Application of the red fluorescent protein mCherry in mycelial labeling and organelle tracing in the dermatophyte Trichophyton mentagrophytes

Application of the red fluorescent protein mCherry in mycelial labeling and organelle tracing in... Abstract Trichophyton mentagrophytes is a fungus that causes skin disease in humans and other animals worldwide. Studies on molecular biology and fluorescent labeling of the fungus are limited. Here, we applied mCherry for the first time in T. mentagrophytes to label the fungus and its organelles. We constructed four expression vectors of mCherry or mCherry fusions containing a variety of resistance markers and promoters, which were then integrated, together with two previous mCherry expression vectors, in T. mentagrophytes via Agrobacterium tumefaciens-mediated transformation (AtMT). The resulting transformants emitted bright red fluorescence. We used the histone protein H2B and the peroxisome targeting signal 1 (PTS1) peptide to target the nucleus and peroxisomes, respectively, in T. mentagrophytes. In the transformants expressing mCherry-fused H2B, the fluorescence was distinctly localized to the nuclei in hyphae, spores and the fungal cells in infected animal tissue. In the T. mentagrophytes transformants where the peroxisome was targeted, the mCherry was present as small dots (0.2–1 μm diameter) throughout the spores and the hyphae. We also constructed a T. mentagrophytes AtMT library containing more than 1000 hygromycin-resistant transformants that were genetically stable. Our results provide useful tools for further investigations on molecular pathogenesis of T. mentagrophytes. Trichophyton mentagrophytes, fluorescent, mCherry, AtMT INTRODUCTION Trichophyton mentagrophytes, a common fungus, causes skin diseases in humans and other animals worldwide (Cafarchia et al.2012). In rabbits, the symptoms of T. mentagrophytes infection include scurf, encrustation, fur loss, exudation, epifolliculitis and itchy skin (Cafarchia et al.2012), resulting in severe economic losses for rabbit breeders. The control of T. mentagrophytes infections in rabbits is vital both for the rabbit breeding industry and for public health and safety. Recent studies on T. mentagrophytes infections in rabbits have focused on outbreak prevention. However, the underlying mechanisms of the infection have rarely been investigated. Furthermore, investigations on gene function in T. mentagrophytes have been thus far limited to the Ku genes (Ku70 and Ku80) (Yamada et al.2009a), the keratinase gene (Shi et al.2015) and the metalloprotease gene (Zhang et al.2013). In previous studies, various physical and chemical methods have been used to construct T. mentagrophytes mutants, but these methods were deemed inefficient, and the mutated genes were difficult to isolate (Gonzalez et al.1989; Kaufman et al.2004). The availability of the T. mentagrophytes genome sequence (Alipour and Mozafari 2015) and the establishment of new fungal transformation methods make it possible to provide a more rapid and high-throughput study of the gene function in this species. Agrobacterium tumefaciens-mediated transformation (AtMT) is one of the most common methods used for genetic transformation. De Groot et al. (1998) conducted insertion of T-DNA for the first time into a filamentous fungal genome using the AtMT method. Due to the simplicity and efficiency of AtMT, as well as the stability of the resulting transformants, AtMT has been used in many fungi, including T. mentagrophytes (Yamada et al.2008, 2009b; Zhang et al.2013). The selection markers used in AtMT of T. mentagrophytes have involved the hygromycin resistance gene (Yamada et al.2009a; Zhang et al.2013), the neomycin phosphotransferase gene (NPTII) (Yamada et al.2008) and the nourseothricin resistance gene (Alshahni et al.2010). Fluorescent proteins have been widely used to assess promoter activity and gene expression level, to monitor proteins localization, and to study organismal growth and development (Wu et al.2014). The green fluorescent protein (GFP) is the most common one used in filamentous fungi (Zhou, Li and Xu 2011), although the red fluorescent protein (RFP), yellow fluorescent protein (YFP) and cyan fluorescent protein (CFP) have also been reported (Garrity et al.2010). In 1999, Matz et al. (1999) isolated an RFP from Discosoma spp. with a maximum absorption wavelength of 558 nm and maximum emission wavelength of 583 nm. Since Mikkelsen et al. (2003) succesfully used DsRed in filamentous fungi in 2013, the RFP has been used with increasing frequency in fungal species. RFP has a variety of variants, including mBanana, mOrange, dTomato, mTangerine, mStrawberry and mCherry (Shaner et al.2004). These proteins have different spectra, colors and physiochemical properties. The protein mCherry is excited by light at a wavelength of 580 nm and emits fluorescence at 610 nm (Shaner et al.2004), which is detected as cherry-red fluorescence. Compared to DsRed, mCherry matures faster and has other better physiochemical properties (Yang, Zhang and Luo 2010). To date, however, only GFP has been used in T. mentagrophytes (Kaufman et al.2004; Yamada et al.2008). In present work, the application of mCherry in T. mentagrophytes was established. We constructed four different promoter-driven mCherry expression vectors with two selective markers, which were then transformed into T. mentagrophytes using AtMT. In the resulting transformants, the mCherry was stably expressed in high levels, which could be detected both in artificial medium and in animal skin. We then tagged the nuclei and peroxisomes of T. mentagrophytes with mCherry. We also constructed a library of T. mentagrophytes AtMT transformants. Our research provided a tool for the study of the pathogenic mechanisms and molecular biology of T. mentagrophytes. MATERIALS AND METHODS Fungal species and culture medium We isolated and stored wild-type T. mentagrophytes strain ZJA-1 in our laboratory. This strain was authenticated by the Nanjing Institute of Dermatology, Chinese Academy of Medical Sciences, Nanjing, China. We cultured T. mentagrophytes in Sabourand's agar (SDA; Beijing Solarbio Science and Technology Co., Ltd., Beijing, China). The A. tumefaciens strain used in this study was AGL1. We used YEB medium (5 g beef extract, 1 g yeast extract, 5 g peptone, 5 g sucrose and 0.04 g MgSO4·7H2O) to culture A. tumefaciens. We used IM medium (Zhang et al.2013) to co-culture T. mentagrophytes and A. tumefaciens. SDA plates containing 400 μg/mL hygromycin B (Roche, Mannheim, Germany) or 500 μg/mL G418 (Sigma) were used to screen the transformants. Vector construction To initiate vector construction, we used p1300NMcherryA (hereafter abbreviated as pNMChA) (Li et al.2016), a vector carrying the G418 resistance gene (NPTII), and a version of mCherry tagged with peroxisomal targeting signal 1 (mCherry-PTS1) under the promoter of MPG1 gene (MGG_10315) from Magnaporthe oryzae. A 0.7-kb fragment of the mCherry CDS without PTS1 was amplified using pNMChA as template and the primer pair mCh-Xb/mCh-Sm. We replaced the mCherry-PTS1 in pNMChA with the mCherry CDS without PTS1 using XbaI/SmaI digestion to generate pNMCh. A 1.4-kb fragment of the HPH cassette was amplified using p1300-KO (Li et al.2014) as template and the primer pair HPH-Xh1/HPH-Xh2. We replaced the NPTII gene in pNMChA with the HPH cassette using XhoI digestion to generate pHMChA, and replaced the NPTII gene in pNMCh with the HPH cassette using XhoI digestion to generate pHMCh. A 1.5-kb fragment of the histone H3 gene promoter from M. oryzae (MGG_01159) was amplified using genomic DNA from M. oryzae Guy11 as template and the primer pair H3-Pv/H3-Xb. We replaced the MPG1 promoter in pHMCh with the H3 promoter using PvuI/XbaI digestion to generate pHHCh. All the primers used are listed in Table 1. Table 1. Primers of different genes. Primer  Sequence  Length  HPHCK1  TTCGCCCTTCCTCCCTTTATTTCA  1.0 kb  HPHCK2  GCTTCTGCGGGCGATTTGTGTACG    NPTCK1  GAGGTCAACACATCAATGC  1.1 kb  NPTCK2  TCAGAAGAACTCGTCAAGAAGGCG    mCh-Xb  GCCCTCTAGAATGGTGAGCAAGGGCGAGGAGGAT  0.7 kb  mCh-Sm  TCCCCCGGGTTAGCCGCCGGTGGAGTGGCGGCCCTC    HPH-Xh1  CCGCTCGAGTGGAGGTCAACACATCAATGCTAT  1.4 kb  HPH-Xh2  CCGCTCGAGCTACTCTATTCCTTTGCCCTCGGA    H3-Pv  ATCGATCGAGTCATGTTGATTGAGGTGTTGT  1.5 kb  H3-Xb  GCTCTAGAGGCCATTGTGATTGATTTGTGATT    Primer  Sequence  Length  HPHCK1  TTCGCCCTTCCTCCCTTTATTTCA  1.0 kb  HPHCK2  GCTTCTGCGGGCGATTTGTGTACG    NPTCK1  GAGGTCAACACATCAATGC  1.1 kb  NPTCK2  TCAGAAGAACTCGTCAAGAAGGCG    mCh-Xb  GCCCTCTAGAATGGTGAGCAAGGGCGAGGAGGAT  0.7 kb  mCh-Sm  TCCCCCGGGTTAGCCGCCGGTGGAGTGGCGGCCCTC    HPH-Xh1  CCGCTCGAGTGGAGGTCAACACATCAATGCTAT  1.4 kb  HPH-Xh2  CCGCTCGAGCTACTCTATTCCTTTGCCCTCGGA    H3-Pv  ATCGATCGAGTCATGTTGATTGAGGTGTTGT  1.5 kb  H3-Xb  GCTCTAGAGGCCATTGTGATTGATTTGTGATT    *The restriction sites were underlined. View Large pNMCh, pHMCh and pHHCh were used to label the mycelia of T. mentagrophytes. pNMChA and pHMChA were used to target the peroxisomes in T. mentagrophytes. pKD9-H2B-mCherry (Li et al.2012; Sun et al.2017), a gift from Dr Lu of Zhejiang University (Hangzhou, China), which carries a mCherry fusion with M. oryzae histone H2B (MGG 03578) and under the control of the M. oryzae H3 promoter, was used for nuclear targeting. All of these vectors were transformed into T. mentagrophytes respectively using the AtMT method. To generate a T. mentagrophytes transformant library, we used hygromycin-resistant vector p1300-KO (Li et al.2014). AtMT transformation The T. mentagrophytes AtMT transformation protocol we used was adapted from Rho, Kang and Lee (2001). Briefly, T. mentagrophytes was inoculated into SDA medium and grown for 7 days at 28°C and a relative humidity of 60%. Spores were collected using 5 mL sterile water. The spore solution was filtered through three layers of sterile lens paper, and the residue was centrifuged at 5000 rpm for 10 min to collect the spores. The spores were then washed three times with sterile water. The spore concentration was adjusted to 5 × 105 spores/mL. We streaked A. tumefaciens onto a plate and activated it. A single colony was cultured in YPD-medium overnight at 28°C until the OD660 was 0.6. We then mixed 100 μL of the T. mentagrophytes culture with 100 μL of A. tumefaciens culture and plated the mixture on 6-cm diameter IM plates lined with a nitrocellulose membrane. The IM plates were incubated in the dark at 22°C for 48 h. The membranes and culture were then transferred onto selection plates containing either 400 μg/mL hygromycin or 500 μg/mL G418 and incubated for 4 days at 28°C. Transformed colonies were selected using sterile toothpicks, and checked again on selection media. The colonies after two rounds of selection, as the potential transformants, were stored for further experimentation. HPH and NPTII gene amplification We used PCR to amplify the HPH gene (with primers HPHCK1 and HPHCK2; Table 1) and the NPTII gene (with primers NPTCK1 and NPTCK2; Table 1). The amplified fragment of HPH was 1.0 kb long, and that of NPTII was 1.1 kb long. We used a 50 μL reaction volume containing 0.5 μL Taq, 4 μL dNTP, 5 μL 10 × buffer, 39.5 μL water, 2 μL forward primer and 2 μL reverse primer. Our PCR reaction conditions were as follows: 5 mins at 95°C; followed by 35 cycles of 30 s at 95°C, 30 s at 55°C and 90 s at 72°C; and 10 min at 72°C. Measurement of colony growth and spore production We used a 0.5-cm diameter puncher to collect samples from the margins of the transformant and wild-type ZJA-1 colonies. Both sets of samples were inoculated into separate SDA plates and incubated at 28°C for 9 days. The colonies were photographed and the diameters of the colonies were measured. The experiment was repeated three times for each colony. Each plate was washed with 5 mL sterile water, and the collected solution was filtered through three layers of lens paper to collect spores. The collected spores were counted using a hemocytometer, and spore concentration and production were calculated. Each treatment was performed in triplicate. Animal inoculation We generated transformants and wild-strain spore solutions (5 × 107 spores/mL) as mentioned above and obtained three 2-month-old New Zealand rabbits from a rabbit farm located in Zhejiang Academy of Agricultural Science. The hair on backs of the rabbits was shaved, and the shaved areas were divided into two equal-sized regions using a marker. We injected the transformant spore solution and wild-type strain spore solution respectively into the experimental regions and the control region. After 5 days, the skins in the inoculated regions were removed, and frozen microtome sections were quickly prepared. The samples were observed under a confocal microscope. After 7 days, we re-isolated the strains from the skin tissues and cultured them on SDA plates to test the resistance of the transformants. All our experimental methodologies and protocols were approved by the Animal Ethics Committee for Clinical Veterinary Science Experiments of the Zhejiang Academy of Agricultural Science, Hangzhou, China. Confocal microscope observation We used a Leica SP2 confocal microscope (Leica, Germany) and a ZEISS LSM780 inverted confocal microscope (Zeiss, Germany) to examine hyphae and spores of the transformant, as well as the animal tissue samples. We used an excitation wavelength of 580 nm and an emission wavelength of 610 nm. RESULTS Transformant selection and genetic stability The structures of pNMCh, pHMChA, pHMCh and pHHCh are shown in Fig. 1. The expression cassettes of the fluorescence proteins and the selection markers were both enclosed between two T-borders to ensure integration into the T. mentagrophytes genome. Figure 1. View largeDownload slide The structures of pNMChA (Li et al.2016), pNMCh, pHMChA, pHMCh, pHHCh and pKD9-H2B-mCherry (Sun et al.2017). Figure 1. View largeDownload slide The structures of pNMChA (Li et al.2016), pNMCh, pHMChA, pHMCh, pHHCh and pKD9-H2B-mCherry (Sun et al.2017). Transformant selection and genetic stability We obtained more than 1000 T. mentagrophytes p1300-KO transformants and more than 30 transformants for pHHCh, pNMCh, pHMChA, pNMChA and pKD9-H2B-mCherry, respectively. These transformants grew normally on the SDA plates supplemented with hygromycin or G418. We randomly selected 20 p1300-KO and 12 pNMCh transformants for extraction DNA and to test the T-DNA insertion by PCR. With the primers HPHCK1 (forward) and HPHCK2 (reverse) and the DNA from p1300-KO transformants as templates, we obtained amplicons of ∼1.0 kb in size, identical to the size of the DNA fragment amplified using the p1300-KO plasmid as template (Fig. 2B and C), indicating that the hygromycin resistance gene had been inserted into the transformant genome. When the genome of T. mentagrophytes ZJA-1 was used as template, no PCR product was amplified. Similarly, PCR amplification of NTPII from pNMCh transformants obtained DNA fragments of 1.1 kb in size, which were identical in size to the fragment of the G418 resistance gene amplified using pNMCh plasmid as template. When the genome of T. mentagrophytes ZJA-1 was used as template, no PCR product of this size was amplified (Fig. 2D), indicating that the NTPII gene had been inserted into the transformant genome. Figure 2. View largeDownload slide Resistance test and PCR amplification to confirm the transformants and check the genetic stability of the transformants. (A) We subcultured the selected T. mentagrophytes p1300-KO transformants on SDA medium for five generations, and then incubated these transformants on hygromycin-containing SDA medium at 26°C for 5 days. 1#, the first generation; and 5#, the fifth generation. (B and C) DNAs of the transformants at the first and fifth generations were extracted, and PCR was performed with primers for the hygromycin resistance gene (forward primer HPHCK1 and reverse primer HPHCK2). All of the transformants [2(5#), 3(5#), 5(5#), 8(5#), 9(5#), 10(5#)] showed a band of 1 kb in size, similar to the band amplified with the p1300-KO plasmid (positive control). However, no PCR products were generated using the genome of T. mentagrophytes ZJA-1 as template. (C) The selected pNMCh transformants were cultured on G418-contained SDA plates for 5 days and then used in DNA extraction, which was later in PCR amplification of the G418 resistance gene in the transformants (forward primer NPTCK1 and reverse primer NPTCK2). All of the transformants (1–6) had a band of 1.1 kb in size, similar to the band amplified using the pNMCh plasmid (positive control). However, no PCR products of this size were generated using the genome of T. mentagrophytes ZJA-1 as template. Figure 2. View largeDownload slide Resistance test and PCR amplification to confirm the transformants and check the genetic stability of the transformants. (A) We subcultured the selected T. mentagrophytes p1300-KO transformants on SDA medium for five generations, and then incubated these transformants on hygromycin-containing SDA medium at 26°C for 5 days. 1#, the first generation; and 5#, the fifth generation. (B and C) DNAs of the transformants at the first and fifth generations were extracted, and PCR was performed with primers for the hygromycin resistance gene (forward primer HPHCK1 and reverse primer HPHCK2). All of the transformants [2(5#), 3(5#), 5(5#), 8(5#), 9(5#), 10(5#)] showed a band of 1 kb in size, similar to the band amplified with the p1300-KO plasmid (positive control). However, no PCR products were generated using the genome of T. mentagrophytes ZJA-1 as template. (C) The selected pNMCh transformants were cultured on G418-contained SDA plates for 5 days and then used in DNA extraction, which was later in PCR amplification of the G418 resistance gene in the transformants (forward primer NPTCK1 and reverse primer NPTCK2). All of the transformants (1–6) had a band of 1.1 kb in size, similar to the band amplified using the pNMCh plasmid (positive control). However, no PCR products of this size were generated using the genome of T. mentagrophytes ZJA-1 as template. To test the genetic stability of the transformants, randomly selected p1300-KO transformants were inoculated into hygromycin-free SDA plates and cultured for five generations. The colonies were then inoculated into plates containing hygromycin. All transformants grew as well on the hygromycin-contained SDA plates as they did on hygromycin-free SDA plates (Fig. 2A). We used PCR to amplify the HPH gene from the fifth-generation transformants and got the proper PCR product of 1.0 kb in size (Fig. 2C). mCherry expression in T. mentagrophytes The T. mentagrophytes pHHCh and pNMCh transformants emitted bright red fluorescence under a confocal microscope, which was evenly distributed throughout the cell, while no fluorescence was observed in the T. mentagrophytes wild-type strain ZJA-1 (control). No significant difference was observed in the fluorescence intensity among the different transformants. The brightness of the fluorescence in hyphae and spores within the same transformant were also not significantly different (Fig. 3). These findings indicate that mCherry was highly expressed in the hyphae and spores of T. mentagrophytes irrespective of H3 or MPG1 as promoter, and the selection markers (HPH or NTPII) did not affect the level of mCherry expression. Figure 3. View largeDownload slide Fluorescence detection of mCherry-labeled strains of T. mentagrophytes We incubated the T. mentagrophytes pHHCh (H3:mCherry/HPH) and pNMCh (MPG1: mCherry/NTPII) transformants on SDA media for 1 week. The fungal hyphae and spores were then picked and observed under a Leica microscope, which showed red fluorescence that was evenly distributed throughout the hyphae and spores of the transformants. No fluorescence was observed in the wild-type ZJA-1 strain (control). Bar = 10 μm. Figure 3. View largeDownload slide Fluorescence detection of mCherry-labeled strains of T. mentagrophytes We incubated the T. mentagrophytes pHHCh (H3:mCherry/HPH) and pNMCh (MPG1: mCherry/NTPII) transformants on SDA media for 1 week. The fungal hyphae and spores were then picked and observed under a Leica microscope, which showed red fluorescence that was evenly distributed throughout the hyphae and spores of the transformants. No fluorescence was observed in the wild-type ZJA-1 strain (control). Bar = 10 μm. Figure 4. View largeDownload slide Nuclear labeling in T. mentagrophytes using mCherry We incubated the T. mentagrophytes transformant pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) on SDA medium for 1 week and then observed the fungal hyphae and spores with a Leica microscope. A dot of red fluorescence was observed in the center of each fungal cell, which coincided with the results of nuclear localization. Bar = 10 μm. Figure 4. View largeDownload slide Nuclear labeling in T. mentagrophytes using mCherry We incubated the T. mentagrophytes transformant pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) on SDA medium for 1 week and then observed the fungal hyphae and spores with a Leica microscope. A dot of red fluorescence was observed in the center of each fungal cell, which coincided with the results of nuclear localization. Bar = 10 μm. Figure 5. View largeDownload slide Detection of the T. mentagrophytes strains with mCherry-labeled nuclei in the skin tissues of infected rabbits. We subcutaneously injected rabbits with the pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) transformant. After 5 days, their skin tissues were collected and prepared for microscopic analysis. Numerous mCherry-labeled T. mentagrophytes cells were detected in the samples. Control tissues injected with the wild-type ZJA-1 strain (indicated with black arrows) did not fluoresce. Bar = 10 μm. Figure 5. View largeDownload slide Detection of the T. mentagrophytes strains with mCherry-labeled nuclei in the skin tissues of infected rabbits. We subcutaneously injected rabbits with the pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) transformant. After 5 days, their skin tissues were collected and prepared for microscopic analysis. Numerous mCherry-labeled T. mentagrophytes cells were detected in the samples. Control tissues injected with the wild-type ZJA-1 strain (indicated with black arrows) did not fluoresce. Bar = 10 μm. Fluorescent labeling of nuclei and peroxisomes in T. mentagrophytes with mCherry To use mCherry to trace the localization of target proteins in T. mentagrophytes, we used AtMT to transform T. mentagrophytes with pKD9-H2B-mCherry (mCherry was fused to histone H2B), pHMChA and pNMChA (mCherry was fused to peroxisome targeting signal PTS1), respectively. In the pKD9-H2B-mCherry transformant, the mCherry-H2B protein, driven by the H3 promoter, emitted bright red fluorescence both in the hyphae and the spores. In each cell, the red fluorescence was concentrated in one spot in the central region, consistent well with the position and the size of the nucleus (Fig. 4). In pHMChA and pNMChA transformants, irrespective of selection marker, the mCherry-PTS1 fusion protein driven by the MPG1 promoter also fluoresced in the hyphae and the spores. In this case, the red fluorescence was distributed as small red dots (0.2–1 μm in diameter) throughout the cell, a position and size consistent with that of the fungal peroxisome (Fig. 6). Our results thus indicate that mCherry could be used in subcellular targeting T. mentagrophytes proteins. The high level of expression observed in the H3 and MPG1 promoters indicates that mCherry is useful even for targeting small organelles. Figure 6. View largeDownload slide Peroxisome labeling in T. mentagrophytes using mCherry. We incubated the T. mentagrophytes pHMChA (MPG1:mCherry-PTS1/HPH) and pNMmChA (MPG1:mCherry-PTS1/NTPII) transformants on SDA media for 1 week, and then observed the fungal hyphae and spores under a Leica microscope. Several bright dots of red fluorescence were observed in each fungal cell, which coincided with the results of peroxisome localization. Bar = 5 μm. Figure 6. View largeDownload slide Peroxisome labeling in T. mentagrophytes using mCherry. We incubated the T. mentagrophytes pHMChA (MPG1:mCherry-PTS1/HPH) and pNMmChA (MPG1:mCherry-PTS1/NTPII) transformants on SDA media for 1 week, and then observed the fungal hyphae and spores under a Leica microscope. Several bright dots of red fluorescence were observed in each fungal cell, which coincided with the results of peroxisome localization. Bar = 5 μm. We randomly selected two pKD9-H2B-mCherry transformants with high fluorescence intensities to inject the skins of rabbits. After 5 days, the skin tissues were detected under a fluorescence microscope. The skin patches inoculated with pKD9-H2B-mCherry emitted red fluorescence, whereas no fluorescence was observed in the skin patches inoculated with the wild-type strain (Fig. 5). Analysis of the p1300-KO transformant phenotype To test the p1300-KO transformant library, we examined the phenotypes of 20 transformants randomly selected from the library. Except that a transformant of them produced fewer spores than the wild-type strain, the transformants did not differ significantly from the wild-type in vegetative growth and colony morphology (Fig. 7). In addition, the virulence of transformants appeared to be similar to rabbit skin as the wild-type strain. The regions of rabbit skin inoculated with either the wild type or the p1300-KO transformants displayed typical symptoms of T. mentagrophytes infection, fur loss, scurf and encrustation (Fig. 8). The strains were re-isolated from the diseased skin tissues and tested, which proved that they were still resistant to hygromycin. Figure 7. View largeDownload slide Colony diameters and spore production of a portion of T. mentagrophytes p1300-KO transformants. After incubating the randomly selected p1300-KO transformants and the wild-type strain ZJA-1 on SDA plates for 9 days (28°C), colony diameter and spore production were measured. In most of the transformants, no significant differences were observed between the transformants and the wild-type strain ZJA-1. However, spore production was significantly lower only in a single transformant (No. 3) compared to the control group. Colony morphology was not significantly different between the transformants and the wild-type strain ZJA-1. Each treatment was performed in triplicate; error bars indicate the standard error. Figure 7. View largeDownload slide Colony diameters and spore production of a portion of T. mentagrophytes p1300-KO transformants. After incubating the randomly selected p1300-KO transformants and the wild-type strain ZJA-1 on SDA plates for 9 days (28°C), colony diameter and spore production were measured. In most of the transformants, no significant differences were observed between the transformants and the wild-type strain ZJA-1. However, spore production was significantly lower only in a single transformant (No. 3) compared to the control group. Colony morphology was not significantly different between the transformants and the wild-type strain ZJA-1. Each treatment was performed in triplicate; error bars indicate the standard error. Figure 8. View largeDownload slide Virulence test of a portion of T. mentagrophytes p1300-KO transformants. Rabbits were subcutaneously injected with randomly selected p1300-KO transformants. After 10 days, the skin tissues were assessed. The virulence of the p1300-KO transformants was similar to that of the wild-type strain ZJA-1. Figure 8. View largeDownload slide Virulence test of a portion of T. mentagrophytes p1300-KO transformants. Rabbits were subcutaneously injected with randomly selected p1300-KO transformants. After 10 days, the skin tissues were assessed. The virulence of the p1300-KO transformants was similar to that of the wild-type strain ZJA-1. DISCUSSION Fluorescent protein labeling is widely used to assess the spatiotemporal expression of genes and to monitor the subcellular localization of proteins in cells, and also to track the infection progresses of pathogens in their hosts (Li et al.2014). However, in T. mentagrophytes, the important fungal pathogen for both human and animal, only one fluorescent protein, GFP, has been used, which severely limits the research on pathogenesis and gene functions of the fungus. Here, we expressed mCherry for the first time in T. mentagrophytes and obtained the transformants emitting bright, well distributed and genetically stable red fluorescence. The fluorescence was also detectable in infected rabbit-skin cells. We also achieved the nuclear and the peroxisomal labeling with mCherry in the fungus. The mCherry and GFP, cooperating with each other, and/or with chemical staining, could be more efficient employed in the fungus, for cellular or subcellular localization of proteins and as well as protein–protein interactions (Nagai et al.2002). We used a series vectors and two selection markers in AtMT transformation of the fungus. Our results reinforced the opinion that AtMT is an efficient, easily operated and stable genetic transformation method in filamentous fungi (Shi 2015). The combination of AtMT, multiple resistance markers, mCherry and GFP, and gene deletion strategy will allow a high-throughput and more precise assessment of gene function in T. mentagrophytes. To select a suitable promoter is critical to express fluorescent proteins and to study on gene functions in a given organism. In filamentous fungi, the Aspergillus nidulans promoters trpC and GPD1 are two constitutive promoters, active in a variety of fungal species (Chen, Choi and Nuss 1993) and are often used to express the resistance markers. Here, both the hygromycin resistance gene and the NPTII gene were driven by the trpC promoter. In addition, the A. nidulans GPD1 promoter has also been used to express DsRed-Express in Penicillium paxilli, Trichoderma harzianum and T. virens (syn. Gliocladium virens) (Mikkelsen et al.2003). Histone H3 is regarded as a gene constitutively and highly expressed in a variety of organisms (Barski et al.2007). The M. oryzae H3 promoter is highly expressed not only in M. oryzae, but also in Harpophora oryzae and Chaetomium globosum (Li et al.2012). Here, we used the M. oryzae H3 promoter to drive the expression of mCherry and mCherry fusions. The result showed that under the M. oryzae H3 promoter, mCherry was expressed in spores and hyphae of T. mentagrophytes, as well as in infected animal tissues, indicating that the M. oryzae H3 promoter is also effective in T. mentagrophytes. The M. oryzae MPG1 gene encodes a hydrophobic protein that is located on the surface of the hyphae and spores and maintains surface hydrophobicity (Talbot, Ebbole and Hamer 1993), and specifically involved in appressorium formation and pathogenicity. The MPG1 gene is highly expressed in M. oryzae hyphae, spores and appressoria (Hamer and Talbot 1998). We previously found that the MPG1 promoter is active even more than either GPD1 or the trpC promoter in M. oryzae (Wang et al.2008). However, the MPG1 promoter has not yet been used in fungal species other than M. oryzae. Our results showed that the MPG1 promoter is highly active in the hyphae and spores of T. mentagrophytes, with an expression level equal to or higher than that of the M. oryzae H3 promoter. Therefore, the MPG1 promoter is likely another useful promoter in studying filamentous fungal species besides M. oryzae. In addition, the high expression of the MPG1 promoter in both T. mentagrophytes and M. oryzae might suggest a shared pathogenic pathway between the plant pathogen and the animal pathogen. The number of nuclei and the dynamic processes of nuclear cleavage, movement and degradation during reproduction (both sexual and parasexual) are important aspects of fungal development (Suelmann, Sievers and Fischer 1997). Previous studies have shown that in fungal infections in plants, a specific set of nuclear splits and degradation events occur during the formation of infectious structures, which play very important roles in fungal pathogenicity. Here, we labeled the nucleus of T. mentagrophytes with mCherry, generating an important tool for the study on nuclear developments during infection. The peroxisome is an organelle presented throughout eukaryotic cells which is involved in basic metabolic functions, including fatty acid β-oxidation and glyoxylate recycling (Poirier et al.2006). In filamentous fungi, the peroxisome is additionally involved in the biosynthesis of melanin and the generation of Woronin body (van der Klei and Veenhuis, 2013; Li et al.2014). The proliferation and degradation of peroxisomes, including changes in number and volume, is controlled by the metabolism of the organism (Veenhuis et al.1983). Enzymes in peroxisomes contain specific signal peptides that are recognized specifically and transported into the organelles (Brocard and Hartig 2006). Thus, visualization of the peroxisomes by tagging peroxisome signal peptides with fluorescent proteins is a useful method for investigating peroxisomal dynamics and the function of the genes (PEX) related to peroxisome formation. Here, we used PTS1 to label the T. mentagrophytes peroxisomes, allowing it possible to study peroxisomal dynamics in T. mentagrophytes. Previous studies have indicated that peroxisomes and PEX gene play important roles in fungal pathogenicity in plant pathogenic fungi and the human fungal pathogen Cryptococcus neoformans (Goh et al.2011). However, no any previous studies have investigated the relationship between peroxisomes and pathogenicity in T. mentagrophytes. Our work also provided an important tool for future studies on the role of peroxisomes and PEX genes in the development and pathogenicity of T. mentagrophytes. We constructed a hygromycin-resistant AtMT library containing more than 1000 transformants. A subculture of the transformants from the library indicated that the hygromycin resistance gene had been successfully integrated into the genome and stably inherited in the transformants. The phenotypical analysis showed that most of the transformants were not significantly different from the wild-type strain in vegetative growth, spore production and pathogenicity. These results were not out of our expectation because phenotypic changes are usually rare events upon gene insertion and to obtain one desired mutant often requires selection from a pool of thousands of transformants. In addition, the phenotypical identity of these transformants to the wild-type indicates that the transformation procedures and the expression of the hygromycin-resistance gene did not affect the development of T. mentagrophytes. We will focus on the selection of mutants with defective development or pathogenicity from the library and on the related genes in future studies. FUNDING The China Agricultural Research System (No. nycytx-44-3-2), the National Natural Science Foundation of China (No. 31402241) and Key research and development plan of Zhejiang Province (No. 2016C02054-10) supported this study. Acknowledgements We would like to thank Ms. Xu Yuan from Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences for her technical help in the experiment. We have to thank Dr. Lu Jianping from Zhejiang university kindly provided pKD9-H2B-mCherry. Conflicts of interest. None declared. REFERENCES Alipour M, Mozafari NA. Terbinafine susceptibility and genotypic heterogeneity in clinical isolates of Trichophyton mentagrophytes by random amplified polymorphic DNA (RAPD). J Mycol Méd  2015; 25: e1– 9. Google Scholar CrossRef Search ADS PubMed  Alshahni MM, Makimura K, Yamada T et al.   Nourseothricin acetyltransferase: a new dominant selectable marker for the dermatophyte Trichophyton mentagrophytes. Med Mycol  2010; 48: 665– 8. Google Scholar CrossRef Search ADS PubMed  Barski A, Cuddapah S, Cui K et al.   High-resolution profiling of histone methylations in the human genome. Cell  2007; 129: 823– 37. Google Scholar CrossRef Search ADS PubMed  Brocard C, Hartig A. Peroxisome targeting signal 1: Is it really a simple tripeptide? BBA-Mol Cell Res  2006; 1763: 1565– 73. Cafarchia C, Weigl S, Figueredo LA et al.   Molecular identification and phylogenesis of dermatophytes isolated from rabbit farms and rabbit farm workers. Vet Microbiol  2012; 154: 395– 402. Google Scholar CrossRef Search ADS PubMed  Chen B, Choi GH, Nuss DL. Mitotic stability and nuclear inheritance of integrated viral cDNA in engineered hypovirulent strains of the chestnut blight fungus. EMBO J  1993; 12: 2991– 8. Google Scholar PubMed  De Groot MJ, Bundock P, Hooykaas PJ et al.   Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol  1998; 16: 839– 42. Google Scholar CrossRef Search ADS PubMed  Garrity SJ, Sivanathan V, Dong J et al.   Conversion of a yeast prion protein to an infectious form in bacteria. P Natl Acad Sci USA  2010; 107: 10596– 601. Google Scholar CrossRef Search ADS   Goh J, Jeon J, Kim KS et al.   The PEX7-mediated peroxisomal import system is required for fungal development and pathogenicity in Magnaporthe oryzae. PLoS One  2011; 6: e28220. Google Scholar CrossRef Search ADS PubMed  Gonzalez R, Ferrer S, Buesa J et al.   Transformation of the dermatophyte Trichophyton mentagrophytes to hygromycin B resistance. Infect Immun  1989; 57: 2923– 5. Google Scholar PubMed  Hamer JE, Talbot NJ. Infection-related development in the rice blast fungus Magnaporthe grisea. Curr Opin Microbiol  1998; 1: 693– 7. Google Scholar CrossRef Search ADS PubMed  Kaufman G, Horwitz BA, Hadar R et al.   Green fluorescent protein (GFP) as a vital marker for pathogenic development of the dermatophyte Trichophyton mentagrophytes. Microbiology  2004; 150: 2785– 90. Google Scholar CrossRef Search ADS PubMed  Li H, Lu J, Liu X et al.   Vectors building and usage for gene knockout, protein expression and fluorescent fusion protein in the rice blast fungus. J Agr Biotechnol  2012; 20: 94– 104. Li L, Wang J, Chen H et al.   Pex14/17, a filamentous fungus-specific peroxin, is required for the import of peroxisomal matrix proteins and full virulence of Magnaporthe oryzae. Mol Plant Pathol  2016. Li L, Wang J, Zhang Z et al.   MoPex19, which is essential for maintenance of peroxisomal structure and woronin bodies, is required for metabolism and development in the rice blast fungus. PLoS One  2014; 9: e85252. Google Scholar CrossRef Search ADS PubMed  Matz MV, Fradkov AF, Labas YA et al.   Erratum: Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol  1999; 17. Mikkelsen L, Sarrocco S, Lübeck M et al.   Expression of the red fluorescent protein DsRed-Express in filamentous ascomycete fungi. FEMS Microbiol Lett  2003; 223: 135– 9. Google Scholar CrossRef Search ADS PubMed  Nagai T, Ibata K, Park ES et al.   A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol  2002; 20: 87– 90. Google Scholar CrossRef Search ADS PubMed  Poirier Y, Antonenkov VD, Glumoff T et al.   Peroxisomal β-oxidation—A metabolic pathway with multiple functions. BBA-Mol Cell Res  2006; 1763: 1413– 26. Rho HS, Kang S, Lee YH. Agrobacterium tumefaciens-mediated transformation of the plant pathogenic fungus, Magnaporthe grisea. Mol Cell  2001; 12: 407– 11. Shaner NC, Campbell RE, Steinbach PA et al.   Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol  2004; 22: 1567– 72. Google Scholar CrossRef Search ADS PubMed  Shi Y. Assessment of the function of SUB6 gene for the pathogenicity of Trichophyton mentagrophytes. Doctro Thesis China Agricultural University, 2015. Shi Y, Niu Q, Yu X et al.   Assessment of the function of SUB6 in the pathogenic dermatophyte Trichophyton mentagrophytes. Med Mycol  2015; 54: 59– 71. Google Scholar PubMed  Suelmann R, Sievers N, Fischer R. Nuclear traffic in fungal hyphae: in vivo study of nuclear migration and positioning in Aspergillus nidulans. Mol Microbiol  1997; 25: 757– 69. Google Scholar CrossRef Search ADS PubMed  Sun D, Cao H, Shi Y et al.   The regulatory factor X protein MoRfx1 is required for development and pathogenicity in the rice blast fungus Magnaporthe oryzae. Mol Plant Pathol  2017; 18: 1075– 88. Google Scholar CrossRef Search ADS PubMed  Talbot NJ, Ebbole DJ, Hamer JE. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell  1993; 5: 1575– 90. Google Scholar CrossRef Search ADS PubMed  van der Klei IJ, Veenhuis M. The versatility of peroxisome function in filamentous fungi. In: del Río LA (ed). Peroxisomes and Their Key Role in Cellular Signaling and Metabolism . Springer Netherlands, Dordrecht, 2013. Google Scholar CrossRef Search ADS   Veenhuis M, Douma A, Harder W et al.   Degradation and turnover of peroxisomes in the yeast Hansenula polymorpha induced by selective inactivation of peroxisomal enzymes. Arch Microbiol  1983; 134: 193– 203. Google Scholar CrossRef Search ADS PubMed  Wang JY, Wu XY, Zhang Z et al.   Fluorescent co-localization of PTS1 and PTS2 and its application in analysis of the gene function and the peroxisomal dynamic in Magnaporthe oryzae. J Zhejiang Univ Sci B  2008; 9: 802– 10. Google Scholar CrossRef Search ADS PubMed  Wu CZ, Xu F, Gao YI et al.   Application of fluorescent labeling technique in the research of biology and medicine. J Chongqing Univ Technol  2014; 5: 55– 62. Yamada T, Makimura K, Hisajima T et al.   Genetic transformation of the dermatophyte, Trichophyton mentagrophytes, based on the use of G418 resistance as a dominant selectable marker. J Dermatol Sci  2008; 49: 53– 61. Google Scholar CrossRef Search ADS PubMed  Yamada T, Makimura K, Hisajima T et al.   Enhanced gene replacements in Ku80 disruption mutants of the dermatophyte, Trichophyton mentagrophytes. FEMS Microbiol Lett  2009a; 298: 208– 17. Google Scholar CrossRef Search ADS   Yamada T, Makimura K, Satoh K et al.   Agrobacterium tumefaciens -mediated transformation of the dermatophyte, Trichophyton mentagrophytes: an efficient tool for gene transfer. Med Mycol  2009b; 47: 485– 94. Google Scholar CrossRef Search ADS   Yang J, Zhang ZH, Luo QM. Research progress of fluorescent protein. Acta Biophys Sin  2010; 26: 1025– 35. Zhang X, Wang Y, Chi W et al.   Metalloprotease genes of Trichophyton mentagrophytes are important for pathogenicity. Med Mycol  2013; 52: 36– 45. Zhou X, Li G, Xu JR. Efficient approaches for generating gfp fusion and epitope-tagging constructs in filamentous fungi. In: Xu J-R, Bluhm BH (eds). Fungal Genomics: Methods and Protocols . Humana Press, Totowa, NJ, 2011. Google Scholar CrossRef Search ADS   © Crown copyright 2018. This article contains public sector information licensed under the Open Government Licence v3.0 (http://www.nationalarchives.gov.uk/doc/open-government-licence/version/3/). http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Microbiology Letters Oxford University Press

Application of the red fluorescent protein mCherry in mycelial labeling and organelle tracing in the dermatophyte Trichophyton mentagrophytes

Loading next page...
 
/lp/ou_press/application-of-the-red-fluorescent-protein-mcherry-in-mycelial-FfjejVW7TD
Publisher
Blackwell
Copyright
© Crown copyright 2018.
ISSN
0378-1097
eISSN
1574-6968
D.O.I.
10.1093/femsle/fny006
Publisher site
See Article on Publisher Site

Abstract

Abstract Trichophyton mentagrophytes is a fungus that causes skin disease in humans and other animals worldwide. Studies on molecular biology and fluorescent labeling of the fungus are limited. Here, we applied mCherry for the first time in T. mentagrophytes to label the fungus and its organelles. We constructed four expression vectors of mCherry or mCherry fusions containing a variety of resistance markers and promoters, which were then integrated, together with two previous mCherry expression vectors, in T. mentagrophytes via Agrobacterium tumefaciens-mediated transformation (AtMT). The resulting transformants emitted bright red fluorescence. We used the histone protein H2B and the peroxisome targeting signal 1 (PTS1) peptide to target the nucleus and peroxisomes, respectively, in T. mentagrophytes. In the transformants expressing mCherry-fused H2B, the fluorescence was distinctly localized to the nuclei in hyphae, spores and the fungal cells in infected animal tissue. In the T. mentagrophytes transformants where the peroxisome was targeted, the mCherry was present as small dots (0.2–1 μm diameter) throughout the spores and the hyphae. We also constructed a T. mentagrophytes AtMT library containing more than 1000 hygromycin-resistant transformants that were genetically stable. Our results provide useful tools for further investigations on molecular pathogenesis of T. mentagrophytes. Trichophyton mentagrophytes, fluorescent, mCherry, AtMT INTRODUCTION Trichophyton mentagrophytes, a common fungus, causes skin diseases in humans and other animals worldwide (Cafarchia et al.2012). In rabbits, the symptoms of T. mentagrophytes infection include scurf, encrustation, fur loss, exudation, epifolliculitis and itchy skin (Cafarchia et al.2012), resulting in severe economic losses for rabbit breeders. The control of T. mentagrophytes infections in rabbits is vital both for the rabbit breeding industry and for public health and safety. Recent studies on T. mentagrophytes infections in rabbits have focused on outbreak prevention. However, the underlying mechanisms of the infection have rarely been investigated. Furthermore, investigations on gene function in T. mentagrophytes have been thus far limited to the Ku genes (Ku70 and Ku80) (Yamada et al.2009a), the keratinase gene (Shi et al.2015) and the metalloprotease gene (Zhang et al.2013). In previous studies, various physical and chemical methods have been used to construct T. mentagrophytes mutants, but these methods were deemed inefficient, and the mutated genes were difficult to isolate (Gonzalez et al.1989; Kaufman et al.2004). The availability of the T. mentagrophytes genome sequence (Alipour and Mozafari 2015) and the establishment of new fungal transformation methods make it possible to provide a more rapid and high-throughput study of the gene function in this species. Agrobacterium tumefaciens-mediated transformation (AtMT) is one of the most common methods used for genetic transformation. De Groot et al. (1998) conducted insertion of T-DNA for the first time into a filamentous fungal genome using the AtMT method. Due to the simplicity and efficiency of AtMT, as well as the stability of the resulting transformants, AtMT has been used in many fungi, including T. mentagrophytes (Yamada et al.2008, 2009b; Zhang et al.2013). The selection markers used in AtMT of T. mentagrophytes have involved the hygromycin resistance gene (Yamada et al.2009a; Zhang et al.2013), the neomycin phosphotransferase gene (NPTII) (Yamada et al.2008) and the nourseothricin resistance gene (Alshahni et al.2010). Fluorescent proteins have been widely used to assess promoter activity and gene expression level, to monitor proteins localization, and to study organismal growth and development (Wu et al.2014). The green fluorescent protein (GFP) is the most common one used in filamentous fungi (Zhou, Li and Xu 2011), although the red fluorescent protein (RFP), yellow fluorescent protein (YFP) and cyan fluorescent protein (CFP) have also been reported (Garrity et al.2010). In 1999, Matz et al. (1999) isolated an RFP from Discosoma spp. with a maximum absorption wavelength of 558 nm and maximum emission wavelength of 583 nm. Since Mikkelsen et al. (2003) succesfully used DsRed in filamentous fungi in 2013, the RFP has been used with increasing frequency in fungal species. RFP has a variety of variants, including mBanana, mOrange, dTomato, mTangerine, mStrawberry and mCherry (Shaner et al.2004). These proteins have different spectra, colors and physiochemical properties. The protein mCherry is excited by light at a wavelength of 580 nm and emits fluorescence at 610 nm (Shaner et al.2004), which is detected as cherry-red fluorescence. Compared to DsRed, mCherry matures faster and has other better physiochemical properties (Yang, Zhang and Luo 2010). To date, however, only GFP has been used in T. mentagrophytes (Kaufman et al.2004; Yamada et al.2008). In present work, the application of mCherry in T. mentagrophytes was established. We constructed four different promoter-driven mCherry expression vectors with two selective markers, which were then transformed into T. mentagrophytes using AtMT. In the resulting transformants, the mCherry was stably expressed in high levels, which could be detected both in artificial medium and in animal skin. We then tagged the nuclei and peroxisomes of T. mentagrophytes with mCherry. We also constructed a library of T. mentagrophytes AtMT transformants. Our research provided a tool for the study of the pathogenic mechanisms and molecular biology of T. mentagrophytes. MATERIALS AND METHODS Fungal species and culture medium We isolated and stored wild-type T. mentagrophytes strain ZJA-1 in our laboratory. This strain was authenticated by the Nanjing Institute of Dermatology, Chinese Academy of Medical Sciences, Nanjing, China. We cultured T. mentagrophytes in Sabourand's agar (SDA; Beijing Solarbio Science and Technology Co., Ltd., Beijing, China). The A. tumefaciens strain used in this study was AGL1. We used YEB medium (5 g beef extract, 1 g yeast extract, 5 g peptone, 5 g sucrose and 0.04 g MgSO4·7H2O) to culture A. tumefaciens. We used IM medium (Zhang et al.2013) to co-culture T. mentagrophytes and A. tumefaciens. SDA plates containing 400 μg/mL hygromycin B (Roche, Mannheim, Germany) or 500 μg/mL G418 (Sigma) were used to screen the transformants. Vector construction To initiate vector construction, we used p1300NMcherryA (hereafter abbreviated as pNMChA) (Li et al.2016), a vector carrying the G418 resistance gene (NPTII), and a version of mCherry tagged with peroxisomal targeting signal 1 (mCherry-PTS1) under the promoter of MPG1 gene (MGG_10315) from Magnaporthe oryzae. A 0.7-kb fragment of the mCherry CDS without PTS1 was amplified using pNMChA as template and the primer pair mCh-Xb/mCh-Sm. We replaced the mCherry-PTS1 in pNMChA with the mCherry CDS without PTS1 using XbaI/SmaI digestion to generate pNMCh. A 1.4-kb fragment of the HPH cassette was amplified using p1300-KO (Li et al.2014) as template and the primer pair HPH-Xh1/HPH-Xh2. We replaced the NPTII gene in pNMChA with the HPH cassette using XhoI digestion to generate pHMChA, and replaced the NPTII gene in pNMCh with the HPH cassette using XhoI digestion to generate pHMCh. A 1.5-kb fragment of the histone H3 gene promoter from M. oryzae (MGG_01159) was amplified using genomic DNA from M. oryzae Guy11 as template and the primer pair H3-Pv/H3-Xb. We replaced the MPG1 promoter in pHMCh with the H3 promoter using PvuI/XbaI digestion to generate pHHCh. All the primers used are listed in Table 1. Table 1. Primers of different genes. Primer  Sequence  Length  HPHCK1  TTCGCCCTTCCTCCCTTTATTTCA  1.0 kb  HPHCK2  GCTTCTGCGGGCGATTTGTGTACG    NPTCK1  GAGGTCAACACATCAATGC  1.1 kb  NPTCK2  TCAGAAGAACTCGTCAAGAAGGCG    mCh-Xb  GCCCTCTAGAATGGTGAGCAAGGGCGAGGAGGAT  0.7 kb  mCh-Sm  TCCCCCGGGTTAGCCGCCGGTGGAGTGGCGGCCCTC    HPH-Xh1  CCGCTCGAGTGGAGGTCAACACATCAATGCTAT  1.4 kb  HPH-Xh2  CCGCTCGAGCTACTCTATTCCTTTGCCCTCGGA    H3-Pv  ATCGATCGAGTCATGTTGATTGAGGTGTTGT  1.5 kb  H3-Xb  GCTCTAGAGGCCATTGTGATTGATTTGTGATT    Primer  Sequence  Length  HPHCK1  TTCGCCCTTCCTCCCTTTATTTCA  1.0 kb  HPHCK2  GCTTCTGCGGGCGATTTGTGTACG    NPTCK1  GAGGTCAACACATCAATGC  1.1 kb  NPTCK2  TCAGAAGAACTCGTCAAGAAGGCG    mCh-Xb  GCCCTCTAGAATGGTGAGCAAGGGCGAGGAGGAT  0.7 kb  mCh-Sm  TCCCCCGGGTTAGCCGCCGGTGGAGTGGCGGCCCTC    HPH-Xh1  CCGCTCGAGTGGAGGTCAACACATCAATGCTAT  1.4 kb  HPH-Xh2  CCGCTCGAGCTACTCTATTCCTTTGCCCTCGGA    H3-Pv  ATCGATCGAGTCATGTTGATTGAGGTGTTGT  1.5 kb  H3-Xb  GCTCTAGAGGCCATTGTGATTGATTTGTGATT    *The restriction sites were underlined. View Large pNMCh, pHMCh and pHHCh were used to label the mycelia of T. mentagrophytes. pNMChA and pHMChA were used to target the peroxisomes in T. mentagrophytes. pKD9-H2B-mCherry (Li et al.2012; Sun et al.2017), a gift from Dr Lu of Zhejiang University (Hangzhou, China), which carries a mCherry fusion with M. oryzae histone H2B (MGG 03578) and under the control of the M. oryzae H3 promoter, was used for nuclear targeting. All of these vectors were transformed into T. mentagrophytes respectively using the AtMT method. To generate a T. mentagrophytes transformant library, we used hygromycin-resistant vector p1300-KO (Li et al.2014). AtMT transformation The T. mentagrophytes AtMT transformation protocol we used was adapted from Rho, Kang and Lee (2001). Briefly, T. mentagrophytes was inoculated into SDA medium and grown for 7 days at 28°C and a relative humidity of 60%. Spores were collected using 5 mL sterile water. The spore solution was filtered through three layers of sterile lens paper, and the residue was centrifuged at 5000 rpm for 10 min to collect the spores. The spores were then washed three times with sterile water. The spore concentration was adjusted to 5 × 105 spores/mL. We streaked A. tumefaciens onto a plate and activated it. A single colony was cultured in YPD-medium overnight at 28°C until the OD660 was 0.6. We then mixed 100 μL of the T. mentagrophytes culture with 100 μL of A. tumefaciens culture and plated the mixture on 6-cm diameter IM plates lined with a nitrocellulose membrane. The IM plates were incubated in the dark at 22°C for 48 h. The membranes and culture were then transferred onto selection plates containing either 400 μg/mL hygromycin or 500 μg/mL G418 and incubated for 4 days at 28°C. Transformed colonies were selected using sterile toothpicks, and checked