CDKN1C (P57): one of the determinants of human endometrial stromal cell decidualization

CDKN1C (P57): one of the determinants of human endometrial stromal cell decidualization Abstract Decidualization is regulated by crosstalk of progesterone and the cAMP pathway. It involves extensive reprogramming of gene expression and includes a wide range of functions. To investigate how cell cycle regulatory genes drive the human endometrial stromal cell (ESC) exit cell cycle and enter differentiation, primary cultured ESC was treated with 8-Br-cAMP and MPA and cell cycle distribution was investigated by flow cytometry. High-throughput cell cycle regulatory gene expression was also studied by microarray. To validate the results of microarray chip, immunohistochemistry and semi-quantitative method of optical density were used to analyze the expression of cell cycle regulator proteins in proliferative phase of endometrium (n = 6) and early pregnancy decidua (n = 6). In addition, we selected cyclin-dependent kinase inhibitor 1c (CDKN1C, also known as P57) and cyclin-dependent kinase inhibitor 2b (CDKN2B, also known as P15) in order to study their role in the process of decidualization by the RNAi method. ESC was arrested at G0/G1 checkpoints during decidualization. Cell cycle regulatory genes P57 and P15 were upregulated, while cyclin D1 (CCND1), cyclin-dependent kinase 2 (CDK2), and cell division cycle protein 2 homolog (CDC2) were downregulated during ESC differentiation both in vitro and vivo. P57 siRNA impaired ESC decidualization and caused different morphological and ultrastructural changes as well as a relatively low secretion of prolactin, but P15 siRNA had no effects. We concluded that P15, CCND1, CDK2, and CDC2 may participate in ESC withdraw from the cell cycle and go into differentiation both in vitro and in vivo. P57 is one of the key determinants of ESC differentiation due to its effect on the cell cycle distribution, but its association with the decidua-specific transcription factor needs further investigation. Introduction A successful pregnancy entails two pivotal processes: correct embryo development and uterine differentiation. The latter involves secretory transformation of the glandular epithelium and decidualization (differentiation) of the endometrial stromal cell (ESC) into a distinct morphological appearance with a unique biosynthetic phenotype [1]. In cells surrounding the terminal spiral arteries and underlying the luminal epithelium, decidualization starts approximately 9 days after ovulation. It then continues throughout the entire gestational period, with the ratio of prolactin (PRL)-expressing cells in the decidua increasing progressively from 9.8% at early pregnancy to 57.8% at full term [2]. Decidualization is critical for the regulation of trophoblast growth and invasiveness, control of implantation window, angiogenesis, placenta formation, embryo selection, and establishment of maternofetal immuno-microenvironment [3]. On the other hand, abnormal decidualization can result in multiple disorders during pregnancy, such as implantation failure, miscarriages, preeclampsia, and intrauterine growth restriction, among others [1, 3–7]. It is generally accepted that cellular differentiation comes after cell cycle arrest. Cell proliferation and differentiation bears a reciprocal relationship [8–10]. Precursor cells continue their division before acquiring a fully differentiated status, while terminally differentiated cells coincidently undergo proliferation arrest and exit from the cell cycle [11]. However, the exact molecular mechanisms underlying cell cycle arrest of human ESCs during the decidualization remain poorly understood. Decidualization is regulated by a crosstalk between the progesterone pathway and the cAMP pathway [12]. Microarray studies have confirmed that decidualization involves extensive reprogramming of gene expression in ESCs [13]. These specifically expressing genes possess a wide array of functions, such as cell cycle regulation, cytoskeletal remodeling, angiogenesis, immune modulation, oxidative stress defense, ion and water transport, response to steroid hormones, deposition of ECM, modulation of transcription, epigenetic patterning, and posttranslational modifications [5, 14, 15]. Despite considerable advances, most of the researches used 80%–100% confluent ESCs for differentiation, while in other studies cells were treated by progesterone for up to 10 days. In these scenarios, contact inhibition among the cells might result and is unacceptable for the identification of cell cycle regulatory molecules, especially those controlled by progesterone and cAMP [16–19]. So far, most of our knowledge about the regulation of ESC differentiation has come from in vitro model systems [5, 20–22]. Decidualization can be induced in primary cultures of ESCs by incubating the cells with progesterone in combination with high level of cAMP [20]. In this study, by employing this model and 30%–40% confluent ESCs, we examined the cell cycle distribution during ESC differentiation by flow cytometry and the expression of cell cycle regulatory gene by high-throughput microarray analysis. Furthermore, we also tested the microarray results in human endometrial biopsy specimens. Our RNAi study demonstrated that P57 and not P15 is one of the determinants of ESC decidualization. Materials and methods This study was approved by the Medical Board of the Tongji Hospital of Huazhong University of Science and Technology, Wuhan, China. Informed consent was obtained from all participants. All efforts were made to conduct our studies involving human subjects in strict accordance with the declaration of Helsinki. Sample collection Endometrial tissues at proliferative phase were isolated from normally cycling women at diagnostic laparoscopy for fallopian tube obstruction (totally 23 cases: 1 case for stromal cell identification (supplemental materials); 3 cases for microarray assay; 3 cases for cell cycle analysis; 6 cases for immunohistochemistry; 3 cases for PRL test; 4 cases for transmission electron microscopy and small interfering RNA (siRNA) verification (supplemental materials); 3 cases for cell cycle analysis after siRNA transfection). Histological examination revealed that endometrium was normal in all the subjects. Endometrial dating was determined by menstrual history and histologically confirmed by a pathologist who was blind to clinical outcomes. Deciduae (six cases for immunohistochemistry) were collected from women who had been subjected to artificial abortion during the 7–10 weeks of pregnancy. Primary ESC culture and in vitro decidualization The tissues were collected into an Eagle phosphate-buffered saline (PBS) containing 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen Corp., Grand Island, NY), and then washed in DMEM/F12 (Invitrogen). The tissues were minced and enzymatically digested, and the ESCs were separated from epithelial cells and cultured as described previously [23]. Confluent ESCs (30%–40%) were cultured in phenol red-free DMEM/F12 (Invitrogen) without serum for 24 h. To elicit decidualization, the media were changed to phenol red-free DMEM/F12 containing 2% dextran-coated charcoal-treated FBS (DCC-FBS) (Hyclone Co., Logan, UT) with 0.5 mM 8-Br-cAMP and 10−6 M MPA (Sigma) for 4 days. The control group was maintained in phenol red-free DMEM/F12 with 2% DCC-FBS for 4 days. The culture medium was centrifuged at 800 g for 10 min. The PRL was determined by using a chemiluminescence assay (Bayer Corp., Vital GmbH, Fernwald, Germany). The sensitivity of the assay was 0.3 ng/ml. Cell number per well was counted on an automated cell counter (Alit International Trade Co., Ltd, Shanghai, China) using Trypan Blue (Goodbio Technology Co.) according to the manufacturer’s instructions. Messenger RNA microarray analysis Total RNA was extracted with TRIzol reagent (Invitrogen, Gaithersburg, MD, USA). RNA purification, cDNA synthesis, cRNA synthesis, purification, labeling, and hybridization to human cell cycle genome oligonucleotide microarrays (CapitalBio, Beijing, China) were performed by using a cRNA Amplification and Labeling Kit (CapitalBio, Beijing, China) by following the manufacturer's instructions. Slides were scanned with the LuxScan 10 KA microarray scanner (CapitalBio), and mRNA data were analyzed by using the LuxScan3.0 image analysis software package (CapitalBio). Genes with the signal intensity (Cy3 or Cy5)  > 800 were regarded as the expressed ones. Hybridization was performed on each of the materials (including three biological replicates and two technical replicates). Gene expression during ESC decidualization was detected by using the significance analysis of microarrays software package (SAM; Stanford University). Any gene with a false discovery rate less than 0.05 and a fold change no less than 2 were considered to be a differentially expressed one. Flow cytometrical determination of cell cycle For the flow cytometrical analysis of cell cycle, cells were trypsinized, collected by centrifugation, fixed by 70% ethanol at 4°C overnight, centrifuged again, and resuspended in PBS containing 0.5 μg/ml ribonuclease A at 37°C for 1 h, and then 50 μl (0.1 mg/ml) propidium iodide was added for 30 min at 4°C before analysis by FACScan (Becton Dickinson, San Jose, CA). Data were analyzed by utilizing Cell Quest software (Becton Dickinson). Immunohistochemical staining Tissue samples were fixed in formalin, paraffin-embedded, cut into 5-μm sections, and mounted onto slides for immunostaining. Slides were then deparaffinized and dehydrated through a series of xylene and ethanol washes. After a 5-min rinse in distilled water, an antigen-presenting step was performed by steaming the slides in 0.01 M sodium citrate buffer for 20 min, followed by removal of the staining jar from the steam chamber and cooling it for 20 min. Slides were rinsed for 5 min in PBS. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 5 min followed by a 5-min PBS wash. Nonspecific binding was blocked with 1.5% normal horse serum in PBS for 1 h at room temperature. Slides were incubated in the P57 (ABcam, Cambridge, UK), P15 (ABcam, Cambridge, UK), cyclin B1 (CCNB1) (Absin, Shanghai, China), cyclin D1 (CCND1) (ABcam, Cambridge, UK), cyclin A2 (CCNA2) (Absin, Shanghai, China), cyclin dependent kinase 2 (CDK2) (ABcam, Cambridge, UK), cell division cycle protein 20 (CDC20) (Absin, Shanghai, China), cell division cycle protein 6 (CDC6) (ABcam, Cambridge, UK), and cell division cycle protein 2 homolog (CDC2) (ProteinTech, Chicago, IL, USA) primary antibodies overnight at 4°C. The final concentration of each antibody was as follows: P57 1:250, P15 1:500, cyclin B1 1:200, cyclin D1 1:100, cyclin A2 1:200, CDK2 1:100, CDC20 1:200, CDC6 1:1000, CDC2 1:100. Afterwards, sections were incubated with the secondary antibody (Boster, Wuhan, China) for staining, then with avidin and biotinylated peroxidase at room temperature for 45 min, and finally with DAB (400 mg/ml) at room temperature for 5 min. The sections were exposed to hematoxylin serving as counterstain. The average optical density was analyzed by using an image analysis system (HPIAS-1000). Small interfering RNA transfection Small interfering RNAs were purchased from Invitrogen (sequences of P57: CCAAGCGCAAGAGAUCAGCGCCUGA; UCAGGCGCUGAUCUCUUGCGCUUGG; sequences of P15: GGAGAAGGUGCGACAGCUCCUGGAA; UUCCAGGAGCUGUCGCACCUUCUCC). ESCs were transfected with P57-siRNA or with control negative siRNA by using Lipofectamine 2000 (Invitrogen, Life Technologies) according to the manufacturer's instructions. The cells were then cultured and decidualized with 8-Br-cAMP and MPA as aforementioned. The transfection efficiency was validated by fluorescent photography and western blotting (Supplementary Figure S1). Transmission electron microscopy Cells were trypsinized, collected by centrifugation, and fixed with phosphate-buffered (pH 7.3) 2.5% glutaraldehyde and 2% paraformaldehyde mixture solution for 2 h at room temperature. The samples were washed with PBS, and then fixed with 1% osmium tetraoxide for 2 h for secondary fixation. After washing, the samples were embedded in Araldite 6005, and cut with a Leica EM FCS (Vienna, Austria) ultramicrotome. Semi-thin sections (1 μm) were stained by Toluidine blue-Azure II to select region of interest for the ensuing procedures. Thin sections (60–70 nm) were stained with uranyl acetate and lead citrate, examined and photographed under a LEO 906 E TEM (80 kV; Oberkochen, Germany). Statistical analysis Each experiment was performed at least three times and repeated on three different specimens. The results were expressed as the mean ± SEM. Normal distribution of the data was tested by the Shapiro-Wilk normality test. A Student t-test was used to analyze the average optical density of each protein in the proliferative stroma cell and decidua in vivo. Two-way analysis of variance (ANOVA) was performed on the cells treated with 8-br-cAMP plus MPA on days 0, 2, and 4 (D0, D2, and D4. respectively), followed by the SNK post hoc test. ANOVA was used to test the difference in cell cycle distribution between the treated and control group on the same days. A P < 0.05 was considered to be statistically significant. Results Cell cycle distribution during ESC decidualization ESCs were decidualized by progesterone and cAMP containing 2% charcoal-treated FBS (decidualization group) for 4 days and then cultured in DMEM-F12 containing only 2% charcoal-treated FBS as a control (control group). Flow cytometry showed that the percentage of cells in G0/1 phase increased during decidualization (65.7% ± 1.98% in D0, 84.80% ± 1.52% in D2, and 88.63% ± 1.48% in D4). Nonetheless, the percentage of cells in S phase decreased (18.2% ± 1.62% in D0, 3.92% ± 0.87% in D2, and 0.38% ± 0.10% in D4, respectively). Similarly, the percentage of cells in G2/M phase also dropped (15.47% ± 1.36% in D0, 11.20% ± 0.79% in D2, and 10.99% ± 0.64% in D4) (Figure 1). Figure 1. View largeDownload slide Cell cycle distribution during decidualization. (A) Cell cycle distribution in the process of ESC decidualization in vitro. The cells were analyzed after being cultured in DMEM/F12 containing 2% FBS (control group) or decidualization medium for 0 day, 2 days, and 4 days, respectively. N, control group; D, decidualization group. (B) The average cell cycle distribution of nondecidualized and decidualized ESC in D0, D2, and D4. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Figure 1. View largeDownload slide Cell cycle distribution during decidualization. (A) Cell cycle distribution in the process of ESC decidualization in vitro. The cells were analyzed after being cultured in DMEM/F12 containing 2% FBS (control group) or decidualization medium for 0 day, 2 days, and 4 days, respectively. N, control group; D, decidualization group. (B) The average cell cycle distribution of nondecidualized and decidualized ESC in D0, D2, and D4. Data represent mean ± SEM from three separate experiments. (*P < 0.05). We compared the decidualization group and the control group in terms of cell cycle distribution. The S phase percentage of the decidualization group was significantly lower in D2 and D4 (3.92% ± 0.87% and 0.38% ± 0.10%) than the control group (6.70% ± 0.77% and 5.22% ± 0.68%). The G0/G1 percentage of the decidualization group (84.80% ± 1.52% in D2 and 88.63% ± 1.48% in D4) ended up being higher than that of the control group in D2 (75.25% ± 1.73%) and D4 (85.17% ± 1.62%). The G2/M percentage of the decidualization group was lower than that of the control group in D2 (11.20% ± 0.79% and 18.05% ± 1.40%, respectively), and became similar in D4 (10.99% ± 0.64% vs 9.61% ± 0.97%). The above results suggested that ESCs were arrested at the G0/G1 phase during decidualization (Figure 1). Profiles of cell cycle regulatory genes during human ESC decidualization in vitro To explore how cell cycle regulatory genes control the differentiation of ESCs, we decidualized human ESCs by progesterone and cAMP. Cells at 30%–40% confluency were used in order to avoid contact inhibition. Then we detected the expression of 100 cell cycle regulatory genes by using a microarray chip. Two genes were found to be significantly upregulated, while seven genes were significantly downregulated in the decidualized group as compared to the control group. Among them, the P57 was upregulated with a fold change (FC) of 127.5903 on day 2 and 29.1919 on day 4. P15 was upregulated with an FC of 10.3344 on day 2 and 7.9224 on day 4. The downregulated genes (CCND1 , CCNA2, CCNB1, CDC2, CDC6, CDC20, and CDK2) are listed in Table 1. Table 1. The upregulated and downregulated genes after ESC decidualization in vitro. Upregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  Downregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  CDKN1C(P57)  127.5903  29.1919  CDK2  0.3883  0.4638  CDKN2B(P15)  10.3344  7.9224  CCNA2  0.3245  0.2976        CDC6  0.2546  0.4068        CDC20  0.2308          CCND1  0.1489  0.1775        CCNB1  0.1343  0.2710        CDC2  0.1006    Upregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  Downregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  CDKN1C(P57)  127.5903  29.1919  CDK2  0.3883  0.4638  CDKN2B(P15)  10.3344  7.9224  CCNA2  0.3245  0.2976        CDC6  0.2546  0.4068        CDC20  0.2308          CCND1  0.1489  0.1775        CCNB1  0.1343  0.2710        CDC2  0.1006    The table showed the exact fold change of the up and down cell cycle regulatory genes after 2 days and 4 days of induced decidualization. The analysis was repeated three times. D2, decidualization day 2; C2, control day 2; D4, decidualization day 4; C4, control day 4. View Large In vivo expression of cell cycle regulatory proteins To validate the results of the microarray chip in vivo, the expression of cell cycle regulator proteins in human endometrial biopsy specimens was immunohistochemically and desitometrically determined (Figure 2A). The specimens included endometria at proliferative phase (n = 6) and decidua at early pregnancy (n = 6). The expression of P57, P15, Cyclin D1, CDK2, and CDC2 was found to be consistent with the findings of microarray analysis. The P57 and P15 proteins were highly expressed in the cytoplasm and nucleus of decidual cells. In the proliferative endometrium, these two genes were hardly expressed in the cytoplasm of ESCs. Cyclin D1, CDK2, and CDC2 were expressed strongly in the stromal cells of the endometria at proliferative phase as compared to the decidual stromal cells (P < 0.05). Contrary to the microarray results, the expression of Cyclin B1, Cyclin A2, CDC6, and CDC20 was increased in the decidual stromal cells when compared to those of the proliferative ESCs (P < 0.05). The average optical densities of each protein in proliferative and decidualized stromal cells are listed in Figure 2B. Figure 2. View largeDownload slide Cell cycle regulatory protein expression in vivo. (A) Immunohistochemical staining of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Scale bar = 20 × 100 μm. (B) Average optical densities of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Each group has six individual patients, and three different slides from each patient were analyzed. Data represented mean ± SEM (*P < 0.05). Figure 2. View largeDownload slide Cell cycle regulatory protein expression in vivo. (A) Immunohistochemical staining of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Scale bar = 20 × 100 μm. (B) Average optical densities of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Each group has six individual patients, and three different slides from each patient were analyzed. Data represented mean ± SEM (*P < 0.05). Downregulated P57 inhibits ESC decidualization Among the five genes that presented similar expression pattern, the two CDKIs (P57 and P15) had a strong expression in decidual stromal cells, suggesting that the two molecules may be crucial to the G0/G1 arrest during ESC decidualization. Therefore, the two CDKIs were singled out for further evaluation of their roles in decidualization by the RNAi method. The ESCs had undergone a series of typical morphological changes after decidualization. Four days after induced decidualization, they transformed from spindle-shaped cells into larger polygonal epithemlioid cells with a larger nucleus (Figure 3A1 and A2). Apart from the typical morphological changes, the decidualized ESCs secreted significantly more PRL than their nondecidualized counterparts, and PRL is widely known as a biomarker of decidualization (Figure 3B1). After P57 was downregulated, the decidualization of ESCs was partially inhibited, as indicated by less typical morphological changes under an inverted microscope (Figure 3A3). The concentration of PRL per cell in the culture medium decreased by more than 50% when compared to the negatively transfected cells (P < 0.05) 2 and 4 days after the induced decidualization (Figure 3B2). However, the downregulation of P15 did not seem to exert comparable effect on the decidualization of ESCs. After induced decidualization, the P15-transfected cells showed morphological features similar to those observed in the negatively transfected cells (Figure 3A4). Two and four days after the induced decidualization, the PRL secretion per cell in the P15-transfected cells was also close to that in the negatively transfected group (Figure 3B3). The ultrastructural morphology of the decidualized ESCs was observed under a transmission electron microscope. In the negatively transfected cells, decidualized ESCs were round and large sized, with a bigger euchromatic nucleus, conspicuous nucleoli, and a well-developed network of rough endoplasmic reticulum (Figure 3C1–C3). Also noted were several vesicles in the intracellular matrix and a number of condensed mitochondria. Such ultrastructural changes were indicative of active secretion of the decidualized ESCs. In the P57 siRNA-transfected cells, the decidualized ESCs had smaller cell nuclei and their rough endoplasmic reticula were less developed, indicating that decidualization was diminished (Figure 3C4–C6). Figure 3. View largeDownload slide Downregulation of P57 inhibits ESC decidualization. (A) Morphological changes of decidualized ESC after the downregulation of P57 or P15. (B) PRL secretion change of decidualized ESC after the downregulation of P57 or P15. (C) Ultrastructure changes of decidualized ESC after the downregulation of P57. (D) Cell cycle distribution changes of decidualized ESC after the downregulation of P57. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Figure 3. View largeDownload slide Downregulation of P57 inhibits ESC decidualization. (A) Morphological changes of decidualized ESC after the downregulation of P57 or P15. (B) PRL secretion change of decidualized ESC after the downregulation of P57 or P15. (C) Ultrastructure changes of decidualized ESC after the downregulation of P57. (D) Cell cycle distribution changes of decidualized ESC after the downregulation of P57. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Downregulated P57 inhibited ESC decidualization by interfering G0/G1 arrest Two days after decidualization, the cell number in S phase of the P57 transfection group was increased compared to the control group (2.05% ± 0.44% vs 6.48% ± 3.14% respectively, P < 0.01). The cell number at G0/G1 phase of the P57-transfected group was decreased in comparison to the control group (91.55% ± 2.21% vs 82.54% ± 4.64%, P < 0.01) and the cell number at G2/M phase was increased compared with that in the control group (6.41% ± 1.99% vs 10.97% ± 1.95%, P < 0.01). Four days after decidualization, the cell number at S phase in the P57-transfected group was increased when compared with the control group (1.51% ± 0.27% vs 3.06% ± 1.40%, respectively, P < 0.05) (Figure 3D). These findings indicated that downregulated P57 adversely interferes with the cell cycle G0/G1 arrest, thereby impeding decidualization of ESCs. Discussion ESC decidualization is essential for normal pregnancy [3, 5, 24]. and proper decidualization requires cell cycle exit in combination with differentiation. The cell cycle is precisely regulated at G1-to-S and G2-to-M checkpoints. Most of the cells undergoing differentiation are arrested at the G1-to-S checkpoint, i.e., at the G0/G1 phase. With many cell types, such as ovarian cancer cells, cAMP triggers, in molecular term, the arrest of the G0/G1 cell cycle [25]. Progesterone was also shown to be able to terminate the cell cycle, thereby inhibiting proliferation [26]. This study showed that the percentage of cells was increased in the G0/1 phase and decreased in S phase upon the treatment by a cAMP plus MPA for a period of 2 to 4 days, suggesting that cell cycle was arrested at the G0/1 phase. This result was consistent with a previous finding in immortalized ESCs decidualized by 17β-estradiol, MPA, and cAMP at 30% cell confluency [27]. G1-to-S checkpoints are strictly regulated by cyclins, cyclin-dependent kinases (CDKs) and CDK inhibitors (CDKIs) [28]. Cyclin D1 forms a complex with CDK4 or CDK6, whose activity is required for the transition from G1 to S phase. CyclinD1-CDK4 complex promotes passage through the G1 to S phase by inhibiting the Rb protein via phosphorylation [29]. CyclinE-CDK2 complex is also essential for the G1-to-S transition [30]. CDC2, also known as CDK1, binds to G1/S cyclin and is critical for the preparation of S phase (e.g. duplication of centromeres or the spindle pole bodies) [31]. Using 30%–40% confluent primary cultured ESCs, we examined the changes in the profile of cell cycle-regulating genes during ESC differentiation by employing high-throughput microarray. Furthermore, we validated the in vitro result in histological sections of decidua at early pregnancy and ESCs in proliferative phase. We found that the expression of Cyclin D1, CDK2, and CDC2 was lower in the decidualized cells than in the control cells both in vitro and in vivo, which indicated that they might play an important role in the G1/G0 cell arrest during endometrial cell decidualization. CDKI negatively regulates CDK activity and plays a crucial role in the G0/G1 cell cycle arrest. Based on the sequence homology and CDK specificity, CDKIs have two major families, i.e. INK4 and CIP/KIP. The CIP/KIP family consists of three structurally related members: P21, P27, and P57 while INK4 includes P16, P15, and P19 [32, 33]. Both in vitro and in vivo, P57 and P15 were highly expressed in the differentiated ESCs. P57 is a paternally imprinted CDKI and exerts its anti-proliferative effect by stopping cells in the G1 phase in a wide array of tissues and cell lines [34]. The 310-helix region of P57 is indispensable for the inhibition of CyclinA/CDK2 and CyclinE/CDK2 complex [35]. P15 is also a tight-binding CDKI of several G1 cyclin-CDK complexes, and it inhibits the cell cycle at several checkpoints [36, 37]. CDKIs are implicated, both directly and indirectly, in the regulation of cell differentiation and its members are important for integrating cell cycle exit and differentiation [38]. We further studied the two upregulated CDKIs (P57 and P15) to understand their specific roles in the ESC decidualization. As aforementioned, siRNA study showed that the expression of P57 gene in ESCs was downregulated and ESCs were decidualized by MPA and cAMP at the same time. After P57 downregulation, decidualization of human ESCs was impaired, as manifested by corresponding morphological changes, and a relatively low secretion of PRL when compared to the controls. As a member of CDKIs, P57 prevents cells from entering S phase by interacting with the D-type cyclins and a number of CDKs [35, 38]. Downregulation of P57 lessened such inhibition and encouraged ESCs to go into S phase 2 and 4 days after treatment with MPA + cAMP, thus attenuating the decidualization. Conclusively, P57 regulates ESC decidualization by affecting the cell cycle distribution. Nonetheless, CDKIs can work independent of CDK regulation. For instance, the direct binding of P57 to MyoD has been reported to stabilize MyoD, thereby promoting myoblast differentiation [39]. Whether P57 can regulate decidua-specific transcription factors warrants further investigations. Moreover, we also found that the expression of P15 was elevated in decidualized ESCs. However, downregulation of P15 in ESCs did not seem to interfere with the process of decidualization. This can be explained by two possible reasons. First, P15 is not functionally important in the ESC decidualization. As we know it, just because some proteins are highly expressed that does not mean they are functionally important in some biological process. Second, P15 can be functionally compensated by other molecules, such as P57, which was found to be important in the process of human ESC decidualization. A question will naturally present itself: How cAMP and progesterone pathways upregulate the expression of P57? In our previous studies, we confirmed several upstream regulators of P57 that play crucial roles in the ESC decidualization [23, 40]. We found that the activation of cAMP and the progesterone pathways could downregulate the has-miR-222/221, thereby leading to the overexpression of P57 during decidualization [23]. Additionally, we previously found that homeobox A10 (HOXA10), one of the progesterone receptors that directly regulate genes, was downregulated during decidualization [40]. The reduced expression of HOXA10 might contribute to the upregulation of P57 during ESC decidualization [40]. Other studies also exhibited that Forkhead Box O1A (FOXO1) controlled ESC differentiation by regulating P57 expression [13, 41]. On the basis of above-mentioned findings, we hereby proposed a model that explains how ESC exit the cell cycle and go into differentiation (Figure 4). Figure 4. View largeDownload slide A proposed model for ESC exiting the cell cycle and entering into differentiation. Figure 4. View largeDownload slide A proposed model for ESC exiting the cell cycle and entering into differentiation. In conclusion, in this study we proved that cell cycle regulatory genes P57 and P15 are upregulated, while Cyclin D1, CDK2, and CDC2 are downregulated during the ESC differentiation both in vitro and in vivo. Furthermore, we demonstrated that P57 is one of the key regulators that modulates ESC differentiation by controlling cell cycle distribution. The interaction between P57 and decidua-specific transcription factors awaits further investigations. Supplementary data Supplementary data are available at BIOLRE online. Supplementary Figure S1. Downregulation of P57 and P15 protein by P57 siRNA and P15 siRNA. (A) Immunofluorescence detection of vimentin in primary cultured ESC. (B) Fluorescent photography of ESCs after transfection of Cy3-labeled control siRNA. (C) Expression of P57 and P15 protein after transfection of P57 siRNA and P15 siRNA. The level of protein expression for P57 and P15 was calculated as a ratio for their densitometric reading to that of the corresponding GAPDH. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Acknowledgments We are indebted to all the staff in the Reproductive Center who assisted in the collection of human samples. Authors' contributor LW and HY participated in study execution, analysis, manuscript drafting, and critical discussion. LH performed the cell cycle and microarray experiments. DH conducted the microarray experiments. SM completed the immunostaining. XS, LJ, JS, and LJ assisted in the manuscript drafting. JFM assisted in the English language revision. KQ and HZ are involved in study design, paper revision and final check, and approval. Conflict of interest: The authors have declared that no conflict of interest exists. Footnotes † Grant support: This work was supported by NSFC 81571464 and NSFC 81170583. References 1. Strowitzki T, Germeyer A, Popovici R, von Wolff M. The human endometrium as a fertility-determining factor. Hum Reprod Update  2006; 12: 617– 630. Google Scholar CrossRef Search ADS PubMed  2. Telgmann R, Gellersen B. Marker genes of decidualization: activation of the decidual prolactin gene. Hum Reprod Update  1998; 4: 472– 479. Google Scholar CrossRef Search ADS PubMed  3. Cha J, Sun X, Dey SK. Mechanisms of implantation: strategies for successful pregnancy. Nat Med  2012; 18: 1754– 1767. Google Scholar CrossRef Search ADS PubMed  4. Zhang S, Lin H, Kong S, Wang S, Wang H, Wang H, Armant DR. Physiological and molecular determinants of embryo implantation. Mol Aspects Med  2013; 34: 939– 980. Google Scholar CrossRef Search ADS PubMed  5. Gellersen B, Brosens JJ. Cyclic decidualization of the human endometrium in reproductive health and failure. Endocr Rev  2014; 35: 851– 905. Google Scholar CrossRef Search ADS PubMed  6. Sarno J, Schatz F, Huang SJ, Lockwood C, Taylor HS. Thrombin and interleukin-1beta decrease HOX gene expression in human first trimester decidual cells: implications for pregnancy loss. Mol Hum Reprod  2009; 15: 451– 457. Google Scholar CrossRef Search ADS PubMed  7. Yang H, Zhou Y, Edelshain B, Schatz F, Lockwood CJ, Taylor HS. FKBP4 is regulated by HOXA10 during decidualization and in endometriosis. Reproduction  2012; 143: 531– 538. Google Scholar CrossRef Search ADS PubMed  8. Wille JJ Jr, Scott RE. Suppression of tumorigenicity by the cell-cycle-dependent control of cellular differentiation and proliferation. Int J Cancer  1986; 37: 875– 881. Google Scholar CrossRef Search ADS PubMed  9. Kolly C, Suter MM, Muller EJ. Proliferation, cell cycle exit, and onset of terminal differentiation in cultured keratinocytes: pre-programmed pathways in control of c-Myc and Notch1 prevail over extracellular calcium signals. J Invest Dermatol  2005; 124: 1014– 1025. Google Scholar CrossRef Search ADS PubMed  10. Rogers PAW, Abberton KM. Endometrial arteriogenesis: vascular smooth muscle cell proliferation and differentiation during the menstrual cycle and changes associated with endometrial bleeding disorders. Microsc Res Tech  2003; 60: 412– 419. Google Scholar CrossRef Search ADS PubMed  11. Ruijtenberg S, van den Heuvel S. Coordinating cell proliferation and differentiation: antagonism between cell cycle regulators and cell type-specific gene expression. Cell Cycle  2016; 15: 196– 212. Google Scholar CrossRef Search ADS PubMed  12. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S. Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine  1997; 6: 301– 307. Google Scholar CrossRef Search ADS PubMed  13. Takano M, Lu Z, Goto T, Fusi L, Higham J, Francis J, Withey A, Hardt J, Cloke B, Stavropoulou AV, Ishihara O, Lam EW et al.   Transcriptional cross talk between the forkhead transcription factor forkhead box O1A and the progesterone receptor coordinates cell cycle regulation and differentiation in human endometrial stromal cells. Mol Endocrinol  2007; 21: 2334– 2349. Google Scholar CrossRef Search ADS PubMed  14. Kuroda K, Venkatakrishnan R, Salker MS, Lucas ES, Shaheen F, Kuroda M, Blanks A, Christian M, Quenby S, Brosens JJ. Induction of 11beta-HSD 1 and activation of distinct mineralocorticoid receptor- and glucocorticoid receptor-dependent gene networks in decidualizing human endometrial stromal cells. Mol Endocrinol  2013; 27: 192– 202. Google Scholar CrossRef Search ADS PubMed  15. Tierney EP, Tulac S, Huang ST, Giudice LC. Activation of the protein kinase a pathway in human endometrial stromal cells reveals sequential categorical gene regulation. Physiol Genomics  2003; 16: 47– 66. Google Scholar CrossRef Search ADS PubMed  16. Akiba J, Murakami Y, Noda M, Watari K, Ogasawara S, Yoshida T, Kawahara A, Sanada S, Yasumoto M, Yamaguchi R, Kage M, Kuwano M et al.   N-myc downstream regulated gene1/Cap43 overexpression suppresses tumor growth by hepatic cancer cells through cell cycle arrest at the G0/G1 phase. Cancer Lett  2011; 310: 25– 34. Google Scholar CrossRef Search ADS PubMed  17. de Barros FR, Goissis MD, Caetano HV, Paula-Lopes FF, Peres MA, Assumpcao ME, Visintin JA. Serum starvation and full confluency for cell cycle synchronization of domestic cat (felis catus) foetal fibroblasts. Reprod Domest Anim  2010; 45: 38– 41. Google Scholar CrossRef Search ADS PubMed  18. Mordica WJ, Woods KM, Clem RJ, Passarelli AL, Chapes SK. Macrophage cell lines use CD81 in cell growth regulation. In Vitro Cell Dev Biol Anim  2009; 45: 213– 225. Google Scholar CrossRef Search ADS PubMed  19. Wayne J, Sielski J, Rizvi A, Georges K, Hutter D. ERK regulation upon contact inhibition in fibroblasts. Mol Cell Biochem  2006; 286: 181– 189. Google Scholar CrossRef Search ADS PubMed  20. Cho JH, Yoon M-S, Koo JB, Kim YS, Lee K-S, Lee JH, Han J-S. The progesterone receptor as a transcription factor regulates phospholipase D1 expression through independent activation of protein kinase A and Ras during 8-Br-cAMP-induced decidualization in human endometrial stromal cells. Biochem J  2011; 436: 181– 191. Google Scholar CrossRef Search ADS PubMed  21. Menkhorst E, Salamonsen LA, Zhang J, Harrison CA, Gu J, Dimitriadis E. Interleukin 11 and activin A synergise to regulate progesterone-induced but not cAMP-induced decidualization. J Reprod Immunol  2010; 84: 124– 132. Google Scholar CrossRef Search ADS PubMed  22. Wang DF, Minoura H, Sugiyama T, Tanaka K, Kawato H, Toyoda N, Sagawa N. Analysis on the promoter region of human decidual prolactin gene in the progesterone-induced decidualization and cAMP-induced decidualization of human endometrial stromal cells. Mol Cell Biochem  2007; 300: 239– 247. Google Scholar CrossRef Search ADS PubMed  23. Qian K, Hu L, Chen H, Li H, Liu N, Li Y, Ai J, Zhu G, Tang Z, Zhang H. Hsa-miR-222 is involved in differentiation of endometrial stromal cells in vitro. Endocrinology  2009; 150: 4734– 4743. Google Scholar CrossRef Search ADS PubMed  24. Zhang S, Lin HY, Kong SB, Wang SM, Wang HM, Wang HB, Armant DR. Physiological and molecular determinants of embryo implantation. Mol Aspects Med  2013; 34: 939– 980. Google Scholar CrossRef Search ADS PubMed  25. Horiuchi S, Kato K, Suga S, Takahashi A, Ueoka Y, Arima T, Nishida J, Hachisuga T, Kawarabayashi T, Wake N. Expression of progesterone receptor B is associated with G0/G1 arrest of the cell cycle and growth inhibition in NIH3T3 cells. Exp Cell Res  2005; 305: 233– 243. Google Scholar CrossRef Search ADS PubMed  26. Gellersen B, Brosens J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol  2003; 178: 357– 372. Google Scholar CrossRef Search ADS PubMed  27. Logan PC, Steiner M, Ponnampalam AP, Mitchell MD. Cell cycle regulation of human endometrial stromal cells during decidualization. Reprod Sci  2012; 19: 883– 894. Google Scholar CrossRef Search ADS PubMed  28. Tan J, Raja S, Davis MK, Tawfik O, Dey SK, Das SK. Evidence for coordinated interaction of cyclin D3 with p21 and cdk6 in directing the development of uterine stromal cell decidualization and polyploidy during implantation. Mech Dev  2002; 111: 99– 113. Google Scholar CrossRef Search ADS PubMed  29. Casimiro MC, Velasco-Velazquez M, Aguirre-Alvarado C, Pestell RG. Overview of cyclins D1 function in cancer and the CDK inhibitor landscape: past and present. Expert Opin Investig Drugs  2014; 23: 295– 304. Google Scholar CrossRef Search ADS PubMed  30. He L, Lu N, Dai Q, Zhao Y, Zhao L, Wang H, Li Z, You Q, Guo Q. Wogonin induced G1 cell cycle arrest by regulating Wnt/?-catenin signaling pathway and inactivating CDK8 in human colorectal cancer carcinoma cells. Toxicology  2013; 312: 36– 47. Google Scholar CrossRef Search ADS PubMed  31. Fisher D, Krasinska L, Coudreuse D, Novak B. Phosphorylation network dynamics in the control of cell cycle transitions. J Cell Sci  2012; 125: 4703– 4711. Google Scholar CrossRef Search ADS PubMed  32. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev  1999; 13: 1501– 1512. Google Scholar CrossRef Search ADS PubMed  33. Canepa ET, Scassa ME, Ceruti JM, Marazita MC, Carcagno AL, Sirkin PF, Ogara MF. INK4 proteins, a family of mammalian CDK inhibitors with novel biological functions. IUBMB Life  2007; 59: 419– 426. Google Scholar CrossRef Search ADS PubMed  34. Kerns SL, Guevara-Aguirre J, Andrew S, Geng J, Guevara C, Guevara-Aguirre M, Guo M, Oddoux C, Shen Y, Zurita A, Rosenfeld RG, Ostrer H et al.   A novel variant in CDKN1C is associated with intrauterine growth restriction, short stature, and early-adulthood-onset diabetes. J Clin Endocrinol Metab  2014; 99: E2117– E2122. Google Scholar CrossRef Search ADS PubMed  35. Hashimoto Y, Kohri K, Kaneko Y, Morisaki H, Kato T, Ikeda K, Nakanishi M. Critical role for the 310 helix region of p57 Kip2 in Cyclin-dependent kinase 2 inhibition and growth suppression. J Biol Chem  1998; 273: 16544– 16550. Google Scholar CrossRef Search ADS PubMed  36. Pita JM, Figueiredo IF, Moura MM, Leite V, Cavaco BM. Cell cycle deregulation and TP53 and RAS mutations are major events in poorly differentiated and undifferentiated thyroid carcinomas. J Clin Endocrinol Metab  2014; 99: E497– E507. Google Scholar CrossRef Search ADS PubMed  37. Mahmoud AI, Kocabas F, Muralidhar SA, Kimura W, Koura AS, Thet S, Porrello ER, Sadek HA. Meis1 regulates postnatal cardiomyocyte cell cycle arrest. Nature  2013; 497: 249– 253. Google Scholar CrossRef Search ADS PubMed  38. Schmetsdorf S, Gartner U, Arendt T. Expression of cell cycle-related proteins in developing and adult mouse hippocampus. Int J Dev Neurosci  2005; 23: 101– 112. Google Scholar CrossRef Search ADS PubMed  39. Reynaud EG, Leibovitch MP, Tintignac LA, Pelpel K, Guillier M, Leibovitch SA. Stabilization of MyoD by Direct Binding to p57 Kip2. J Biol Chem  2000; 275: 18767– 18776. Google Scholar CrossRef Search ADS PubMed  40. Qian K, Chen H, Wei Y, Hu J, Zhu G. Differentiation of endometrial stromal cells in vitro: down-regulation of suppression of the cell cycle inhibitor p57 by HOXA10? Mol Hum Repro d 2005; 11: 245– 251. Google Scholar CrossRef Search ADS   41. Labied S, Kajihara T, Madureira PA, Fusi L, Jones MC, Higham JM, Varshochi R, Francis JM, Zoumpoulidou G, Essafi A, Fernandez de Mattos S, Lam EW et al.   Progestins regulate the expression and activity of the forkhead transcription factor FOXO1 in differentiating human endometrium. Mol Endocrinol  2006; 20: 35– 44. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Biology of Reproduction Oxford University Press

CDKN1C (P57): one of the determinants of human endometrial stromal cell decidualization

9 pages
Read Article

Loading next page...
 
/lp/ou_press/cdkn1c-p57-one-of-the-determinants-of-human-endometrial-stromal-cell-pjWlwqjpFg
Publisher
Society for the Study of Reproduction
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0006-3363
eISSN
1529-7268
D.O.I.
10.1093/biolre/iox187
Publisher site
See Article on Publisher Site

Abstract

Abstract Decidualization is regulated by crosstalk of progesterone and the cAMP pathway. It involves extensive reprogramming of gene expression and includes a wide range of functions. To investigate how cell cycle regulatory genes drive the human endometrial stromal cell (ESC) exit cell cycle and enter differentiation, primary cultured ESC was treated with 8-Br-cAMP and MPA and cell cycle distribution was investigated by flow cytometry. High-throughput cell cycle regulatory gene expression was also studied by microarray. To validate the results of microarray chip, immunohistochemistry and semi-quantitative method of optical density were used to analyze the expression of cell cycle regulator proteins in proliferative phase of endometrium (n = 6) and early pregnancy decidua (n = 6). In addition, we selected cyclin-dependent kinase inhibitor 1c (CDKN1C, also known as P57) and cyclin-dependent kinase inhibitor 2b (CDKN2B, also known as P15) in order to study their role in the process of decidualization by the RNAi method. ESC was arrested at G0/G1 checkpoints during decidualization. Cell cycle regulatory genes P57 and P15 were upregulated, while cyclin D1 (CCND1), cyclin-dependent kinase 2 (CDK2), and cell division cycle protein 2 homolog (CDC2) were downregulated during ESC differentiation both in vitro and vivo. P57 siRNA impaired ESC decidualization and caused different morphological and ultrastructural changes as well as a relatively low secretion of prolactin, but P15 siRNA had no effects. We concluded that P15, CCND1, CDK2, and CDC2 may participate in ESC withdraw from the cell cycle and go into differentiation both in vitro and in vivo. P57 is one of the key determinants of ESC differentiation due to its effect on the cell cycle distribution, but its association with the decidua-specific transcription factor needs further investigation. Introduction A successful pregnancy entails two pivotal processes: correct embryo development and uterine differentiation. The latter involves secretory transformation of the glandular epithelium and decidualization (differentiation) of the endometrial stromal cell (ESC) into a distinct morphological appearance with a unique biosynthetic phenotype [1]. In cells surrounding the terminal spiral arteries and underlying the luminal epithelium, decidualization starts approximately 9 days after ovulation. It then continues throughout the entire gestational period, with the ratio of prolactin (PRL)-expressing cells in the decidua increasing progressively from 9.8% at early pregnancy to 57.8% at full term [2]. Decidualization is critical for the regulation of trophoblast growth and invasiveness, control of implantation window, angiogenesis, placenta formation, embryo selection, and establishment of maternofetal immuno-microenvironment [3]. On the other hand, abnormal decidualization can result in multiple disorders during pregnancy, such as implantation failure, miscarriages, preeclampsia, and intrauterine growth restriction, among others [1, 3–7]. It is generally accepted that cellular differentiation comes after cell cycle arrest. Cell proliferation and differentiation bears a reciprocal relationship [8–10]. Precursor cells continue their division before acquiring a fully differentiated status, while terminally differentiated cells coincidently undergo proliferation arrest and exit from the cell cycle [11]. However, the exact molecular mechanisms underlying cell cycle arrest of human ESCs during the decidualization remain poorly understood. Decidualization is regulated by a crosstalk between the progesterone pathway and the cAMP pathway [12]. Microarray studies have confirmed that decidualization involves extensive reprogramming of gene expression in ESCs [13]. These specifically expressing genes possess a wide array of functions, such as cell cycle regulation, cytoskeletal remodeling, angiogenesis, immune modulation, oxidative stress defense, ion and water transport, response to steroid hormones, deposition of ECM, modulation of transcription, epigenetic patterning, and posttranslational modifications [5, 14, 15]. Despite considerable advances, most of the researches used 80%–100% confluent ESCs for differentiation, while in other studies cells were treated by progesterone for up to 10 days. In these scenarios, contact inhibition among the cells might result and is unacceptable for the identification of cell cycle regulatory molecules, especially those controlled by progesterone and cAMP [16–19]. So far, most of our knowledge about the regulation of ESC differentiation has come from in vitro model systems [5, 20–22]. Decidualization can be induced in primary cultures of ESCs by incubating the cells with progesterone in combination with high level of cAMP [20]. In this study, by employing this model and 30%–40% confluent ESCs, we examined the cell cycle distribution during ESC differentiation by flow cytometry and the expression of cell cycle regulatory gene by high-throughput microarray analysis. Furthermore, we also tested the microarray results in human endometrial biopsy specimens. Our RNAi study demonstrated that P57 and not P15 is one of the determinants of ESC decidualization. Materials and methods This study was approved by the Medical Board of the Tongji Hospital of Huazhong University of Science and Technology, Wuhan, China. Informed consent was obtained from all participants. All efforts were made to conduct our studies involving human subjects in strict accordance with the declaration of Helsinki. Sample collection Endometrial tissues at proliferative phase were isolated from normally cycling women at diagnostic laparoscopy for fallopian tube obstruction (totally 23 cases: 1 case for stromal cell identification (supplemental materials); 3 cases for microarray assay; 3 cases for cell cycle analysis; 6 cases for immunohistochemistry; 3 cases for PRL test; 4 cases for transmission electron microscopy and small interfering RNA (siRNA) verification (supplemental materials); 3 cases for cell cycle analysis after siRNA transfection). Histological examination revealed that endometrium was normal in all the subjects. Endometrial dating was determined by menstrual history and histologically confirmed by a pathologist who was blind to clinical outcomes. Deciduae (six cases for immunohistochemistry) were collected from women who had been subjected to artificial abortion during the 7–10 weeks of pregnancy. Primary ESC culture and in vitro decidualization The tissues were collected into an Eagle phosphate-buffered saline (PBS) containing 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen Corp., Grand Island, NY), and then washed in DMEM/F12 (Invitrogen). The tissues were minced and enzymatically digested, and the ESCs were separated from epithelial cells and cultured as described previously [23]. Confluent ESCs (30%–40%) were cultured in phenol red-free DMEM/F12 (Invitrogen) without serum for 24 h. To elicit decidualization, the media were changed to phenol red-free DMEM/F12 containing 2% dextran-coated charcoal-treated FBS (DCC-FBS) (Hyclone Co., Logan, UT) with 0.5 mM 8-Br-cAMP and 10−6 M MPA (Sigma) for 4 days. The control group was maintained in phenol red-free DMEM/F12 with 2% DCC-FBS for 4 days. The culture medium was centrifuged at 800 g for 10 min. The PRL was determined by using a chemiluminescence assay (Bayer Corp., Vital GmbH, Fernwald, Germany). The sensitivity of the assay was 0.3 ng/ml. Cell number per well was counted on an automated cell counter (Alit International Trade Co., Ltd, Shanghai, China) using Trypan Blue (Goodbio Technology Co.) according to the manufacturer’s instructions. Messenger RNA microarray analysis Total RNA was extracted with TRIzol reagent (Invitrogen, Gaithersburg, MD, USA). RNA purification, cDNA synthesis, cRNA synthesis, purification, labeling, and hybridization to human cell cycle genome oligonucleotide microarrays (CapitalBio, Beijing, China) were performed by using a cRNA Amplification and Labeling Kit (CapitalBio, Beijing, China) by following the manufacturer's instructions. Slides were scanned with the LuxScan 10 KA microarray scanner (CapitalBio), and mRNA data were analyzed by using the LuxScan3.0 image analysis software package (CapitalBio). Genes with the signal intensity (Cy3 or Cy5)  > 800 were regarded as the expressed ones. Hybridization was performed on each of the materials (including three biological replicates and two technical replicates). Gene expression during ESC decidualization was detected by using the significance analysis of microarrays software package (SAM; Stanford University). Any gene with a false discovery rate less than 0.05 and a fold change no less than 2 were considered to be a differentially expressed one. Flow cytometrical determination of cell cycle For the flow cytometrical analysis of cell cycle, cells were trypsinized, collected by centrifugation, fixed by 70% ethanol at 4°C overnight, centrifuged again, and resuspended in PBS containing 0.5 μg/ml ribonuclease A at 37°C for 1 h, and then 50 μl (0.1 mg/ml) propidium iodide was added for 30 min at 4°C before analysis by FACScan (Becton Dickinson, San Jose, CA). Data were analyzed by utilizing Cell Quest software (Becton Dickinson). Immunohistochemical staining Tissue samples were fixed in formalin, paraffin-embedded, cut into 5-μm sections, and mounted onto slides for immunostaining. Slides were then deparaffinized and dehydrated through a series of xylene and ethanol washes. After a 5-min rinse in distilled water, an antigen-presenting step was performed by steaming the slides in 0.01 M sodium citrate buffer for 20 min, followed by removal of the staining jar from the steam chamber and cooling it for 20 min. Slides were rinsed for 5 min in PBS. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 5 min followed by a 5-min PBS wash. Nonspecific binding was blocked with 1.5% normal horse serum in PBS for 1 h at room temperature. Slides were incubated in the P57 (ABcam, Cambridge, UK), P15 (ABcam, Cambridge, UK), cyclin B1 (CCNB1) (Absin, Shanghai, China), cyclin D1 (CCND1) (ABcam, Cambridge, UK), cyclin A2 (CCNA2) (Absin, Shanghai, China), cyclin dependent kinase 2 (CDK2) (ABcam, Cambridge, UK), cell division cycle protein 20 (CDC20) (Absin, Shanghai, China), cell division cycle protein 6 (CDC6) (ABcam, Cambridge, UK), and cell division cycle protein 2 homolog (CDC2) (ProteinTech, Chicago, IL, USA) primary antibodies overnight at 4°C. The final concentration of each antibody was as follows: P57 1:250, P15 1:500, cyclin B1 1:200, cyclin D1 1:100, cyclin A2 1:200, CDK2 1:100, CDC20 1:200, CDC6 1:1000, CDC2 1:100. Afterwards, sections were incubated with the secondary antibody (Boster, Wuhan, China) for staining, then with avidin and biotinylated peroxidase at room temperature for 45 min, and finally with DAB (400 mg/ml) at room temperature for 5 min. The sections were exposed to hematoxylin serving as counterstain. The average optical density was analyzed by using an image analysis system (HPIAS-1000). Small interfering RNA transfection Small interfering RNAs were purchased from Invitrogen (sequences of P57: CCAAGCGCAAGAGAUCAGCGCCUGA; UCAGGCGCUGAUCUCUUGCGCUUGG; sequences of P15: GGAGAAGGUGCGACAGCUCCUGGAA; UUCCAGGAGCUGUCGCACCUUCUCC). ESCs were transfected with P57-siRNA or with control negative siRNA by using Lipofectamine 2000 (Invitrogen, Life Technologies) according to the manufacturer's instructions. The cells were then cultured and decidualized with 8-Br-cAMP and MPA as aforementioned. The transfection efficiency was validated by fluorescent photography and western blotting (Supplementary Figure S1). Transmission electron microscopy Cells were trypsinized, collected by centrifugation, and fixed with phosphate-buffered (pH 7.3) 2.5% glutaraldehyde and 2% paraformaldehyde mixture solution for 2 h at room temperature. The samples were washed with PBS, and then fixed with 1% osmium tetraoxide for 2 h for secondary fixation. After washing, the samples were embedded in Araldite 6005, and cut with a Leica EM FCS (Vienna, Austria) ultramicrotome. Semi-thin sections (1 μm) were stained by Toluidine blue-Azure II to select region of interest for the ensuing procedures. Thin sections (60–70 nm) were stained with uranyl acetate and lead citrate, examined and photographed under a LEO 906 E TEM (80 kV; Oberkochen, Germany). Statistical analysis Each experiment was performed at least three times and repeated on three different specimens. The results were expressed as the mean ± SEM. Normal distribution of the data was tested by the Shapiro-Wilk normality test. A Student t-test was used to analyze the average optical density of each protein in the proliferative stroma cell and decidua in vivo. Two-way analysis of variance (ANOVA) was performed on the cells treated with 8-br-cAMP plus MPA on days 0, 2, and 4 (D0, D2, and D4. respectively), followed by the SNK post hoc test. ANOVA was used to test the difference in cell cycle distribution between the treated and control group on the same days. A P < 0.05 was considered to be statistically significant. Results Cell cycle distribution during ESC decidualization ESCs were decidualized by progesterone and cAMP containing 2% charcoal-treated FBS (decidualization group) for 4 days and then cultured in DMEM-F12 containing only 2% charcoal-treated FBS as a control (control group). Flow cytometry showed that the percentage of cells in G0/1 phase increased during decidualization (65.7% ± 1.98% in D0, 84.80% ± 1.52% in D2, and 88.63% ± 1.48% in D4). Nonetheless, the percentage of cells in S phase decreased (18.2% ± 1.62% in D0, 3.92% ± 0.87% in D2, and 0.38% ± 0.10% in D4, respectively). Similarly, the percentage of cells in G2/M phase also dropped (15.47% ± 1.36% in D0, 11.20% ± 0.79% in D2, and 10.99% ± 0.64% in D4) (Figure 1). Figure 1. View largeDownload slide Cell cycle distribution during decidualization. (A) Cell cycle distribution in the process of ESC decidualization in vitro. The cells were analyzed after being cultured in DMEM/F12 containing 2% FBS (control group) or decidualization medium for 0 day, 2 days, and 4 days, respectively. N, control group; D, decidualization group. (B) The average cell cycle distribution of nondecidualized and decidualized ESC in D0, D2, and D4. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Figure 1. View largeDownload slide Cell cycle distribution during decidualization. (A) Cell cycle distribution in the process of ESC decidualization in vitro. The cells were analyzed after being cultured in DMEM/F12 containing 2% FBS (control group) or decidualization medium for 0 day, 2 days, and 4 days, respectively. N, control group; D, decidualization group. (B) The average cell cycle distribution of nondecidualized and decidualized ESC in D0, D2, and D4. Data represent mean ± SEM from three separate experiments. (*P < 0.05). We compared the decidualization group and the control group in terms of cell cycle distribution. The S phase percentage of the decidualization group was significantly lower in D2 and D4 (3.92% ± 0.87% and 0.38% ± 0.10%) than the control group (6.70% ± 0.77% and 5.22% ± 0.68%). The G0/G1 percentage of the decidualization group (84.80% ± 1.52% in D2 and 88.63% ± 1.48% in D4) ended up being higher than that of the control group in D2 (75.25% ± 1.73%) and D4 (85.17% ± 1.62%). The G2/M percentage of the decidualization group was lower than that of the control group in D2 (11.20% ± 0.79% and 18.05% ± 1.40%, respectively), and became similar in D4 (10.99% ± 0.64% vs 9.61% ± 0.97%). The above results suggested that ESCs were arrested at the G0/G1 phase during decidualization (Figure 1). Profiles of cell cycle regulatory genes during human ESC decidualization in vitro To explore how cell cycle regulatory genes control the differentiation of ESCs, we decidualized human ESCs by progesterone and cAMP. Cells at 30%–40% confluency were used in order to avoid contact inhibition. Then we detected the expression of 100 cell cycle regulatory genes by using a microarray chip. Two genes were found to be significantly upregulated, while seven genes were significantly downregulated in the decidualized group as compared to the control group. Among them, the P57 was upregulated with a fold change (FC) of 127.5903 on day 2 and 29.1919 on day 4. P15 was upregulated with an FC of 10.3344 on day 2 and 7.9224 on day 4. The downregulated genes (CCND1 , CCNA2, CCNB1, CDC2, CDC6, CDC20, and CDK2) are listed in Table 1. Table 1. The upregulated and downregulated genes after ESC decidualization in vitro. Upregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  Downregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  CDKN1C(P57)  127.5903  29.1919  CDK2  0.3883  0.4638  CDKN2B(P15)  10.3344  7.9224  CCNA2  0.3245  0.2976        CDC6  0.2546  0.4068        CDC20  0.2308          CCND1  0.1489  0.1775        CCNB1  0.1343  0.2710        CDC2  0.1006    Upregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  Downregulated genes  Fold change (D2/C2)  Fold change (D4/C4)  CDKN1C(P57)  127.5903  29.1919  CDK2  0.3883  0.4638  CDKN2B(P15)  10.3344  7.9224  CCNA2  0.3245  0.2976        CDC6  0.2546  0.4068        CDC20  0.2308          CCND1  0.1489  0.1775        CCNB1  0.1343  0.2710        CDC2  0.1006    The table showed the exact fold change of the up and down cell cycle regulatory genes after 2 days and 4 days of induced decidualization. The analysis was repeated three times. D2, decidualization day 2; C2, control day 2; D4, decidualization day 4; C4, control day 4. View Large In vivo expression of cell cycle regulatory proteins To validate the results of the microarray chip in vivo, the expression of cell cycle regulator proteins in human endometrial biopsy specimens was immunohistochemically and desitometrically determined (Figure 2A). The specimens included endometria at proliferative phase (n = 6) and decidua at early pregnancy (n = 6). The expression of P57, P15, Cyclin D1, CDK2, and CDC2 was found to be consistent with the findings of microarray analysis. The P57 and P15 proteins were highly expressed in the cytoplasm and nucleus of decidual cells. In the proliferative endometrium, these two genes were hardly expressed in the cytoplasm of ESCs. Cyclin D1, CDK2, and CDC2 were expressed strongly in the stromal cells of the endometria at proliferative phase as compared to the decidual stromal cells (P < 0.05). Contrary to the microarray results, the expression of Cyclin B1, Cyclin A2, CDC6, and CDC20 was increased in the decidual stromal cells when compared to those of the proliferative ESCs (P < 0.05). The average optical densities of each protein in proliferative and decidualized stromal cells are listed in Figure 2B. Figure 2. View largeDownload slide Cell cycle regulatory protein expression in vivo. (A) Immunohistochemical staining of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Scale bar = 20 × 100 μm. (B) Average optical densities of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Each group has six individual patients, and three different slides from each patient were analyzed. Data represented mean ± SEM (*P < 0.05). Figure 2. View largeDownload slide Cell cycle regulatory protein expression in vivo. (A) Immunohistochemical staining of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Scale bar = 20 × 100 μm. (B) Average optical densities of P57, P15, Cyclin D1, CDK2, CDC2, Cyclin B1, Cyclin A2, CDC6, and CDC20 in the proliferative phase of endometrium and early pregnancy decidua. Each group has six individual patients, and three different slides from each patient were analyzed. Data represented mean ± SEM (*P < 0.05). Downregulated P57 inhibits ESC decidualization Among the five genes that presented similar expression pattern, the two CDKIs (P57 and P15) had a strong expression in decidual stromal cells, suggesting that the two molecules may be crucial to the G0/G1 arrest during ESC decidualization. Therefore, the two CDKIs were singled out for further evaluation of their roles in decidualization by the RNAi method. The ESCs had undergone a series of typical morphological changes after decidualization. Four days after induced decidualization, they transformed from spindle-shaped cells into larger polygonal epithemlioid cells with a larger nucleus (Figure 3A1 and A2). Apart from the typical morphological changes, the decidualized ESCs secreted significantly more PRL than their nondecidualized counterparts, and PRL is widely known as a biomarker of decidualization (Figure 3B1). After P57 was downregulated, the decidualization of ESCs was partially inhibited, as indicated by less typical morphological changes under an inverted microscope (Figure 3A3). The concentration of PRL per cell in the culture medium decreased by more than 50% when compared to the negatively transfected cells (P < 0.05) 2 and 4 days after the induced decidualization (Figure 3B2). However, the downregulation of P15 did not seem to exert comparable effect on the decidualization of ESCs. After induced decidualization, the P15-transfected cells showed morphological features similar to those observed in the negatively transfected cells (Figure 3A4). Two and four days after the induced decidualization, the PRL secretion per cell in the P15-transfected cells was also close to that in the negatively transfected group (Figure 3B3). The ultrastructural morphology of the decidualized ESCs was observed under a transmission electron microscope. In the negatively transfected cells, decidualized ESCs were round and large sized, with a bigger euchromatic nucleus, conspicuous nucleoli, and a well-developed network of rough endoplasmic reticulum (Figure 3C1–C3). Also noted were several vesicles in the intracellular matrix and a number of condensed mitochondria. Such ultrastructural changes were indicative of active secretion of the decidualized ESCs. In the P57 siRNA-transfected cells, the decidualized ESCs had smaller cell nuclei and their rough endoplasmic reticula were less developed, indicating that decidualization was diminished (Figure 3C4–C6). Figure 3. View largeDownload slide Downregulation of P57 inhibits ESC decidualization. (A) Morphological changes of decidualized ESC after the downregulation of P57 or P15. (B) PRL secretion change of decidualized ESC after the downregulation of P57 or P15. (C) Ultrastructure changes of decidualized ESC after the downregulation of P57. (D) Cell cycle distribution changes of decidualized ESC after the downregulation of P57. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Figure 3. View largeDownload slide Downregulation of P57 inhibits ESC decidualization. (A) Morphological changes of decidualized ESC after the downregulation of P57 or P15. (B) PRL secretion change of decidualized ESC after the downregulation of P57 or P15. (C) Ultrastructure changes of decidualized ESC after the downregulation of P57. (D) Cell cycle distribution changes of decidualized ESC after the downregulation of P57. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Downregulated P57 inhibited ESC decidualization by interfering G0/G1 arrest Two days after decidualization, the cell number in S phase of the P57 transfection group was increased compared to the control group (2.05% ± 0.44% vs 6.48% ± 3.14% respectively, P < 0.01). The cell number at G0/G1 phase of the P57-transfected group was decreased in comparison to the control group (91.55% ± 2.21% vs 82.54% ± 4.64%, P < 0.01) and the cell number at G2/M phase was increased compared with that in the control group (6.41% ± 1.99% vs 10.97% ± 1.95%, P < 0.01). Four days after decidualization, the cell number at S phase in the P57-transfected group was increased when compared with the control group (1.51% ± 0.27% vs 3.06% ± 1.40%, respectively, P < 0.05) (Figure 3D). These findings indicated that downregulated P57 adversely interferes with the cell cycle G0/G1 arrest, thereby impeding decidualization of ESCs. Discussion ESC decidualization is essential for normal pregnancy [3, 5, 24]. and proper decidualization requires cell cycle exit in combination with differentiation. The cell cycle is precisely regulated at G1-to-S and G2-to-M checkpoints. Most of the cells undergoing differentiation are arrested at the G1-to-S checkpoint, i.e., at the G0/G1 phase. With many cell types, such as ovarian cancer cells, cAMP triggers, in molecular term, the arrest of the G0/G1 cell cycle [25]. Progesterone was also shown to be able to terminate the cell cycle, thereby inhibiting proliferation [26]. This study showed that the percentage of cells was increased in the G0/1 phase and decreased in S phase upon the treatment by a cAMP plus MPA for a period of 2 to 4 days, suggesting that cell cycle was arrested at the G0/1 phase. This result was consistent with a previous finding in immortalized ESCs decidualized by 17β-estradiol, MPA, and cAMP at 30% cell confluency [27]. G1-to-S checkpoints are strictly regulated by cyclins, cyclin-dependent kinases (CDKs) and CDK inhibitors (CDKIs) [28]. Cyclin D1 forms a complex with CDK4 or CDK6, whose activity is required for the transition from G1 to S phase. CyclinD1-CDK4 complex promotes passage through the G1 to S phase by inhibiting the Rb protein via phosphorylation [29]. CyclinE-CDK2 complex is also essential for the G1-to-S transition [30]. CDC2, also known as CDK1, binds to G1/S cyclin and is critical for the preparation of S phase (e.g. duplication of centromeres or the spindle pole bodies) [31]. Using 30%–40% confluent primary cultured ESCs, we examined the changes in the profile of cell cycle-regulating genes during ESC differentiation by employing high-throughput microarray. Furthermore, we validated the in vitro result in histological sections of decidua at early pregnancy and ESCs in proliferative phase. We found that the expression of Cyclin D1, CDK2, and CDC2 was lower in the decidualized cells than in the control cells both in vitro and in vivo, which indicated that they might play an important role in the G1/G0 cell arrest during endometrial cell decidualization. CDKI negatively regulates CDK activity and plays a crucial role in the G0/G1 cell cycle arrest. Based on the sequence homology and CDK specificity, CDKIs have two major families, i.e. INK4 and CIP/KIP. The CIP/KIP family consists of three structurally related members: P21, P27, and P57 while INK4 includes P16, P15, and P19 [32, 33]. Both in vitro and in vivo, P57 and P15 were highly expressed in the differentiated ESCs. P57 is a paternally imprinted CDKI and exerts its anti-proliferative effect by stopping cells in the G1 phase in a wide array of tissues and cell lines [34]. The 310-helix region of P57 is indispensable for the inhibition of CyclinA/CDK2 and CyclinE/CDK2 complex [35]. P15 is also a tight-binding CDKI of several G1 cyclin-CDK complexes, and it inhibits the cell cycle at several checkpoints [36, 37]. CDKIs are implicated, both directly and indirectly, in the regulation of cell differentiation and its members are important for integrating cell cycle exit and differentiation [38]. We further studied the two upregulated CDKIs (P57 and P15) to understand their specific roles in the ESC decidualization. As aforementioned, siRNA study showed that the expression of P57 gene in ESCs was downregulated and ESCs were decidualized by MPA and cAMP at the same time. After P57 downregulation, decidualization of human ESCs was impaired, as manifested by corresponding morphological changes, and a relatively low secretion of PRL when compared to the controls. As a member of CDKIs, P57 prevents cells from entering S phase by interacting with the D-type cyclins and a number of CDKs [35, 38]. Downregulation of P57 lessened such inhibition and encouraged ESCs to go into S phase 2 and 4 days after treatment with MPA + cAMP, thus attenuating the decidualization. Conclusively, P57 regulates ESC decidualization by affecting the cell cycle distribution. Nonetheless, CDKIs can work independent of CDK regulation. For instance, the direct binding of P57 to MyoD has been reported to stabilize MyoD, thereby promoting myoblast differentiation [39]. Whether P57 can regulate decidua-specific transcription factors warrants further investigations. Moreover, we also found that the expression of P15 was elevated in decidualized ESCs. However, downregulation of P15 in ESCs did not seem to interfere with the process of decidualization. This can be explained by two possible reasons. First, P15 is not functionally important in the ESC decidualization. As we know it, just because some proteins are highly expressed that does not mean they are functionally important in some biological process. Second, P15 can be functionally compensated by other molecules, such as P57, which was found to be important in the process of human ESC decidualization. A question will naturally present itself: How cAMP and progesterone pathways upregulate the expression of P57? In our previous studies, we confirmed several upstream regulators of P57 that play crucial roles in the ESC decidualization [23, 40]. We found that the activation of cAMP and the progesterone pathways could downregulate the has-miR-222/221, thereby leading to the overexpression of P57 during decidualization [23]. Additionally, we previously found that homeobox A10 (HOXA10), one of the progesterone receptors that directly regulate genes, was downregulated during decidualization [40]. The reduced expression of HOXA10 might contribute to the upregulation of P57 during ESC decidualization [40]. Other studies also exhibited that Forkhead Box O1A (FOXO1) controlled ESC differentiation by regulating P57 expression [13, 41]. On the basis of above-mentioned findings, we hereby proposed a model that explains how ESC exit the cell cycle and go into differentiation (Figure 4). Figure 4. View largeDownload slide A proposed model for ESC exiting the cell cycle and entering into differentiation. Figure 4. View largeDownload slide A proposed model for ESC exiting the cell cycle and entering into differentiation. In conclusion, in this study we proved that cell cycle regulatory genes P57 and P15 are upregulated, while Cyclin D1, CDK2, and CDC2 are downregulated during the ESC differentiation both in vitro and in vivo. Furthermore, we demonstrated that P57 is one of the key regulators that modulates ESC differentiation by controlling cell cycle distribution. The interaction between P57 and decidua-specific transcription factors awaits further investigations. Supplementary data Supplementary data are available at BIOLRE online. Supplementary Figure S1. Downregulation of P57 and P15 protein by P57 siRNA and P15 siRNA. (A) Immunofluorescence detection of vimentin in primary cultured ESC. (B) Fluorescent photography of ESCs after transfection of Cy3-labeled control siRNA. (C) Expression of P57 and P15 protein after transfection of P57 siRNA and P15 siRNA. The level of protein expression for P57 and P15 was calculated as a ratio for their densitometric reading to that of the corresponding GAPDH. Data represent mean ± SEM from three separate experiments. (*P < 0.05). Acknowledgments We are indebted to all the staff in the Reproductive Center who assisted in the collection of human samples. Authors' contributor LW and HY participated in study execution, analysis, manuscript drafting, and critical discussion. LH performed the cell cycle and microarray experiments. DH conducted the microarray experiments. SM completed the immunostaining. XS, LJ, JS, and LJ assisted in the manuscript drafting. JFM assisted in the English language revision. KQ and HZ are involved in study design, paper revision and final check, and approval. Conflict of interest: The authors have declared that no conflict of interest exists. Footnotes † Grant support: This work was supported by NSFC 81571464 and NSFC 81170583. References 1. Strowitzki T, Germeyer A, Popovici R, von Wolff M. The human endometrium as a fertility-determining factor. Hum Reprod Update  2006; 12: 617– 630. Google Scholar CrossRef Search ADS PubMed  2. Telgmann R, Gellersen B. Marker genes of decidualization: activation of the decidual prolactin gene. Hum Reprod Update  1998; 4: 472– 479. Google Scholar CrossRef Search ADS PubMed  3. Cha J, Sun X, Dey SK. Mechanisms of implantation: strategies for successful pregnancy. Nat Med  2012; 18: 1754– 1767. Google Scholar CrossRef Search ADS PubMed  4. Zhang S, Lin H, Kong S, Wang S, Wang H, Wang H, Armant DR. Physiological and molecular determinants of embryo implantation. Mol Aspects Med  2013; 34: 939– 980. Google Scholar CrossRef Search ADS PubMed  5. Gellersen B, Brosens JJ. Cyclic decidualization of the human endometrium in reproductive health and failure. Endocr Rev  2014; 35: 851– 905. Google Scholar CrossRef Search ADS PubMed  6. Sarno J, Schatz F, Huang SJ, Lockwood C, Taylor HS. Thrombin and interleukin-1beta decrease HOX gene expression in human first trimester decidual cells: implications for pregnancy loss. Mol Hum Reprod  2009; 15: 451– 457. Google Scholar CrossRef Search ADS PubMed  7. Yang H, Zhou Y, Edelshain B, Schatz F, Lockwood CJ, Taylor HS. FKBP4 is regulated by HOXA10 during decidualization and in endometriosis. Reproduction  2012; 143: 531– 538. Google Scholar CrossRef Search ADS PubMed  8. Wille JJ Jr, Scott RE. Suppression of tumorigenicity by the cell-cycle-dependent control of cellular differentiation and proliferation. Int J Cancer  1986; 37: 875– 881. Google Scholar CrossRef Search ADS PubMed  9. Kolly C, Suter MM, Muller EJ. Proliferation, cell cycle exit, and onset of terminal differentiation in cultured keratinocytes: pre-programmed pathways in control of c-Myc and Notch1 prevail over extracellular calcium signals. J Invest Dermatol  2005; 124: 1014– 1025. Google Scholar CrossRef Search ADS PubMed  10. Rogers PAW, Abberton KM. Endometrial arteriogenesis: vascular smooth muscle cell proliferation and differentiation during the menstrual cycle and changes associated with endometrial bleeding disorders. Microsc Res Tech  2003; 60: 412– 419. Google Scholar CrossRef Search ADS PubMed  11. Ruijtenberg S, van den Heuvel S. Coordinating cell proliferation and differentiation: antagonism between cell cycle regulators and cell type-specific gene expression. Cell Cycle  2016; 15: 196– 212. Google Scholar CrossRef Search ADS PubMed  12. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S. Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine  1997; 6: 301– 307. Google Scholar CrossRef Search ADS PubMed  13. Takano M, Lu Z, Goto T, Fusi L, Higham J, Francis J, Withey A, Hardt J, Cloke B, Stavropoulou AV, Ishihara O, Lam EW et al.   Transcriptional cross talk between the forkhead transcription factor forkhead box O1A and the progesterone receptor coordinates cell cycle regulation and differentiation in human endometrial stromal cells. Mol Endocrinol  2007; 21: 2334– 2349. Google Scholar CrossRef Search ADS PubMed  14. Kuroda K, Venkatakrishnan R, Salker MS, Lucas ES, Shaheen F, Kuroda M, Blanks A, Christian M, Quenby S, Brosens JJ. Induction of 11beta-HSD 1 and activation of distinct mineralocorticoid receptor- and glucocorticoid receptor-dependent gene networks in decidualizing human endometrial stromal cells. Mol Endocrinol  2013; 27: 192– 202. Google Scholar CrossRef Search ADS PubMed  15. Tierney EP, Tulac S, Huang ST, Giudice LC. Activation of the protein kinase a pathway in human endometrial stromal cells reveals sequential categorical gene regulation. Physiol Genomics  2003; 16: 47– 66. Google Scholar CrossRef Search ADS PubMed  16. Akiba J, Murakami Y, Noda M, Watari K, Ogasawara S, Yoshida T, Kawahara A, Sanada S, Yasumoto M, Yamaguchi R, Kage M, Kuwano M et al.   N-myc downstream regulated gene1/Cap43 overexpression suppresses tumor growth by hepatic cancer cells through cell cycle arrest at the G0/G1 phase. Cancer Lett  2011; 310: 25– 34. Google Scholar CrossRef Search ADS PubMed  17. de Barros FR, Goissis MD, Caetano HV, Paula-Lopes FF, Peres MA, Assumpcao ME, Visintin JA. Serum starvation and full confluency for cell cycle synchronization of domestic cat (felis catus) foetal fibroblasts. Reprod Domest Anim  2010; 45: 38– 41. Google Scholar CrossRef Search ADS PubMed  18. Mordica WJ, Woods KM, Clem RJ, Passarelli AL, Chapes SK. Macrophage cell lines use CD81 in cell growth regulation. In Vitro Cell Dev Biol Anim  2009; 45: 213– 225. Google Scholar CrossRef Search ADS PubMed  19. Wayne J, Sielski J, Rizvi A, Georges K, Hutter D. ERK regulation upon contact inhibition in fibroblasts. Mol Cell Biochem  2006; 286: 181– 189. Google Scholar CrossRef Search ADS PubMed  20. Cho JH, Yoon M-S, Koo JB, Kim YS, Lee K-S, Lee JH, Han J-S. The progesterone receptor as a transcription factor regulates phospholipase D1 expression through independent activation of protein kinase A and Ras during 8-Br-cAMP-induced decidualization in human endometrial stromal cells. Biochem J  2011; 436: 181– 191. Google Scholar CrossRef Search ADS PubMed  21. Menkhorst E, Salamonsen LA, Zhang J, Harrison CA, Gu J, Dimitriadis E. Interleukin 11 and activin A synergise to regulate progesterone-induced but not cAMP-induced decidualization. J Reprod Immunol  2010; 84: 124– 132. Google Scholar CrossRef Search ADS PubMed  22. Wang DF, Minoura H, Sugiyama T, Tanaka K, Kawato H, Toyoda N, Sagawa N. Analysis on the promoter region of human decidual prolactin gene in the progesterone-induced decidualization and cAMP-induced decidualization of human endometrial stromal cells. Mol Cell Biochem  2007; 300: 239– 247. Google Scholar CrossRef Search ADS PubMed  23. Qian K, Hu L, Chen H, Li H, Liu N, Li Y, Ai J, Zhu G, Tang Z, Zhang H. Hsa-miR-222 is involved in differentiation of endometrial stromal cells in vitro. Endocrinology  2009; 150: 4734– 4743. Google Scholar CrossRef Search ADS PubMed  24. Zhang S, Lin HY, Kong SB, Wang SM, Wang HM, Wang HB, Armant DR. Physiological and molecular determinants of embryo implantation. Mol Aspects Med  2013; 34: 939– 980. Google Scholar CrossRef Search ADS PubMed  25. Horiuchi S, Kato K, Suga S, Takahashi A, Ueoka Y, Arima T, Nishida J, Hachisuga T, Kawarabayashi T, Wake N. Expression of progesterone receptor B is associated with G0/G1 arrest of the cell cycle and growth inhibition in NIH3T3 cells. Exp Cell Res  2005; 305: 233– 243. Google Scholar CrossRef Search ADS PubMed  26. Gellersen B, Brosens J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol  2003; 178: 357– 372. Google Scholar CrossRef Search ADS PubMed  27. Logan PC, Steiner M, Ponnampalam AP, Mitchell MD. Cell cycle regulation of human endometrial stromal cells during decidualization. Reprod Sci  2012; 19: 883– 894. Google Scholar CrossRef Search ADS PubMed  28. Tan J, Raja S, Davis MK, Tawfik O, Dey SK, Das SK. Evidence for coordinated interaction of cyclin D3 with p21 and cdk6 in directing the development of uterine stromal cell decidualization and polyploidy during implantation. Mech Dev  2002; 111: 99– 113. Google Scholar CrossRef Search ADS PubMed  29. Casimiro MC, Velasco-Velazquez M, Aguirre-Alvarado C, Pestell RG. Overview of cyclins D1 function in cancer and the CDK inhibitor landscape: past and present. Expert Opin Investig Drugs  2014; 23: 295– 304. Google Scholar CrossRef Search ADS PubMed  30. He L, Lu N, Dai Q, Zhao Y, Zhao L, Wang H, Li Z, You Q, Guo Q. Wogonin induced G1 cell cycle arrest by regulating Wnt/?-catenin signaling pathway and inactivating CDK8 in human colorectal cancer carcinoma cells. Toxicology  2013; 312: 36– 47. Google Scholar CrossRef Search ADS PubMed  31. Fisher D, Krasinska L, Coudreuse D, Novak B. Phosphorylation network dynamics in the control of cell cycle transitions. J Cell Sci  2012; 125: 4703– 4711. Google Scholar CrossRef Search ADS PubMed  32. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev  1999; 13: 1501– 1512. Google Scholar CrossRef Search ADS PubMed  33. Canepa ET, Scassa ME, Ceruti JM, Marazita MC, Carcagno AL, Sirkin PF, Ogara MF. INK4 proteins, a family of mammalian CDK inhibitors with novel biological functions. IUBMB Life  2007; 59: 419– 426. Google Scholar CrossRef Search ADS PubMed  34. Kerns SL, Guevara-Aguirre J, Andrew S, Geng J, Guevara C, Guevara-Aguirre M, Guo M, Oddoux C, Shen Y, Zurita A, Rosenfeld RG, Ostrer H et al.   A novel variant in CDKN1C is associated with intrauterine growth restriction, short stature, and early-adulthood-onset diabetes. J Clin Endocrinol Metab  2014; 99: E2117– E2122. Google Scholar CrossRef Search ADS PubMed  35. Hashimoto Y, Kohri K, Kaneko Y, Morisaki H, Kato T, Ikeda K, Nakanishi M. Critical role for the 310 helix region of p57 Kip2 in Cyclin-dependent kinase 2 inhibition and growth suppression. J Biol Chem  1998; 273: 16544– 16550. Google Scholar CrossRef Search ADS PubMed  36. Pita JM, Figueiredo IF, Moura MM, Leite V, Cavaco BM. Cell cycle deregulation and TP53 and RAS mutations are major events in poorly differentiated and undifferentiated thyroid carcinomas. J Clin Endocrinol Metab  2014; 99: E497– E507. Google Scholar CrossRef Search ADS PubMed  37. Mahmoud AI, Kocabas F, Muralidhar SA, Kimura W, Koura AS, Thet S, Porrello ER, Sadek HA. Meis1 regulates postnatal cardiomyocyte cell cycle arrest. Nature  2013; 497: 249– 253. Google Scholar CrossRef Search ADS PubMed  38. Schmetsdorf S, Gartner U, Arendt T. Expression of cell cycle-related proteins in developing and adult mouse hippocampus. Int J Dev Neurosci  2005; 23: 101– 112. Google Scholar CrossRef Search ADS PubMed  39. Reynaud EG, Leibovitch MP, Tintignac LA, Pelpel K, Guillier M, Leibovitch SA. Stabilization of MyoD by Direct Binding to p57 Kip2. J Biol Chem  2000; 275: 18767– 18776. Google Scholar CrossRef Search ADS PubMed  40. Qian K, Chen H, Wei Y, Hu J, Zhu G. Differentiation of endometrial stromal cells in vitro: down-regulation of suppression of the cell cycle inhibitor p57 by HOXA10? Mol Hum Repro d 2005; 11: 245– 251. Google Scholar CrossRef Search ADS   41. Labied S, Kajihara T, Madureira PA, Fusi L, Jones MC, Higham JM, Varshochi R, Francis JM, Zoumpoulidou G, Essafi A, Fernandez de Mattos S, Lam EW et al.   Progestins regulate the expression and activity of the forkhead transcription factor FOXO1 in differentiating human endometrium. Mol Endocrinol  2006; 20: 35– 44. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

Biology of Reproduction – Oxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.

Try 2 weeks free now

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

or browse the journals available

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial

Interested in DeepDyve for your group?
Try 2 weeks free now