Changes in hormone profiles, growth factors, and mRNA expression of the related receptors in crop tissue, relative organ weight, and serum biochemical parameters in the domestic pigeon (Columba livia) during incubation and chick-rearing periods under artificial farming conditions

Changes in hormone profiles, growth factors, and mRNA expression of the related receptors in crop... ABSTRACT The present study was conducted to determine the changes in concentrations of hormones and growth factors and their related receptor gene expressions in crop tissue, relative organ weight, and serum biochemical parameters in male and female pigeons during incubation and chick-rearing periods under artificial farming conditions. Seventy-eight pairs of 60-week-old White King pigeons with 2 fertile eggs per pair were randomly divided into 13 groups by different breeding stages. Serum prolactin and insulin-like growth factor-1 (IGF-1) concentrations in crop tissue homogenates were the highest in both male and female pigeons at 1 d of chick-rearing (R1), while epidermal growth factor (EGF) in female pigeons peaked at d 17 of incubation (I17) (P < 0.05). mRNA expression of the prolactin and EGF receptors in the crop tissue increased at the end of incubation and the early chick-rearing stage in both sexes. However, estrogen, progesterone, and growth hormone receptor expression each decreased during the early chick-rearing stage (P < 0.05). In male pigeons, IGF-1 receptor gene expression reached its peak at R7, while in female pigeons, it increased at the end of incubation. The relative weight of breast and abdominal fat in both sexes and thighs in the males was lowest at R7, and then gradually increased to the incubation period level. Serum total protein, albumin, and globulin concentrations increased to the highest levels at I17 (P < 0.05). Total cholesterol, triglyceride, and low-density lipoprotein reached their highest values at I17 in male pigeons and R25 in female pigeons (P < 0.05). In conclusion, hormones, growth factors, and their receptors potentially underlie pigeon crop tissue development. Changes in organs and serum biochemical profiles suggested their different breeding-cycle patterns with sexual effects. INTRODUCTION The avian crop plays a major role in food storage and moistening and provides a functional barrier for pathogens (Kierończyk et al., 2016), but in brooding pigeons, under prolactin stimulation, epithelial cells in the crop proliferate, accumulate nutrients via unclear mechanisms, and finally slough off to complete the “crop milk” formation (Horseman and Buntin, 1995; Gillespie et al., 2011). The prolactin receptor interacting with the hormone ligand in pigeon crop tissue has been examined by gene cloning and binding assays (Shani et al., 1981; Chen and Horseman, 1994). However, until now, prolactin seems to be the only factor directly affecting crop milk formation, feeding behaviors, and nest defense in pigeons during breeding stages (Horseman and Buntin, 1995; Mohamed et al., 2016). It remains unclear whether other factors are involved. In mammals, a complex network of endocrine and paracrine signaling, including various hormones, gonadal steroids, and cytokines, underlies mammary gland development (Filgo and Faqi, 2017). Therefore, more detailed information may be revealed by investigating other hormones or cytokines and their receptors in pigeon crops. Life-history theory indicates that individuals trade off current and future reproductive success (Stearns, 1992). Reproduction-induced changes in body weight or energy reserves suggest a cost to the animal itself (Gammonley, 1995; Neto and Gosler, 2010). Methods for balancing breeding efforts between males and females, and the energy required for survival, sustenance, and caring for offspring via the interactions between body condition and nutritional and environmental factors have always been difficult (Farner and Wingfield, 1980; Scanes et al., 1984). Domestic pigeons are monogamous, non-seasonal breeders, and are known for their biparental care of their eggs and young. Squabs have an impressive growth performance, nearly reaching adult body weight at 28 d (Gao et al., 2016). The body weight loss of parental pigeons under different nutritional manipulation strategies suggests that their reproduction is physiologically challenging (Xie et al., 2016). Animals’ phenotypic flexibility in organ size occurs in response to environmental factors or physiological states (Hammond et al., 2001; Bauchinger and Biebach, 2006). Previous studies on migrating birds showed that digestive organs hypertrophied while flight muscle atrophied to facilitate fueling (Piersma and Gill, 1998; Landys-Ciannelli, 2003). Organ changes in breeding birds are less studied than those in response to migration and molting, despite weight loss being common during reproduction (Gaston and Perin, 1993; Christians and Williams, 1999; Vézina and Williams, 2003). In addition, serum biochemical metabolites are important indicators of animals’ physiological states. Avian plasma chemistry studies have examined various aspects, including the influence of age (Gao et al., 2016), sex (Ferrer and Dobado-Berrios, 1998), nutrition (Chen et al., 2016), and circadian rhythms (García-Rodriguez et al., 1987); however, little information exists on the dynamic changes in organs and serum biochemical profiles of adult pigeons during different breeding cycle stages. Therefore, the objective of the present study was to determine the changes in concentrations of hormones, growth factors, and gene expression of their related receptors, organs, and serum biochemical parameters in male and female pigeons during incubation and chick rearing under artificial farming conditions. MATERIALS AND METHODS All procedures used in this study were approved by the Animal Care Committee of the Chinese Academy of Agricultural Sciences. Birds and Sample Collection A total of 156 (60 wk of age) adult White King pigeons (78 pairs of 78 males and 78 females each) was obtained from a commercial pigeon farm (Weitekai Pigeon Co., Ltd., Wuxi, China). All pairs were coupled when sexually mature, and chosen from a large flock (about 2,000 pairs). They all have a non-breeding phase between egg-laying and chick-rearing stages. Each pair of parent pigeons was housed in a manmade aviary equipped with a nest and perch. To avoid egg breakage, fertile eggs were hatched artificially, and plastic eggs were provided to maintain broodiness as described in the previous study (Xie et al., 2017). The time interval between the first and second egg production was about 44 hours. In order to keep in sync, 2 plastic eggs were put into cages only after the second egg was laid, and pigeon squabs hatched from the incubator were reared by parents after 18 d of incubation. Parent pigeons were fed a compound diet of 55% corn, 24.5% soybean meal (44.2% crude protein), 11% wheat, 1.2% dicalcium phosphate, 2% limestone, 0.25% salt, 0.5% vitamin and mineral premix, 2% soybean oil, 3.42% zeolite powder, 0.07% lysine, and 0.06% methionine (16.67% crude protein, 12.00 MJ/kg of metabolizable energy, 1.13% calcium, 0.34% available P, 0.89% lysine, and 0.31% methionine). The nutrient levels were recommended by pigeon producers in southern China and Xie et al. (2017). During the study, caged birds were housed in a room under a 16L:8D lighting cycle. The mean daily temperature was 23±4°C. Pellet feed, sand, and water were provided ad libitum. The parent pigeons were assigned randomly into 13 groups by different breeding stages, which included d 2 (I2), 4 (I4), 6 (I6), 10 (I10), 14 (I14), and 17 (I17) of the incubation period and d 1 (R1), 4 (R4), 7 (R7), 10 (R10), 15 (R15), 20 (R20), and 25 (R25) of the chick-rearing period. Pigeons were weighed, and blood was sampled by wing vein puncture before a 12-hour fasting. Serum was prepared by centrifugation at 1,500 × g for 20 min at 4°C and stored at –20°C for subsequent analysis. After blood sampling, all pigeons were euthanized by cervical dislocation. Crop tissues were quickly frozen in liquid nitrogen and stored at –80°C. Heart, liver, spleen, pancreas, proventriculus, gizzard, breast, thigh, abdominal fat, and kidney were weighed and the relative weights (RW) were calculated by expressing them as a percentage of the whole body weight. Eggs and baby squabs were transferred to a commercial pigeon farm to be cared for by other pigeons. ELISA Prolactin and gonadal steroid hormones in the serum were measured using commercial ELISA kits: Human Prolactin (PRL) ELISA Kit (Abcam Inc., Cambridge, MA), Estradiol (E2) Parameter Assay Kit (R&D Systems Inc., Minneapolis, Minnesota), and Progesterone (P) ELISA Kit (Sigma-Aldrich Corp., St. Louis, MO). Assays were conducted in duplicate. The minimal detectable dose and intra-assay coefficients of variation (CV) were 0.05 ng/mL and 6.8% for prolactin, 12.1 pg/mlL and 4.7% for E2, and 0.22 ng/mL and 5.2% for P, respectively. Absorbance at 450 nm was measured by microplate reader (SpectraMax M5, Molecular Devices, Sunnyvale, CA, USA). Concentrations of epidermal growth factor (EGF) and insulin-like growth factor-1 (IGF-1) were examined in the crop tissue. According to the method described by Bharathi et al. (1997), the crop was carefully excised as a whole and opened longitudinally, and rinsed in ice-cold saline to remove the contents and blotted dry. The middle part of the right lateral lobe was homogenized in 10 volumes of lysis buffer (KeyGEN, Nanjing, China) with an Ultra-Turrax (T8, IKA-Labortechnik, Staufen, Germany). The process was conducted on ice. The homogenate was centrifuged at 10,000 rpm for 10 min at 4°C, and the supernatant was pooled. EGF and IGF-1 were measured using the ELISA method (Boster Biological Technology, Wuhan, China) under 450 nm. The detection limit and intra-assay CV were 7.8 pg/mL and 5.9% for EGF, and 62.5 pg/mL and 7.2% for IGF-1. RNA Isolation and Real-time Quantitative PCR Total RNA was isolated from the crop tissue using the Trizol method. Briefly, the frozen middle part of the left lateral lobe was finely shattered in liquid nitrogen, and 0.1 gram of tissue powder was immediately transferred into 1.0 mL Trizol reagent. Then, 200 μL of chloroform were added, and the mixture was centrifuged at 12, 000 rpm for 10 min at 4°C. The aqueous phase was transferred into another tube. RNA was precipitated with isopropanol, washed with 75% ethanol, and finally resuspended in diethypyrocarbonate-treated H2O. Genomic DNA was eliminated using RNase-free DNase (TaKaRa, Dalian, China). RNA quality was examined by both native RNA electrophoresis and the UV absorbance ratio at 260 nm and 280 nm. cDNA was synthesized by M-MLV reverse transcriptase at 42°C for 60 min with oligo dT-Adaptor primer. The mRNA abundances of the prolactin receptor (PRLR), estrogen receptor (ER), progesterone receptor (PR), growth hormone receptor (GHR), insulin receptor (INSR), EGF receptor, and IGF-1 receptor were detected by real-time quantitative PCR (qRT-PCR). The qRT-PCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China) on an ABI StepOne Plus Real-Time PCR system (ABI7500, Carlsbad, CA). The 18S rRNA gene was used as the internal control. The PCR program was 95°C for 30 s, followed by 42 cycles of 95°C for 3 s, 60°C for 10 s, and 72°C for 30 seconds. Each sample was analyzed in triplicate. Melting curve analysis was used to verify amplification specificity. The relative expression quantity was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). The primers for the receptors and 18S are shown in Table 1. Table 1. Primers used in the present study.1 Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC 1PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor; EGF receptor = epidermal growth factor receptor; IGF-1 receptor = insulin-like growth factor (IGF)-1 receptor. 2F = forward; R = reverse. View Large Table 1. Primers used in the present study.1 Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC 1PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor; EGF receptor = epidermal growth factor receptor; IGF-1 receptor = insulin-like growth factor (IGF)-1 receptor. 2F = forward; R = reverse. View Large Biochemical Study The concentrations of serum total protein (TP), albumin (ALB), creatinine (CRE), urea nitrogen (UN), uric acid (UA), glucose (GLU), total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were analyzed by an automated system (7020 analyzer, Hitachi High-Technologies Co., Tokyo, Japan) with standard commercial kits following the protocols recommended by the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The serum globulin (GLB) concentration was calculated by subtracting the ALB concentration from the TP concentration. Statistical Analysis All data were presented as means ± SE. Data were statistically evaluated using SPSS 17.0 (SPSS Inc., Chicago, IL), and analyzed using the GLM procedure. The model included the main effects of sex, stage, and their interactions. Differences among breeding stages were estimated by Duncan post-hoc test. All of the statements of significance were based on P < 0.05. RESULTS PRL, E2, and P Different breeding stages significantly affected PRL and E2 concentrations in pigeon serum. PRL concentration ranged from 0.46 to 0.57 ng/mL and 0.29 to 0.47 ng/mL from I2 to I14 in male and female pigeons, respectively (Figure 1A). It rapidly reached the peak value (male: 2.29 ng/mL, female: 1.54 ng/mL) in both sexes at R1 (P < 0.05), and then gradually decreased to the base concentration after R15. In male pigeons, serum E2 concentration was higher at R10 (39.06 pg/mL) and R15 (46.87 pg/mL) (P < 0.05) (Figure 1B), but in female pigeons, it increased drastically after R15 (P < 0.05) (Figure 1B). In both male and female pigeons, the P concentration showed no changes during the incubation or chick-rearing period (P > 0.05) (Figure 1C). An interaction of sex × breeding stage for the concentrations of PRL (P = 0.014), E2 (P < 0.001), and P (P = 0.027) was observed in the study (Table 6). Figure 1. View largeDownload slide Concentrations of serum prolactin (A), estradiol (B), and progesterone (C) in male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-F) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 1. View largeDownload slide Concentrations of serum prolactin (A), estradiol (B), and progesterone (C) in male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-F) or lowercase letters (a-c) are significantly different (P < 0.05). Gene Expression of Hormone Receptors All hormone receptor genes (PRLR, ER, PR, GHR, and INSR) were expressed in the crop tissues of both male and female pigeons. They all varied significantly with stage and with the interaction of sex and stage (Table 6). mRNA expression of PRLR showed a similar pattern of change in both male and female pigeons, reaching peak values at I17 and I14, respectively (P < 0.05) (Figure 2A). ER gene expression was lower at R1 in both male and female pigeons (P < 0.05) (Figure 2B), and PR and GHR gene expression decreased during the incubation period (P < 0.05) (Figure 2C-D). PR mRNA reached the lowest level at R1 in both males and females, and at R4 for GHR. In male pigeons, no changes were found in INSR gene expression in male crop tissue during incubation or chick rearing (Figure 2E). In female pigeons, INSR gene expression reached a peak value at R4, and then decreased sharply during the late chick-rearing period (P < 0.05) (Figure 2E). Figure 2. View largeDownload slide mRNA expression profiles of prolactin receptor (A), estrogen receptor (B), progesterone receptor (C), growth hormone receptor (D), and insulin receptor (E) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-F) or lowercase letters (a-e) are significantly different (P < 0.05). Figure 2. View largeDownload slide mRNA expression profiles of prolactin receptor (A), estrogen receptor (B), progesterone receptor (C), growth hormone receptor (D), and insulin receptor (E) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-F) or lowercase letters (a-e) are significantly different (P < 0.05). EGF and IGF-1 EGF and IGF-1 concentrations in crop tissue homogenates showed similar change patterns in both male and female pigeons, and they changed significantly with sex, with stage, and their interaction (Table 7). Relatively higher levels of EGF were found in the late incubation period (after I14) and at the beginning of the chick-rearing period (before R7) (P < 0.05) (Figure 3). Peak values for EGF (male: 378.70 pg/mL) and IGF-1 concentrations (male: 5424.20 pg/mL, female: 5064.06 pg/mL) were reached at R1, except for EGF in females (349.84 pg/mL), which was at I17. Figure 3. View largeDownload slide Concentrations of epidermal growth factor (EGF) (A) and insulin-like growth factor-1 (IGF-1) (B) in crop tissue homogenates of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-G) or lowercase letters (a-e) are significantly different (P < 0.05). Figure 3. View largeDownload slide Concentrations of epidermal growth factor (EGF) (A) and insulin-like growth factor-1 (IGF-1) (B) in crop tissue homogenates of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-G) or lowercase letters (a-e) are significantly different (P < 0.05). EGF and IGF-1 Receptors mRNA abundance of the EGF receptor in crop tissue reached its highest value at I17 in male pigeons and at R1 in female pigeons (P < 0.05) (Figure 4A), and then decreased to the level at the start of incubation. In male pigeons, IGF-1 receptor gene expression was highest at R7, while in females, it increased significantly from I14 to I17 (P < 0.05) (Figure 4B). An interaction of sex and stage for the gene expression of the EGF receptor (P = 0.009) and IGF-1 receptor (P < 0.001) also was observed in the study (Table 6). Figure 4. View largeDownload slide mRNA expression profiles of epidermal growth factor (EGF) receptor (A) and insulin-like growth factor-1 (IGF-1) receptor (B) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-E) or lowercase letters (a-f) are significantly different (P < 0.05). Figure 4. View largeDownload slide mRNA expression profiles of epidermal growth factor (EGF) receptor (A) and insulin-like growth factor-1 (IGF-1) receptor (B) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-E) or lowercase letters (a-f) are significantly different (P < 0.05). Body Weight and Relative Organ Weight As shown in Figure 5, body weight of both male pigeons and female pigeons was the greatest at I17, and it decreased significantly at R15 in males and R7 in females (P < 0.05). Different incubation and chick-rearing stages did not affect the RW of the heart, liver, spleen, pancreas, or kidney (P > 0.05) (Figures 6A-D; 8B). In female pigeons, proventriculus RW was higher at R7 (P < 0.05) (Figure 7A), while gizzard RW decreased to the lowest at R1 (P < 0.05) (Figure 7B). Breast RW in both males and females and thigh RW in males were the lowest at R7, and then gradually increased to the incubation period level (P < 0.05) (Figure 7C-D). Thigh RW in females was lowest at I4 (P < 0.05) (Figure 7D), and it also was affected by the interaction of sex and stage (P = 0.016) (Table 8). Abdominal fat RW increased at I17, but sharply decreased at R7 and R1 in male and female pigeons, respectively (P < 0.05) (Figure 8A). Figure 5. View largeDownload slide Changes in body weight of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 5. View largeDownload slide Changes in body weight of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 6. View largeDownload slide Changes in relative weight of organs [heart (A), liver (B), spleen (C), and pancreas (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Figure 6. View largeDownload slide Changes in relative weight of organs [heart (A), liver (B), spleen (C), and pancreas (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Figure 7. View largeDownload slide Changes in relative weight of organs [proventriculus (A), gizzard (B), breast (C), and thigh (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-b) are significantly different (P < 0.05). Figure 7. View largeDownload slide Changes in relative weight of organs [proventriculus (A), gizzard (B), breast (C), and thigh (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-b) are significantly different (P < 0.05). Figure 8. View largeDownload slide Changes in relative weight of organs [abdominal (A) and kidney (B)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 8. View largeDownload slide Changes in relative weight of organs [abdominal (A) and kidney (B)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Serum Biochemical Parameters Serum TP, ALB, and GLB concentrations reached the highest value at I17 (P < 0.05), and then decreased to the lowest at R4 in both male and female pigeons (P < 0.05) (Table 2). CRE and UA concentrations were the highest at R7 in both sexes during the incubation and chick-rearing stages (P < 0.05) (Table 3). UN concentration in male pigeons increased after R15 (P < 0.05), whereas it was higher at R25 than at other stages in female pigeons (P < 0.05) (Table 3). In male pigeons, TC, TG, and LDL concentrations reached their highest values at I17 (P < 0.05), while they were highest at R25 in female pigeons (P < 0.05). HLD concentration peaked at R15 (P < 0.05) for males, and at I17 in females (P < 0.05) (Table 5). Concentrations of HDL and LDL also varied significantly with the interaction of sex and stage (Table 9). Different incubation and chick-rearing stages did not affect pigeon serum GLU concentration (P > 0.05) (Table 4). Table 2. Concentrations of serum total protein (TP), albumin (ALB), and globulin (GLB) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a 1Data are shown as means ± SEM; n = 6. 2TP = total protein; ALB = albumin; GLB = globulin. A–D, a–dMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 2. Concentrations of serum total protein (TP), albumin (ALB), and globulin (GLB) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a 1Data are shown as means ± SEM; n = 6. 2TP = total protein; ALB = albumin; GLB = globulin. A–D, a–dMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 3. Concentrations of serum creatinine (CRE), urea nitrogen (UN), and uric acid (UA) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b 1Data are shown as means ± SEM; n = 6. 2CRE = creatinine; UN = urea nitrogen; UA = uric acid. A–C, a–bMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 3. Concentrations of serum creatinine (CRE), urea nitrogen (UN), and uric acid (UA) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b 1Data are shown as means ± SEM; n = 6. 2CRE = creatinine; UN = urea nitrogen; UA = uric acid. A–C, a–bMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 4. Concentration of serum glucose (GLU) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 1Data are shown as means ± SEM; n = 6. 2GLU = glucose. View Large Table 4. Concentration of serum glucose (GLU) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 1Data are shown as means ± SEM; n = 6. 2GLU = glucose. View Large Table 5. Concentrations of serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a 1Data are shown as means ± SEM; n = 6. 2TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. A–C, a–cMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 5. Concentrations of serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a 1Data are shown as means ± SEM; n = 6. 2TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. A–C, a–cMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 6. P-values for the effects of sex, stage, and their interactions in concentrations of serum hormones and gene expression of the related receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 1PRL = prolactin; E2 = estradiol; P = progesterone. 2PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor. View Large Table 6. P-values for the effects of sex, stage, and their interactions in concentrations of serum hormones and gene expression of the related receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 1PRL = prolactin; E2 = estradiol; P = progesterone. 2PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor. View Large Table 7. P-values for the effects of sex, stage, and their interactions in concentrations of growth factors and gene expression of their receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 1EGF = epidermal growth factor; IGF-1 = insulin-like growth factor-1. 2EGF receptor = epidermal growth factor receptor; IGF-1 = insulin-like growth factor-1 receptor. View Large Table 7. P-values for the effects of sex, stage, and their interactions in concentrations of growth factors and gene expression of their receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 1EGF = epidermal growth factor; IGF-1 = insulin-like growth factor-1. 2EGF receptor = epidermal growth factor receptor; IGF-1 = insulin-like growth factor-1 receptor. View Large Table 8. P-values for the effects of sex, stage, and their interactions in body weight and relative weight of organs in male and female pigeons during incubation and chick-rearing period. Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 View Large Table 8. P-values for the effects of sex, stage, and their interactions in body weight and relative weight of organs in male and female pigeons during incubation and chick-rearing period. Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 View Large Table 9. P-values for the effects of sex, stage, and their interaction in serum biochemical parameters in male and female pigeons during incubation and chick-rearing period. Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 1TP = total protein; ALB = albumin; GLB = globulin; CRE = creatinine; UN = urea nitrogen; UA = uric acid; GLU = glucose; TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. View Large Table 9. P-values for the effects of sex, stage, and their interaction in serum biochemical parameters in male and female pigeons during incubation and chick-rearing period. Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 1TP = total protein; ALB = albumin; GLB = globulin; CRE = creatinine; UN = urea nitrogen; UA = uric acid; GLU = glucose; TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. View Large DISCUSSION Prolactin produced by the pituitary gland in pigeons has been shown to induce a marked epithelial hyperplasia of the crop tissue (Dumont, 1965; Horseman and Buntin, 1995), leading to “milk” formation, which includes lipid (Horseman and Will, 1984; Gillespie et al., 2013) and protein synthesis (Hu et al., 2016) during the brooding period. To support crop milk feeding, a complex array of behavioral adaptations (parental hyperphagia and feeding activity) is triggered by high levels of prolactin secretion (Foreman et al., 1990; Hnasko and Buntin, 1993). In the present study, prolactin increased at the end of the incubation period, and peaked at the beginning of the chick-rearing period, which was consistent with the previous study (Horseman and Buntin, 1995). Crop sac development was directly followed by increased prolactin levels (Goldsmith et al., 1981; Horseman, 1987), and its weight and thickness remained higher during the first wk of lactation (Hu et al., 2016). Vandeputte-Poma (1980) reported that pure pigeon milk constituted only 50% of crop content at 12 d after squab hatching and is replaced by full grains at the end of chick rearing. In the present study, the serum prolactin level gradually decreased to the base concentration after R15. This fluctuation was well conformed to the regular changes in physiological structure of crop tissue and pigeon milk formation. In an early study, gonadectomy appeared to have no adverse effects on crop milk production, indicating that gonadal steroids may be not involved in crop development and stimulation (Schooley et al., 1941). In mammals, estradiol and progesterone also play important roles in mammary gland development, including gland lobuloalveolar growth, ductal enlongation and differentiation, and cell proliferation (Stingl, 2011). However, relatively lower estradiol levels in pigeons during incubation and at the beginning of chick rearing were found in the present study. It may be caused by higher prolactin levels, which induced ovarian regression (Dawson, 2006). In addition, adopting chicks also leads to decreased gonadal steroid secretion (Leboucher et al., 1990). Estradiol synthesized by stroma and the theca layer of white non-hierarchical and yellow hierarchical follicles is essential for nutrient accumulation during egg formation (Bahr et al., 1983; Williams et al., 2004; Wistedt et al., 2014). Serum estrogen levels in female pigeons increase during the egg-laying period (Dong et al., 2013). Higher concentration of serum estradiol in female pigeons after R15 in the present study may be explained by the relatively longer breeding cycle needing a slower follicle development due to a continued hormone effect. However, estradiol's function in male pigeons during chick rearing remains unclear. Our data showed that the changing pattern of PRLR gene expression coincided with prolactin fluctuation in both male and female pigeons. The prolactin receptor belongs to the class I cytokine receptor superfamily and is considered as a candidate gene for broodiness (Dunn et al., 1998). We found it at higher concentrations in late incubation and at the beginning of chick rearing. PRLR modulates prolactin-inducible signal transmitting (Vleck et al., 2000), and prolactin can increase the receptor content in the pigeon crop sac (Shani et al., 1981), possibly because it increases activity of PRLR promoter via the STAT5 pathway found in mammals (Welte et al., 1994). Although both ER and PR can be directly regulated by the corresponding hormone ligands via distinctive membrane signaling (Dominguez and Micevych, 2011; Sivik and Jansson, 2012), changing gene expression patterns in pigeon crop tissue were incompatible with the circulating hormone fluctuation during the breeding period, indicating that other factors may be involved in this regulation. The PR gene contains an Sp1 site and could confer estrogen responsiveness to a heterologous promoter in an estrogen receptor-dependent manner (Schultz et al., 2003). The correlation between ER and RP gene expression probably also exists in the pigeon crop. Compared to ER and PR, the similar changing pattern of GHR gene expression in crop tissue also made it likely unnecessary in crop-stimulating growth. This study raised the new question of whether prolactin negatively affects gene expressions of ER, PR, and GHR in pigeon crops. In addition, the irregular change in INSR gene expression only in female pigeon crops showed its potential involvement in crop milk formation or other physiological processes. Both EGF and IGF-1 concentrations in crop milk decreased during chick rearing in a previous study (Xie et al., 2013), which was similar to the results for the crop tissue in the current study. It suggested that EGF and IGF-1 in crop milk and crop tissue probably have the same origination. Milk secreted by mammals contains higher EGF and IGF-1 concentrations, and both subsequently decreased in the later period of lactation (Donovan et al., 1994; Xu, 1996). The changing pattern of 2 growth factors was found to coincide with crop weight and thickness changes, as reported by Hu et al (2016). This result indirectly verified the early hypothesis that crop cell proliferation might be brought about by the synergistic action of prolactin and growth factors (Anderson et al., 1987), which can accumulate in the tissue during brooding (Bharathi et al., 1993). Generally, a final cellular outcome can be governed by input from several factors, because the combined effect of cellular inputs may be more than their individual effects due to synergistic action (Crouch et al., 2000). Growth factors such as IGF-1 and EGF play important roles in multiple cellular responses, including DNA synthesis, nutrient accumulation, and mitogenesis (Thomas et al., 1982; Adams and Haddad, 1996; Deleu et al., 1999; Berfield et al., 2002; Mau et al., 2008). The authors speculated they were also potentially involved in crop tissue hyperplasia and milk formation via their receptors. In addition, IGF-1 stimulates insulin-like action, and the overlap in action is due to the high homology between the INSR and the IGF-1 receptor, initiating the intracellular signaling pathway via similar cascades (Taniguchi et al., 2006). A nearly 4-fold increase in insulin levels was found in lactating pigeons, although it did not distinguish the parental sex (Hu et al., 2016), and insulin also enhanced the gene expression of the IGF-1 receptor and effectively induced EGF receptor accumulation on the actin arc of cells (Crouch et al., 2000; Hunter and Hers, 2009). Seasonal variations, reproductive cycle, and sex-related differences in body weight and organ dynamics are well-documented in water fowls, passerines, or some species of wild migratory birds in the wild (Ankney and MacInnes, 1978; Gammonley, 1995; Woodburn and Perrins, 1997; Badzinski et al., 2011; Jacobs et al., 2011), but similar studies in pigeons are few, especially under artificial caged farming conditions. We hypothesized that pigeons allocate energy resources for the most demanding period of the reproductive cycle through phenotypic flexibility in body weight and organ size. In female blue tits, body reserves increased after clutch completion, and were mobilized during the first 5 d of the nestling period, which showed a decrease in whole body weight (Woodburn and Perrins, 1997). Lower body weights in male and female pigeons during the chick-rearing period observed in the present study were probably due to both parents giving the contributions of caring for offspring. Lean dry weight and fat content of the digestive system in female blue tits also was found to be decreased during the beginning of the nestling period (Woodburn and Perrins, 1997), but no significant changes in gizzard or intestine weight during the reproductive cycle were reported in ruddy ducks (Tome, 1984). In the present study, the proventriculus RW increased at R7 and gizzard RW decreased at R1 in female pigeons, but no changes in these 2 organs were found in males, indicating that sex and potential species differences existed. Breast muscle is a key factor for flight performance, and it also functions as a nutrient reserve that can be used during the reproductive cycle (Kullberg et al., 2002). However, no evidence of incubation negatively affecting bird's body condition was found, and energy reserves increased during this period, such as in Savi's Warblers, although the female did most of the incubating (Neto and Gosler, 2010). Similar results for thigh RW in female pigeons were found in our experiment. As in other studies, breast muscle in bird species decreased in weight during chick rearing (Woodburn and Perrins, 1997; Neto and Gosler, 2010), which was almost entirely due to protein (Jones, 1991) and lipid loss (Jacobs et al., 2011). This phenomenon also was observed in the present study, and in passerines, the decline in muscle during the breeding season was even greater in females than in males (Gosler, 1991). The author speculated that both male and female parent pigeons probably incurred physiological stress when caring for offspring, but the relative contributions of the 2 sexes, as well as the mechanism involved, remain unclear. Our study found dramatic changes in abdominal fat RW, especially in female pigeons within only a few d (from I17 to R1). It was reported that body fat content can change rapidly in birds, for instance, during the d and as an adaptation to predation risk (Gosler, 1996). The decline in organ RW in parent pigeons mostly occurred before R15 in the present study. These results verified the hypothesis that the first half of the nestling period may be more demanding because the parents have to brood and feed the nestlings simultaneously, having little time to feed themselves (Sanz and Moreno, 1995; Moe et al., 2002). During the second half of the nestling period, parent pigeons do not need to remain in the nest as long, and the food received by the squabs changes from crop milk to whole grains (Vanderputte-poma, 1980; Horseman and Buntin, 1995). This suggested that the physiological stress of the parent pigeons was alleviated after R15. Blood metabolites, such as glucose, protein, albumin, and TG, are indicative of nutritional status in general (Junghanns and Coles, 2008). In the present study, continuous increases in serum TP, ALB, and GLB in both male and female pigeons during incubation are attributed to strengthening of the metabolism by protein synthesis. ALB is a carrier protein for many hormones and metal ions (Refetoff et al., 1970; Cookson et al., 1988). Prolactin induces serum albumin translation (Baruch et al., 1998), and the maximum ALB value parallels with the peak prolactin level during the terminal incubation phase in pigeons reported by Gayathri and Hegde (2006). In addition, squab pigeons obtain the immunoglobulins, mainly IgA and IgG, through crop milk from parental transfer (Jacquin et al., 2012). However, with crop tissue regression during the second half of the chick-rearing period, squabs were gradually fed by full grains, and this may be why the trend of recovered serum protein indices occurred. Creatinine, a byproduct of phosphocreatine breakdown in skeletal muscle, is another important indicator of protein metabolism (Piotrowska et al., 2011). We speculated that the increased serum creatinine value probably correlated with breast and thigh muscle decomposition, which showed a lower RW at R7 in the present study. UA and UN come mainly from digestion, the breakdown products of the digestive tract, and the metabolites released from tissue cells (Wang et al., 2009). Their changes can reflect the efficiency of amino acid use throughout the body (Donsbough et al., 2010). Casado et al. (2002) found that nestling brooding eagles had higher plasma UA and UN concentrations than non-brooding ones, which was consistent with our results. We speculated that physiological stresses brought on by feeding squabs may incur the 2 increased parameters with muscle tissue decomposition. Serum levels of TG, TC, LDL, and HDL are used to measure serum lipid levels (Chou et al., 2012). Our data showed that serum concentrations of TC, TG, and LDL were lower in both male and female pigeons at the beginning of chick rearing, which may be due to lipid formation in crop milk with the decrease of abdominal fat RW simultaneously. However, the time needed to reach the higher values of these parameters differed between males and females, indicating that potential differences in lipid metabolism existed between the two sexes, as sexual dimorphism in the plasma lipid profile established in mammals (Wang et al., 2011). The higher values of serum TC, TG, and LDL detected in female pigeons during the terminal phase of chick rearing was probably due to the continuously increasing estradiol level. This phenomenon has already been shown in female mammals (Ferreri and Naito, 1978; Cinci et al., 2000; Mady, 2000). CONCLUSIONS Prolactin, EGF, and IGF-1 concentrations, as well as gene expression of their receptors in pigeon crop tissues changed dynamically during the breeding cycle, and these factors potentially underlie crop tissue development with a combined effect. The RW of breast muscle, thigh muscle, and abdominal fat declined significantly during chick rearing, which may function as a nutrient reserve for later use. Serum biochemical profiles detected in the present study showed that protein and lipid metabolism-related parameters in adult pigeons varied significantly during incubation and chick rearing with sexual effects. ACKNOWLEDGMENTS The authors thank all the members in the School and Institute for their generous technical advice. This research was supported by National Natural Funds of China (No. 31501974) and National Natural Science Foundation of Jiangsu Province (BK20150462). REFERENCES Adams G. R. , Haddad F. . 1996 . The relationships among IGF-1, DNA content, and protein accumulation during skeletal muscle hypertrophy . J. Appl. Physiol . 81 : 2509 – 2516 . Google Scholar CrossRef Search ADS PubMed Anderson T. R. , Mayer G. L , Hebert N. , Nicoll C. S. . 1987 . Interactions among prolactin, epidermal growth factor, and proinsulin on the growth and morphology of the pigeon crop-sac mucosal epithelium in vivo . Endocrinology . 120 : 1258 – 1264 . Google Scholar CrossRef Search ADS PubMed Ankney C. D. , Macinnes C. D. . 1978 . Nutrient reserves and reproductive performance of female lesser snow geese . Auk . 95 : 459 – 471 . Badzinski S. S. , Kennedy L. , Petrie S. A. , Schummer M. L. . 2011 . Variation in body composition and digestive organs of tundra swans during migration at long point, Lake Erie, Ontario , Waterbirds 34 : 468 – 475 . Google Scholar CrossRef Search ADS Bahr J. M. , Wang S. C. , Huang M. Y. , Calvo F. O. . 1983 . Steroid concentrations in isolated theca and granulosa layers of preovulatory follicles during the ovulatory cycle of the domestic hen . Biol. Reprod . 29 : 326 – 334 . Google Scholar CrossRef Search ADS PubMed Baruch A. , Shani M. , Barash I. . 1997 . Insulin and prolactin synergize to induce translation of human serum albumin in the mammary gland of transgenic mice . Transgenic Res . 7 : 15 – 27 . Google Scholar CrossRef Search ADS Bauchinger U. , Biebach H. . 2006 . Transition between moult and migration in a long-distance migratory passerine: organ flexibility in the African wintering area . J Ornithol . 147 : 266 – 273 . Google Scholar CrossRef Search ADS Berfield A. K. , Andress D. L. , Abrass C. K. . 2002 . IGF-1-induced lipid accumulation impairs mesangial cell migration and contractile function . Kidney Int . 62 : 1229 – 1237 . Google Scholar CrossRef Search ADS PubMed Bharathi L. , Shenoy K. B. , Mojamdar M. , Hegde S. N. . 1993 . Studies on the growth-stimulatory activity of pigeon milk-comparison and synergistic effects with serum . J. Comp. Physiol. B . 163 : 332 – 336 . Google Scholar CrossRef Search ADS PubMed Bharathi L. , Shenoy K. B. , Hegde S. N. . 1997 . Biochemical differences between crop tissue and crop milk of pigeons (Columba livia) . Comparative Biochemistry and Physiology Part A: Physiology . 116 : 51 – 55 . Google Scholar CrossRef Search ADS Casado E. , Balbontin J. , Ferrer M. . 2002 . Plasma chemistry in booted eagle (Hieraaetus pennatus) during breeding season . Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology . 131 : 233 – 241 . Google Scholar CrossRef Search ADS Chen X. , Horseman N. D. . 1994 . Cloning, expression, and mutational analysis of the pigeon prolactin receptor . Endocrinology 135 : 269 – 276 . Google Scholar CrossRef Search ADS PubMed Chen X. , Naehrer K. , Applegate T. J. . 2016 . Interactive effects of dietary protein concentration and aflatoxin B1 on performance, nutrient digestibility, and gut health in broiler chicks . Poult. Sci. 95 : 1312 – 1325 . Google Scholar CrossRef Search ADS PubMed Christians J. K. , Williams T. D. . 1999 . Organ mass dynamics in relation to yolk precursor production and egg formation in european starlings sturnus vulgaris . Physiol. Biochem. Zool. 72 : 455 – 461 . Google Scholar CrossRef Search ADS PubMed Chou C. H. , Chang Y. Y. , Tzang B. S. , Hsu C. L. , Lin Y. L. , Lin H. W. , Chen Y. C. . 2012 . Effects of taurine on hepatic lipid metabolism and anti-inflammation in chronic alcohol-fed rats . Food Chem . 135 : 24 – 30 . Google Scholar CrossRef Search ADS Cinci G. , Guerranti R. , Pagani R. , Carlucci F. , Terzuoli L. , Rosi F. , Marinello E. . 2000 . Fatty acid composition of phospholipids, triglycerides and cholesterol in serum of castrated and estradiol treated rats . Life Sci . 66 : 1647 – 1654 . Google Scholar CrossRef Search ADS PubMed Cookson E. J. , Hall M. R. , Glover J. . 1988 . The transport of plasma thyroxine in White storks (Ciconia ciconia) and the association of high levels of plasma transthyretin (thyroxine-binding prealbumin) with moult . J. Endocrinol . 117 : 75 – 84 . Google Scholar CrossRef Search ADS PubMed Crouch M. F. , Davy D. A. , Willard F. S. , Berven L. A. . 2000 . Insulin induces epidermal growth factor (EGF) receptor clustering and potentiates EGF-stimulated DNA synthesis in Swiss 3T3 cells: A mechanism for costimulation in mitogenic synergy . Immunol Cell Biol . 78 : 408 – 414 . Google Scholar CrossRef Search ADS PubMed Dawson A. 2006 . Control of molt in birds: Association with prolactin and gonadal regression in starlings . Gen. Comp. Endocrinol . 147 : 314 – 322 . Google Scholar CrossRef Search ADS PubMed Deleu S. , Pirson I. , Coulonval K. , Drouin A. , Taton M. , Clermont F. , Roger P. P. , Nakamura T. , Dumont J. E. , Maenhaut C. . 1999 . IGF-1 or insulin, and the TSH cyclic AMP cascade separately control dog and human thyroid cell growth and DNA synthesis, and complement each other in inducing mitogenesis . Mol. Cell. Endocrinol . 149 : 41 – 51 . Google Scholar CrossRef Search ADS PubMed Dominguez R. , Micevych P. . 2010 . Estradiol rapidly regulates membrane ERα levels in hypothalamic neurons . J. Neurosci . 30 : 12589 – 12596 . Google Scholar CrossRef Search ADS PubMed Dong X. Y. , Zhang M. , Jia Y. X. , Zou X. T. . 2013 . Physiological and hormonal aspects in female domestic pigeons (Columba livia) associated with breeding stage and experience . J. Anim. Physiol. An. N. 97 : 861 – 867 . Donovan S. M. , McNeil L. K. , Jiménez-Flores R. , Odle J. . 1994 . Insulin-like growth factors and insulin-like growth factor binding proteins in porcine serum and milk throughout lactation . Pediatr Res 36 : 159 – 168 . Google Scholar CrossRef Search ADS PubMed Donsbough A. L. , Powell S. , Waguespack A. , Bidner T. D. , Southern L. L. . 2010 . Uric acid, urea, and ammonia concentrations in serum and uric acid concentration in excreta as indicators of amino acid utilization in diets for broilers . Poult. Sci. 89 : 287 – 294 . Google Scholar CrossRef Search ADS PubMed Dumont J. N. 1965 . Prolactin-induced cytologic changes in the mucosa of the pigeon crop during crop-“milk” formation . Z. Zellforsch. Mikrosk. 68 : 755 – 782 . Google Scholar CrossRef Search ADS Dunn I. C. , Mcewan G. , Okhubo T. , Sharp P. J. , Paton I. R. , Burt D. W. . 1998 . Genetic mapping of the chicken prolactin receptor gene: a candidate gene for the control of broodiness . Br. Poult. Sci. 39 : 23 – 24 . Google Scholar CrossRef Search ADS Farner D. S. , Wingfield J. C. . 1980 . Reproductive endocrinology of birds . Annu. Rev. Physiol. 42 : 457 – 472 Google Scholar CrossRef Search ADS PubMed Ferreri L. F. , Naito H. K. . 1978 . Effect of estrogens on rat serum cholesterol concentrations: Consideration of dose, type of estrogen, and treatment duration . Endocrinology . 102 : 1621 – 1627 . Google Scholar CrossRef Search ADS PubMed Ferrer M. , Dobado-Berrios P. . 1998 . Factors affecting plasma chemistry values of the Spanish Imperial Eagle, Aquila adalberti . Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology . 120 : 209 – 217 . Google Scholar CrossRef Search ADS Filgo A. J. , Faqi A. S. . 2017 . Effects of chemicals on mammary gland development . Pages 205 – 234 in Developmental and Reproductive Toxicology . Springer , New York . Google Scholar CrossRef Search ADS Foreman K. T. , Lea R. W. , Buntin J. P. . 1990 . Changes in feeding activity, plasma luteinizing hormone, and testes weight in ring doves following hypothalamic injections of prolactin . J. Neuroendocrinol . 2 : 667 – 673 . Google Scholar CrossRef Search ADS PubMed Gammonley J. H. 1995 . Nutrient reserve and organ dynamics of breeding Cinnamon Teal . The Condor . 97 : 985 – 992 . Google Scholar CrossRef Search ADS Gao C. Q. , Yang J. X. , Chen M. X. , Yan H. C. , Wang X. Q. . 2016 . Growth curves and age-related changes in carcass characteristics, organs, serum parameters, and intestinal transporter gene expression in domestic pigeon (Columba livia) . Poult. Sci . 95 : 867 – 877 . Google Scholar CrossRef Search ADS PubMed García-Rodriguez T. , Ferrer M. , Recio J. C. , Castroviejo J. . 1987 . Circadian rhythms of determined blood chemistry values in buzzards and eagle owls . Comparative Biochemistry and Physiology Part A: Physiology . 88 : 663 – 669 . Google Scholar CrossRef Search ADS Gaston A. J. , Perin S. . 1993 . Loss of mass in breeding Brunnich's Guillemots Uria lomvia is triggered by hatching . Ibis . 135 : 472 – 475 . Google Scholar CrossRef Search ADS Gayathri K. L. , Hegde S. N. . 2006 . Alteration in haematocrit values and plasma protein fractions during the breeding cycle of female pigeons, Columba livia . Anim. Reprod. Sci. 91 : 133 – 141 . Google Scholar CrossRef Search ADS PubMed Gillespie M. J. , Haring V. R. , McColl K. A. , Monaghan P. , Donald J. A. , Nicholas K. R. , Moore R. J. , Crowley T. M. . 2011 . Histological and global gene expression analysis of the 'lactating' pigeon crop . BMC Genomics . 12 : 452 – 461 . Google Scholar CrossRef Search ADS PubMed Gillespie M. J. , Crowley T. M. , Haring V. R. , Wilson S. L. , Harper J. A. , Payne J. S. , Green D. , Monaghan P. , Donald J. A. , Nicholas K. R. , Moore R. J. . 2013 . Transcriptome analysis of pigeon milk production - Role of cornification and triglyceride synthesis genes . BMC Genomics . 14 : 169 – 181 . Google Scholar CrossRef Search ADS PubMed Goldsmith A. R. , Edwards C. , Koprucu M. , Silver R. . 1981 . Concentrations of prolactin and luteinizing hormone in plasma of doves in relation to incubation and development of the crop gland . J. Endocrinol . 90 : 437 – 443 . Google Scholar CrossRef Search ADS PubMed Gosler A. G. 1991 . On the use of greater covert moult and pectoral muscle as measures of condition in passerines with data for the Great Tit Parus major . Bird Study . 38 : 1 – 9 . Google Scholar CrossRef Search ADS Gosler A. G. 1996 . Environmental and social determinants of winter fat storage in the great tit Parus major . J. Anim. Ecol. 65 : 1 – 17 . Google Scholar CrossRef Search ADS Hammond K. A. , Szewczak J. , Król E. . 2001 . Effects of altitude and temperature on organ phenotypic plasticity along an altitudinal gradient . J. Exp. Biol . 204 : 1991 – 2000 . Google Scholar PubMed Hnasko R. M. , Buntin J. D. . 1993 . Functional mapping of neural sites mediating prolactin-induced hyperphagia in doves . Brain Res . 623 : 257 – 266 . Google Scholar CrossRef Search ADS PubMed Horseman N. D. , Will C. L. . 1984 . Characterization of lipid storage associated proteins induced in crop tissue by prolactin . J. Comp. Physiol. B . 154 : 237 – 242 . Google Scholar CrossRef Search ADS Horseman N. D. 1987 . Models of prolactin action in nonmammalian vertebrates . Pages 41 – 67 in Actions of Prolactin on Molecular Processes , ed. Rillema J. A. , Boca Raton, FL : CRC . Horseman N. D. , Buntin J. D. . 1995 . Regulation of pigeon cropmilk secretion and parental behaviors by prolactin . Annu. Rev. Nutr. 15 : 213 – 238 . Google Scholar CrossRef Search ADS PubMed Hu X. C. , Gao C. Q. , Wang X. H. , Yan H. C. , Chen Z. S. , Wang X. Q. . 2016 . Crop milk protein is synthesised following activation of the IRS1/Akt/TOR signalling pathway in the domestic pigeon (Columba livia) . Br. Poult. Sci. 57 : 855 – 862 . Google Scholar CrossRef Search ADS PubMed Hunter R. W. , Hers I. . 2009 . Insulin/IGF-1 hybrid receptor expression on human platelets: Consequences for the effect of insulin on platelet function . J. Thromb. Haemost . 7 : 2123 – 2130 . Google Scholar CrossRef Search ADS PubMed Jacobs S. R. , Edwards D. B. , Ringrose J. , Elliott K. H. , Weber J. M. , Gaston A. J. . 2011 . Changes in body composition during breeding: reproductive strategies of three species of seabirds under poor environmental conditions . Comp. Biochem. Physiol. B Biochem. Mol. Biol. 158 : 77 – 82 . Google Scholar CrossRef Search ADS PubMed Jacquin L. , Blottière L. , Haussy C. , Perret S. , Gasparini J. . 2012 . Prenatal and postnatal parental effects on immunity and growth in ‘lactating’ pigeons . Funct. Ecol . 26 : 866 – 875 . Google Scholar CrossRef Search ADS Jones M. M. 1991 . Muscle protein loss in laying House Sparrows Passer domesticus . Ibis . 133 : 193 – 198 . Google Scholar CrossRef Search ADS Junghanns M. K. , Coles B. H. . 2008 . Aids to diagnosis . Pages 56 – 102 in Essentials of Avian Medicine and Surgery . Black well Publishing Ltd : Oxford, UK . Google Scholar CrossRef Search ADS Kierończyk B. , Rawski M. , Długosz J. , Świątkiewicz S. , Józefiak D. . 2016 . Avian crop function - A review . Ann. Anim. Sci . 16 : 653 – 678 . Google Scholar CrossRef Search ADS Kullberg C. , Houston D. C. , Metcalfe N. B. . 2002 . Impaired flight ability–A cost of reproduction in female blue tits . Behav. Ecol. 13 : 575 – 579 . Google Scholar CrossRef Search ADS Landys-Ciannelli M. M. , Piersma T. , Jukema J. . 2003 . Strategic size changes of internal organs and muscle tissue in the Bar-tailed Godwit during fat storage on a spring stopover site . Funct Ecology . 17 : 151 – 159 . Google Scholar CrossRef Search ADS Leboucher G. , Richard-Yris M. A. , Williams J. , Chadwick A. . 1990 . Incubation and maternal behaviour in domestic hens: Influence of the presence of chicks on circulating luteinising hormone, prolactin and oestradiol and on behaviour . Br. Poult. Sci . 31 : 851 – 862 . Google Scholar CrossRef Search ADS PubMed Livak K. J. , Schmittgen T. D. . 2001 . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method . Methods . 25 : 402 – 408 . Mady E. A. 2000 . Association between estradiol, estrogen receptors, total lipids, triglycerides, and cholesterol in patients with benign and malignant breast tumors . J. Steroid Biochem. Mol. Biol . 75 : 323 – 328 . Google Scholar CrossRef Search ADS PubMed Mau M. , Kalbe C. , Wollenhaupt K. , Nürnberg G. , Rehfeldt C. . 2008 . IGF-I- and EGF-dependent DNA synthesis of porcine myoblasts is influenced by the dietary isoflavones genistein and daidzein . Domest. Anim. Endocrinol . 35 : 281 – 289 . Google Scholar CrossRef Search ADS PubMed Moe B. , Langseth I. , Fyhn M. , Gabrielsen G. W. , Bech C. . 2002 . Changes in body condition in breeding kittiwakes Rissa tridactyla . Journal of Avian Biology . 33 : 225 – 234 . Google Scholar CrossRef Search ADS Mohamed R. A. , Shukry M. , Mousa-Balabel T. M. , Elbassiouny A. A. . 2016 . Assessment of plasma prolactin and nest defense behaviour during breeding cycle of pigeon (Columba livia domestica) . Journal of Environmental and Agricultural Sciences . 7 : 19 – 22 . Neto J. M. , Gosler A. G. . 2010 . Variation in body condition of breeding Savi's Warblers Locustella luscinioides: The reproductive stress and flight adaptation hypothesis revisited . J. Ornithol . 151 : 201 – 210 . Google Scholar CrossRef Search ADS Piersma T. , Gill R. E. Jr . 1998 . Guts don’t fly: Small digestive organs in obese Bar-Tailed Godwits . The Auk 115 : 196 – 203 . Google Scholar CrossRef Search ADS Piotrowska A. , Burlikowska K. , Szymeczko R. . 2011 . Changes in blood chemistry in broiler chickens during the fattening period . folia biol (krakow) . 59 : 183 – 187 . Google Scholar CrossRef Search ADS PubMed Refetoff S. , Robin N. I. , Fang V. S. . 1970 . Parameters of thyroid function in serum of 16 selected vertebrate species: A study of PBI, serum T4, free T4, and the pattern of T4 and T3 binding to serum proteins . Endocrinology . 86 : 793 – 805 . Google Scholar CrossRef Search ADS PubMed Sanz J. J. , Moreno J. . 1995 . Mass loss in brooding female pied flycatchers Ficedula hypoleuca: No evidence for reproductive stress . Journal of Avian Biology . 26 : 313 – 320 . Google Scholar CrossRef Search ADS Scanes C. G. , Harvey S. , Marsh J. A. , King D. B. . 1984 . Hormones and growth in poultry . Poult. Sci . 63 : 2062 – 2074 . Google Scholar CrossRef Search ADS PubMed Schooley J. P. , Riddle O. , Bates R. W. . 1941 . Replacement therapy in hypophysectomized juvenile pigeons . Dev. Dynam. 69 : 123 – 157 . Schultz J. R. , Petz L. N. , Nardulli A. M. . 2003 . Estrogen receptor alpha and Sp1 regulate progesterone receptor gene expression . Mol. Cell. Endocrinol . 201 : 165 – 175 . Google Scholar CrossRef Search ADS PubMed Shani J. , Barkey R. J. , Amit T. . 1981 . Endogenous prolactin maintains its own binding sites in the pigeon crop sac mucosa . J. Recept. Res. 2 : 407 – 417 . Google Scholar CrossRef Search ADS PubMed Sivik T. , Jansson A. . 2012 . Progesterone and levonorgestrel regulate expression of 17βHSD-enzymes in progesterone receptor positive breast cancer cell line T47D . Biochem. Biophys. Res. Commun . 422 : 109 – 113 . Google Scholar CrossRef Search ADS PubMed Stearns S. C. 1992 . The evolution of life histories . Q. Rev. Biol. 123 : 835 – 839 . Stingl J. 2011 . Estrogen and progesterone in normal mammary gland development and in cancer . HORM CANC 2 : 85 – 90 . Google Scholar CrossRef Search ADS Taniguchi C. M. , Emanuelli B. , Kahn C. R. . 2006 . Critical nodes in signalling pathways: Insights into insulin action . Nat. Rev. Mol. Cell Biol . 7 : 85 – 96 . Google Scholar CrossRef Search ADS PubMed Thomas G. , Martin-Perez J. , Siegmann M. , Otto A. M. . 1982 . The effect of serum, EGF, PGF2 alpha and insulin on S6 phosphorylation and the initiation of protein and DNA synthesis . Cell . 30 : 235 – 242 . Google Scholar CrossRef Search ADS PubMed Tome M. W. 1984 . Changes in nutrient reserves and organ size of female ruddy ducks breeding in manitoba . The Auk 101 : 830 – 837 . Google Scholar CrossRef Search ADS Vandeputte-poma J. 1980 . Feeding, growth and metabolism of the pigeon, Columba livia domestica: Duration and role of crop milk feeding . J. Comp. Physiol. B . 135 : 97 – 99 . Google Scholar CrossRef Search ADS Vézina F. , Williams T. D. . 2003 . Plasticity in body composition in breeding birds: What drives the metabolic costs of egg production? Physiol. Biochem. Zool . 76 : 716 – 730 . Google Scholar CrossRef Search ADS PubMed Vleck C. M. , Ross L. L. , Vleck D. , Bucher T. L. . 2000 . Prolactin and parental behavior in Adélie penguins: Effects of absence from nest, incubation length, and nest failure . Horm. Behav. 38 : 149 – 158 . Google Scholar CrossRef Search ADS PubMed Wang J. P. , Yoo J. S. , Kim H. J. , Lee J. H. , Kim I. H. . 2009 . Nutrient digestibility, blood profiles and fecal microbiota are influenced by chitooligosaccharide supplementation of growing pigs . Livestock Sci . 125 : 298 – 303 . Google Scholar CrossRef Search ADS Wang X. , Magkos F. , Mittendorfer B. . 2011 . Sex differences in lipid and lipoprotein metabolism: It's not just about sex hormones . The Journal of Clinical Endocrinology & Metabolism 96 : 885 – 893 . Google Scholar CrossRef Search ADS Welte T. , Garimorth K. , Philipp S. , Doppler W. . 1994 . Prolactin-dependent acti vation of a tyrosine phosphorylated DNA binding factor in mouse mammary epithelial cells . Mol. Endocrinol . 8 : 1091 – 1102 . Google Scholar PubMed Williams T. D. , Kitaysky A. S. , Vézina F. . 2004 . Individual variation in plasma estradiol-17β and androgen levels during egg formation in the European starling Sturnus vulgaris: Implications for regulation of yolk steroids . Gen. Comp. Endocrinol . 136 : 346 – 352 . Google Scholar CrossRef Search ADS PubMed Wistedt A. , Ridderstråle Y. , Wall H. , Holm L. . 2014 . Exogenous estradiol improves shell strength in laying hens at the end of the laying period . Acta Vet Scand . 56 : 34 – 44 . Google Scholar CrossRef Search ADS PubMed Woodburn R. J. W. , Perrins C. M. . 1997 . Weight change and the body reserves of female blue tits, Parus caeruleus, during the breeding season . J. Zool. Lond . 243 : 789 – 802 . Google Scholar CrossRef Search ADS Xie P. , Fu S. Y. , Bu Z. , Tong H. B. , Zou J. M. . 2013 . Effects of age and parental sex on digestive enzymes, growth factors, and immunoglobulin of pigeon squab . J. Anim. Vet. Adv . 12 : 932 – 936 . Xie P. , Jiang X. Y. , Bu Z. , Fu S. Y. , Zhang S. Y. , Tang Q. P. . 2016 . Free choice feeding of whole grains in meat-type pigeons: 1. Effect on performance, carcass traits, and organ development . Brit. Poult. Sci. 57 : 699 – 706 . Xie P. , Wang X. P. , Bu Z. , Zou X. T. . 2017 . Differential expression of fatty acid transporters and fatty acid synthesis-related genes in crop tissues of male and female pigeons (Columba livia domestica) during incubation and chick rearing . Br. Poult. Sci . 58 : 594 – 602 . Google Scholar CrossRef Search ADS PubMed Xu R. J. 1996 . Development of the newborn GI tract and its relation to colostrum/milk intake: A review . Reprod. Fertil. Dev . 8 : 35 – 48 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Changes in hormone profiles, growth factors, and mRNA expression of the related receptors in crop tissue, relative organ weight, and serum biochemical parameters in the domestic pigeon (Columba livia) during incubation and chick-rearing periods under artificial farming conditions

Poultry Science , Volume Advance Article (6) – Mar 15, 2018

Loading next page...
 
/lp/ou_press/changes-in-hormone-profiles-growth-factors-and-mrna-expression-of-the-ViguRPwBTi
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey061
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT The present study was conducted to determine the changes in concentrations of hormones and growth factors and their related receptor gene expressions in crop tissue, relative organ weight, and serum biochemical parameters in male and female pigeons during incubation and chick-rearing periods under artificial farming conditions. Seventy-eight pairs of 60-week-old White King pigeons with 2 fertile eggs per pair were randomly divided into 13 groups by different breeding stages. Serum prolactin and insulin-like growth factor-1 (IGF-1) concentrations in crop tissue homogenates were the highest in both male and female pigeons at 1 d of chick-rearing (R1), while epidermal growth factor (EGF) in female pigeons peaked at d 17 of incubation (I17) (P < 0.05). mRNA expression of the prolactin and EGF receptors in the crop tissue increased at the end of incubation and the early chick-rearing stage in both sexes. However, estrogen, progesterone, and growth hormone receptor expression each decreased during the early chick-rearing stage (P < 0.05). In male pigeons, IGF-1 receptor gene expression reached its peak at R7, while in female pigeons, it increased at the end of incubation. The relative weight of breast and abdominal fat in both sexes and thighs in the males was lowest at R7, and then gradually increased to the incubation period level. Serum total protein, albumin, and globulin concentrations increased to the highest levels at I17 (P < 0.05). Total cholesterol, triglyceride, and low-density lipoprotein reached their highest values at I17 in male pigeons and R25 in female pigeons (P < 0.05). In conclusion, hormones, growth factors, and their receptors potentially underlie pigeon crop tissue development. Changes in organs and serum biochemical profiles suggested their different breeding-cycle patterns with sexual effects. INTRODUCTION The avian crop plays a major role in food storage and moistening and provides a functional barrier for pathogens (Kierończyk et al., 2016), but in brooding pigeons, under prolactin stimulation, epithelial cells in the crop proliferate, accumulate nutrients via unclear mechanisms, and finally slough off to complete the “crop milk” formation (Horseman and Buntin, 1995; Gillespie et al., 2011). The prolactin receptor interacting with the hormone ligand in pigeon crop tissue has been examined by gene cloning and binding assays (Shani et al., 1981; Chen and Horseman, 1994). However, until now, prolactin seems to be the only factor directly affecting crop milk formation, feeding behaviors, and nest defense in pigeons during breeding stages (Horseman and Buntin, 1995; Mohamed et al., 2016). It remains unclear whether other factors are involved. In mammals, a complex network of endocrine and paracrine signaling, including various hormones, gonadal steroids, and cytokines, underlies mammary gland development (Filgo and Faqi, 2017). Therefore, more detailed information may be revealed by investigating other hormones or cytokines and their receptors in pigeon crops. Life-history theory indicates that individuals trade off current and future reproductive success (Stearns, 1992). Reproduction-induced changes in body weight or energy reserves suggest a cost to the animal itself (Gammonley, 1995; Neto and Gosler, 2010). Methods for balancing breeding efforts between males and females, and the energy required for survival, sustenance, and caring for offspring via the interactions between body condition and nutritional and environmental factors have always been difficult (Farner and Wingfield, 1980; Scanes et al., 1984). Domestic pigeons are monogamous, non-seasonal breeders, and are known for their biparental care of their eggs and young. Squabs have an impressive growth performance, nearly reaching adult body weight at 28 d (Gao et al., 2016). The body weight loss of parental pigeons under different nutritional manipulation strategies suggests that their reproduction is physiologically challenging (Xie et al., 2016). Animals’ phenotypic flexibility in organ size occurs in response to environmental factors or physiological states (Hammond et al., 2001; Bauchinger and Biebach, 2006). Previous studies on migrating birds showed that digestive organs hypertrophied while flight muscle atrophied to facilitate fueling (Piersma and Gill, 1998; Landys-Ciannelli, 2003). Organ changes in breeding birds are less studied than those in response to migration and molting, despite weight loss being common during reproduction (Gaston and Perin, 1993; Christians and Williams, 1999; Vézina and Williams, 2003). In addition, serum biochemical metabolites are important indicators of animals’ physiological states. Avian plasma chemistry studies have examined various aspects, including the influence of age (Gao et al., 2016), sex (Ferrer and Dobado-Berrios, 1998), nutrition (Chen et al., 2016), and circadian rhythms (García-Rodriguez et al., 1987); however, little information exists on the dynamic changes in organs and serum biochemical profiles of adult pigeons during different breeding cycle stages. Therefore, the objective of the present study was to determine the changes in concentrations of hormones, growth factors, and gene expression of their related receptors, organs, and serum biochemical parameters in male and female pigeons during incubation and chick rearing under artificial farming conditions. MATERIALS AND METHODS All procedures used in this study were approved by the Animal Care Committee of the Chinese Academy of Agricultural Sciences. Birds and Sample Collection A total of 156 (60 wk of age) adult White King pigeons (78 pairs of 78 males and 78 females each) was obtained from a commercial pigeon farm (Weitekai Pigeon Co., Ltd., Wuxi, China). All pairs were coupled when sexually mature, and chosen from a large flock (about 2,000 pairs). They all have a non-breeding phase between egg-laying and chick-rearing stages. Each pair of parent pigeons was housed in a manmade aviary equipped with a nest and perch. To avoid egg breakage, fertile eggs were hatched artificially, and plastic eggs were provided to maintain broodiness as described in the previous study (Xie et al., 2017). The time interval between the first and second egg production was about 44 hours. In order to keep in sync, 2 plastic eggs were put into cages only after the second egg was laid, and pigeon squabs hatched from the incubator were reared by parents after 18 d of incubation. Parent pigeons were fed a compound diet of 55% corn, 24.5% soybean meal (44.2% crude protein), 11% wheat, 1.2% dicalcium phosphate, 2% limestone, 0.25% salt, 0.5% vitamin and mineral premix, 2% soybean oil, 3.42% zeolite powder, 0.07% lysine, and 0.06% methionine (16.67% crude protein, 12.00 MJ/kg of metabolizable energy, 1.13% calcium, 0.34% available P, 0.89% lysine, and 0.31% methionine). The nutrient levels were recommended by pigeon producers in southern China and Xie et al. (2017). During the study, caged birds were housed in a room under a 16L:8D lighting cycle. The mean daily temperature was 23±4°C. Pellet feed, sand, and water were provided ad libitum. The parent pigeons were assigned randomly into 13 groups by different breeding stages, which included d 2 (I2), 4 (I4), 6 (I6), 10 (I10), 14 (I14), and 17 (I17) of the incubation period and d 1 (R1), 4 (R4), 7 (R7), 10 (R10), 15 (R15), 20 (R20), and 25 (R25) of the chick-rearing period. Pigeons were weighed, and blood was sampled by wing vein puncture before a 12-hour fasting. Serum was prepared by centrifugation at 1,500 × g for 20 min at 4°C and stored at –20°C for subsequent analysis. After blood sampling, all pigeons were euthanized by cervical dislocation. Crop tissues were quickly frozen in liquid nitrogen and stored at –80°C. Heart, liver, spleen, pancreas, proventriculus, gizzard, breast, thigh, abdominal fat, and kidney were weighed and the relative weights (RW) were calculated by expressing them as a percentage of the whole body weight. Eggs and baby squabs were transferred to a commercial pigeon farm to be cared for by other pigeons. ELISA Prolactin and gonadal steroid hormones in the serum were measured using commercial ELISA kits: Human Prolactin (PRL) ELISA Kit (Abcam Inc., Cambridge, MA), Estradiol (E2) Parameter Assay Kit (R&D Systems Inc., Minneapolis, Minnesota), and Progesterone (P) ELISA Kit (Sigma-Aldrich Corp., St. Louis, MO). Assays were conducted in duplicate. The minimal detectable dose and intra-assay coefficients of variation (CV) were 0.05 ng/mL and 6.8% for prolactin, 12.1 pg/mlL and 4.7% for E2, and 0.22 ng/mL and 5.2% for P, respectively. Absorbance at 450 nm was measured by microplate reader (SpectraMax M5, Molecular Devices, Sunnyvale, CA, USA). Concentrations of epidermal growth factor (EGF) and insulin-like growth factor-1 (IGF-1) were examined in the crop tissue. According to the method described by Bharathi et al. (1997), the crop was carefully excised as a whole and opened longitudinally, and rinsed in ice-cold saline to remove the contents and blotted dry. The middle part of the right lateral lobe was homogenized in 10 volumes of lysis buffer (KeyGEN, Nanjing, China) with an Ultra-Turrax (T8, IKA-Labortechnik, Staufen, Germany). The process was conducted on ice. The homogenate was centrifuged at 10,000 rpm for 10 min at 4°C, and the supernatant was pooled. EGF and IGF-1 were measured using the ELISA method (Boster Biological Technology, Wuhan, China) under 450 nm. The detection limit and intra-assay CV were 7.8 pg/mL and 5.9% for EGF, and 62.5 pg/mL and 7.2% for IGF-1. RNA Isolation and Real-time Quantitative PCR Total RNA was isolated from the crop tissue using the Trizol method. Briefly, the frozen middle part of the left lateral lobe was finely shattered in liquid nitrogen, and 0.1 gram of tissue powder was immediately transferred into 1.0 mL Trizol reagent. Then, 200 μL of chloroform were added, and the mixture was centrifuged at 12, 000 rpm for 10 min at 4°C. The aqueous phase was transferred into another tube. RNA was precipitated with isopropanol, washed with 75% ethanol, and finally resuspended in diethypyrocarbonate-treated H2O. Genomic DNA was eliminated using RNase-free DNase (TaKaRa, Dalian, China). RNA quality was examined by both native RNA electrophoresis and the UV absorbance ratio at 260 nm and 280 nm. cDNA was synthesized by M-MLV reverse transcriptase at 42°C for 60 min with oligo dT-Adaptor primer. The mRNA abundances of the prolactin receptor (PRLR), estrogen receptor (ER), progesterone receptor (PR), growth hormone receptor (GHR), insulin receptor (INSR), EGF receptor, and IGF-1 receptor were detected by real-time quantitative PCR (qRT-PCR). The qRT-PCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China) on an ABI StepOne Plus Real-Time PCR system (ABI7500, Carlsbad, CA). The 18S rRNA gene was used as the internal control. The PCR program was 95°C for 30 s, followed by 42 cycles of 95°C for 3 s, 60°C for 10 s, and 72°C for 30 seconds. Each sample was analyzed in triplicate. Melting curve analysis was used to verify amplification specificity. The relative expression quantity was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). The primers for the receptors and 18S are shown in Table 1. Table 1. Primers used in the present study.1 Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC 1PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor; EGF receptor = epidermal growth factor receptor; IGF-1 receptor = insulin-like growth factor (IGF)-1 receptor. 2F = forward; R = reverse. View Large Table 1. Primers used in the present study.1 Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC Target gene Nucleotide sequence (5΄→3΄)2 Accession No. Size (bp) PRLR F: ATTATTGAGTGCTCTCGGTTGC NM_0,012,82822 263 R: TGTCTTGGGTTTGAAGTGTTGA ER F: CCAGCTTTCACCCTTCATCCA NM_0,012,82825 180 R: GACAGGCTCCCTTTCTCGTT PR F: GGCATTGAGCCTGAAGTTGTC XM_02,128,6334 147 R: ATTCCGAAATCCTGGTAGCA GHR F: TGCCAACACAGACACCCAAC NM_0,012,82815 235 R: TTCACACCGTGCTCTCGCCA INSR F: CTCGGATGAACGAAGAACCTACG XM_02,129,1610 106 R: AGAGTTGGAAACGGAGATGGGA EGF receptor F: TACGGCTGCCTCCTTGATTA XM_02,129,3035 240 R: GCCTCCCTCGGCGTGATA IGF-1 receptor F: TATGCTGTTTGAACTGATGCG Cloned by the author 226 R: AGTGGGTTGGAGGGTAGAGG 18S F: AGCTCTTTCTCGATTCCGTG AF173630 256 R: GGGTAGGCACAAGCTGAGCC 1PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor; EGF receptor = epidermal growth factor receptor; IGF-1 receptor = insulin-like growth factor (IGF)-1 receptor. 2F = forward; R = reverse. View Large Biochemical Study The concentrations of serum total protein (TP), albumin (ALB), creatinine (CRE), urea nitrogen (UN), uric acid (UA), glucose (GLU), total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were analyzed by an automated system (7020 analyzer, Hitachi High-Technologies Co., Tokyo, Japan) with standard commercial kits following the protocols recommended by the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The serum globulin (GLB) concentration was calculated by subtracting the ALB concentration from the TP concentration. Statistical Analysis All data were presented as means ± SE. Data were statistically evaluated using SPSS 17.0 (SPSS Inc., Chicago, IL), and analyzed using the GLM procedure. The model included the main effects of sex, stage, and their interactions. Differences among breeding stages were estimated by Duncan post-hoc test. All of the statements of significance were based on P < 0.05. RESULTS PRL, E2, and P Different breeding stages significantly affected PRL and E2 concentrations in pigeon serum. PRL concentration ranged from 0.46 to 0.57 ng/mL and 0.29 to 0.47 ng/mL from I2 to I14 in male and female pigeons, respectively (Figure 1A). It rapidly reached the peak value (male: 2.29 ng/mL, female: 1.54 ng/mL) in both sexes at R1 (P < 0.05), and then gradually decreased to the base concentration after R15. In male pigeons, serum E2 concentration was higher at R10 (39.06 pg/mL) and R15 (46.87 pg/mL) (P < 0.05) (Figure 1B), but in female pigeons, it increased drastically after R15 (P < 0.05) (Figure 1B). In both male and female pigeons, the P concentration showed no changes during the incubation or chick-rearing period (P > 0.05) (Figure 1C). An interaction of sex × breeding stage for the concentrations of PRL (P = 0.014), E2 (P < 0.001), and P (P = 0.027) was observed in the study (Table 6). Figure 1. View largeDownload slide Concentrations of serum prolactin (A), estradiol (B), and progesterone (C) in male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-F) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 1. View largeDownload slide Concentrations of serum prolactin (A), estradiol (B), and progesterone (C) in male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-F) or lowercase letters (a-c) are significantly different (P < 0.05). Gene Expression of Hormone Receptors All hormone receptor genes (PRLR, ER, PR, GHR, and INSR) were expressed in the crop tissues of both male and female pigeons. They all varied significantly with stage and with the interaction of sex and stage (Table 6). mRNA expression of PRLR showed a similar pattern of change in both male and female pigeons, reaching peak values at I17 and I14, respectively (P < 0.05) (Figure 2A). ER gene expression was lower at R1 in both male and female pigeons (P < 0.05) (Figure 2B), and PR and GHR gene expression decreased during the incubation period (P < 0.05) (Figure 2C-D). PR mRNA reached the lowest level at R1 in both males and females, and at R4 for GHR. In male pigeons, no changes were found in INSR gene expression in male crop tissue during incubation or chick rearing (Figure 2E). In female pigeons, INSR gene expression reached a peak value at R4, and then decreased sharply during the late chick-rearing period (P < 0.05) (Figure 2E). Figure 2. View largeDownload slide mRNA expression profiles of prolactin receptor (A), estrogen receptor (B), progesterone receptor (C), growth hormone receptor (D), and insulin receptor (E) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-F) or lowercase letters (a-e) are significantly different (P < 0.05). Figure 2. View largeDownload slide mRNA expression profiles of prolactin receptor (A), estrogen receptor (B), progesterone receptor (C), growth hormone receptor (D), and insulin receptor (E) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-F) or lowercase letters (a-e) are significantly different (P < 0.05). EGF and IGF-1 EGF and IGF-1 concentrations in crop tissue homogenates showed similar change patterns in both male and female pigeons, and they changed significantly with sex, with stage, and their interaction (Table 7). Relatively higher levels of EGF were found in the late incubation period (after I14) and at the beginning of the chick-rearing period (before R7) (P < 0.05) (Figure 3). Peak values for EGF (male: 378.70 pg/mL) and IGF-1 concentrations (male: 5424.20 pg/mL, female: 5064.06 pg/mL) were reached at R1, except for EGF in females (349.84 pg/mL), which was at I17. Figure 3. View largeDownload slide Concentrations of epidermal growth factor (EGF) (A) and insulin-like growth factor-1 (IGF-1) (B) in crop tissue homogenates of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-G) or lowercase letters (a-e) are significantly different (P < 0.05). Figure 3. View largeDownload slide Concentrations of epidermal growth factor (EGF) (A) and insulin-like growth factor-1 (IGF-1) (B) in crop tissue homogenates of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different capital letters (A-G) or lowercase letters (a-e) are significantly different (P < 0.05). EGF and IGF-1 Receptors mRNA abundance of the EGF receptor in crop tissue reached its highest value at I17 in male pigeons and at R1 in female pigeons (P < 0.05) (Figure 4A), and then decreased to the level at the start of incubation. In male pigeons, IGF-1 receptor gene expression was highest at R7, while in females, it increased significantly from I14 to I17 (P < 0.05) (Figure 4B). An interaction of sex and stage for the gene expression of the EGF receptor (P = 0.009) and IGF-1 receptor (P < 0.001) also was observed in the study (Table 6). Figure 4. View largeDownload slide mRNA expression profiles of epidermal growth factor (EGF) receptor (A) and insulin-like growth factor-1 (IGF-1) receptor (B) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-E) or lowercase letters (a-f) are significantly different (P < 0.05). Figure 4. View largeDownload slide mRNA expression profiles of epidermal growth factor (EGF) receptor (A) and insulin-like growth factor-1 (IGF-1) receptor (B) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-E) or lowercase letters (a-f) are significantly different (P < 0.05). Body Weight and Relative Organ Weight As shown in Figure 5, body weight of both male pigeons and female pigeons was the greatest at I17, and it decreased significantly at R15 in males and R7 in females (P < 0.05). Different incubation and chick-rearing stages did not affect the RW of the heart, liver, spleen, pancreas, or kidney (P > 0.05) (Figures 6A-D; 8B). In female pigeons, proventriculus RW was higher at R7 (P < 0.05) (Figure 7A), while gizzard RW decreased to the lowest at R1 (P < 0.05) (Figure 7B). Breast RW in both males and females and thigh RW in males were the lowest at R7, and then gradually increased to the incubation period level (P < 0.05) (Figure 7C-D). Thigh RW in females was lowest at I4 (P < 0.05) (Figure 7D), and it also was affected by the interaction of sex and stage (P = 0.016) (Table 8). Abdominal fat RW increased at I17, but sharply decreased at R7 and R1 in male and female pigeons, respectively (P < 0.05) (Figure 8A). Figure 5. View largeDownload slide Changes in body weight of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 5. View largeDownload slide Changes in body weight of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 6. View largeDownload slide Changes in relative weight of organs [heart (A), liver (B), spleen (C), and pancreas (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Figure 6. View largeDownload slide Changes in relative weight of organs [heart (A), liver (B), spleen (C), and pancreas (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Figure 7. View largeDownload slide Changes in relative weight of organs [proventriculus (A), gizzard (B), breast (C), and thigh (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-b) are significantly different (P < 0.05). Figure 7. View largeDownload slide Changes in relative weight of organs [proventriculus (A), gizzard (B), breast (C), and thigh (D)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-b) are significantly different (P < 0.05). Figure 8. View largeDownload slide Changes in relative weight of organs [abdominal (A) and kidney (B)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Figure 8. View largeDownload slide Changes in relative weight of organs [abdominal (A) and kidney (B)] of male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05). Serum Biochemical Parameters Serum TP, ALB, and GLB concentrations reached the highest value at I17 (P < 0.05), and then decreased to the lowest at R4 in both male and female pigeons (P < 0.05) (Table 2). CRE and UA concentrations were the highest at R7 in both sexes during the incubation and chick-rearing stages (P < 0.05) (Table 3). UN concentration in male pigeons increased after R15 (P < 0.05), whereas it was higher at R25 than at other stages in female pigeons (P < 0.05) (Table 3). In male pigeons, TC, TG, and LDL concentrations reached their highest values at I17 (P < 0.05), while they were highest at R25 in female pigeons (P < 0.05). HLD concentration peaked at R15 (P < 0.05) for males, and at I17 in females (P < 0.05) (Table 5). Concentrations of HDL and LDL also varied significantly with the interaction of sex and stage (Table 9). Different incubation and chick-rearing stages did not affect pigeon serum GLU concentration (P > 0.05) (Table 4). Table 2. Concentrations of serum total protein (TP), albumin (ALB), and globulin (GLB) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a 1Data are shown as means ± SEM; n = 6. 2TP = total protein; ALB = albumin; GLB = globulin. A–D, a–dMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 2. Concentrations of serum total protein (TP), albumin (ALB), and globulin (GLB) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TP (mg/mL)  Male 35.0±1.2B,C 36.3±1.6A,B 40.1±1.2A 30.4±1.5C,D 28.7±0.9D 32.3±2.6B,C,D 34.0±1.7B,C  Female 36.6±1.7a,b 32.6±1.2b,c 39.5±1.8a 30.7±1.3b,c 27.9±1.6c 33.6±3.1a,b,c 36.4±2.5a,b ALB (mg/mL)  Male 14.2±0.4A,B 14.1±0.7A,B 15.2±0.7A 12.3±0.6B,C 11.7±0.6C 12.4±0.6B,C 13.6±0.7A,B,C  Female 14.5±0.4a,b 13.1±0.6b,c 15.9±0.7a 12.1±0.4c,d 10.5±0.7d 12.0±0.9c,d 13.2±0.6b,c GLB (mg/mL)  Male 20.8±1.0B,C 22.2±1.0A,B 24.9±0.6A 18.2±1.2C,D 17.0±0.5D 19.9±2.2B,C,D 20.4±1.1B,C,D  Female 22.2±1.3a,b 19.4±0.7a,b,c 23.6±1.1a 18.5±1.1b,c 17.4±0.9c 21.6±2.3a,b,c 23.2±2.0a 1Data are shown as means ± SEM; n = 6. 2TP = total protein; ALB = albumin; GLB = globulin. A–D, a–dMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 3. Concentrations of serum creatinine (CRE), urea nitrogen (UN), and uric acid (UA) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b 1Data are shown as means ± SEM; n = 6. 2CRE = creatinine; UN = urea nitrogen; UA = uric acid. A–C, a–bMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 3. Concentrations of serum creatinine (CRE), urea nitrogen (UN), and uric acid (UA) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 CRE (μmol/mL)  Male 11.7±1.3B 10.2±1.3B 10.6±1.4B 15.8±3.6A,B 22.2±5.6A 12.3±3.3B 10.3±1.3B  Female 12.2±0.7b 10.5±0.9b 11.7±1.1b 13.7±2.9b 29.5±4.8a 15.8±3.2b 10.2±2.8b UN (μmol/mL)  Male 1.93±0.07B 1.98±0.07A,B 2.00±0.16A,B 1.98±0.05A,B 2.22±0.10A,B 2.35±0.17A 2.32±0.20A  Female 2.00±0.10b 1.98±0.07b 2.02±0.11b 1.87±0.06b 1.90±0.07b 2.00±0.04b 2.34±0.14a UA (μmol/mL)  Male 358±39B,C 419±49A,B,C 311±8C 426±96A,B,C 618±78A 549±70A,B 435±58A,B,C  Female 451±40a,b 355±22b 453±37a,b 565±69a 541±65a 467±61a,b 422±34a,b 1Data are shown as means ± SEM; n = 6. 2CRE = creatinine; UN = urea nitrogen; UA = uric acid. A–C, a–bMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 4. Concentration of serum glucose (GLU) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 1Data are shown as means ± SEM; n = 6. 2GLU = glucose. View Large Table 4. Concentration of serum glucose (GLU) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 GLU (μmol/mL)  Male 19.3±0.9 20.1±0.5 19.4±0.5 19.3±0.7 19.1±0.4 18.8±0.5 19.6±0.6  Female 18.8±0.6 19.5±0.8 18.8±0.6 18.3±0.5 18.4±1.0 17.7±0.8 18.5±1.2 1Data are shown as means ± SEM; n = 6. 2GLU = glucose. View Large Table 5. Concentrations of serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a 1Data are shown as means ± SEM; n = 6. 2TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. A–C, a–cMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 5. Concentrations of serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) of male and female pigeons during different stages of incubation and chick-rearing periods.1 Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a Incubation (d) Chick-rearing (d) Item2 4 10 17 1 7 15 25 TC (μmol/mL)  Male 7.69±0.46A,B 7.92±0.29A,B 8.41±0.57A 6.37±0.73B 7.15±0.51A,B 7.44±0.48A,B 7.83±0.42A,B  Female 8.12±0.38a,b 7.23±0.27b 7.76±0.49b 6.74±0.33b 6.81±0.27b 7.73±0.70b 9.67±1.24a TG (μmol/mL)  Male 2.16±0.27A 2.28±0.23A 2.38±0.09A 1.29±0.24B 2.05±0.27A,B 1.27±0.15B 2.06±0.31A,B  Female 1.98±0.22a,b 1.93±0.23a,b 1.96±0.17a,b 1.51±0.15b 2.35±0.40a,b 2.39±0.65a,b 2.62±0.58a HDL (μmol/mL)  Male 4.22±0.16A,B,C 4.28±0.21A,B,C 4.23±0.21A,B,C 3.84±0.23C 3.91±0.25B,C 4.64±0.22A 4.54±0.20A,B  Female 4.58±0.14a 4.03±0.11a,b 4.39±0.18a 4.09±0.16a,b 3.57±0.27b,c 3.17±0.32c 4.15±0.17a,b LDL (μmol/mL)  Male 1.59±0.12A,B 1.73±0.10A 1.94±0.21A 1.28±0.15B 1.64±0.17A,B 1.61±0.07A,B 1.61±0.13A,B  Female 1.59±0.11b,c 1.55±0.10b,c 1.56±0.14b,c 1.26±0.09c 1.89±0.14a,b,c 2.37±0.42a,b 2.56±0.50a 1Data are shown as means ± SEM; n = 6. 2TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. A–C, a–cMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05). View Large Table 6. P-values for the effects of sex, stage, and their interactions in concentrations of serum hormones and gene expression of the related receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 1PRL = prolactin; E2 = estradiol; P = progesterone. 2PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor. View Large Table 6. P-values for the effects of sex, stage, and their interactions in concentrations of serum hormones and gene expression of the related receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 Hormone1 Gene2 Item PRL E2 P PRLR ER PR GHR INSR P-value  Sex <0.001 <0.001 0.010 0.466 0.803 0.216 0.001 <0.001  Stage <0.001 <0.001 0.233 <0.001 <0.001 <0.001 <0.001 <0.001  Sex × Stage 0.014 <0.001 0.027 0.001 0.007 <0.001 <0.001 <0.001 1PRL = prolactin; E2 = estradiol; P = progesterone. 2PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor. View Large Table 7. P-values for the effects of sex, stage, and their interactions in concentrations of growth factors and gene expression of their receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 1EGF = epidermal growth factor; IGF-1 = insulin-like growth factor-1. 2EGF receptor = epidermal growth factor receptor; IGF-1 = insulin-like growth factor-1 receptor. View Large Table 7. P-values for the effects of sex, stage, and their interactions in concentrations of growth factors and gene expression of their receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods. Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 Growth factor1 Gene2 Item EGF IGF-1 EGF receptor IGF-1 receptor P-value  Sex 0.001 0.004 0.001 0.058  Stage <0.001 <0.001 <0.001 <0.001  Sex × Stage <0.001 <0.001 0.009 <0.001 1EGF = epidermal growth factor; IGF-1 = insulin-like growth factor-1. 2EGF receptor = epidermal growth factor receptor; IGF-1 = insulin-like growth factor-1 receptor. View Large Table 8. P-values for the effects of sex, stage, and their interactions in body weight and relative weight of organs in male and female pigeons during incubation and chick-rearing period. Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 View Large Table 8. P-values for the effects of sex, stage, and their interactions in body weight and relative weight of organs in male and female pigeons during incubation and chick-rearing period. Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 Relative weight of organ Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney P-value  Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186  Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091  Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489 View Large Table 9. P-values for the effects of sex, stage, and their interaction in serum biochemical parameters in male and female pigeons during incubation and chick-rearing period. Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 1TP = total protein; ALB = albumin; GLB = globulin; CRE = creatinine; UN = urea nitrogen; UA = uric acid; GLU = glucose; TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. View Large Table 9. P-values for the effects of sex, stage, and their interaction in serum biochemical parameters in male and female pigeons during incubation and chick-rearing period. Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 Serum biochemical parameter1 Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL P-value  Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117  Stage <0.001 <0.001 <0.001 <0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008  Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028 1TP = total protein; ALB = albumin; GLB = globulin; CRE = creatinine; UN = urea nitrogen; UA = uric acid; GLU = glucose; TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein. View Large DISCUSSION Prolactin produced by the pituitary gland in pigeons has been shown to induce a marked epithelial hyperplasia of the crop tissue (Dumont, 1965; Horseman and Buntin, 1995), leading to “milk” formation, which includes lipid (Horseman and Will, 1984; Gillespie et al., 2013) and protein synthesis (Hu et al., 2016) during the brooding period. To support crop milk feeding, a complex array of behavioral adaptations (parental hyperphagia and feeding activity) is triggered by high levels of prolactin secretion (Foreman et al., 1990; Hnasko and Buntin, 1993). In the present study, prolactin increased at the end of the incubation period, and peaked at the beginning of the chick-rearing period, which was consistent with the previous study (Horseman and Buntin, 1995). Crop sac development was directly followed by increased prolactin levels (Goldsmith et al., 1981; Horseman, 1987), and its weight and thickness remained higher during the first wk of lactation (Hu et al., 2016). Vandeputte-Poma (1980) reported that pure pigeon milk constituted only 50% of crop content at 12 d after squab hatching and is replaced by full grains at the end of chick rearing. In the present study, the serum prolactin level gradually decreased to the base concentration after R15. This fluctuation was well conformed to the regular changes in physiological structure of crop tissue and pigeon milk formation. In an early study, gonadectomy appeared to have no adverse effects on crop milk production, indicating that gonadal steroids may be not involved in crop development and stimulation (Schooley et al., 1941). In mammals, estradiol and progesterone also play important roles in mammary gland development, including gland lobuloalveolar growth, ductal enlongation and differentiation, and cell proliferation (Stingl, 2011). However, relatively lower estradiol levels in pigeons during incubation and at the beginning of chick rearing were found in the present study. It may be caused by higher prolactin levels, which induced ovarian regression (Dawson, 2006). In addition, adopting chicks also leads to decreased gonadal steroid secretion (Leboucher et al., 1990). Estradiol synthesized by stroma and the theca layer of white non-hierarchical and yellow hierarchical follicles is essential for nutrient accumulation during egg formation (Bahr et al., 1983; Williams et al., 2004; Wistedt et al., 2014). Serum estrogen levels in female pigeons increase during the egg-laying period (Dong et al., 2013). Higher concentration of serum estradiol in female pigeons after R15 in the present study may be explained by the relatively longer breeding cycle needing a slower follicle development due to a continued hormone effect. However, estradiol's function in male pigeons during chick rearing remains unclear. Our data showed that the changing pattern of PRLR gene expression coincided with prolactin fluctuation in both male and female pigeons. The prolactin receptor belongs to the class I cytokine receptor superfamily and is considered as a candidate gene for broodiness (Dunn et al., 1998). We found it at higher concentrations in late incubation and at the beginning of chick rearing. PRLR modulates prolactin-inducible signal transmitting (Vleck et al., 2000), and prolactin can increase the receptor content in the pigeon crop sac (Shani et al., 1981), possibly because it increases activity of PRLR promoter via the STAT5 pathway found in mammals (Welte et al., 1994). Although both ER and PR can be directly regulated by the corresponding hormone ligands via distinctive membrane signaling (Dominguez and Micevych, 2011; Sivik and Jansson, 2012), changing gene expression patterns in pigeon crop tissue were incompatible with the circulating hormone fluctuation during the breeding period, indicating that other factors may be involved in this regulation. The PR gene contains an Sp1 site and could confer estrogen responsiveness to a heterologous promoter in an estrogen receptor-dependent manner (Schultz et al., 2003). The correlation between ER and RP gene expression probably also exists in the pigeon crop. Compared to ER and PR, the similar changing pattern of GHR gene expression in crop tissue also made it likely unnecessary in crop-stimulating growth. This study raised the new question of whether prolactin negatively affects gene expressions of ER, PR, and GHR in pigeon crops. In addition, the irregular change in INSR gene expression only in female pigeon crops showed its potential involvement in crop milk formation or other physiological processes. Both EGF and IGF-1 concentrations in crop milk decreased during chick rearing in a previous study (Xie et al., 2013), which was similar to the results for the crop tissue in the current study. It suggested that EGF and IGF-1 in crop milk and crop tissue probably have the same origination. Milk secreted by mammals contains higher EGF and IGF-1 concentrations, and both subsequently decreased in the later period of lactation (Donovan et al., 1994; Xu, 1996). The changing pattern of 2 growth factors was found to coincide with crop weight and thickness changes, as reported by Hu et al (2016). This result indirectly verified the early hypothesis that crop cell proliferation might be brought about by the synergistic action of prolactin and growth factors (Anderson et al., 1987), which can accumulate in the tissue during brooding (Bharathi et al., 1993). Generally, a final cellular outcome can be governed by input from several factors, because the combined effect of cellular inputs may be more than their individual effects due to synergistic action (Crouch et al., 2000). Growth factors such as IGF-1 and EGF play important roles in multiple cellular responses, including DNA synthesis, nutrient accumulation, and mitogenesis (Thomas et al., 1982; Adams and Haddad, 1996; Deleu et al., 1999; Berfield et al., 2002; Mau et al., 2008). The authors speculated they were also potentially involved in crop tissue hyperplasia and milk formation via their receptors. In addition, IGF-1 stimulates insulin-like action, and the overlap in action is due to the high homology between the INSR and the IGF-1 receptor, initiating the intracellular signaling pathway via similar cascades (Taniguchi et al., 2006). A nearly 4-fold increase in insulin levels was found in lactating pigeons, although it did not distinguish the parental sex (Hu et al., 2016), and insulin also enhanced the gene expression of the IGF-1 receptor and effectively induced EGF receptor accumulation on the actin arc of cells (Crouch et al., 2000; Hunter and Hers, 2009). Seasonal variations, reproductive cycle, and sex-related differences in body weight and organ dynamics are well-documented in water fowls, passerines, or some species of wild migratory birds in the wild (Ankney and MacInnes, 1978; Gammonley, 1995; Woodburn and Perrins, 1997; Badzinski et al., 2011; Jacobs et al., 2011), but similar studies in pigeons are few, especially under artificial caged farming conditions. We hypothesized that pigeons allocate energy resources for the most demanding period of the reproductive cycle through phenotypic flexibility in body weight and organ size. In female blue tits, body reserves increased after clutch completion, and were mobilized during the first 5 d of the nestling period, which showed a decrease in whole body weight (Woodburn and Perrins, 1997). Lower body weights in male and female pigeons during the chick-rearing period observed in the present study were probably due to both parents giving the contributions of caring for offspring. Lean dry weight and fat content of the digestive system in female blue tits also was found to be decreased during the beginning of the nestling period (Woodburn and Perrins, 1997), but no significant changes in gizzard or intestine weight during the reproductive cycle were reported in ruddy ducks (Tome, 1984). In the present study, the proventriculus RW increased at R7 and gizzard RW decreased at R1 in female pigeons, but no changes in these 2 organs were found in males, indicating that sex and potential species differences existed. Breast muscle is a key factor for flight performance, and it also functions as a nutrient reserve that can be used during the reproductive cycle (Kullberg et al., 2002). However, no evidence of incubation negatively affecting bird's body condition was found, and energy reserves increased during this period, such as in Savi's Warblers, although the female did most of the incubating (Neto and Gosler, 2010). Similar results for thigh RW in female pigeons were found in our experiment. As in other studies, breast muscle in bird species decreased in weight during chick rearing (Woodburn and Perrins, 1997; Neto and Gosler, 2010), which was almost entirely due to protein (Jones, 1991) and lipid loss (Jacobs et al., 2011). This phenomenon also was observed in the present study, and in passerines, the decline in muscle during the breeding season was even greater in females than in males (Gosler, 1991). The author speculated that both male and female parent pigeons probably incurred physiological stress when caring for offspring, but the relative contributions of the 2 sexes, as well as the mechanism involved, remain unclear. Our study found dramatic changes in abdominal fat RW, especially in female pigeons within only a few d (from I17 to R1). It was reported that body fat content can change rapidly in birds, for instance, during the d and as an adaptation to predation risk (Gosler, 1996). The decline in organ RW in parent pigeons mostly occurred before R15 in the present study. These results verified the hypothesis that the first half of the nestling period may be more demanding because the parents have to brood and feed the nestlings simultaneously, having little time to feed themselves (Sanz and Moreno, 1995; Moe et al., 2002). During the second half of the nestling period, parent pigeons do not need to remain in the nest as long, and the food received by the squabs changes from crop milk to whole grains (Vanderputte-poma, 1980; Horseman and Buntin, 1995). This suggested that the physiological stress of the parent pigeons was alleviated after R15. Blood metabolites, such as glucose, protein, albumin, and TG, are indicative of nutritional status in general (Junghanns and Coles, 2008). In the present study, continuous increases in serum TP, ALB, and GLB in both male and female pigeons during incubation are attributed to strengthening of the metabolism by protein synthesis. ALB is a carrier protein for many hormones and metal ions (Refetoff et al., 1970; Cookson et al., 1988). Prolactin induces serum albumin translation (Baruch et al., 1998), and the maximum ALB value parallels with the peak prolactin level during the terminal incubation phase in pigeons reported by Gayathri and Hegde (2006). In addition, squab pigeons obtain the immunoglobulins, mainly IgA and IgG, through crop milk from parental transfer (Jacquin et al., 2012). However, with crop tissue regression during the second half of the chick-rearing period, squabs were gradually fed by full grains, and this may be why the trend of recovered serum protein indices occurred. Creatinine, a byproduct of phosphocreatine breakdown in skeletal muscle, is another important indicator of protein metabolism (Piotrowska et al., 2011). We speculated that the increased serum creatinine value probably correlated with breast and thigh muscle decomposition, which showed a lower RW at R7 in the present study. UA and UN come mainly from digestion, the breakdown products of the digestive tract, and the metabolites released from tissue cells (Wang et al., 2009). Their changes can reflect the efficiency of amino acid use throughout the body (Donsbough et al., 2010). Casado et al. (2002) found that nestling brooding eagles had higher plasma UA and UN concentrations than non-brooding ones, which was consistent with our results. We speculated that physiological stresses brought on by feeding squabs may incur the 2 increased parameters with muscle tissue decomposition. Serum levels of TG, TC, LDL, and HDL are used to measure serum lipid levels (Chou et al., 2012). Our data showed that serum concentrations of TC, TG, and LDL were lower in both male and female pigeons at the beginning of chick rearing, which may be due to lipid formation in crop milk with the decrease of abdominal fat RW simultaneously. However, the time needed to reach the higher values of these parameters differed between males and females, indicating that potential differences in lipid metabolism existed between the two sexes, as sexual dimorphism in the plasma lipid profile established in mammals (Wang et al., 2011). The higher values of serum TC, TG, and LDL detected in female pigeons during the terminal phase of chick rearing was probably due to the continuously increasing estradiol level. This phenomenon has already been shown in female mammals (Ferreri and Naito, 1978; Cinci et al., 2000; Mady, 2000). CONCLUSIONS Prolactin, EGF, and IGF-1 concentrations, as well as gene expression of their receptors in pigeon crop tissues changed dynamically during the breeding cycle, and these factors potentially underlie crop tissue development with a combined effect. The RW of breast muscle, thigh muscle, and abdominal fat declined significantly during chick rearing, which may function as a nutrient reserve for later use. Serum biochemical profiles detected in the present study showed that protein and lipid metabolism-related parameters in adult pigeons varied significantly during incubation and chick rearing with sexual effects. ACKNOWLEDGMENTS The authors thank all the members in the School and Institute for their generous technical advice. This research was supported by National Natural Funds of China (No. 31501974) and National Natural Science Foundation of Jiangsu Province (BK20150462). REFERENCES Adams G. R. , Haddad F. . 1996 . The relationships among IGF-1, DNA content, and protein accumulation during skeletal muscle hypertrophy . J. Appl. Physiol . 81 : 2509 – 2516 . Google Scholar CrossRef Search ADS PubMed Anderson T. R. , Mayer G. L , Hebert N. , Nicoll C. S. . 1987 . Interactions among prolactin, epidermal growth factor, and proinsulin on the growth and morphology of the pigeon crop-sac mucosal epithelium in vivo . Endocrinology . 120 : 1258 – 1264 . Google Scholar CrossRef Search ADS PubMed Ankney C. D. , Macinnes C. D. . 1978 . Nutrient reserves and reproductive performance of female lesser snow geese . Auk . 95 : 459 – 471 . Badzinski S. S. , Kennedy L. , Petrie S. A. , Schummer M. L. . 2011 . Variation in body composition and digestive organs of tundra swans during migration at long point, Lake Erie, Ontario , Waterbirds 34 : 468 – 475 . Google Scholar CrossRef Search ADS Bahr J. M. , Wang S. C. , Huang M. Y. , Calvo F. O. . 1983 . Steroid concentrations in isolated theca and granulosa layers of preovulatory follicles during the ovulatory cycle of the domestic hen . Biol. Reprod . 29 : 326 – 334 . Google Scholar CrossRef Search ADS PubMed Baruch A. , Shani M. , Barash I. . 1997 . Insulin and prolactin synergize to induce translation of human serum albumin in the mammary gland of transgenic mice . Transgenic Res . 7 : 15 – 27 . Google Scholar CrossRef Search ADS Bauchinger U. , Biebach H. . 2006 . Transition between moult and migration in a long-distance migratory passerine: organ flexibility in the African wintering area . J Ornithol . 147 : 266 – 273 . Google Scholar CrossRef Search ADS Berfield A. K. , Andress D. L. , Abrass C. K. . 2002 . IGF-1-induced lipid accumulation impairs mesangial cell migration and contractile function . Kidney Int . 62 : 1229 – 1237 . Google Scholar CrossRef Search ADS PubMed Bharathi L. , Shenoy K. B. , Mojamdar M. , Hegde S. N. . 1993 . Studies on the growth-stimulatory activity of pigeon milk-comparison and synergistic effects with serum . J. Comp. Physiol. B . 163 : 332 – 336 . Google Scholar CrossRef Search ADS PubMed Bharathi L. , Shenoy K. B. , Hegde S. N. . 1997 . Biochemical differences between crop tissue and crop milk of pigeons (Columba livia) . Comparative Biochemistry and Physiology Part A: Physiology . 116 : 51 – 55 . Google Scholar CrossRef Search ADS Casado E. , Balbontin J. , Ferrer M. . 2002 . Plasma chemistry in booted eagle (Hieraaetus pennatus) during breeding season . Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology . 131 : 233 – 241 . Google Scholar CrossRef Search ADS Chen X. , Horseman N. D. . 1994 . Cloning, expression, and mutational analysis of the pigeon prolactin receptor . Endocrinology 135 : 269 – 276 . Google Scholar CrossRef Search ADS PubMed Chen X. , Naehrer K. , Applegate T. J. . 2016 . Interactive effects of dietary protein concentration and aflatoxin B1 on performance, nutrient digestibility, and gut health in broiler chicks . Poult. Sci. 95 : 1312 – 1325 . Google Scholar CrossRef Search ADS PubMed Christians J. K. , Williams T. D. . 1999 . Organ mass dynamics in relation to yolk precursor production and egg formation in european starlings sturnus vulgaris . Physiol. Biochem. Zool. 72 : 455 – 461 . Google Scholar CrossRef Search ADS PubMed Chou C. H. , Chang Y. Y. , Tzang B. S. , Hsu C. L. , Lin Y. L. , Lin H. W. , Chen Y. C. . 2012 . Effects of taurine on hepatic lipid metabolism and anti-inflammation in chronic alcohol-fed rats . Food Chem . 135 : 24 – 30 . Google Scholar CrossRef Search ADS Cinci G. , Guerranti R. , Pagani R. , Carlucci F. , Terzuoli L. , Rosi F. , Marinello E. . 2000 . Fatty acid composition of phospholipids, triglycerides and cholesterol in serum of castrated and estradiol treated rats . Life Sci . 66 : 1647 – 1654 . Google Scholar CrossRef Search ADS PubMed Cookson E. J. , Hall M. R. , Glover J. . 1988 . The transport of plasma thyroxine in White storks (Ciconia ciconia) and the association of high levels of plasma transthyretin (thyroxine-binding prealbumin) with moult . J. Endocrinol . 117 : 75 – 84 . Google Scholar CrossRef Search ADS PubMed Crouch M. F. , Davy D. A. , Willard F. S. , Berven L. A. . 2000 . Insulin induces epidermal growth factor (EGF) receptor clustering and potentiates EGF-stimulated DNA synthesis in Swiss 3T3 cells: A mechanism for costimulation in mitogenic synergy . Immunol Cell Biol . 78 : 408 – 414 . Google Scholar CrossRef Search ADS PubMed Dawson A. 2006 . Control of molt in birds: Association with prolactin and gonadal regression in starlings . Gen. Comp. Endocrinol . 147 : 314 – 322 . Google Scholar CrossRef Search ADS PubMed Deleu S. , Pirson I. , Coulonval K. , Drouin A. , Taton M. , Clermont F. , Roger P. P. , Nakamura T. , Dumont J. E. , Maenhaut C. . 1999 . IGF-1 or insulin, and the TSH cyclic AMP cascade separately control dog and human thyroid cell growth and DNA synthesis, and complement each other in inducing mitogenesis . Mol. Cell. Endocrinol . 149 : 41 – 51 . Google Scholar CrossRef Search ADS PubMed Dominguez R. , Micevych P. . 2010 . Estradiol rapidly regulates membrane ERα levels in hypothalamic neurons . J. Neurosci . 30 : 12589 – 12596 . Google Scholar CrossRef Search ADS PubMed Dong X. Y. , Zhang M. , Jia Y. X. , Zou X. T. . 2013 . Physiological and hormonal aspects in female domestic pigeons (Columba livia) associated with breeding stage and experience . J. Anim. Physiol. An. N. 97 : 861 – 867 . Donovan S. M. , McNeil L. K. , Jiménez-Flores R. , Odle J. . 1994 . Insulin-like growth factors and insulin-like growth factor binding proteins in porcine serum and milk throughout lactation . Pediatr Res 36 : 159 – 168 . Google Scholar CrossRef Search ADS PubMed Donsbough A. L. , Powell S. , Waguespack A. , Bidner T. D. , Southern L. L. . 2010 . Uric acid, urea, and ammonia concentrations in serum and uric acid concentration in excreta as indicators of amino acid utilization in diets for broilers . Poult. Sci. 89 : 287 – 294 . Google Scholar CrossRef Search ADS PubMed Dumont J. N. 1965 . Prolactin-induced cytologic changes in the mucosa of the pigeon crop during crop-“milk” formation . Z. Zellforsch. Mikrosk. 68 : 755 – 782 . Google Scholar CrossRef Search ADS Dunn I. C. , Mcewan G. , Okhubo T. , Sharp P. J. , Paton I. R. , Burt D. W. . 1998 . Genetic mapping of the chicken prolactin receptor gene: a candidate gene for the control of broodiness . Br. Poult. Sci. 39 : 23 – 24 . Google Scholar CrossRef Search ADS Farner D. S. , Wingfield J. C. . 1980 . Reproductive endocrinology of birds . Annu. Rev. Physiol. 42 : 457 – 472 Google Scholar CrossRef Search ADS PubMed Ferreri L. F. , Naito H. K. . 1978 . Effect of estrogens on rat serum cholesterol concentrations: Consideration of dose, type of estrogen, and treatment duration . Endocrinology . 102 : 1621 – 1627 . Google Scholar CrossRef Search ADS PubMed Ferrer M. , Dobado-Berrios P. . 1998 . Factors affecting plasma chemistry values of the Spanish Imperial Eagle, Aquila adalberti . Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology . 120 : 209 – 217 . Google Scholar CrossRef Search ADS Filgo A. J. , Faqi A. S. . 2017 . Effects of chemicals on mammary gland development . Pages 205 – 234 in Developmental and Reproductive Toxicology . Springer , New York . Google Scholar CrossRef Search ADS Foreman K. T. , Lea R. W. , Buntin J. P. . 1990 . Changes in feeding activity, plasma luteinizing hormone, and testes weight in ring doves following hypothalamic injections of prolactin . J. Neuroendocrinol . 2 : 667 – 673 . Google Scholar CrossRef Search ADS PubMed Gammonley J. H. 1995 . Nutrient reserve and organ dynamics of breeding Cinnamon Teal . The Condor . 97 : 985 – 992 . Google Scholar CrossRef Search ADS Gao C. Q. , Yang J. X. , Chen M. X. , Yan H. C. , Wang X. Q. . 2016 . Growth curves and age-related changes in carcass characteristics, organs, serum parameters, and intestinal transporter gene expression in domestic pigeon (Columba livia) . Poult. Sci . 95 : 867 – 877 . Google Scholar CrossRef Search ADS PubMed García-Rodriguez T. , Ferrer M. , Recio J. C. , Castroviejo J. . 1987 . Circadian rhythms of determined blood chemistry values in buzzards and eagle owls . Comparative Biochemistry and Physiology Part A: Physiology . 88 : 663 – 669 . Google Scholar CrossRef Search ADS Gaston A. J. , Perin S. . 1993 . Loss of mass in breeding Brunnich's Guillemots Uria lomvia is triggered by hatching . Ibis . 135 : 472 – 475 . Google Scholar CrossRef Search ADS Gayathri K. L. , Hegde S. N. . 2006 . Alteration in haematocrit values and plasma protein fractions during the breeding cycle of female pigeons, Columba livia . Anim. Reprod. Sci. 91 : 133 – 141 . Google Scholar CrossRef Search ADS PubMed Gillespie M. J. , Haring V. R. , McColl K. A. , Monaghan P. , Donald J. A. , Nicholas K. R. , Moore R. J. , Crowley T. M. . 2011 . Histological and global gene expression analysis of the 'lactating' pigeon crop . BMC Genomics . 12 : 452 – 461 . Google Scholar CrossRef Search ADS PubMed Gillespie M. J. , Crowley T. M. , Haring V. R. , Wilson S. L. , Harper J. A. , Payne J. S. , Green D. , Monaghan P. , Donald J. A. , Nicholas K. R. , Moore R. J. . 2013 . Transcriptome analysis of pigeon milk production - Role of cornification and triglyceride synthesis genes . BMC Genomics . 14 : 169 – 181 . Google Scholar CrossRef Search ADS PubMed Goldsmith A. R. , Edwards C. , Koprucu M. , Silver R. . 1981 . Concentrations of prolactin and luteinizing hormone in plasma of doves in relation to incubation and development of the crop gland . J. Endocrinol . 90 : 437 – 443 . Google Scholar CrossRef Search ADS PubMed Gosler A. G. 1991 . On the use of greater covert moult and pectoral muscle as measures of condition in passerines with data for the Great Tit Parus major . Bird Study . 38 : 1 – 9 . Google Scholar CrossRef Search ADS Gosler A. G. 1996 . Environmental and social determinants of winter fat storage in the great tit Parus major . J. Anim. Ecol. 65 : 1 – 17 . Google Scholar CrossRef Search ADS Hammond K. A. , Szewczak J. , Król E. . 2001 . Effects of altitude and temperature on organ phenotypic plasticity along an altitudinal gradient . J. Exp. Biol . 204 : 1991 – 2000 . Google Scholar PubMed Hnasko R. M. , Buntin J. D. . 1993 . Functional mapping of neural sites mediating prolactin-induced hyperphagia in doves . Brain Res . 623 : 257 – 266 . Google Scholar CrossRef Search ADS PubMed Horseman N. D. , Will C. L. . 1984 . Characterization of lipid storage associated proteins induced in crop tissue by prolactin . J. Comp. Physiol. B . 154 : 237 – 242 . Google Scholar CrossRef Search ADS Horseman N. D. 1987 . Models of prolactin action in nonmammalian vertebrates . Pages 41 – 67 in Actions of Prolactin on Molecular Processes , ed. Rillema J. A. , Boca Raton, FL : CRC . Horseman N. D. , Buntin J. D. . 1995 . Regulation of pigeon cropmilk secretion and parental behaviors by prolactin . Annu. Rev. Nutr. 15 : 213 – 238 . Google Scholar CrossRef Search ADS PubMed Hu X. C. , Gao C. Q. , Wang X. H. , Yan H. C. , Chen Z. S. , Wang X. Q. . 2016 . Crop milk protein is synthesised following activation of the IRS1/Akt/TOR signalling pathway in the domestic pigeon (Columba livia) . Br. Poult. Sci. 57 : 855 – 862 . Google Scholar CrossRef Search ADS PubMed Hunter R. W. , Hers I. . 2009 . Insulin/IGF-1 hybrid receptor expression on human platelets: Consequences for the effect of insulin on platelet function . J. Thromb. Haemost . 7 : 2123 – 2130 . Google Scholar CrossRef Search ADS PubMed Jacobs S. R. , Edwards D. B. , Ringrose J. , Elliott K. H. , Weber J. M. , Gaston A. J. . 2011 . Changes in body composition during breeding: reproductive strategies of three species of seabirds under poor environmental conditions . Comp. Biochem. Physiol. B Biochem. Mol. Biol. 158 : 77 – 82 . Google Scholar CrossRef Search ADS PubMed Jacquin L. , Blottière L. , Haussy C. , Perret S. , Gasparini J. . 2012 . Prenatal and postnatal parental effects on immunity and growth in ‘lactating’ pigeons . Funct. Ecol . 26 : 866 – 875 . Google Scholar CrossRef Search ADS Jones M. M. 1991 . Muscle protein loss in laying House Sparrows Passer domesticus . Ibis . 133 : 193 – 198 . Google Scholar CrossRef Search ADS Junghanns M. K. , Coles B. H. . 2008 . Aids to diagnosis . Pages 56 – 102 in Essentials of Avian Medicine and Surgery . Black well Publishing Ltd : Oxford, UK . Google Scholar CrossRef Search ADS Kierończyk B. , Rawski M. , Długosz J. , Świątkiewicz S. , Józefiak D. . 2016 . Avian crop function - A review . Ann. Anim. Sci . 16 : 653 – 678 . Google Scholar CrossRef Search ADS Kullberg C. , Houston D. C. , Metcalfe N. B. . 2002 . Impaired flight ability–A cost of reproduction in female blue tits . Behav. Ecol. 13 : 575 – 579 . Google Scholar CrossRef Search ADS Landys-Ciannelli M. M. , Piersma T. , Jukema J. . 2003 . Strategic size changes of internal organs and muscle tissue in the Bar-tailed Godwit during fat storage on a spring stopover site . Funct Ecology . 17 : 151 – 159 . Google Scholar CrossRef Search ADS Leboucher G. , Richard-Yris M. A. , Williams J. , Chadwick A. . 1990 . Incubation and maternal behaviour in domestic hens: Influence of the presence of chicks on circulating luteinising hormone, prolactin and oestradiol and on behaviour . Br. Poult. Sci . 31 : 851 – 862 . Google Scholar CrossRef Search ADS PubMed Livak K. J. , Schmittgen T. D. . 2001 . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method . Methods . 25 : 402 – 408 . Mady E. A. 2000 . Association between estradiol, estrogen receptors, total lipids, triglycerides, and cholesterol in patients with benign and malignant breast tumors . J. Steroid Biochem. Mol. Biol . 75 : 323 – 328 . Google Scholar CrossRef Search ADS PubMed Mau M. , Kalbe C. , Wollenhaupt K. , Nürnberg G. , Rehfeldt C. . 2008 . IGF-I- and EGF-dependent DNA synthesis of porcine myoblasts is influenced by the dietary isoflavones genistein and daidzein . Domest. Anim. Endocrinol . 35 : 281 – 289 . Google Scholar CrossRef Search ADS PubMed Moe B. , Langseth I. , Fyhn M. , Gabrielsen G. W. , Bech C. . 2002 . Changes in body condition in breeding kittiwakes Rissa tridactyla . Journal of Avian Biology . 33 : 225 – 234 . Google Scholar CrossRef Search ADS Mohamed R. A. , Shukry M. , Mousa-Balabel T. M. , Elbassiouny A. A. . 2016 . Assessment of plasma prolactin and nest defense behaviour during breeding cycle of pigeon (Columba livia domestica) . Journal of Environmental and Agricultural Sciences . 7 : 19 – 22 . Neto J. M. , Gosler A. G. . 2010 . Variation in body condition of breeding Savi's Warblers Locustella luscinioides: The reproductive stress and flight adaptation hypothesis revisited . J. Ornithol . 151 : 201 – 210 . Google Scholar CrossRef Search ADS Piersma T. , Gill R. E. Jr . 1998 . Guts don’t fly: Small digestive organs in obese Bar-Tailed Godwits . The Auk 115 : 196 – 203 . Google Scholar CrossRef Search ADS Piotrowska A. , Burlikowska K. , Szymeczko R. . 2011 . Changes in blood chemistry in broiler chickens during the fattening period . folia biol (krakow) . 59 : 183 – 187 . Google Scholar CrossRef Search ADS PubMed Refetoff S. , Robin N. I. , Fang V. S. . 1970 . Parameters of thyroid function in serum of 16 selected vertebrate species: A study of PBI, serum T4, free T4, and the pattern of T4 and T3 binding to serum proteins . Endocrinology . 86 : 793 – 805 . Google Scholar CrossRef Search ADS PubMed Sanz J. J. , Moreno J. . 1995 . Mass loss in brooding female pied flycatchers Ficedula hypoleuca: No evidence for reproductive stress . Journal of Avian Biology . 26 : 313 – 320 . Google Scholar CrossRef Search ADS Scanes C. G. , Harvey S. , Marsh J. A. , King D. B. . 1984 . Hormones and growth in poultry . Poult. Sci . 63 : 2062 – 2074 . Google Scholar CrossRef Search ADS PubMed Schooley J. P. , Riddle O. , Bates R. W. . 1941 . Replacement therapy in hypophysectomized juvenile pigeons . Dev. Dynam. 69 : 123 – 157 . Schultz J. R. , Petz L. N. , Nardulli A. M. . 2003 . Estrogen receptor alpha and Sp1 regulate progesterone receptor gene expression . Mol. Cell. Endocrinol . 201 : 165 – 175 . Google Scholar CrossRef Search ADS PubMed Shani J. , Barkey R. J. , Amit T. . 1981 . Endogenous prolactin maintains its own binding sites in the pigeon crop sac mucosa . J. Recept. Res. 2 : 407 – 417 . Google Scholar CrossRef Search ADS PubMed Sivik T. , Jansson A. . 2012 . Progesterone and levonorgestrel regulate expression of 17βHSD-enzymes in progesterone receptor positive breast cancer cell line T47D . Biochem. Biophys. Res. Commun . 422 : 109 – 113 . Google Scholar CrossRef Search ADS PubMed Stearns S. C. 1992 . The evolution of life histories . Q. Rev. Biol. 123 : 835 – 839 . Stingl J. 2011 . Estrogen and progesterone in normal mammary gland development and in cancer . HORM CANC 2 : 85 – 90 . Google Scholar CrossRef Search ADS Taniguchi C. M. , Emanuelli B. , Kahn C. R. . 2006 . Critical nodes in signalling pathways: Insights into insulin action . Nat. Rev. Mol. Cell Biol . 7 : 85 – 96 . Google Scholar CrossRef Search ADS PubMed Thomas G. , Martin-Perez J. , Siegmann M. , Otto A. M. . 1982 . The effect of serum, EGF, PGF2 alpha and insulin on S6 phosphorylation and the initiation of protein and DNA synthesis . Cell . 30 : 235 – 242 . Google Scholar CrossRef Search ADS PubMed Tome M. W. 1984 . Changes in nutrient reserves and organ size of female ruddy ducks breeding in manitoba . The Auk 101 : 830 – 837 . Google Scholar CrossRef Search ADS Vandeputte-poma J. 1980 . Feeding, growth and metabolism of the pigeon, Columba livia domestica: Duration and role of crop milk feeding . J. Comp. Physiol. B . 135 : 97 – 99 . Google Scholar CrossRef Search ADS Vézina F. , Williams T. D. . 2003 . Plasticity in body composition in breeding birds: What drives the metabolic costs of egg production? Physiol. Biochem. Zool . 76 : 716 – 730 . Google Scholar CrossRef Search ADS PubMed Vleck C. M. , Ross L. L. , Vleck D. , Bucher T. L. . 2000 . Prolactin and parental behavior in Adélie penguins: Effects of absence from nest, incubation length, and nest failure . Horm. Behav. 38 : 149 – 158 . Google Scholar CrossRef Search ADS PubMed Wang J. P. , Yoo J. S. , Kim H. J. , Lee J. H. , Kim I. H. . 2009 . Nutrient digestibility, blood profiles and fecal microbiota are influenced by chitooligosaccharide supplementation of growing pigs . Livestock Sci . 125 : 298 – 303 . Google Scholar CrossRef Search ADS Wang X. , Magkos F. , Mittendorfer B. . 2011 . Sex differences in lipid and lipoprotein metabolism: It's not just about sex hormones . The Journal of Clinical Endocrinology & Metabolism 96 : 885 – 893 . Google Scholar CrossRef Search ADS Welte T. , Garimorth K. , Philipp S. , Doppler W. . 1994 . Prolactin-dependent acti vation of a tyrosine phosphorylated DNA binding factor in mouse mammary epithelial cells . Mol. Endocrinol . 8 : 1091 – 1102 . Google Scholar PubMed Williams T. D. , Kitaysky A. S. , Vézina F. . 2004 . Individual variation in plasma estradiol-17β and androgen levels during egg formation in the European starling Sturnus vulgaris: Implications for regulation of yolk steroids . Gen. Comp. Endocrinol . 136 : 346 – 352 . Google Scholar CrossRef Search ADS PubMed Wistedt A. , Ridderstråle Y. , Wall H. , Holm L. . 2014 . Exogenous estradiol improves shell strength in laying hens at the end of the laying period . Acta Vet Scand . 56 : 34 – 44 . Google Scholar CrossRef Search ADS PubMed Woodburn R. J. W. , Perrins C. M. . 1997 . Weight change and the body reserves of female blue tits, Parus caeruleus, during the breeding season . J. Zool. Lond . 243 : 789 – 802 . Google Scholar CrossRef Search ADS Xie P. , Fu S. Y. , Bu Z. , Tong H. B. , Zou J. M. . 2013 . Effects of age and parental sex on digestive enzymes, growth factors, and immunoglobulin of pigeon squab . J. Anim. Vet. Adv . 12 : 932 – 936 . Xie P. , Jiang X. Y. , Bu Z. , Fu S. Y. , Zhang S. Y. , Tang Q. P. . 2016 . Free choice feeding of whole grains in meat-type pigeons: 1. Effect on performance, carcass traits, and organ development . Brit. Poult. Sci. 57 : 699 – 706 . Xie P. , Wang X. P. , Bu Z. , Zou X. T. . 2017 . Differential expression of fatty acid transporters and fatty acid synthesis-related genes in crop tissues of male and female pigeons (Columba livia domestica) during incubation and chick rearing . Br. Poult. Sci . 58 : 594 – 602 . Google Scholar CrossRef Search ADS PubMed Xu R. J. 1996 . Development of the newborn GI tract and its relation to colostrum/milk intake: A review . Reprod. Fertil. Dev . 8 : 35 – 48 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Mar 15, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off