again on selection media. The colonies after two rounds of selection, as the potential transformants, were stored for further experimentation. HPH and NPTII gene amplification We used PCR to amplify the HPH gene (with primers HPHCK1 and HPHCK2; Table 1) and the NPTII gene (with primers NPTCK1 and NPTCK2; Table 1). The amplified fragment of HPH was 1.0 kb long, and that of NPTII was 1.1 kb long. We used a 50 μL reaction volume containing 0.5 μL Taq, 4 μL dNTP, 5 μL 10 × buffer, 39.5 μL water, 2 μL forward primer and 2 μL reverse primer. Our PCR reaction conditions were as follows: 5 mins at 95°C; followed by 35 cycles of 30 s at 95°C, 30 s at 55°C and 90 s at 72°C; and 10 min at 72°C. Measurement of colony growth and spore production We used a 0.5-cm diameter puncher to collect samples from the margins of the transformant and wild-type ZJA-1 colonies. Both sets of samples were inoculated into separate SDA plates and incubated at 28°C for 9 days. The colonies were photographed and the diameters of the colonies were measured. The experiment was repeated three times for each colony. Each plate was washed with 5 mL sterile water, and the collected solution was filtered through three layers of lens paper to collect spores. The collected spores were counted using a hemocytometer, and spore concentration and production were calculated. Each treatment was performed in triplicate. Animal inoculation We generated transformants and wild-strain spore solutions (5 × 107 spores/mL) as mentioned above and obtained three 2-month-old New Zealand rabbits from a rabbit farm located in Zhejiang Academy of Agricultural Science. The hair on backs of the rabbits was shaved, and the shaved areas were divided into two equal-sized regions using a marker. We injected the transformant spore solution and wild-type strain spore solution respectively into the experimental regions and the control region. After 5 days, the skins in the inoculated regions were removed, and frozen microtome sections were quickly prepared. The samples were observed under a confocal microscope. After 7 days, we re-isolated the strains from the skin tissues and cultured them on SDA plates to test the resistance of the transformants. All our experimental methodologies and protocols were approved by the Animal Ethics Committee for Clinical Veterinary Science Experiments of the Zhejiang Academy of Agricultural Science, Hangzhou, China. Confocal microscope observation We used a Leica SP2 confocal microscope (Leica, Germany) and a ZEISS LSM780 inverted confocal microscope (Zeiss, Germany) to examine hyphae and spores of the transformant, as well as the animal tissue samples. We used an excitation wavelength of 580 nm and an emission wavelength of 610 nm. RESULTS Transformant selection and genetic stability The structures of pNMCh, pHMChA, pHMCh and pHHCh are shown in Fig. 1. The expression cassettes of the fluorescence proteins and the selection markers were both enclosed between two T-borders to ensure integration into the T. mentagrophytes genome. Figure 1. View largeDownload slide The structures of pNMChA (Li et al.2016), pNMCh, pHMChA, pHMCh, pHHCh and pKD9-H2B-mCherry (Sun et al.2017). Figure 1. View largeDownload slide The structures of pNMChA (Li et al.2016), pNMCh, pHMChA, pHMCh, pHHCh and pKD9-H2B-mCherry (Sun et al.2017). Transformant selection and genetic stability We obtained more than 1000 T. mentagrophytes p1300-KO transformants and more than 30 transformants for pHHCh, pNMCh, pHMChA, pNMChA and pKD9-H2B-mCherry, respectively. These transformants grew normally on the SDA plates supplemented with hygromycin or G418. We randomly selected 20 p1300-KO and 12 pNMCh transformants for extraction DNA and to test the T-DNA insertion by PCR. With the primers HPHCK1 (forward) and HPHCK2 (reverse) and the DNA from p1300-KO transformants as templates, we obtained amplicons of ∼1.0 kb in size, identical to the size of the DNA fragment amplified using the p1300-KO plasmid as template (Fig. 2B and C), indicating that the hygromycin resistance gene had been inserted into the transformant genome. When the genome of T. mentagrophytes ZJA-1 was used as template, no PCR product was amplified. Similarly, PCR amplification of NTPII from pNMCh transformants obtained DNA fragments of 1.1 kb in size, which were identical in size to the fragment of the G418 resistance gene amplified using pNMCh plasmid as template. When the genome of T. mentagrophytes ZJA-1 was used as template, no PCR product of this size was amplified (Fig. 2D), indicating that the NTPII gene had been inserted into the transformant genome. Figure 2. View largeDownload slide Resistance test and PCR amplification to confirm the transformants and check the genetic stability of the transformants. (A) We subcultured the selected T. mentagrophytes p1300-KO transformants on SDA medium for five generations, and then incubated these transformants on hygromycin-containing SDA medium at 26°C for 5 days. 1#, the first generation; and 5#, the fifth generation. (B and C) DNAs of the transformants at the first and fifth generations were extracted, and PCR was performed with primers for the hygromycin resistance gene (forward primer HPHCK1 and reverse primer HPHCK2). All of the transformants [2(5#), 3(5#), 5(5#), 8(5#), 9(5#), 10(5#)] showed a band of 1 kb in size, similar to the band amplified with the p1300-KO plasmid (positive control). However, no PCR products were generated using the genome of T. mentagrophytes ZJA-1 as template. (C) The selected pNMCh transformants were cultured on G418-contained SDA plates for 5 days and then used in DNA extraction, which was later in PCR amplification of the G418 resistance gene in the transformants (forward primer NPTCK1 and reverse primer NPTCK2). All of the transformants (1–6) had a band of 1.1 kb in size, similar to the band amplified using the pNMCh plasmid (positive control). However, no PCR products of this size were generated using the genome of T. mentagrophytes ZJA-1 as template. Figure 2. View largeDownload slide Resistance test and PCR amplification to confirm the transformants and check the genetic stability of the transformants. (A) We subcultured the selected T. mentagrophytes p1300-KO transformants on SDA medium for five generations, and then incubated these transformants on hygromycin-containing SDA medium at 26°C for 5 days. 1#, the first generation; and 5#, the fifth generation. (B and C) DNAs of the transformants at the first and fifth generations were extracted, and PCR was performed with primers for the hygromycin resistance gene (forward primer HPHCK1 and reverse primer HPHCK2). All of the transformants [2(5#), 3(5#), 5(5#), 8(5#), 9(5#), 10(5#)] showed a band of 1 kb in size, similar to the band amplified with the p1300-KO plasmid (positive control). However, no PCR products were generated using the genome of T. mentagrophytes ZJA-1 as template. (C) The selected pNMCh transformants were cultured on G418-contained SDA plates for 5 days and then used in DNA extraction, which was later in PCR amplification of the G418 resistance gene in the transformants (forward primer NPTCK1 and reverse primer NPTCK2). All of the transformants (1–6) had a band of 1.1 kb in size, similar to the band amplified using the pNMCh plasmid (positive control). However, no PCR products of this size were generated using the genome of T. mentagrophytes ZJA-1 as template. To test the genetic stability of the transformants, randomly selected p1300-KO transformants were inoculated into hygromycin-free SDA plates and cultured for five generations. The colonies were then inoculated into plates containing hygromycin. All transformants grew as well on the hygromycin-contained SDA plates as they did on hygromycin-free SDA plates (Fig. 2A). We used PCR to amplify the HPH gene from the fifth-generation transformants and got the proper PCR product of 1.0 kb in size (Fig. 2C). mCherry expression in T. mentagrophytes The T. mentagrophytes pHHCh and pNMCh transformants emitted bright red fluorescence under a confocal microscope, which was evenly distributed throughout the cell, while no fluorescence was observed in the T. mentagrophytes wild-type strain ZJA-1 (control). No significant difference was observed in the fluorescence intensity among the different transformants. The brightness of the fluorescence in hyphae and spores within the same transformant were also not significantly different (Fig. 3). These findings indicate that mCherry was highly expressed in the hyphae and spores of T. mentagrophytes irrespective of H3 or MPG1 as promoter, and the selection markers (HPH or NTPII) did not affect the level of mCherry expression. Figure 3. View largeDownload slide Fluorescence detection of mCherry-labeled strains of T. mentagrophytes We incubated the T. mentagrophytes pHHCh (H3:mCherry/HPH) and pNMCh (MPG1: mCherry/NTPII) transformants on SDA media for 1 week. The fungal hyphae and spores were then picked and observed under a Leica microscope, which showed red fluorescence that was evenly distributed throughout the hyphae and spores of the transformants. No fluorescence was observed in the wild-type ZJA-1 strain (control). Bar = 10 μm. Figure 3. View largeDownload slide Fluorescence detection of mCherry-labeled strains of T. mentagrophytes We incubated the T. mentagrophytes pHHCh (H3:mCherry/HPH) and pNMCh (MPG1: mCherry/NTPII) transformants on SDA media for 1 week. The fungal hyphae and spores were then picked and observed under a Leica microscope, which showed red fluorescence that was evenly distributed throughout the hyphae and spores of the transformants. No fluorescence was observed in the wild-type ZJA-1 strain (control). Bar = 10 μm. Figure 4. View largeDownload slide Nuclear labeling in T. mentagrophytes using mCherry We incubated the T. mentagrophytes transformant pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) on SDA medium for 1 week and then observed the fungal hyphae and spores with a Leica microscope. A dot of red fluorescence was observed in the center of each fungal cell, which coincided with the results of nuclear localization. Bar = 10 μm. Figure 4. View largeDownload slide Nuclear labeling in T. mentagrophytes using mCherry We incubated the T. mentagrophytes transformant pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) on SDA medium for 1 week and then observed the fungal hyphae and spores with a Leica microscope. A dot of red fluorescence was observed in the center of each fungal cell, which coincided with the results of nuclear localization. Bar = 10 μm. Figure 5. View largeDownload slide Detection of the T. mentagrophytes strains with mCherry-labeled nuclei in the skin tissues of infected rabbits. We subcutaneously injected rabbits with the pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) transformant. After 5 days, their skin tissues were collected and prepared for microscopic analysis. Numerous mCherry-labeled T. mentagrophytes cells were detected in the samples. Control tissues injected with the wild-type ZJA-1 strain (indicated with black arrows) did not fluoresce. Bar = 10 μm. Figure 5. View largeDownload slide Detection of the T. mentagrophytes strains with mCherry-labeled nuclei in the skin tissues of infected rabbits. We subcutaneously injected rabbits with the pKD9-H2B-mCherry (H3:mCherry-H2B/HPH) transformant. After 5 days, their skin tissues were collected and prepared for microscopic analysis. Numerous mCherry-labeled T. mentagrophytes cells were detected in the samples. Control tissues injected with the wild-type ZJA-1 strain (indicated with black arrows) did not fluoresce. Bar = 10 μm. Fluorescent labeling of nuclei and peroxisomes in T. mentagrophytes with mCherry To use mCherry to trace the localization of target proteins in T. mentagrophytes, we used AtMT to transform T. mentagrophytes with pKD9-H2B-mCherry (mCherry was fused to histone H2B), pHMChA and pNMChA (mCherry was fused to peroxisome targeting signal PTS1), respectively. In the pKD9-H2B-mCherry transformant, the mCherry-H2B protein, driven by the H3 promoter, emitted bright red fluorescence both in the hyphae and the spores. In each cell, the red fluorescence was concentrated in one spot in the central region, consistent well with the position and the size of the nucleus (Fig. 4). In pHMChA and pNMChA transformants, irrespective of selection marker, the mCherry-PTS1 fusion protein driven by the MPG1 promoter also fluoresced in the hyphae and the spores. In this case, the red fluorescence was distributed as small red dots (0.2–1 μm in diameter) throughout the cell, a position and size consistent with that of the fungal peroxisome (Fig. 6). Our results thus indicate that mCherry could be used in subcellular targeting T. mentagrophytes proteins. The high level of expression observed in the H3 and MPG1 promoters indicates that mCherry is useful even for targeting small organelles. Figure 6. View largeDownload slide Peroxisome labeling in T. mentagrophytes using mCherry. We incubated the T. mentagrophytes pHMChA (MPG1:mCherry-PTS1/HPH) and pNMmChA (MPG1:mCherry-PTS1/NTPII) transformants on SDA media for 1 week, and then observed the fungal hyphae and spores under a Leica microscope. Several bright dots of red fluorescence were observed in each fungal cell, which coincided with the results of peroxisome localization. Bar = 5 μm. Figure 6. View largeDownload slide Peroxisome labeling in T. mentagrophytes using mCherry. We incubated the T. mentagrophytes pHMChA (MPG1:mCherry-PTS1/HPH) and pNMmChA (MPG1:mCherry-PTS1/NTPII) transformants on SDA media for 1 week, and then observed the fungal hyphae and spores under a Leica microscope. Several bright dots of red fluorescence were observed in each fungal cell, which coincided with the results of peroxisome localization. Bar = 5 μm. We randomly selected two pKD9-H2B-mCherry transformants with high fluorescence intensities to inject the skins of rabbits. After 5 days, the skin tissues were detected under a fluorescence microscope. The skin patches inoculated with pKD9-H2B-mCherry emitted red fluorescence, whereas no fluorescence was observed in the skin patches inoculated with the wild-type strain (Fig. 5). Analysis of the p1300-KO transformant phenotype To test the p1300-KO transformant library, we examined the phenotypes of 20 transformants randomly selected from the library. Except that a transformant of them produced fewer spores than the wild-type strain, the transformants did not differ significantly from the wild-type in vegetative growth and colony morphology (Fig. 7). In addition, the virulence of transformants appeared to be similar to rabbit skin as the wild-type strain. The regions of rabbit skin inoculated with either the wild type or the p1300-KO transformants displayed typical symptoms of T. mentagrophytes infection, fur loss, scurf and encrustation (Fig. 8). The strains were re-isolated from the diseased skin tissues and tested, which proved that they were still resistant to hygromycin. Figure 7. View largeDownload slide Colony diameters and spore production of a portion of T. mentagrophytes p1300-KO transformants. After incubating the randomly selected p1300-KO transformants and the wild-type strain ZJA-1 on SDA plates for 9 days (28°C), colony diameter and spore production were measured. In most of the transformants, no significant differences were observed between the transformants and the wild-type strain ZJA-1. However, spore production was significantly lower only in a single transformant (No. 3) compared to the control group. Colony morphology was not significantly different between the transformants and the wild-type strain ZJA-1. Each treatment was performed in triplicate; error bars indicate the standard error. Figure 7. View largeDownload slide Colony diameters and spore production of a portion of T. mentagrophytes p1300-KO transformants. After incubating the randomly selected p1300-KO transformants and the wild-type strain ZJA-1 on SDA plates for 9 days (28°C), colony diameter and spore production were measured. In most of the transformants, no significant differences were observed between the transformants and the wild-type strain ZJA-1. However, spore production was significantly lower only in a single transformant (No. 3) compared to the control group. Colony morphology was not significantly different between the transformants and the wild-type strain ZJA-1. Each treatment was performed in triplicate; error bars indicate the standard error. Figure 8. View largeDownload slide Virulence test of a portion of T. mentagrophytes p1300-KO transformants. Rabbits were subcutaneously injected with randomly selected p1300-KO transformants. After 10 days, the skin tissues were assessed. The virulence of the p1300-KO transformants was similar to that of the wild-type strain ZJA-1. Figure 8. View largeDownload slide Virulence test of a portion of T. mentagrophytes p1300-KO transformants. Rabbits were subcutaneously injected with randomly selected p1300-KO transformants. After 10 days, the skin tissues were assessed. The virulence of the p1300-KO transformants was similar to that of the wild-type strain ZJA-1. DISCUSSION Fluorescent protein labeling is widely used to assess the spatiotemporal expression of genes and to monitor the subcellular localization of proteins in cells, and also to track the infection progresses of pathogens in their hosts (Li et al.2014). However, in T. mentagrophytes, the important fungal pathogen for both human and animal, only one fluorescent protein, GFP, has been used, which severely limits the research on pathogenesis and gene functions of the fungus. Here, we expressed mCherry for the first time in T. mentagrophytes and obtained the transformants emitting bright, well distributed and genetically stable red fluorescence. The fluorescence was also detectable in infected rabbit-skin cells. We also achieved the nuclear and the peroxisomal labeling with mCherry in the fungus. The mCherry and GFP, cooperating with each other, and/or with chemical staining, could be more efficient employed in the fungus, for cellular or subcellular localization of proteins and as well as protein–protein interactions (Nagai et al.2002). We used a series vectors and two selection markers in AtMT transformation of the fungus. Our results reinforced the opinion that AtMT is an efficient, easily operated and stable genetic transformation method in filamentous fungi (Shi 2015). The combination of AtMT, multiple resistance markers, mCherry and GFP, and gene deletion strategy will allow a high-throughput and more precise assessment of gene function in T. mentagrophytes. To select a suitable promoter is critical to express fluorescent proteins and to study on gene functions in a given organism. In filamentous fungi, the Aspergillus nidulans promoters trpC and GPD1 are two constitutive promoters, active in a variety of fungal species (Chen, Choi and Nuss 1993) and are often used to express the resistance markers. Here, both the hygromycin resistance gene and the NPTII gene were driven by the trpC promoter. In addition, the A. nidulans GPD1 promoter has also been used to express DsRed-Express in Penicillium paxilli, Trichoderma harzianum and T. virens (syn. Gliocladium virens) (Mikkelsen et al.2003). Histone H3 is regarded as a gene constitutively and highly expressed in a variety of organisms (Barski et al.2007). The M. oryzae H3 promoter is highly expressed not only in M. oryzae, but also in Harpophora oryzae and Chaetomium globosum (Li et al.2012). Here, we used the M. oryzae H3 promoter to drive the expression of mCherry and mCherry fusions. The result showed that under the M. oryzae H3 promoter, mCherry was expressed in spores and hyphae of T. mentagrophytes, as well as in infected animal tissues, indicating that the M. oryzae H3 promoter is also effective in T. mentagrophytes. The M. oryzae MPG1 gene encodes a hydrophobic protein that is located on the surface of the hyphae and spores and maintains surface hydrophobicity (Talbot, Ebbole and Hamer 1993), and specifically involved in appressorium formation and pathogenicity. The MPG1 gene is highly expressed in M. oryzae hyphae, spores and appressoria (Hamer and Talbot 1998). We previously found that the MPG1 promoter is active even more than either GPD1 or the trpC promoter in M. oryzae (Wang et al.2008). However, the MPG1 promoter has not yet been used in fungal species other than M. oryzae. Our results showed that the MPG1 promoter is highly active in the hyphae and spores of T. mentagrophytes, with an expression level equal to or higher than that of the M. oryzae H3 promoter. Therefore, the MPG1 promoter is likely another useful promoter in studying filamentous fungal species besides M. oryzae. In addition, the high expression of the MPG1 promoter in both T. mentagrophytes and M. oryzae might suggest a shared pathogenic pathway between the plant pathogen and the animal pathogen. The number of nuclei and the dynamic processes of nuclear cleavage, movement and degradation during reproduction (both sexual and parasexual) are important aspects of fungal development (Suelmann, Sievers and Fischer 1997). Previous studies have shown that in fungal infections in plants, a specific set of nuclear splits and degradation events occur during the formation of infectious structures, which play very important roles in fungal pathogenicity. Here, we labeled the nucleus of T. mentagrophytes with mCherry, generating an important tool for the study on nuclear developments during infection. The peroxisome is an organelle presented throughout eukaryotic cells which is involved in basic metabolic functions, including fatty acid β-oxidation and glyoxylate recycling (Poirier et al.2006). In filamentous fungi, the peroxisome is additionally involved in the biosynthesis of melanin and the generation of Woronin body (van der Klei and Veenhuis, 2013; Li et al.2014). The proliferation and degradation of peroxisomes, including changes in number and volume, is controlled by the metabolism of the organism (Veenhuis et al.1983). Enzymes in peroxisomes contain specific signal peptides that are recognized specifically and transported into the organelles (Brocard and Hartig 2006). Thus, visualization of the peroxisomes by tagging peroxisome signal peptides with fluorescent proteins is a useful method for investigating peroxisomal dynamics and the function of the genes (PEX) related to peroxisome formation. Here, we used PTS1 to label the T. mentagrophytes peroxisomes, allowing it possible to study peroxisomal dynamics in T. mentagrophytes. Previous studies have indicated that peroxisomes and PEX gene play important roles in fungal pathogenicity in plant pathogenic fungi and the human fungal pathogen Cryptococcus neoformans (Goh et al.2011). However, no any previous studies have investigated the relationship between peroxisomes and pathogenicity in T. mentagrophytes. Our work also provided an important tool for future studies on the role of peroxisomes and PEX genes in the development and pathogenicity of T. mentagrophytes. We constructed a hygromycin-resistant AtMT library containing more than 1000 transformants. A subculture of the transformants from the library indicated that the hygromycin resistance gene had been successfully integrated into the genome and stably inherited in the transformants. The phenotypical analysis showed that most of the transformants were not significantly different from the wild-type strain in vegetative growth, spore production and pathogenicity. These results were not out of our expectation because phenotypic changes are usually rare events upon gene insertion and to obtain one desired mutant often requires selection from a pool of thousands of transformants. In addition, the phenotypical identity of these transformants to the wild-type indicates that the transformation procedures and the expression of the hygromycin-resistance gene did not affect the development of T. mentagrophytes. We will focus on the selection of mutants with defective development or pathogenicity from the library and on the related genes in future studies. FUNDING The China Agricultural Research System (No. nycytx-44-3-2), the National Natural Science Foundation of China (No. 31402241) and Key research and development plan of Zhejiang Province (No. 2016C02054-10) supported this study. Acknowledgements We would like to thank Ms. Xu Yuan from Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences for her technical help in the experiment. We have to thank Dr. Lu Jianping from Zhejiang university kindly provided pKD9-H2B-mCherry. Conflicts of interest. None declared. REFERENCES Alipour M, Mozafari NA. Terbinafine susceptibility and genotypic heterogeneity in clinical isolates of Trichophyton mentagrophytes by random amplified polymorphic DNA (RAPD). J Mycol Méd  2015; 25: e1– 9. Google Scholar CrossRef Search ADS PubMed  Alshahni MM, Makimura K, Yamada T et al.   Nourseothricin acetyltransferase: a new dominant selectable marker for the dermatophyte Trichophyton mentagrophytes. Med Mycol  2010; 48: 665– 8. Google Scholar CrossRef Search ADS PubMed  Barski A, Cuddapah S, Cui K et al.   High-resolution profiling of histone methylations in the human genome. Cell  2007; 129: 823– 37. Google Scholar CrossRef Search ADS PubMed  Brocard C, Hartig A. Peroxisome targeting signal 1: Is it really a simple tripeptide? BBA-Mol Cell Res  2006; 1763: 1565– 73. Cafarchia C, Weigl S, Figueredo LA et al.   Molecular identification and phylogenesis of dermatophytes isolated from rabbit farms and rabbit farm workers. Vet Microbiol  2012; 154: 395– 402. Google Scholar CrossRef Search ADS PubMed  Chen B, Choi GH, Nuss DL. Mitotic stability and nuclear inheritance of integrated viral cDNA in engineered hypovirulent strains of the chestnut blight fungus. EMBO J  1993; 12: 2991– 8. Google Scholar PubMed  De Groot MJ, Bundock P, Hooykaas PJ et al.   Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol  1998; 16: 839– 42. Google Scholar CrossRef Search ADS PubMed  Garrity SJ, Sivanathan V, Dong J et al.   Conversion of a yeast prion protein to an infectious form in bacteria. P Natl Acad Sci USA  2010; 107: 10596– 601. Google Scholar CrossRef Search ADS   Goh J, Jeon J, Kim KS et al.   The PEX7-mediated peroxisomal import system is required for fungal development and pathogenicity in Magnaporthe oryzae. PLoS One  2011; 6: e28220. Google Scholar CrossRef Search ADS PubMed  Gonzalez R, Ferrer S, Buesa J et al.   Transformation of the dermatophyte Trichophyton mentagrophytes to hygromycin B resistance. Infect Immun  1989; 57: 2923– 5. Google Scholar PubMed  Hamer JE, Talbot NJ. Infection-related development in the rice blast fungus Magnaporthe grisea. Curr Opin Microbiol  1998; 1: 693– 7. Google Scholar CrossRef Search ADS PubMed  Kaufman G, Horwitz BA, Hadar R et al.   Green fluorescent protein (GFP) as a vital marker for pathogenic development of the dermatophyte Trichophyton mentagrophytes. Microbiology  2004; 150: 2785– 90. Google Scholar CrossRef Search ADS PubMed  Li H, Lu J, Liu X et al.   Vectors building and usage for gene knockout, protein expression and fluorescent fusion protein in the rice blast fungus. J Agr Biotechnol  2012; 20: 94– 104. Li L, Wang J, Chen H et al.   Pex14/17, a filamentous fungus-specific peroxin, is required for the import of peroxisomal matrix proteins and full virulence of Magnaporthe oryzae. Mol Plant Pathol  2016. Li L, Wang J, Zhang Z et al.   MoPex19, which is essential for maintenance of peroxisomal structure and woronin bodies, is required for metabolism and development in the rice blast fungus. PLoS One  2014; 9: e85252. Google Scholar CrossRef Search ADS PubMed  Matz MV, Fradkov AF, Labas YA et al.   Erratum: Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol  1999; 17. Mikkelsen L, Sarrocco S, Lübeck M et al.   Expression of the red fluorescent protein DsRed-Express in filamentous ascomycete fungi. FEMS Microbiol Lett  2003; 223: 135– 9. Google Scholar CrossRef Search ADS PubMed  Nagai T, Ibata K, Park ES et al.   A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol  2002; 20: 87– 90. Google Scholar CrossRef Search ADS PubMed  Poirier Y, Antonenkov VD, Glumoff T et al.   Peroxisomal β-oxidation—A metabolic pathway with multiple functions. BBA-Mol Cell Res  2006; 1763: 1413– 26. Rho HS, Kang S, Lee YH. Agrobacterium tumefaciens-mediated transformation of the plant pathogenic fungus, Magnaporthe grisea. Mol Cell  2001; 12: 407– 11. Shaner NC, Campbell RE, Steinbach PA et al.   Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol  2004; 22: 1567– 72. Google Scholar CrossRef Search ADS PubMed  Shi Y. Assessment of the function of SUB6 gene for the pathogenicity of Trichophyton mentagrophytes. Doctro Thesis China Agricultural University, 2015. Shi Y, Niu Q, Yu X et al.   Assessment of the function of SUB6 in the pathogenic dermatophyte Trichophyton mentagrophytes. Med Mycol  2015; 54: 59– 71. Google Scholar PubMed  Suelmann R, Sievers N, Fischer R. Nuclear traffic in fungal hyphae: in vivo study of nuclear migration and positioning in Aspergillus nidulans. Mol Microbiol  1997; 25: 757– 69. Google Scholar CrossRef Search ADS PubMed  Sun D, Cao H, Shi Y et al.   The regulatory factor X protein MoRfx1 is required for development and pathogenicity in the rice blast fungus Magnaporthe oryzae. Mol Plant Pathol  2017; 18: 1075– 88. Google Scholar CrossRef Search ADS PubMed  Talbot NJ, Ebbole DJ, Hamer JE. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell  1993; 5: 1575– 90. Google Scholar CrossRef Search ADS PubMed  van der Klei IJ, Veenhuis M. The versatility of peroxisome function in filamentous fungi. In: del Río LA (ed). Peroxisomes and Their Key Role in Cellular Signaling and Metabolism . Springer Netherlands, Dordrecht, 2013. Google Scholar CrossRef Search ADS   Veenhuis M, Douma A, Harder W et al.   Degradation and turnover of peroxisomes in the yeast Hansenula polymorpha induced by selective inactivation of peroxisomal enzymes. Arch Microbiol  1983; 134: 193– 203. Google Scholar CrossRef Search ADS PubMed  Wang JY, Wu XY, Zhang Z et al.   Fluorescent co-localization of PTS1 and PTS2 and its application in analysis of the gene function and the peroxisomal dynamic in Magnaporthe oryzae. J Zhejiang Univ Sci B  2008; 9: 802– 10. Google Scholar CrossRef Search ADS PubMed  Wu CZ, Xu F, Gao YI et al.   Application of fluorescent labeling technique in the research of biology and medicine. J Chongqing Univ Technol  2014; 5: 55– 62. Yamada T, Makimura K, Hisajima T et al.   Genetic transformation of the dermatophyte, Trichophyton mentagrophytes, based on the use of G418 resistance as a dominant selectable marker. J Dermatol Sci  2008; 49: 53– 61. Google Scholar CrossRef Search ADS PubMed  Yamada T, Makimura K, Hisajima T et al.   Enhanced gene replacements in Ku80 disruption mutants of the dermatophyte, Trichophyton mentagrophytes. FEMS Microbiol Lett  2009a; 298: 208– 17. Google Scholar CrossRef Search ADS   Yamada T, Makimura K, Satoh K et al.   Agrobacterium tumefaciens -mediated transformation of the dermatophyte, Trichophyton mentagrophytes: an efficient tool for gene transfer. Med Mycol  2009b; 47: 485– 94. Google Scholar CrossRef Search ADS   Yang J, Zhang ZH, Luo QM. Research progress of fluorescent protein. Acta Biophys Sin  2010; 26: 1025– 35. Zhang X, Wang Y, Chi W et al.   Metalloprotease genes of Trichophyton mentagrophytes are important for pathogenicity. Med Mycol  2013; 52: 36– 45. Zhou X, Li G, Xu JR. Efficient approaches for generating gfp fusion and epitope-tagging constructs in filamentous fungi. In: Xu J-R, Bluhm BH (eds). Fungal Genomics: Methods and Protocols . Humana Press, Totowa, NJ, 2011. Google Scholar CrossRef Search ADS   © Crown copyright 2018. This article contains public sector information licensed under the Open Government Licence v3.0 (http://www.nationalarchives.gov.uk/doc/open-government-licence/version/3/).

Journal

FEMS Microbiology LettersOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial