1,000 replicates. Lepidoptera: Lymantridae) (Nussbaumer et al. 2000), however, little characterization of a jheh gene in L. dispar has been done. Thus, in RNA Isolation and Synthesis of First-Strand cDNA this study, we focused on the characterization of a jheh gene. Total RNA was isolated using a TRIzol regent (Invitrogen) accord- ing to the manufacturer’s protocol and subsequently treated with RNase-free DNase I  (Promega) to remove any contaminating gen- Materials and Methods omic DNA. RNA concentrations were measured using a spectropho- Insect Rearing tometer and RNA integrity was checked by analysis on a 1% w/v L.  dispar eggs were collected from the Liangshui Natural Reserve of agarose gel. One microgram of total RNA was reverse transcribed Xiaoxing’an Mountain (128°53′20″E, 47°10′50″N) and maintained at using reverse transcriptase (Takara Bio., Dalian, China). 4°C. When the egg masses were ready to hatch, they were disinfected with 5% methanol. Hatched gypsy moth larvae were reared in sterilized Quantitative Real-Time PCR Analysis Petri dishes (9 cm in diameter and 1.5 cm in height) on leaves of Populus In the developmental expression analysis, cDNA templates were prepared alba × Populus glandulosa under a 14:10 (L:D) h photoperiod, and at from eggs, larvae, prepupae, day 5 pupae (PD5) and adults to compare constant temperature (25 ± 1°C) and humidity (60%). Thirty first instar, transcription levels of ldjheh1 in different developmental stages. cDNA 20 second instar, and 10 third instar larvae were reared per sterilized templates were also derived from the heads, thoraces, and abdomens Petri dish. The leaves were replaced every day and botanical sponges of gypsy moth larvae on day 2 of the third instar for an initial survey soaked in water were used to keep the leaves fresh. Gypsy moth larvae of the tissue expression. For the temporal analysis, cDNA templates that were healthy and similar in size were used for the experiment. were derived from the whole bodies of the third instar larvae at different times (hours) post-ecdysis (I3H0, I3H12, I3H24,I3H36, I3H48, I3H60, Cloning and Identification of the ldjheh1 Gene I3H72, I3H84, I3H96, I3H108, I3H120) to test the transcription levels Total RNA was isolated from the third instar larvae using Invitrogen of the ldjheh1 gene. For each sample, RNA was extracted from five indi- TRIzol reagent (Invitrogen, Carlsbad, CA) according to the man- viduals and repeated in biological triplicate. cDNAs used as templates ufacturer’s protocol. Contaminating genomic DNA was removed for qRT-PCR were synthesized using 1 μg of total RNA and 1 μM oligo- by treatment with RNase-free DNase I (Promaga). One microgram deoxythymidine primer, diluted ten times with RNase-free water. Primer of total RNA (combined from 10 larvae) was prepared for cDNA sequences are listed in Table  1, the efficiency of the PCR (Eff%) and Table 1. Primers used in ORF verification, qRT-PCR, and dsRNA synthesis Experiments Primer names and sequences (5′ to 3′) ORF verification LdJHEH1F: ACTTAAGATGGGTACGAGAATG LdJHEH1R: ACCAGGCTGGGAATAGAA qRT-PCR qLdJHEH1F: AGAGATCATTCCCGTACCTTTG qLdJHEH1R: TGGATTACGGAGGACATTTCG qActin F: ATGTTAGTATGATCGAGCGTATCG qActin R: GCATGATCTGAGGAGCATCTT dsRNAsynthesis dsRNAJHEH1F: TAATACGACTCACTATAGGGGGCCAAGTTCATCCAAAGA dsRNAJHEH1R: TAATACGACTCACTATAGGGCCATCATATAGGCTGCTAATCC dsRNAGFPF: TAATACGACTCACTATAGGGCGCCGAGGTGAAGTTCGAGG dsRNAGFPR: TAATACGACTCACTATAGGGTTACTTGTACAGCTCGTCCA Boldfaced sequences indicate the T7 promoter. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 1 3 coefficient of correlation (R ) for qLdJHEH1 primers were 105.2% and (Tyr299 and Tyr373). The Phe57 and Pro121 conserved in the JHEH 0.996, the Eff% and R for βActin were 108.2% and 0.992. QRT-PCR of other species were also present in LdJHEH1 (Fig. 2). was performed using an MX3000P machine (StrataGene, Agilent, CA) in technical triplicate and normalized to the internal control gene, Actin, Phylogenetic Analysis −ΔΔCt using the 2 method (Pfaffl 2001, Vandesompele et al. 2002). A phylogenetic tree was constructed to evaluate the evolutionary re- lationship of JHEH proteins derived from the cDNAs of 15 insect RNAi Analysis species (Fig. 3). The highly conserved JHEH proteins formed separate Synthesis of dsRNA (513  bp) based on the full-length ldjheh1 order-based clades for Siphonaptera, Hymenoptera, Lepidoptera, gene was performed in vitro using the MEGAscript T7 High Yield and Diptera. As expected, the JHEH of L.  dispar belonged to the Transcription kit (Ambion). Specific primers were designed with the Lepidoptera clade (Fig. 3). T7 promoter to amplify the ldjheh1 gene (listed in Table  1). The dsRNA was purified with phenol/chloroform followed by ethanol Expression of the ldjheh1 Gene precipitation. The dsRNA of a green fluorescent protein (GFP) The transcription levels of ldjheh1 in different developmental stages, gene was generated using a pIRES2-EGFP plasmid as template. including eggs, larvae, prepupae, pupae and adults, showed that The dsRNA was confirmed by electrophoresis on 2% agarose gel. the ldjheh1 gene is expressed throughout all developmental stages. The dsRNA was diluted with RNase-free water to 4 μg/μl and the Expression levels of ldjheh1 in the eggs, prepupae and adults were 3μl dsRNA solution was dripped onto the P. alba × P. glandulosa lower than those in the larvae. The highest peak of ldjheh1 expres- circular leaves (6  mm in diameter). The treated leaves were dried sion occurred at 60 h into the fourth larval instar stage (Fig. 4). The for 0.5  h on filter paper under airflow, and then placed in plastic ldjheh1 mRNA was also detected by qRT-PCR in the heads, thoraces cases (3 cm in diameter and 4.5 cm in height). Leaves treated with and abdomens of gypsy moth larvae on day 2 of the third instar. RNase-free water and the GFP dsRNA were used as control. Each Expression levels of ldjheh1 mRNA were higher in the thoraces and third instar larva was confined to one plastic cases with one of the abdomens than in the heads (Fig.  5). The qRT-PCR analyses were treated circular leaves. Each replicate was fed on a treated leaf, after performed every other 12 h to test the temporal expression profile of feeding completely then kept on normal leaves. Each treatment was ldjheh1 cDNA in the third instar larvae. Higher peaks of ldjheh1 ex- repeated 60 times; 30 replicates were used to extract the total RNA pression occurred 12–24 h after ecdysis, mRNAs decreased from 36 and 30 were used to observe the duration of larval stages. to 120 h, and the highest peaks occurred 24 h after ecdysis (Fig. 6). Effect of dsRNAJHEH on the expression of the Results ldjheh1 gene cDNA Cloning and Characterization of the After ingesting dsRNAJHEH, third instar larvae examined after ldjheh1 Gene 12, 36, and 48  h showed a decreased ldjheh1 mRNA abundance One full length cDNA of a putative ldjheh gene was cloned in L. dis- by a factor of 0.28, 0.68, and 0.88, respectively, however, third in- par and provisionally designated ldjheh1. The ldjheh1 cDNA con- star larvae examined after 24 and 72 h showed a increased ldjheh1 sisted of 2101  bp. The ORF length was 1380  bp, which encodes mRNA abundance by a factor of 0.25 and 3.28, respectively, when a 459 amino-acid protein, and the predicted molecular weight was compared with the correspondent blank control (by the time after 52.64  kDa with the theoretical isoelectric point of 6.87. We pre- ingesting Rnase free water) (Fig. 7). Ingesting dsRNAJHEH slightly dicted the presence of a transmembrane domain using the software delayed the duration of the third instar larval by 0.38 d, compared TMHMM 2.0, and, as expected, LdJHEH1 contains a transmem- with the control group of 5.43 d. brane domain at the N-terminus (Fig. 1). We analyzed and compared the amino acid sequences of seven Discussion JHEH and JHEH-like proteins from other insect species. The N-terminal segments of LdJHEH1 and other four Lepidoptera The physiological function of JH in insect development is strictly insects contain two conserved motifs (‘WWG’ and ‘HGWP’), cata- regulated through synthesis and degradation pathways (Hammock lytic triad (Asp229, Glu402 and His429) and two tyrosine residues 1985). In this paper, we cloned a jheh gene in L.  dispar. Multiple Fig. 1. Transmembrane domains of JHEH in L. dispar. The domains were predicted using TMHMM 2.0. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 4 Journal of Insect Science, 2018, Vol. 18, No. 1 Fig. 2. Alignment of seven insect JHEH or JHEH-like proteins. The N-terminal membrane anchor motif ‘WWG’ is labeled as black triangles. The HGWP motif, catalytic triad (Asp229, Glu402 and His429) and two tyrosine residues (Tyr299 and Tyr373) are labeled as stars. The tyrosine residues (Phe57 and Pro121) are labeled as white triangles (the amino acid position is in LdJHEH1). All sequences were downloaded from the NCBI database (www.ncbi.nlm.nih.gov). The sequences used, with the NCBI accession number codes in parentheses, are: Bombyx mori JHEH-like protein (B.mor, NP_001159617), Plutella xylostella JHEH- like protein (P.xyl, XP_011555625), Amyelois transitella JHEH-like protein (A.tra, XP_013192198), Papilio xuthus JHEH protein (P.xut, KPJ04294), Manduca sexta JHEH protein (M.sex, AAC47018), Drosophila melanogaster JHEH protein (D.mel, ACV04637). Fig. 3. Phylogenetic analysis of JHEH or JHEH-like homologs from different insect species based on amino acid sequences. JHEH or JHEH-like proteins originated from one Siphonapteran, Ctenocephalides felis (C.fel); three Hymenopterans, Camponotus floridanus ( C.flo), Harpegnathos saltator (H.sal), and Athalia rosae (A.ros); seven Lepidopterans, Lymantria dispar (L.dis), Bombyx mori (B.mor), Plutella xylostella (P.xyl), Amyelois transitella (A.tra), Papilio xuthus (P.xut), Manduca sexta (M.sex), and Danaus plexippus (D.ple); and four Dipterans, Aedes aegypti (A.aeg), Culex quinquefasciatus (C.qui), Drosophila melanogaster (D.mel), and Bactrocera dorsalis (B.dor). Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 1 5 Fig. 4. Developmental expression patterns of the ldjheh1 gene. cDNA templates were derived from the whole bodies of the first (I1H60), second (I2H60), third −ΔΔCt (I3H60), fourth (I4H60), fifth (I5H60), and sixth (I6H60) instar larvae, prepupae, pupae and adults. The bars represent the 2 method (±SE) normalized to the geometrical mean of housekeeping gene expression. Different letters above each bar denote significant differences between treatments; P < 0.05, LSD using ANOVA. QAGDWG, as was BmJHEH-r1. All of this importance catalytic triads and residues known for JHEH activity were also present in LdJHEH1 (Fig.  2). The enzymatic activities of JHEH in L.  dispar were not examined in this study, but the importance catalytic triads and residues in the amino acid sequence of LdJHEH1 suggest that LdJHEH1 may be involved in JH degradation. The results also showed that ldjheh1 transcription is detect- able in all developmental stages. The expression levels of ldjheh1 in the eggs, prepupae and adults were lower than in the larvae (Fig. 4). High transcription levels of jheh have been detected in the Malpighian tubules, fat bodies, midgut and epidermis of L. decem- lineata (Lü et al. 2015) and B. mori (Yang et al. 2011). This indicates that JHEH might degrade JH in various tissues (Lü et  al. 2015). Midgut, Malpighian tubules and most fat bodies are located in in- Fig. 5. The expression patterns of the ldjheh1 gene gene in heads, thoraces, and abdomens. cDNA templates were derived from the heads, thoraces sect abdomens. In day 2 third instar larvae, ldjheh1 expression was and abdomens of gypsy moth larvae on day 2 of the third instar. The bars highest in the abdomen (Fig. 5). −ΔΔCt represent the 2 method (±SE) normalized to the geometrical mean of Temporal patterns of ldjheh1 gene expression in the third instar housekeeping gene expression. Different letters above each bar denote showed that the ldjheh1 mRNA content significantly increased, by significant differences between treatments; P < 0.05, LSD using ANOVA. 2.86-fold in 12  h and 4.03-fold in 24  h compared with 0  h, then decreased to about the initial level in 36 and 48  h. Thereafter, the sequence alignments of JHEH with homologs from other insects ldjheh1 mRNA content dropped rapidly and remained at relatively suggested that LdJHEH1 contains a conserved ‘WWG’ motif, which low levels until the end of the instar (Fig. 6). The temporal pattern has been found to function as an anchor for membrane association of ldjheh1 expression has high similarity to that of B.mori jheh (Gilbert et al. 2000). BmJHEH expressed in Sf9 cells was found to mRNA in the fat body in the early stage of the fifth (last) instar be membrane-bound (Zhang et  al. 2005). TMHMM 2.0 predicted (Zhang et  al. 2005). The same expression profile of jheh was also LdJHEH1 contains a transmembrane domain at the N-terminus observed in Trichoplusia ni (L. ; Lepidoptera: Noctuidae) (VanHook (Fig.  2). These data suggest that LdJHEH1 is a membrane-bound Harris et al. 1999). In holometabolous insects, high JH titers elicit protein in L. dispar. BmJHEH, as a typical α/β hydrolase, contains larval-stage-to-larval-stage molting, whereas a pulse of 20E and a a conserved catalytic triad (Asp227, Glu403, and His430) and two drop in JH during the final larval instar triggers larval-to-pupal met- tyrosine residues (Tyr298 and Tyr373), which stabilize and donate amorphosis (Dubrovsky 2005). The ldjheh1 mRNA content rapidly protons to the oxygen atom of the epoxide ring (Yamada et  al. decreased at 36 and 48 h and remained at low levels at 60–120 h in 2000). The ‘WWG’ motif, catalytic triad and two tyrosine residues the third instar. These results are compatible with the common idea were also present in JHEH and five JHEH-r of B. Mori, while only that decreases in jheh mRNA levels cause high levels of JH, which BmJHEH and BmJHEH-r1, -r2, and -r5 show hydrolytic activ- elicit larval-stage-to-larval-stage molts. ity with JH (Seino et  al. 2010). However, the Phe55, Pro119, and The last step in this study was to detect expression of the ldjheh1 Trp228 were not found in BmJHEH-r3 and BmJHEH-r4, which gene after ingesting dsRNA and further, to evaluate the possible effects did not show JHEH activity. Phe55 and Pro119, which conserved on larval development at the third larval instar stage in L.  dispar. in the JHEH of other species reported to have hydrolytic activity on Our results showed that RNAi-mediated knockdown of the ldjheh1 JH, might contribute to proper assembly of the substrate binding gene significantly decreased the expression levels of ldjheh1. After pocket. The Trp228 might be a important site for substrate selec- ingesting dsRNA, the expression did not decrease 72  h post-feed- tivity. The catalytic triad around Asp227 in JHEH of L.dispar was ing (Fig. 7) because dsRNA might be degraded, and the duration of Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 6 Journal of Insect Science, 2018, Vol. 18, No. 1 Fig.  6. Temporal expression patterns of the ldjheh1 gene. cDNA templates were derived from the whole bodies of the third instar larvae at different times −ΔΔCt (hours) post-ecdysis (I3H0, I3H12, I3H24, I3H36, I3H48, I3H60, I3H72, I3H84, I3H96, I3H108 and I3H120) at 12 h intervals. The bars represent the 2 method (±SE) normalized to the geometrical mean of housekeeping gene expression. Different letters above each bar denote significant differences between treatments; P < 0.05, LSD using ANOVA. Acknowledgments This research was supported by grants from the National High Technology Research and Development Program of China (‘863’ Program) (2013AA102701), the Natural Science Foundation of China (3177030144), the Natural Science Foundation of Heilongjiang Province (ZD201404) and the Fundamental Research Funds for the Central Universities (2572016AA09). References Cited Anspaugh, D. D., and R. M. Roe. 2005. Regulation of JH epoxide hydrolase versus JH esterase activity in the cabbage looper, Trichoplusia ni, by juve- nile hormone and xenobiotics. J. Insect Physiol. 51: 523–535. Arand, M., A. Cronin, M. Adamska, and F.  Oesch. 2005. Epoxide hydro- lases: structure, function, mechanism, and assay. Methods Enzymol. 400: 569–588. Fig.  7. Effects of dietary ingestion of dsRNAJHEH on the expression of the Campbell, P. M., M. J. Healy, and J. G. Oakshott. 1992. Characterization of ldjheh1 gene. The newly-enclosed third instar larvae were allowed to ingest juvenile hormone esterase in Drosophila melanogaster. Insect Biochem. leaves immersed in RNase-free water, dsRNAGFP and dsRNAJHEH. The Mol. Biol. 22: 665–677. ldjheh1 expression levels in the whole bodies were measured. The bars −ΔΔCt Cheng, D., M. Meng, J. Peng, W. Qian, L. Kang, and Q. Xia. 2014. Genome- represent the 2 method (±SE) normalized to the geometrical mean of housekeeping gene expression. Different letters above each bar denote wide comparison of genes involved in the biosynthesis, metabolism, and significant differences between treatments at each time point; P < 0.05, LSD signaling of juvenile hormone between silkworm and other insects. Genet. using ANOVA. Mol. Biol. 37: 444–459. Debernard, S., C. Morisseau, T. F. Severson, L. Feng, H. Wojtasek, G. D. Prestwich, and B. D.  Hammock. 1998. Expression and characterization of the recombinant juvenile hormone epoxide hydrolase (JHEH) from the third instar larval development was slightly delayed by 0.38 d, Manduca sexta. Insect Biochem. Mol. Biol. 28: 409–419. compared with the Rnase free water treated group of 5.43 d. RNAi Dubrovsky, E. B. 2005. Hormonal cross talk in insect development. Trends of the ldjheh1 gene, using this oral delivery method and this dsRNA Endocrinol. Metab. 16: 6–11. concentration, did not affect the survivorship and phenotype of the Gilbert, L. I., N.  A. Granger, and R. M.  Roe. 2000. The juvenile hormones: third instar larval. Feeding of dsRNA as a non-invasive approach is historical facts and speculations on future research directions. Insect more attractive than hemocoel injection, and furthermore opens the Biochem. Mol. Biol. 30: 617–644. possibility of new methods to control pest through the production Halarnkar, P. P., G. P. Jackson, K. M. Straub, and D. A. Schooley. 1993. Juvenile hormone catabolism in Manduca sexta: homologue selectivity of catabol- of species-specific hairpin RNAs against pests in transgenic plants ism and identification of a diol-phosphate conjugate as a major end prod- (Price and Gatehouse 2008). In 24 h starved larvae, dsRNA-degrad- uct. Experientia. 49: 988–994. ing activity in the midgut was greatly decreased and could be an Hammock, B. D. 1985. Comprehensive insect physiology, biochemistry and important factor for the increased sensitivity to dsRNA (Rodrı´guez- pharmacology, pp. 431–472. In G. A. Kerkut and L. I. Gilbert (eds.), vol. Cabrera et al. 2010). In addition, gene silencing by feeding dsRNA 7, Pergamon Press, New York. Guidelines for the use and interpretation of requires high concentrations for success (Terenius et  al. 2011). assays for monitoring autophagy. Therefore, low levels of silencing were obtained in L.  dispar after Hammock, B. D., and T. C.  Sparks. 1977. A rapid assay for insect juvenile ingested dsRNAJHEH, may be caused by the dsRNA-degrading hormone esterase activity. Anal. Biochem. 82: 573–579. activity in the midgut, and the concentration of dsRNA need added Hirai, M., M. Kamimura, K. Kikuchi, Y. Yasukochi, M. Kiuchi, T. Shinoda, for high silencing. and T.  Shiotsuki. 2002. cDNA cloning and characterization of Bombyx Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 1 7 mori juvenile hormone esterase: an inducible gene by the imidazole insect Seino, A., T. Ogura, T. Tsubota, M. Shimomura, T. Nakakura, A. Tan, K. Mita, growth regulator KK-42. Insect Biochem. Mol. Biol. 32: 627–635. T. Shinoda, Y. Nakagawa, and T.  Shiotsuki. 2010. Characterization of Itakura, S., S. Kawabata, H. Tanaka, and A. Enoki. 2008. Effect of norharmane juvenile hormone epoxide hydrolase and related genes in the larval devel- in vitro on juvenile hormone epoxide hydrolase activity in the lower ter- opment of the silkworm Bombyx mori. Biosci. Biotechnol. Biochem. 74: mite, Reticulitermes speratus. J. Insect Sci. 8: 13. 1421–1429. Kamita, S. G., A. C. Hinton, C. E. Wheelock, M. D. Wogulis, D. K. Wilson, N. Severson, T. F., M.  H. Goodrow, C. Morisseau, D. L. Dowdy, and B. M. Wolf, J. E. Stok, B. Hock, and B. D. Hammock. 2003. Juvenile hormone D.  Hammock. 2002. Urea and amide-based inhibitors of the juvenile (JH) esterase: why are you so JH specific? Insect Biochem. Mol. Biol. 33: hormone epoxide hydrolase of the tobacco hornworm (Manduca sexta: 1261–1273. Sphingidae). Insect Biochem. Mol. Biol. 32: 1741–1756. Keiser, K. C., K.  S. Brandt, G. M. Silver, and N.  Wisnewski. 2002. Cloning, Share, M. R., and R. M.  Roe. 1988. A partition assay for the simultaneous partial purification and in vivo developmental profile of expression of the determination of insect juvenile hormone esterase and epoxide hydrolase juvenile hormone epoxide hydrolase of Ctenocephalides felis. Arch. Insect activity. Anal. Biochem. 169: 81–88. Biochem. Physiol. 50: 191–206. Stay, B., S. S.  Tobe, and W. G.  Bendena. 1994.Allatostatins: identification, Khlebodarova, T. M., N.  E. Gruntenko, L. G. Grenback, M. Z. Sukhanova, primary structure, function and distribution. Adv. Insect Physiol. 125: M. M. Mazurov, I. Y. Rauschenbach, B. A. Tomas, and B. D. Hammock. 267–337. 1996. A comparative analysis of juvenile hormone metabolyzing enzymes Tamura, K., J. Dudley, M. Nei, and S.  Kumar. 2007. MEGA4: Molecular in two species of Drosophila during development. Insect Biochem. Mol. Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Biol. 26: 829–835. Evol. 24: 1596–1599. Lassiter, M. T., C. S.  Apperson, and R. M.  Roe. 1995. Juvenile hormone Tan, A., H. Tanaka, T. Tamura, and T. Shiotsuki. 2005. Precocious metamor- metabolism during the fourth stadium and pupal stage of the Southern phosis in transgenic silkworms overexpressing juvenile hormone esterase. House Mosquito Culex quinquefasciatus. J. Insect Physiol. 41: 869–876. Proc. Natl. Acad. Sci. U. S. A. 102: 11751–11756. Li, S., P. Falabella, I. Kuriachan, S. B. Vinson, D. W. Borst, C. Malva, and Terenius, O., A. Papanicolaou, J. S. Garbutt, I. Eleftherianos, H. Huvenne, F.  Pennacchio. 2003. Juvenile hormone synthesis, metabolism, and S. Kanginakudru, M. Albrechtsen, C. An, J. L. Aymeric, A. Barthel, et al. resulting haemolymph titre in Heliothis virescens larvae parasitized by 2011. RNA interference in Lepidoptera: an overview of successful and Toxoneuron nigriceps. J. Insect Physiol. 49: 1021–1030. unsuccessful studies and implications for experimental design. J. Insect Lü, F. G., K. Y. Fu, W. C. Guo, and G. Q. Li. 2015. Characterization of two Physiol. 57: 231–245. juvenile hormone epoxide hydrolases by RNA interference in the Colorado Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. potato beetle. Gene. 570: 264–271. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple Mackert, A., K. Hartfelder, M. M. Bitondi, and Z. L. Simões. 2010. The juve- sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: nile hormone (JH) epoxide hydrolase gene in the honey bee (Apis mellif- 4876–4882. era) genome encodes a protein which has negligible participation in JH Touhara, K., and G. D. Prestwich. 1993. Juvenile hormone epoxide hydrolase. degradation. J. Insect Physiol. 56: 1139–1146. Photoaffinity labeling, purification, and characterization from tobacco Maxwell, R. A., W. H. Welch, and D. A. Schooley. 2002a. Juvenile hormone hornworm eggs. J. Biol. Chem. 268: 19604–19609. diol kinase. I.  Purification, characterization, and substrate specificity of Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, juvenile hormone-selective diol kinase from Manduca sexta. J. Biol. Chem. and F. Speleman. 2002. Accurate normalization of real-time quantitative 277: 21874–21881. RT-PCR data by geometric averaging of multiple internal control genes. Maxwell, R. A., W.  H. Welch, F. M. Horodyski, K. M. Schegg, and D. Genome Biol. 3: RESEARCH0034. A. Schooley. 2002b. Juvenile hormone diol kinase. II. Sequencing, cloning, VanHook Harris, S., D. Marin Thompson, R. J. Linderman, M. D. and molecular modeling of juvenile hormone-selective diol kinase from Tomalski, and R. M.  Roe. 1999. Cloning and expression of a novel Manduca sexta. J. Biol. Chem. 277: 21882–21890. juvenile hormone-metabolizing epoxide hydrolase during larval-pupal Morisseau, C., and B. D. Hammock. 2005. Epoxide hydrolases: mechanisms, metamorphosis of the cabbage looper, Trichoplusia ni. Insect Mol. Biol. inhibitor designs, and biological roles. Annu. Rev. Pharmacol. Toxicol. 45: 8: 85–96. 311–333. Wojtasek, H., and G. D.  Prestwich. 1995. Key disulfide bonds in an insect Newman, J. W., C. Morisseau, and B. D. Hammock. 2005. Epoxide hydrolases: hormone binding protein: cDNA cloning of a juvenile hormone binding their roles and interactions with lipid metabolism. Prog. Lipid Res. 44: 1–51. protein of Heliothis virescens and ligand binding by native and mutant Nussbaumer, C., A. C. Hinton, A. Schopf, A. Stradner, and B. D. Hammock. forms. Biochemistry. 34: 5234–5241. 2000. Isolation and characterization of juvenile hormone esterase from Wojtasek, H., and G. D. Prestwich. 1996. An insect juvenile hormone-specific hemolymph of Lymantria dispar by affinity- and by anion-exchange chro- epoxide hydrolase is related to vertebrate microsomal epoxide hydrolases. matography. Insect Biochem. Mol. Biol. 30: 307–314. Biochem. Biophys. Res. Commun. 220: 323–329. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in Wyatt, G. R., and K. G. Davey. 1996. Cellular and molecular actions of juve- real-time RT-PCR. Nucleic Acids Res. 29: e45. nile hormone. II. Roles of juvenile hormone in adult insects. Adv. Insect Price, D. R.  G., and J. A.  Gatehouse. 2008. RNAi-mediated crop protection Physiol. 26: 1–156. against insects. Trends Biotechnol. 26: 393–400. Yamada, T., C. Morisseau, J. E. Maxwell, M. A. Argiriadi, D. W. Christianson, Riddiford, L. M. 1994. Cellular and molecular actions of juvenile hormone and B. D. Hammock. 2000. Biochemical evidence for the involvement of I. general considerations and premetamorphic actions. Adv. Insect Physiol. tyrosine in epoxide activation during the catalytic cycle of epoxide hydro- 24: 213–273. lase. J. Biol. Chem. 275: 23082–23088. Rodrı´guez-Cabrera, L., D. Trujillo-Bacallao, O. Borra´s-Hidalgo, D. J. Wright, and Yang, H. J., F. Zhou, S. Awquib, F. A. Malik, B. Roy, X. H. Li, J. B. Hu, C. C. AyraPardo. 2010. RNAi-mediated knockdown of a Spodoptera frugiperda G. Sun, Y. S. Niu, and Y. G. Miao. 2011. Expression pattern of enzymes trypsinlike serine-protease gene reduces susceptibility to a Bacillus thuringien- related to juvenile hormone metabolism in the silkworm, Bombyx mori L. sis Cry1Ca1 protoxin. Environmental Microbiology. 12: 2894–2903. Mol. Biol. Rep. 38: 4337–4342. Roe, R. M., and K. Venkatesh.1990. Metabolism of juvenile hormones: degrad- Zhang, Q. R., W. H. Xu, F. S. Chen, and S. Li. 2005. Molecular and biochem- ation and titer regulation, pp. 126–179. In Gupta AP (ed.), Morphogenetic ical characterization of juvenile hormone epoxide hydrolase from the silk- hormones of arthropods. Rutgers University Press, New Brunswick, NJ. worm, Bombyx mori. Insect Biochem. Mol. Biol. 35: 153–164. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Insect Science Oxford University Press

Characterization and Expression Profiles of Juvenile Hormone Epoxide Hydrolase From Lymantria dispar (Lepidoptera: Lymantridae) and RNA Interference by Ingestion

Free
7 pages

Loading next page...
 
/lp/ou_press/characterization-and-expression-profiles-of-juvenile-hormone-epoxide-H0jiQLPQDk
Publisher
Entomological Society of America
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America.
eISSN
1536-2442
D.O.I.
10.1093/jisesa/iey002
Publisher site
See Article on Publisher Site

Abstract

Juvenile hormone epoxide hydrolase (JHEH) is an important enzyme in the degradation pathways of juvenile hormone (JH) in insects. It converts JH to JH diol and hydrolyses JH acid to JH acid diol. JHEH titers regulate the entire process of insect development. In this study, full length ldjheh cDNA (2101 bp) was cloned from the Asian gypsy moth Lymantria dispar (L.; Lepidoptera: Lymantridae), and provisionally designated ldjheh1. LdJHEH1 was characterized by predicted molecular weight of 52.64  kDa, theoretical isoelectric points of 6.87 and contains a transmembrane domain at the N-terminus. The transcriptional profiles of ldjheh1 were detected by qRT-PCR. The ldjheh1 was found to be expressed throughout all developmental stages with maximum expression levels occurring in fourth instar larvae. The ldjheh1 mRNA was detected in the heads, thoraces, and abdomens of gypsy moth larvae on day 2 of the third instar. The ldjheh1 was also detected in bodies of third instar larvae stage, with the highest peaks occurring at 24 h after ecdysis. The ldjheh1 gene was successfully knocked down by oral delivery dsRNA in the third instar larvae of L. dispar. The dsRNA targeting ldjheh1 was produced in vitro. Ingesting dsRNA for ldjheh1 only slightly delayed larval development. Key words: Asian gypsy moth, JHEH, transcriptional profiles, qRT-PCR, RNAi Juvenile hormones (JHs) are composed of sesquiterpenoids, which JHE is a member of the carboxylesterase family. It hydrolyzes the are synthesized primarily by the insect corpora allata and then methyl ester moiety of JH to juvenile hormone acid (JHa), which can released into the hemolymph. Here, they play multiple and impor- be reverted back to JH (Hammock 1985, Hirai et al. 2002, Tan et al. tant roles in the regulation of larval metamorphosis (Riddiford 1994) 2005), and catalyzes juvenile hormone diol (JHd) to produce juve- and adult insect reproduction, e.g., by regulating pheromone synthe- nile hormone acid diol (JHad) (Share and Roe 1988). As one of the sis and vitellogenesis (Wyatt and Davey 1996). Accurate regulation epoxide hydrolases, JHEH transforms epoxides to compounds with of JH concentration is, therefore, crucial for orderly development decreased chemical reactivity, increased water solubility, and changed in insects. Many studies have shown that JH titers are controlled biological activity (Arand et  al. 2005, Morisseau and Hammock mainly by changing the rates of its synthesis and degradation (Gilbert 2005). In certain organs and tissues, JHEH degrades JHa to JHad et al. 2000, Li et al. 2003). JH synthesis is regulated by neuropep- (Share and Roe 1988), and hydrolyses JH to JHd, which is an irre- tides, such as allatotropins and allatostatins, secreted from the brain versible hydrolysis reaction (Roe and Venkatesh 1990, Wojtasek and (Stay et  al. 1994). JH degradation occurs over a very short period Prestwich 1995, Anspaugh and Roe 2005, Newman et al. 2005). and is mediated by at least three enzymes: juvenile hormone ester- Initially, research about JH degradation concentrated on the ase (JHE) (Hammock and Sparks 1977), juvenile hormone epoxide mechanism of action of JHE (Kamita et al. 2003). However, since a hydrolase (JHEH) (Share and Roe 1988), and juvenile hormone diol specific partition assay was developed to simultaneously determine kinase (JHDK) (Maxwell et al. 2002a,b). In insects, JH is principally the activity of JHE and JHEH in insect tissue (Share and Roe 1988), degraded by JHEs and JHEHs, which have high substrate specificity. rapid progress has been made in determining how JHEH participates © The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 2 Journal of Insect Science, 2018, Vol. 18, No. 1 in JH degradation (Touhara and Prestwich 1993, Wojtasek and library construction using the Illumina HiSeq 2500 sequencing Prestwich 1996, Debernard et al. 1998, Severson et al. 2002). Many platform (Illumina Inc., San Diego, CA). After purity and quality assays had revealed that JHEH plays an important role, as critical as checks, we obtained approximately 20 million clean reads averaging that of JHE, in degrading JH in certain insects (Campbell et al. 1992, 63.40 bp in length. One ldjheh1 gene was identified in this library Halarnkar et al. 1993, Lassiter et al. 1995, Khlebodarova et al. 1996, according to the functional annotations. The ldjheh1 gene was fur- Debernard et al. 1998). The extent of the roles that JHE and JHEH ther amplified using RT-PCR and sequenced for confirmation. All play in JH degradation depends on the species and the developmen- primer sequences are listed in Table  1. The resulting sequence of tal stages of the insect (Keiser et al. 2002, Kamita et al. 2003). Thus, ldjheh1 was submitted to GenBank (accession number MF996338). JHEH inhibitors are considered to be potential insecticides for cer- tain insects in which JHEH plays major function in JH degradation Gene Characterization and Polygenetic Analysis (Severson et al. 2002). This is further supported by findings that higher ExPASy Proteomics Server (http://cn.expasy.org/tools/pi_tool.html) concentrations of norharman could inhibit the activity of JHEH in was used to compute the molecular weights and isoelectric points Reticulitermes speratus (Kolbe; Isoptera: Rhinotermitidae)  (Itakura of the deduced protein sequences. Transmembrane domains were et  al. 2008). In addition, several jheh or jheh-like genes have been predicted by TMHMM 2.0 (www.cbs.dtu.dk/services/TMHMM). cloned from lepidopteran insects, such as Manduca sexta (L. ; JHEH amino acid sequences from other insects were retrieved from Lepidoptera: Sphingidae)  (Wojtasek and Prestwich 1996), Bombyx NCBI and aligned with the predicted LdJHEH1 using ClustalX mori (L. ; Lepidoptera: Bombycidae) (Hirai et al. 2002, Zhang et al. (1.83) (Thompson et  al. 1997). Phylogenetic trees were generated 2005, Seino et  al. 2010, Cheng et  al. 2014) and Danaus plexippus using the neighbor-joining method in MEGA 5.1 software (Tamura (L. ; Lepidoptera: Nymphalidae) (Mackert et al. 2010, Cheng et al. et al. 2007). The reliability of the NJ tree topology was evaluated by 2014). A  jhe gene has been documented in Lymantria dispar (L.; bootstrapping a sample of 1,000 replicates. Lepidoptera: Lymantridae) (Nussbaumer et al. 2000), however, little characterization of a jheh gene in L. dispar has been done. Thus, in RNA Isolation and Synthesis of First-Strand cDNA this study, we focused on the characterization of a jheh gene. Total RNA was isolated using a TRIzol regent (Invitrogen) accord- ing to the manufacturer’s protocol and subsequently treated with RNase-free DNase I  (Promega) to remove any contaminating gen- Materials and Methods omic DNA. RNA concentrations were measured using a spectropho- Insect Rearing tometer and RNA integrity was checked by analysis on a 1% w/v L.  dispar eggs were collected from the Liangshui Natural Reserve of agarose gel. One microgram of total RNA was reverse transcribed Xiaoxing’an Mountain (128°53′20″E, 47°10′50″N) and maintained at using reverse transcriptase (Takara Bio., Dalian, China). 4°C. When the egg masses were ready to hatch, they were disinfected with 5% methanol. Hatched gypsy moth larvae were reared in sterilized Quantitative Real-Time PCR Analysis Petri dishes (9 cm in diameter and 1.5 cm in height) on leaves of Populus In the developmental expression analysis, cDNA templates were prepared alba × Populus glandulosa under a 14:10 (L:D) h photoperiod, and at from eggs, larvae, prepupae, day 5 pupae (PD5) and adults to compare constant temperature (25 ± 1°C) and humidity (60%). Thirty first instar, transcription levels of ldjheh1 in different developmental stages. cDNA 20 second instar, and 10 third instar larvae were reared per sterilized templates were also derived from the heads, thoraces, and abdomens Petri dish. The leaves were replaced every day and botanical sponges of gypsy moth larvae on day 2 of the third instar for an initial survey soaked in water were used to keep the leaves fresh. Gypsy moth larvae of the tissue expression. For the temporal analysis, cDNA templates that were healthy and similar in size were used for the experiment. were derived from the whole bodies of the third instar larvae at different times (hours) post-ecdysis (I3H0, I3H12, I3H24,I3H36, I3H48, I3H60, Cloning and Identification of the ldjheh1 Gene I3H72, I3H84, I3H96, I3H108, I3H120) to test the transcription levels Total RNA was isolated from the third instar larvae using Invitrogen of the ldjheh1 gene. For each sample, RNA was extracted from five indi- TRIzol reagent (Invitrogen, Carlsbad, CA) according to the man- viduals and repeated in biological triplicate. cDNAs used as templates ufacturer’s protocol. Contaminating genomic DNA was removed for qRT-PCR were synthesized using 1 μg of total RNA and 1 μM oligo- by treatment with RNase-free DNase I (Promaga). One microgram deoxythymidine primer, diluted ten times with RNase-free water. Primer of total RNA (combined from 10 larvae) was prepared for cDNA sequences are listed in Table  1, the efficiency of the PCR (Eff%) and Table 1. Primers used in ORF verification, qRT-PCR, and dsRNA synthesis Experiments Primer names and sequences (5′ to 3′) ORF verification LdJHEH1F: ACTTAAGATGGGTACGAGAATG LdJHEH1R: ACCAGGCTGGGAATAGAA qRT-PCR qLdJHEH1F: AGAGATCATTCCCGTACCTTTG qLdJHEH1R: TGGATTACGGAGGACATTTCG qActin F: ATGTTAGTATGATCGAGCGTATCG qActin R: GCATGATCTGAGGAGCATCTT dsRNAsynthesis dsRNAJHEH1F: TAATACGACTCACTATAGGGGGCCAAGTTCATCCAAAGA dsRNAJHEH1R: TAATACGACTCACTATAGGGCCATCATATAGGCTGCTAATCC dsRNAGFPF: TAATACGACTCACTATAGGGCGCCGAGGTGAAGTTCGAGG dsRNAGFPR: TAATACGACTCACTATAGGGTTACTTGTACAGCTCGTCCA Boldfaced sequences indicate the T7 promoter. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 1 3 coefficient of correlation (R ) for qLdJHEH1 primers were 105.2% and (Tyr299 and Tyr373). The Phe57 and Pro121 conserved in the JHEH 0.996, the Eff% and R for βActin were 108.2% and 0.992. QRT-PCR of other species were also present in LdJHEH1 (Fig. 2). was performed using an MX3000P machine (StrataGene, Agilent, CA) in technical triplicate and normalized to the internal control gene, Actin, Phylogenetic Analysis −ΔΔCt using the 2 method (Pfaffl 2001, Vandesompele et al. 2002). A phylogenetic tree was constructed to evaluate the evolutionary re- lationship of JHEH proteins derived from the cDNAs of 15 insect RNAi Analysis species (Fig. 3). The highly conserved JHEH proteins formed separate Synthesis of dsRNA (513  bp) based on the full-length ldjheh1 order-based clades for Siphonaptera, Hymenoptera, Lepidoptera, gene was performed in vitro using the MEGAscript T7 High Yield and Diptera. As expected, the JHEH of L.  dispar belonged to the Transcription kit (Ambion). Specific primers were designed with the Lepidoptera clade (Fig. 3). T7 promoter to amplify the ldjheh1 gene (listed in Table  1). The dsRNA was purified with phenol/chloroform followed by ethanol Expression of the ldjheh1 Gene precipitation. The dsRNA of a green fluorescent protein (GFP) The transcription levels of ldjheh1 in different developmental stages, gene was generated using a pIRES2-EGFP plasmid as template. including eggs, larvae, prepupae, pupae and adults, showed that The dsRNA was confirmed by electrophoresis on 2% agarose gel. the ldjheh1 gene is expressed throughout all developmental stages. The dsRNA was diluted with RNase-free water to 4 μg/μl and the Expression levels of ldjheh1 in the eggs, prepupae and adults were 3μl dsRNA solution was dripped onto the P. alba × P. glandulosa lower than those in the larvae. The highest peak of ldjheh1 expres- circular leaves (6  mm in diameter). The treated leaves were dried sion occurred at 60 h into the fourth larval instar stage (Fig. 4). The for 0.5  h on filter paper under airflow, and then placed in plastic ldjheh1 mRNA was also detected by qRT-PCR in the heads, thoraces cases (3 cm in diameter and 4.5 cm in height). Leaves treated with and abdomens of gypsy moth larvae on day 2 of the third instar. RNase-free water and the GFP dsRNA were used as control. Each Expression levels of ldjheh1 mRNA were higher in the thoraces and third instar larva was confined to one plastic cases with one of the abdomens than in the heads (Fig.  5). The qRT-PCR analyses were treated circular leaves. Each replicate was fed on a treated leaf, after performed every other 12 h to test the temporal expression profile of feeding completely then kept on normal leaves. Each treatment was ldjheh1 cDNA in the third instar larvae. Higher peaks of ldjheh1 ex- repeated 60 times; 30 replicates were used to extract the total RNA pression occurred 12–24 h after ecdysis, mRNAs decreased from 36 and 30 were used to observe the duration of larval stages. to 120 h, and the highest peaks occurred 24 h after ecdysis (Fig. 6). Effect of dsRNAJHEH on the expression of the Results ldjheh1 gene cDNA Cloning and Characterization of the After ingesting dsRNAJHEH, third instar larvae examined after ldjheh1 Gene 12, 36, and 48  h showed a decreased ldjheh1 mRNA abundance One full length cDNA of a putative ldjheh gene was cloned in L. dis- by a factor of 0.28, 0.68, and 0.88, respectively, however, third in- par and provisionally designated ldjheh1. The ldjheh1 cDNA con- star larvae examined after 24 and 72 h showed a increased ldjheh1 sisted of 2101  bp. The ORF length was 1380  bp, which encodes mRNA abundance by a factor of 0.25 and 3.28, respectively, when a 459 amino-acid protein, and the predicted molecular weight was compared with the correspondent blank control (by the time after 52.64  kDa with the theoretical isoelectric point of 6.87. We pre- ingesting Rnase free water) (Fig. 7). Ingesting dsRNAJHEH slightly dicted the presence of a transmembrane domain using the software delayed the duration of the third instar larval by 0.38 d, compared TMHMM 2.0, and, as expected, LdJHEH1 contains a transmem- with the control group of 5.43 d. brane domain at the N-terminus (Fig. 1). We analyzed and compared the amino acid sequences of seven Discussion JHEH and JHEH-like proteins from other insect species. The N-terminal segments of LdJHEH1 and other four Lepidoptera The physiological function of JH in insect development is strictly insects contain two conserved motifs (‘WWG’ and ‘HGWP’), cata- regulated through synthesis and degradation pathways (Hammock lytic triad (Asp229, Glu402 and His429) and two tyrosine residues 1985). In this paper, we cloned a jheh gene in L.  dispar. Multiple Fig. 1. Transmembrane domains of JHEH in L. dispar. The domains were predicted using TMHMM 2.0. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 4 Journal of Insect Science, 2018, Vol. 18, No. 1 Fig. 2. Alignment of seven insect JHEH or JHEH-like proteins. The N-terminal membrane anchor motif ‘WWG’ is labeled as black triangles. The HGWP motif, catalytic triad (Asp229, Glu402 and His429) and two tyrosine residues (Tyr299 and Tyr373) are labeled as stars. The tyrosine residues (Phe57 and Pro121) are labeled as white triangles (the amino acid position is in LdJHEH1). All sequences were downloaded from the NCBI database (www.ncbi.nlm.nih.gov). The sequences used, with the NCBI accession number codes in parentheses, are: Bombyx mori JHEH-like protein (B.mor, NP_001159617), Plutella xylostella JHEH- like protein (P.xyl, XP_011555625), Amyelois transitella JHEH-like protein (A.tra, XP_013192198), Papilio xuthus JHEH protein (P.xut, KPJ04294), Manduca sexta JHEH protein (M.sex, AAC47018), Drosophila melanogaster JHEH protein (D.mel, ACV04637). Fig. 3. Phylogenetic analysis of JHEH or JHEH-like homologs from different insect species based on amino acid sequences. JHEH or JHEH-like proteins originated from one Siphonapteran, Ctenocephalides felis (C.fel); three Hymenopterans, Camponotus floridanus ( C.flo), Harpegnathos saltator (H.sal), and Athalia rosae (A.ros); seven Lepidopterans, Lymantria dispar (L.dis), Bombyx mori (B.mor), Plutella xylostella (P.xyl), Amyelois transitella (A.tra), Papilio xuthus (P.xut), Manduca sexta (M.sex), and Danaus plexippus (D.ple); and four Dipterans, Aedes aegypti (A.aeg), Culex quinquefasciatus (C.qui), Drosophila melanogaster (D.mel), and Bactrocera dorsalis (B.dor). Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 1 5 Fig. 4. Developmental expression patterns of the ldjheh1 gene. cDNA templates were derived from the whole bodies of the first (I1H60), second (I2H60), third −ΔΔCt (I3H60), fourth (I4H60), fifth (I5H60), and sixth (I6H60) instar larvae, prepupae, pupae and adults. The bars represent the 2 method (±SE) normalized to the geometrical mean of housekeeping gene expression. Different letters above each bar denote significant differences between treatments; P < 0.05, LSD using ANOVA. QAGDWG, as was BmJHEH-r1. All of this importance catalytic triads and residues known for JHEH activity were also present in LdJHEH1 (Fig.  2). The enzymatic activities of JHEH in L.  dispar were not examined in this study, but the importance catalytic triads and residues in the amino acid sequence of LdJHEH1 suggest that LdJHEH1 may be involved in JH degradation. The results also showed that ldjheh1 transcription is detect- able in all developmental stages. The expression levels of ldjheh1 in the eggs, prepupae and adults were lower than in the larvae (Fig. 4). High transcription levels of jheh have been detected in the Malpighian tubules, fat bodies, midgut and epidermis of L. decem- lineata (Lü et al. 2015) and B. mori (Yang et al. 2011). This indicates that JHEH might degrade JH in various tissues (Lü et  al. 2015). Midgut, Malpighian tubules and most fat bodies are located in in- Fig. 5. The expression patterns of the ldjheh1 gene gene in heads, thoraces, and abdomens. cDNA templates were derived from the heads, thoraces sect abdomens. In day 2 third instar larvae, ldjheh1 expression was and abdomens of gypsy moth larvae on day 2 of the third instar. The bars highest in the abdomen (Fig. 5). −ΔΔCt represent the 2 method (±SE) normalized to the geometrical mean of Temporal patterns of ldjheh1 gene expression in the third instar housekeeping gene expression. Different letters above each bar denote showed that the ldjheh1 mRNA content significantly increased, by significant differences between treatments; P < 0.05, LSD using ANOVA. 2.86-fold in 12  h and 4.03-fold in 24  h compared with 0  h, then decreased to about the initial level in 36 and 48  h. Thereafter, the sequence alignments of JHEH with homologs from other insects ldjheh1 mRNA content dropped rapidly and remained at relatively suggested that LdJHEH1 contains a conserved ‘WWG’ motif, which low levels until the end of the instar (Fig. 6). The temporal pattern has been found to function as an anchor for membrane association of ldjheh1 expression has high similarity to that of B.mori jheh (Gilbert et al. 2000). BmJHEH expressed in Sf9 cells was found to mRNA in the fat body in the early stage of the fifth (last) instar be membrane-bound (Zhang et  al. 2005). TMHMM 2.0 predicted (Zhang et  al. 2005). The same expression profile of jheh was also LdJHEH1 contains a transmembrane domain at the N-terminus observed in Trichoplusia ni (L. ; Lepidoptera: Noctuidae) (VanHook (Fig.  2). These data suggest that LdJHEH1 is a membrane-bound Harris et al. 1999). In holometabolous insects, high JH titers elicit protein in L. dispar. BmJHEH, as a typical α/β hydrolase, contains larval-stage-to-larval-stage molting, whereas a pulse of 20E and a a conserved catalytic triad (Asp227, Glu403, and His430) and two drop in JH during the final larval instar triggers larval-to-pupal met- tyrosine residues (Tyr298 and Tyr373), which stabilize and donate amorphosis (Dubrovsky 2005). The ldjheh1 mRNA content rapidly protons to the oxygen atom of the epoxide ring (Yamada et  al. decreased at 36 and 48 h and remained at low levels at 60–120 h in 2000). The ‘WWG’ motif, catalytic triad and two tyrosine residues the third instar. These results are compatible with the common idea were also present in JHEH and five JHEH-r of B. Mori, while only that decreases in jheh mRNA levels cause high levels of JH, which BmJHEH and BmJHEH-r1, -r2, and -r5 show hydrolytic activ- elicit larval-stage-to-larval-stage molts. ity with JH (Seino et  al. 2010). However, the Phe55, Pro119, and The last step in this study was to detect expression of the ldjheh1 Trp228 were not found in BmJHEH-r3 and BmJHEH-r4, which gene after ingesting dsRNA and further, to evaluate the possible effects did not show JHEH activity. Phe55 and Pro119, which conserved on larval development at the third larval instar stage in L.  dispar. in the JHEH of other species reported to have hydrolytic activity on Our results showed that RNAi-mediated knockdown of the ldjheh1 JH, might contribute to proper assembly of the substrate binding gene significantly decreased the expression levels of ldjheh1. After pocket. The Trp228 might be a important site for substrate selec- ingesting dsRNA, the expression did not decrease 72  h post-feed- tivity. The catalytic triad around Asp227 in JHEH of L.dispar was ing (Fig. 7) because dsRNA might be degraded, and the duration of Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 6 Journal of Insect Science, 2018, Vol. 18, No. 1 Fig.  6. Temporal expression patterns of the ldjheh1 gene. cDNA templates were derived from the whole bodies of the third instar larvae at different times −ΔΔCt (hours) post-ecdysis (I3H0, I3H12, I3H24, I3H36, I3H48, I3H60, I3H72, I3H84, I3H96, I3H108 and I3H120) at 12 h intervals. The bars represent the 2 method (±SE) normalized to the geometrical mean of housekeeping gene expression. Different letters above each bar denote significant differences between treatments; P < 0.05, LSD using ANOVA. Acknowledgments This research was supported by grants from the National High Technology Research and Development Program of China (‘863’ Program) (2013AA102701), the Natural Science Foundation of China (3177030144), the Natural Science Foundation of Heilongjiang Province (ZD201404) and the Fundamental Research Funds for the Central Universities (2572016AA09). References Cited Anspaugh, D. D., and R. M. Roe. 2005. Regulation of JH epoxide hydrolase versus JH esterase activity in the cabbage looper, Trichoplusia ni, by juve- nile hormone and xenobiotics. J. Insect Physiol. 51: 523–535. Arand, M., A. Cronin, M. Adamska, and F.  Oesch. 2005. Epoxide hydro- lases: structure, function, mechanism, and assay. Methods Enzymol. 400: 569–588. Fig.  7. Effects of dietary ingestion of dsRNAJHEH on the expression of the Campbell, P. M., M. J. Healy, and J. G. Oakshott. 1992. Characterization of ldjheh1 gene. The newly-enclosed third instar larvae were allowed to ingest juvenile hormone esterase in Drosophila melanogaster. Insect Biochem. leaves immersed in RNase-free water, dsRNAGFP and dsRNAJHEH. The Mol. Biol. 22: 665–677. ldjheh1 expression levels in the whole bodies were measured. The bars −ΔΔCt Cheng, D., M. Meng, J. Peng, W. Qian, L. Kang, and Q. Xia. 2014. Genome- represent the 2 method (±SE) normalized to the geometrical mean of housekeeping gene expression. Different letters above each bar denote wide comparison of genes involved in the biosynthesis, metabolism, and significant differences between treatments at each time point; P < 0.05, LSD signaling of juvenile hormone between silkworm and other insects. Genet. using ANOVA. Mol. Biol. 37: 444–459. Debernard, S., C. Morisseau, T. F. Severson, L. Feng, H. Wojtasek, G. D. Prestwich, and B. D.  Hammock. 1998. Expression and characterization of the recombinant juvenile hormone epoxide hydrolase (JHEH) from the third instar larval development was slightly delayed by 0.38 d, Manduca sexta. Insect Biochem. Mol. Biol. 28: 409–419. compared with the Rnase free water treated group of 5.43 d. RNAi Dubrovsky, E. B. 2005. Hormonal cross talk in insect development. Trends of the ldjheh1 gene, using this oral delivery method and this dsRNA Endocrinol. Metab. 16: 6–11. concentration, did not affect the survivorship and phenotype of the Gilbert, L. I., N.  A. Granger, and R. M.  Roe. 2000. The juvenile hormones: third instar larval. Feeding of dsRNA as a non-invasive approach is historical facts and speculations on future research directions. Insect more attractive than hemocoel injection, and furthermore opens the Biochem. Mol. Biol. 30: 617–644. possibility of new methods to control pest through the production Halarnkar, P. P., G. P. Jackson, K. M. Straub, and D. A. Schooley. 1993. Juvenile hormone catabolism in Manduca sexta: homologue selectivity of catabol- of species-specific hairpin RNAs against pests in transgenic plants ism and identification of a diol-phosphate conjugate as a major end prod- (Price and Gatehouse 2008). In 24 h starved larvae, dsRNA-degrad- uct. Experientia. 49: 988–994. ing activity in the midgut was greatly decreased and could be an Hammock, B. D. 1985. Comprehensive insect physiology, biochemistry and important factor for the increased sensitivity to dsRNA (Rodrı´guez- pharmacology, pp. 431–472. In G. A. Kerkut and L. I. Gilbert (eds.), vol. Cabrera et al. 2010). In addition, gene silencing by feeding dsRNA 7, Pergamon Press, New York. Guidelines for the use and interpretation of requires high concentrations for success (Terenius et  al. 2011). assays for monitoring autophagy. Therefore, low levels of silencing were obtained in L.  dispar after Hammock, B. D., and T. C.  Sparks. 1977. A rapid assay for insect juvenile ingested dsRNAJHEH, may be caused by the dsRNA-degrading hormone esterase activity. Anal. Biochem. 82: 573–579. activity in the midgut, and the concentration of dsRNA need added Hirai, M., M. Kamimura, K. Kikuchi, Y. Yasukochi, M. Kiuchi, T. Shinoda, for high silencing. and T.  Shiotsuki. 2002. cDNA cloning and characterization of Bombyx Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 1 7 mori juvenile hormone esterase: an inducible gene by the imidazole insect Seino, A., T. Ogura, T. Tsubota, M. Shimomura, T. Nakakura, A. Tan, K. Mita, growth regulator KK-42. Insect Biochem. Mol. Biol. 32: 627–635. T. Shinoda, Y. Nakagawa, and T.  Shiotsuki. 2010. Characterization of Itakura, S., S. Kawabata, H. Tanaka, and A. Enoki. 2008. Effect of norharmane juvenile hormone epoxide hydrolase and related genes in the larval devel- in vitro on juvenile hormone epoxide hydrolase activity in the lower ter- opment of the silkworm Bombyx mori. Biosci. Biotechnol. Biochem. 74: mite, Reticulitermes speratus. J. Insect Sci. 8: 13. 1421–1429. Kamita, S. G., A. C. Hinton, C. E. Wheelock, M. D. Wogulis, D. K. Wilson, N. Severson, T. F., M.  H. Goodrow, C. Morisseau, D. L. Dowdy, and B. M. Wolf, J. E. Stok, B. Hock, and B. D. Hammock. 2003. Juvenile hormone D.  Hammock. 2002. Urea and amide-based inhibitors of the juvenile (JH) esterase: why are you so JH specific? Insect Biochem. Mol. Biol. 33: hormone epoxide hydrolase of the tobacco hornworm (Manduca sexta: 1261–1273. Sphingidae). Insect Biochem. Mol. Biol. 32: 1741–1756. Keiser, K. C., K.  S. Brandt, G. M. Silver, and N.  Wisnewski. 2002. Cloning, Share, M. R., and R. M.  Roe. 1988. A partition assay for the simultaneous partial purification and in vivo developmental profile of expression of the determination of insect juvenile hormone esterase and epoxide hydrolase juvenile hormone epoxide hydrolase of Ctenocephalides felis. Arch. Insect activity. Anal. Biochem. 169: 81–88. Biochem. Physiol. 50: 191–206. Stay, B., S. S.  Tobe, and W. G.  Bendena. 1994.Allatostatins: identification, Khlebodarova, T. M., N.  E. Gruntenko, L. G. Grenback, M. Z. Sukhanova, primary structure, function and distribution. Adv. Insect Physiol. 125: M. M. Mazurov, I. Y. Rauschenbach, B. A. Tomas, and B. D. Hammock. 267–337. 1996. A comparative analysis of juvenile hormone metabolyzing enzymes Tamura, K., J. Dudley, M. Nei, and S.  Kumar. 2007. MEGA4: Molecular in two species of Drosophila during development. Insect Biochem. Mol. Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Biol. 26: 829–835. Evol. 24: 1596–1599. Lassiter, M. T., C. S.  Apperson, and R. M.  Roe. 1995. Juvenile hormone Tan, A., H. Tanaka, T. Tamura, and T. Shiotsuki. 2005. Precocious metamor- metabolism during the fourth stadium and pupal stage of the Southern phosis in transgenic silkworms overexpressing juvenile hormone esterase. House Mosquito Culex quinquefasciatus. J. Insect Physiol. 41: 869–876. Proc. Natl. Acad. Sci. U. S. A. 102: 11751–11756. Li, S., P. Falabella, I. Kuriachan, S. B. Vinson, D. W. Borst, C. Malva, and Terenius, O., A. Papanicolaou, J. S. Garbutt, I. Eleftherianos, H. Huvenne, F.  Pennacchio. 2003. Juvenile hormone synthesis, metabolism, and S. Kanginakudru, M. Albrechtsen, C. An, J. L. Aymeric, A. Barthel, et al. resulting haemolymph titre in Heliothis virescens larvae parasitized by 2011. RNA interference in Lepidoptera: an overview of successful and Toxoneuron nigriceps. J. Insect Physiol. 49: 1021–1030. unsuccessful studies and implications for experimental design. J. Insect Lü, F. G., K. Y. Fu, W. C. Guo, and G. Q. Li. 2015. Characterization of two Physiol. 57: 231–245. juvenile hormone epoxide hydrolases by RNA interference in the Colorado Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. potato beetle. Gene. 570: 264–271. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple Mackert, A., K. Hartfelder, M. M. Bitondi, and Z. L. Simões. 2010. The juve- sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: nile hormone (JH) epoxide hydrolase gene in the honey bee (Apis mellif- 4876–4882. era) genome encodes a protein which has negligible participation in JH Touhara, K., and G. D. Prestwich. 1993. Juvenile hormone epoxide hydrolase. degradation. J. Insect Physiol. 56: 1139–1146. Photoaffinity labeling, purification, and characterization from tobacco Maxwell, R. A., W. H. Welch, and D. A. Schooley. 2002a. Juvenile hormone hornworm eggs. J. Biol. Chem. 268: 19604–19609. diol kinase. I.  Purification, characterization, and substrate specificity of Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, juvenile hormone-selective diol kinase from Manduca sexta. J. Biol. Chem. and F. Speleman. 2002. Accurate normalization of real-time quantitative 277: 21874–21881. RT-PCR data by geometric averaging of multiple internal control genes. Maxwell, R. A., W.  H. Welch, F. M. Horodyski, K. M. Schegg, and D. Genome Biol. 3: RESEARCH0034. A. Schooley. 2002b. Juvenile hormone diol kinase. II. Sequencing, cloning, VanHook Harris, S., D. Marin Thompson, R. J. Linderman, M. D. and molecular modeling of juvenile hormone-selective diol kinase from Tomalski, and R. M.  Roe. 1999. Cloning and expression of a novel Manduca sexta. J. Biol. Chem. 277: 21882–21890. juvenile hormone-metabolizing epoxide hydrolase during larval-pupal Morisseau, C., and B. D. Hammock. 2005. Epoxide hydrolases: mechanisms, metamorphosis of the cabbage looper, Trichoplusia ni. Insect Mol. Biol. inhibitor designs, and biological roles. Annu. Rev. Pharmacol. Toxicol. 45: 8: 85–96. 311–333. Wojtasek, H., and G. D.  Prestwich. 1995. Key disulfide bonds in an insect Newman, J. W., C. Morisseau, and B. D. Hammock. 2005. Epoxide hydrolases: hormone binding protein: cDNA cloning of a juvenile hormone binding their roles and interactions with lipid metabolism. Prog. Lipid Res. 44: 1–51. protein of Heliothis virescens and ligand binding by native and mutant Nussbaumer, C., A. C. Hinton, A. Schopf, A. Stradner, and B. D. Hammock. forms. Biochemistry. 34: 5234–5241. 2000. Isolation and characterization of juvenile hormone esterase from Wojtasek, H., and G. D. Prestwich. 1996. An insect juvenile hormone-specific hemolymph of Lymantria dispar by affinity- and by anion-exchange chro- epoxide hydrolase is related to vertebrate microsomal epoxide hydrolases. matography. Insect Biochem. Mol. Biol. 30: 307–314. Biochem. Biophys. Res. Commun. 220: 323–329. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in Wyatt, G. R., and K. G. Davey. 1996. Cellular and molecular actions of juve- real-time RT-PCR. Nucleic Acids Res. 29: e45. nile hormone. II. Roles of juvenile hormone in adult insects. Adv. Insect Price, D. R.  G., and J. A.  Gatehouse. 2008. RNAi-mediated crop protection Physiol. 26: 1–156. against insects. Trends Biotechnol. 26: 393–400. Yamada, T., C. Morisseau, J. E. Maxwell, M. A. Argiriadi, D. W. Christianson, Riddiford, L. M. 1994. Cellular and molecular actions of juvenile hormone and B. D. Hammock. 2000. Biochemical evidence for the involvement of I. general considerations and premetamorphic actions. Adv. Insect Physiol. tyrosine in epoxide activation during the catalytic cycle of epoxide hydro- 24: 213–273. lase. J. Biol. Chem. 275: 23082–23088. Rodrı´guez-Cabrera, L., D. Trujillo-Bacallao, O. Borra´s-Hidalgo, D. J. Wright, and Yang, H. J., F. Zhou, S. Awquib, F. A. Malik, B. Roy, X. H. Li, J. B. Hu, C. C. AyraPardo. 2010. RNAi-mediated knockdown of a Spodoptera frugiperda G. Sun, Y. S. Niu, and Y. G. Miao. 2011. Expression pattern of enzymes trypsinlike serine-protease gene reduces susceptibility to a Bacillus thuringien- related to juvenile hormone metabolism in the silkworm, Bombyx mori L. sis Cry1Ca1 protoxin. Environmental Microbiology. 12: 2894–2903. Mol. Biol. Rep. 38: 4337–4342. Roe, R. M., and K. Venkatesh.1990. Metabolism of juvenile hormones: degrad- Zhang, Q. R., W. H. Xu, F. S. Chen, and S. Li. 2005. Molecular and biochem- ation and titer regulation, pp. 126–179. In Gupta AP (ed.), Morphogenetic ical characterization of juvenile hormone epoxide hydrolase from the silk- hormones of arthropods. Rutgers University Press, New Brunswick, NJ. worm, Bombyx mori. Insect Biochem. Mol. Biol. 35: 153–164. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/13/4845550 by Ed 'DeepDyve' Gillespie user on 16 March 2018

Journal

Journal of Insect ScienceOxford University Press

Published: Jan 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial