Ancient DNA reveals that the ‘extinct’ Hunter Island penguin (Tasidyptes hunteri) is not a distinct taxon

Ancient DNA reveals that the ‘extinct’ Hunter Island penguin (Tasidyptes hunteri) is not a... Abstract The penguin species Tasidyptes hunterivan Tets & O’Connor, 1983, the sole representative of an extinct penguin genus, was described on the basis of four bones excavated from a prehistoric midden on Tasmania’s Hunter Island. Several authors have since questioned the validity of T. hunteri, citing the fragmentary nature of the remains and the similarity of some elements (coracoid and tarsometatarsus) to those of extant crested penguin (Eudyptes) species. We designed four overlapping primer pairs to amplify a 499 bp region of mitochondrial cytochrome c oxidase 1 (COI) in penguins and used these to amplify and sequence COI from all known bones attributed to T. hunteri. The T. hunteri COI sequences were assessed within a phylogenetic framework against COI sequences for all extant penguin species. Our results reveal that the T. hunteri bones are an assemblage of remains from three extant penguin species (Eudyptes pachyrhynchus, E. robustus, Eudyptula novaehollandiae), and we find no molecular support for any of these bones representing an extinct penguin lineage. INTRODUCTION Penguins (Sphenisciformes) are a group of flightless marine birds widely distributed throughout the Southern Hemisphere. The exact number of extant penguin species reported often varies, mainly due to different taxonomic treatment of species/subspecies splits. Nevertheless, based on morphological and phylogenetic analyses (Bertelli & Giannini, 2005), extant penguins fall into six clearly defined genera: Aptenodytes (emperor and king penguins), Eudyptes (crested penguins), Pygoscelis (pygoscelid penguins), Spheniscus (spheniscid penguins), Megadyptes (yellow-eyed penguin) and Eudyptula (blue and fairy penguins). Within extant penguin species, there is clear evidence for loss of genetic lineages as a result of human hunting (e.g. Grosser et al., 2015). Moreover, at least two penguin species are thought to have been hunted to extinction during the Holocene. The first of these is a cryptic penguin species, revealed by genetic analysis of archaeological midden deposits in New Zealand: the Waitaha penguin Megadyptes waitaha (Boessenkool et al., 2009). This species was apparently hunted to extinction shortly after Polynesian arrival in the late 13th Century AD (Rawlence et al., 2015) and rapidly replaced by a subsequent range expansion of the yellow-eyed penguin (Megadyptes antipodes). The second example is the Hunter Island penguin (Tasidyptes hunteri) (van Tets & O’Connor, 1983). The description of this species was based on morphological analysis of bones from a prehistoric midden site on Hunter Island, just north of Tasmania (40°32′S, 144°45′E) (Fig. 1). Available material of T. hunteri includes a complete pelvis (in three parts) (Australian National Wildlife Collection, CSIRO, Canberra; ANWC B21141 (originally published as ANWC BS2670) (holotype), tarsometatarsus [ANWC B21143 (BS2668)] (paratype) coracoid [ANWC B21142 (BS2669)], and a synsacrum [ANWC B22669 (BS2667)] (Fig. 2; Supporting Information, Table S1). All were excavated from among archaeological material on Hunter Island and are thought to represent at least two individuals (van Tets & O’Connor, 1983). Based on a single radiocarbon date and correlation with other middens on Hunter Island, the age of the bones is estimated to be less than 1600 years before present (van Tets & O’Connor, 1983). In addition, two other bones from the ANWC are also referred to T. hunteri. These are a coracoid (ANWC B21145, originally registered as BS6618) from Louisa River Cave, Louisa Bay, southern Tasmania, Australia (43°30′S, 146°22′E), and a coracoid [ANWC B21144 (BS6612)] from Prion Beach, southern Tasmania, Australia (43°32′S, 146°33′E) (Fig. 1). Figure 1. View largeDownload slide Map of locations (red triangles) where Tasidyptes hunteri remains have been recorded and of vagrant Eudyptes pachyrhynchus (green) and Eudyptes robustus (orange) records between 1970 and 1991. Figure 1. View largeDownload slide Map of locations (red triangles) where Tasidyptes hunteri remains have been recorded and of vagrant Eudyptes pachyrhynchus (green) and Eudyptes robustus (orange) records between 1970 and 1991. Figure 2. View largeDownload slide Bones attributed to Tasidyptes hunteri and which were sampled for this study: (A) coracoid ANWC B21145, Louisa Bay; (B) coracoid ANWC B21144, Prion Beach; (C) coracoid ANWC B21142, Hunter Island; (D–F) pelvis ANWC B21141 (holotype), Hunter Island; (G) tarsometatarsus ANWC B21143, Hunter Island; (H) synsacrum ANWC B22669, Hunter Island. Scale bar is 50 mm. Figure 2. View largeDownload slide Bones attributed to Tasidyptes hunteri and which were sampled for this study: (A) coracoid ANWC B21145, Louisa Bay; (B) coracoid ANWC B21144, Prion Beach; (C) coracoid ANWC B21142, Hunter Island; (D–F) pelvis ANWC B21141 (holotype), Hunter Island; (G) tarsometatarsus ANWC B21143, Hunter Island; (H) synsacrum ANWC B22669, Hunter Island. Scale bar is 50 mm. In describing T. hunteri, van Tets & O’Connor (1983) compared morphological characteristics of the Hunter Island bones to those of 16 fossil and extant penguin species. They claimed that the T. hunteri bones were morphologically distinct, yet most closely resembled those of Megadyptes, Eudyptes and Eudyptula. The diagnosis of T. hunteri considered that the caudal part of the synsacrum differed from the three above-mentioned genera in having relatively broader fused vertebrae and longer, more slender lateral processes. Moreover, the lateral foramen vasculare proximale was situated more distally than the medial foramen vasculare proximale on the plantar surface of the tarsometatarsus (van Tets & O’Connor, 1983; Park & Fitzgerald, 2012). The distinctiveness of the taxon T. hunteri, however, has been questioned by several authors (e.g. Fordyce & Jones, 1990; Ksepka & Clarke, 2010; Park & Fitzgerald, 2012) on multiple grounds. First, the remains are fragmentary (e.g. the holotype was found in three separate parts). Second, the coracoid and the tarsometatarsus are indistinguishable from those of Eudyptes spp. Third, the four bones were excavated from different stratigraphic horizons of the archaeological site and so may not represent a single taxon (Park & Fitzgerald, 2012). Unfortunately, discrimination of Eudyptes species (and even between Eudyptes and Megadyptes) based on post-cranial bones is challenging given the high osteological similarities between species and extreme sexual dimorphism within species. This problem is further exacerbated when skeletal remains are fragmentary. Worthy (1997), for example, highlighted challenges in identifying differences between post-cranial elements of Eudyptes pachyrhynchus, E. robustus, E. sclateri and M. antipodes. He found many osteological features of these taxa to be very similar, noting that elements overlapped in size between species in these two genera. Molecular analyses offer an alternative approach for elucidating the taxonomic relationships of morphologically similar remains. Here, we present ancient DNA analyses of all archaeological remains attributed to T. hunteri in order to assess the phylogenetic status of this taxon. In doing so we also present new penguin-specific primers designed to amplify a diagnostic 499 bp fragment of the mitochondrial cytochrome c oxidase 1 (COI) gene, a marker which has been widely used to delineate bird species and, in some cases, identify cryptic species (Hebert et al., 2004). METHODS DNA extraction Ancient DNA extractions were performed in ancient DNA facilities at the Department of Zoology (University of Otago, Dunedin), Landcare Research (Lincoln) and the Museum of New Zealand Te Papa Tongarewa (Wellington). Standard ancient DNA protocols [as advocated by Cooper & Poinar (2000)] were used, including the use of physically isolated dedicated ancient DNA facilities and extraction and PCR controls. Genomic DNA was extracted from each specimen using the Qiagen DNeasy Tissue Kit (Qiagen) following a modified protocol adapted for bone collagen (Thomson et al., 2014). Primer design, PCR and sequencing We designed penguin-specific internal primers (Table 1) to amplify a 499 bp long diagnostic region of the mitochondrial COI gene in four short overlapping fragments, suitable for ancient or degraded DNA. Primers were tested on 22 historical tissue samples from all Eudyptes taxa except Eudyptes moseleyi and Eudyptes chrysocome (Supporting Information, Table S2). The primers were also used to amplify COI from each T. hunteri specimen, with each of the four fragments being amplified and sequenced at least twice for each specimen. PCRs (12.5 µL) were performed using 2 mg/mL RSA (Sigma), 1× PCR buffer, 2 mM MgSO4, 80 µM dNTP, 0.4 µM each primer, 0.625 U HiFi Platinum Taq (Invitrogen) and 1 µL DNA extract on a BIO-RAD MyCycler thermal cycler with an initial denaturation of 94 °C for 3 min, followed by 55 cycles of 94 °C for 30 s, 59 °C for 30 s and 68 °C for 45 s, and a final extension at 68 °C for 10 min. PCR products were purified using SPRIselect (Beckman Coulter, Inc., Indianapolis, IN, USA) and sequenced at the Landcare Research sequencing facility on an Applied Biosystems 3500xL Genetic Analyzer. Table 1. Primers designed for amplifying species-diagnostic mitochondrial COI region in penguins Primer name  Primer sequence (5′–3′)  3′ position on Eudyptes chrysocome reference mt genome (Genbank accession NC_008138.1)  Amplicon length (bp)  Eud_COI_1  GNGACGACCAAATCTACAACGTAA  5666  142  Eud_COI_1a  GTAGGAAGGAAGGGGGGAGT  5809  Eud_COI_2  GACATAGCATTCCCCCGCATG  5788  140  Eud_COI_2a  GGTGGAGTGAGAARATRGCTAAG  5929  Eud_COI_3  GCTGGYACAGGATGRACTGTA  5881  141  Eud_COI_3a  RGGGGTTTGRTACTGTGAGAG  6023  Eud_COI_4  ATTAACTTCATCACCACCGCC  6001  164  Eud_COI_4a  ATTGGGTCACCTCCTCCG  6166  Primer name  Primer sequence (5′–3′)  3′ position on Eudyptes chrysocome reference mt genome (Genbank accession NC_008138.1)  Amplicon length (bp)  Eud_COI_1  GNGACGACCAAATCTACAACGTAA  5666  142  Eud_COI_1a  GTAGGAAGGAAGGGGGGAGT  5809  Eud_COI_2  GACATAGCATTCCCCCGCATG  5788  140  Eud_COI_2a  GGTGGAGTGAGAARATRGCTAAG  5929  Eud_COI_3  GCTGGYACAGGATGRACTGTA  5881  141  Eud_COI_3a  RGGGGTTTGRTACTGTGAGAG  6023  Eud_COI_4  ATTAACTTCATCACCACCGCC  6001  164  Eud_COI_4a  ATTGGGTCACCTCCTCCG  6166  Amplicon length excludes primer sequences. View Large Data analysis We used the program Geneious R8 (Biomatters) to examine, edit and align forward and reverse consensus sequences for each specimen. We used MEGA v.6 to align sequences with the same region of COI for all penguin species obtained from GenBank and BOLD databases (Supporting Information, Table S3). A maximum credibility phylogeny was created using BEAST, with a HKY model with four gamma categories, yule-speciation prior and MCMC chain length of 30 000 000 (recording every 1000 states with a 10% burn-in). RESULTS We successfully amplified between 296 and 499 bp of the mitochondrial COI gene from all specimens using the four overlapping primer pairs. With the exception of the Eudyptes schlegeli/Eudyptes chrysolophus complex (which some authors have considered to represent a single species; e.g. Christidis & Boles, 2008), our primers successfully differentiated every Eudyptes species including the occasionally merged E. pachyrhynchus/E. robustus (Christidis & Boles, 2008). In addition, these primers also amplified sequences effective in distinguishing between Eudyptes and Eudyptula penguin remains (GenBank accession numbers MF469854-MF469881). Based on mitochondrial DNA relationships, the results from our analysis suggest that the bones referred to T. hunteri are an artificial assemblage comprising three extant penguin species in two genera (Fig. 3): the holotype (Hunter Island pelvis: ANWC B21141), paratype (Hunter Island tarsometatarsus: ANWC B21143), Hunter Island coracoid (ANWC B21142) and Louisa River coracoid (ANWC BS6618) are phylogenetically attributable to Fiordland crested penguin (E. pachyrhynchus); the coracoid from Prion Beach (ANWC B21144) is attributable to Snares crested penguin (E. robustus); and the Hunter Island synsacrum (ANWC B22669) is attributable to the Australian little penguin (Eudyptula novaehollandiae). Figure 3. View largeDownload slide Maximum credibility phylogeny of penguin mitochondrial COI sequences from GenBank and BOLD, and sequences from Tasidyptes hunteri bones sequenced in this project. Figure 3. View largeDownload slide Maximum credibility phylogeny of penguin mitochondrial COI sequences from GenBank and BOLD, and sequences from Tasidyptes hunteri bones sequenced in this project. DISCUSSION Ancient DNA results of the current analysis strongly indicate that T. hunteri is not a valid taxon, but instead represents an artificial assemblage of remains from extant penguin taxa. Moreover, where preserved, osteological characters of each bone [following Bertelli & Giannini (2005)] reflected the states present in the species to which it was assigned based on DNA. These findings contradict van Tets & O’Connor’s (1983) claim of a Holocene penguin extinction in southern Australia. Based on our analysis of the type material, we place T. hunterivan Tets & O’Connor, 1983 in synonymy with E. pachyrhynchus G.R. Gray, 1845. The presence of three species of penguin (including two New Zealand Eudyptes taxa) (formerly attributed to Tasidyptes) in Tasmania’s archaeological record is not surprising given the distributions and movement patterns of these species within the Australasian region. For example, Eudyptula is distributed along the southern coastline of Australia including Tasmania, Bass Strait Islands and New Zealand. Recent research by Grosser et al. (2015) and Grosser et al. (2017) has revealed that Eudyptula comprises two distinct lineages accorded species status: Eudyptula novaehollandiae, historically endemic to Australia (but now also on the Otago coast of New Zealand), and Eudyptula minor, endemic to New Zealand. Our results reveal that the synsacrum from Hunter Island belonged to the primarily Australian Eudyptula novaehollandiae. It is likely that this bone may have been from a local colony, given that other Eudyptula bones were also recorded in the Hunter Island site (van Tets & O’Connor, 1983). Although other penguin species do not breed in Australia, at least eight have been recorded as vagrants in Tasmania (Iredale & Cayley, 1925; Hindwood, 1938; Woehler, 1992; Simpson, 2008; Woehler E, personal communication). Of these, E. robustus has regularly been recorded in the Southern Ocean waters near Australia during winter (a distance of around 15 000 km from their breeding colonies on the Snares Islands) (Woehler, 1992; Simpson, 2008; Thompson D, personal communication). A similar winter movement pattern may be exhibited by E. pachyrhynchus, where immature birds frequently disperse to southern Australian waters from their natal grounds along the southern New Zealand coast (Warham, 1974). These winter dispersal patterns may explain both the relatively frequent occurrence of these species in Tasmania and southern mainland Australia (44 records of E. pachyrhynchus and five of E. robustus, in Tasmania between 1970 and 1991; Woehler, 1992) (Fig. 1), and their presence in archaeological deposits from this region. Our finding that the Hunter Island penguin bones include two vagrant species is not without precedent. Vagrant species, particularly medium- to large-sized birds, have been recorded previously from archaeological and prehistoric midden deposits around the world. For example, bones from at least ten individuals of the Australian pelican (Pelecanus conspicillatus) known from eight prehistoric midden deposits throughout New Zealand are considered to represent vagrant individuals (Lalas et al., 2014). A single vagrant Subantarctic yellow-eyed penguin has also been identified in a prehistoric midden deposit from New Zealand prior to the extinction of the Waitaha penguin (Boessenkool et al., 2009). It is thought that cinereous vulture (Aegypius monachus) remains from the Roman period of the Netherlands and Belgium may also represent vagrant individuals (Groot, Ervynck & Pigière, 2010). We suggest that there could even be a bias towards over-representation of large vagrant bird species in midden deposits. Such individuals may have attracted the attention of hunters due to being ‘out of the ordinary’ and may have temporarily been more docile and hence easier to catch due to the state of exhaustion commonly exhibited by long-distance vagrants (e.g. Bried, 2003; Lees & Gilroy, 2009). CONCLUSION Mitochondrial DNA sequences reveal that the assemblage of bones upon which the Hunter Island penguin (T. hunteri) was described includes more than one taxon [supporting the suggestion of Park & Fitzgerald (2012)]. In fact, the assemblage represents three extant species: Eudyptula novaehollandiae, E. pachyrhynchus and E. robustus. The holotype of T. hunteri (pelvis ANWC B21141) was demonstrated to be from E. pachyrhynchus, and so T. hunterivan Tets & O’Connor, 1983 is placed in the synonymy of E. pachyrhynchus G.R. Gray 1845. Eudyptula novaehollandiae remains the only penguin species known to have bred around mainland Australia during the Holocene. Our study provides a further example of how ancient DNA analyses can help resolve issues around the taxonomic identity of prehistoric remains. SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Table S1. Details of Tasidyptes hunteri specimens. ANWC – Australian National Wildlife Collection, CSIRO, Canberra. Table S2. Primer success of 22 Eudyptes tissue samples. Table S3. Samples obtained from GenBank and BOLD databases. ACKNOWLEDGEMENTS The authors thank Alan Tennyson (Museum of New Zealand Te Papa Tongarewa) and Paul Scofield (Canterbury Museum) for providing tissue samples. Robert Palmer (Australian National Wildlife Collection) assisted with arranging loans of specimens from that collection. The authors are grateful to Trevor Worthy for providing useful comments on taxonomy. TLC was supported by an Otago University Postgraduate Scholarship and the Otago Ecology Fund. REFERENCES Bertelli S, Giannini NP. 2005. A phylogeny of extant penguins (Aves: Sphenisciformes) combining morphology and mitochondrial sequences. Cladistics  21: 209– 239. Google Scholar CrossRef Search ADS   Boessenkool S, Austin JA, Worthy TH, Scofield P, Cooper A, Seddon PJ, Waters JM. 2009. Relict or colonizer? Extinction and range expansion of penguins in southern New Zealand. Proceedings of the Royal Society B  276: 815– 821. Google Scholar CrossRef Search ADS PubMed  Bried J. 2003. Impact of vagrant predators on the native fauna: a short-eared owl (Asio flammeus) preying on Madeiran storm petrels (Oceanodroma castro) in the Azores. Life and Marine Sciences  20A: 57– 60. Christidis L, Boles WE. 2008. Systematics and taxonomy of Australian birds . Canberra: CSIRO Publishing, 98. Cooper A, Poinar HN. 2000. Ancient DNA: do it right or not at all. Science  289: 1139. Google Scholar CrossRef Search ADS PubMed  Fordyce RE, Jones CM. 1990. Penguin history and new fossil material from New Zealand. In: Davis LS, Darby JT, eds. Penguin biology . Academic Press: San Diego, 419– 446. Google Scholar CrossRef Search ADS   Groot M, Ervynck A, Pigière F. 2010. Vagrant vultures: archaeological evidence for the cinereous vulture (Aegypius monachus) in the Low Countries. In: Prummel W, Zeiler JT, Brinkhuizen D, eds. Birds in archaeology. Proceedings of the 6th Meeting of the ICAZ Bird Working Group in Groningen , Groningen (Groningen Archaeological Studies 10), 241– 253, 23 August to 27 August 2008. Grosser S, Burridge CP, Peucker AJ, Waters JM. 2015. Coalescent modelling suggests recent secondary-contact of cryptic penguin species. PLoS ONE  10: e0144966. Google Scholar CrossRef Search ADS PubMed  Grosser S, Scofield RP, Waters J. 2017. Multivariate skeletal analyses support a taxonomic distinction between New Zealand and Australian Eudyptula penguins (Sphenisciformes: Spheniscidae). Emu - Austral Ornithology  177: 176– 283. Hebert PD, Stoeckle MY, Zemlak TS, Francis CM. 2004. Identification of birds through DNA barcodes. PLoS Biology  2: e312. Google Scholar CrossRef Search ADS PubMed  Hindwood KA. 1938. The occurrence of crested penguins in Australian waters: with particular reference to Eudyptes pachyrhynchus. Emu  38: 377– 379. Google Scholar CrossRef Search ADS   Iredale T, Cayley NW. 1925. Australian crested penguins. Emu  25: 1– 6. Google Scholar CrossRef Search ADS   Ksepka D, Clarke JA. 2010. The basal penguin (Aves: Sphenisciformes) Perudypes devriesi and a phylogenetic evaluation of the penguin fossil record. Bulletin of the American Museum of Natural History  337: 77. Google Scholar CrossRef Search ADS   Lalas C, Hamel J, Tennyson AJD, Worthy TH. 2014. Southern extensions for Holocene records of Australian pelican (Pelecanus conspicillatus) and New Zealand musk duck (Biziura delautouri) in New Zealand. Notornis  61: 106– 108. Lees AC, Gilroy JJ. 2009. Vagrancy mechanisms in passerines and near-passerines. In: Slack R, ed. Rare birds, where and when: an analysis of status and distribution in Britain and Ireland. Volume 1: sandgrouse to New World orioles . York: Rare Bird Books, 3–4. Park T, Fitzgerald EMG. 2012. A review of Australian fossil penguins (Aves: Sphenisciformes). Memoirs of Museum Victoria  69: 309– 325. Google Scholar CrossRef Search ADS   Rawlence NJ, Perry GLW, Smith IWG, Scofield RP, Tennyson AD, Matisso-Smith EA, Boessenkool S, Austin JJ, Waters JM. 2015. Radiocarbon-dating and ancient DNA reveal rapid replacement of extinct prehistoric penguins. Quaternary Science Reviews  112: 59– 65. Google Scholar CrossRef Search ADS   Simpson KNG. 2008. The ‘Mystery Penguin’: an additional Snares penguin Eudyptes pachyrhynchus robustus for Tasmania. The Tasmanian Naturalist  130: 42– 51. Thomson VA, Lebrasseur O, Austin JJ, Hunt TL, Burney DA, Denham T, Rawlence NJ, Wood JR, Gongora J, Girland Flink L, Linderholm A, Dobney K, Larson G, Cooper A. 2014. Using ancient DNA to study the origins and dispersal of ancestral Polynesian chickens across the Pacific. Proceedings of the National Academy of Sciences USA  111: 4826– 4831. Google Scholar CrossRef Search ADS   van Tets GF, O’Connor S. 1983. The Hunter Island penguin, an extinct new genus and species from a Tasmanian midden. Records of the Queen Victoria Museum  81: 1– 11. Warham J. 1974. The Fiordland crested penguin Eudyptes pachyrhynchus. The Ibis  116: 1– 27. Google Scholar CrossRef Search ADS   Woehler E. 1992. Records of vagrant penguins from Tasmania. Marine Ornithology  20: 61– 73. Worthy TH. 1997. The identification of fossil Eudyptes and Megadyptes bones at Marfells Beach, Marlborough, South Island. New Zealand Natural Sciences  23: 71– 85. © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Zoological Journal of the Linnean Society Oxford University Press

Ancient DNA reveals that the ‘extinct’ Hunter Island penguin (Tasidyptes hunteri) is not a distinct taxon

Loading next page...
 
/lp/ou_press/ancient-dna-reveals-that-the-extinct-hunter-island-penguin-tasidyptes-R9Dz1mS504
Publisher
The Linnean Society of London
Copyright
© 2017 The Linnean Society of London, Zoological Journal of the Linnean Society
ISSN
0024-4082
eISSN
1096-3642
D.O.I.
10.1093/zoolinnean/zlx043
Publisher site
See Article on Publisher Site

Abstract

Abstract The penguin species Tasidyptes hunterivan Tets & O’Connor, 1983, the sole representative of an extinct penguin genus, was described on the basis of four bones excavated from a prehistoric midden on Tasmania’s Hunter Island. Several authors have since questioned the validity of T. hunteri, citing the fragmentary nature of the remains and the similarity of some elements (coracoid and tarsometatarsus) to those of extant crested penguin (Eudyptes) species. We designed four overlapping primer pairs to amplify a 499 bp region of mitochondrial cytochrome c oxidase 1 (COI) in penguins and used these to amplify and sequence COI from all known bones attributed to T. hunteri. The T. hunteri COI sequences were assessed within a phylogenetic framework against COI sequences for all extant penguin species. Our results reveal that the T. hunteri bones are an assemblage of remains from three extant penguin species (Eudyptes pachyrhynchus, E. robustus, Eudyptula novaehollandiae), and we find no molecular support for any of these bones representing an extinct penguin lineage. INTRODUCTION Penguins (Sphenisciformes) are a group of flightless marine birds widely distributed throughout the Southern Hemisphere. The exact number of extant penguin species reported often varies, mainly due to different taxonomic treatment of species/subspecies splits. Nevertheless, based on morphological and phylogenetic analyses (Bertelli & Giannini, 2005), extant penguins fall into six clearly defined genera: Aptenodytes (emperor and king penguins), Eudyptes (crested penguins), Pygoscelis (pygoscelid penguins), Spheniscus (spheniscid penguins), Megadyptes (yellow-eyed penguin) and Eudyptula (blue and fairy penguins). Within extant penguin species, there is clear evidence for loss of genetic lineages as a result of human hunting (e.g. Grosser et al., 2015). Moreover, at least two penguin species are thought to have been hunted to extinction during the Holocene. The first of these is a cryptic penguin species, revealed by genetic analysis of archaeological midden deposits in New Zealand: the Waitaha penguin Megadyptes waitaha (Boessenkool et al., 2009). This species was apparently hunted to extinction shortly after Polynesian arrival in the late 13th Century AD (Rawlence et al., 2015) and rapidly replaced by a subsequent range expansion of the yellow-eyed penguin (Megadyptes antipodes). The second example is the Hunter Island penguin (Tasidyptes hunteri) (van Tets & O’Connor, 1983). The description of this species was based on morphological analysis of bones from a prehistoric midden site on Hunter Island, just north of Tasmania (40°32′S, 144°45′E) (Fig. 1). Available material of T. hunteri includes a complete pelvis (in three parts) (Australian National Wildlife Collection, CSIRO, Canberra; ANWC B21141 (originally published as ANWC BS2670) (holotype), tarsometatarsus [ANWC B21143 (BS2668)] (paratype) coracoid [ANWC B21142 (BS2669)], and a synsacrum [ANWC B22669 (BS2667)] (Fig. 2; Supporting Information, Table S1). All were excavated from among archaeological material on Hunter Island and are thought to represent at least two individuals (van Tets & O’Connor, 1983). Based on a single radiocarbon date and correlation with other middens on Hunter Island, the age of the bones is estimated to be less than 1600 years before present (van Tets & O’Connor, 1983). In addition, two other bones from the ANWC are also referred to T. hunteri. These are a coracoid (ANWC B21145, originally registered as BS6618) from Louisa River Cave, Louisa Bay, southern Tasmania, Australia (43°30′S, 146°22′E), and a coracoid [ANWC B21144 (BS6612)] from Prion Beach, southern Tasmania, Australia (43°32′S, 146°33′E) (Fig. 1). Figure 1. View largeDownload slide Map of locations (red triangles) where Tasidyptes hunteri remains have been recorded and of vagrant Eudyptes pachyrhynchus (green) and Eudyptes robustus (orange) records between 1970 and 1991. Figure 1. View largeDownload slide Map of locations (red triangles) where Tasidyptes hunteri remains have been recorded and of vagrant Eudyptes pachyrhynchus (green) and Eudyptes robustus (orange) records between 1970 and 1991. Figure 2. View largeDownload slide Bones attributed to Tasidyptes hunteri and which were sampled for this study: (A) coracoid ANWC B21145, Louisa Bay; (B) coracoid ANWC B21144, Prion Beach; (C) coracoid ANWC B21142, Hunter Island; (D–F) pelvis ANWC B21141 (holotype), Hunter Island; (G) tarsometatarsus ANWC B21143, Hunter Island; (H) synsacrum ANWC B22669, Hunter Island. Scale bar is 50 mm. Figure 2. View largeDownload slide Bones attributed to Tasidyptes hunteri and which were sampled for this study: (A) coracoid ANWC B21145, Louisa Bay; (B) coracoid ANWC B21144, Prion Beach; (C) coracoid ANWC B21142, Hunter Island; (D–F) pelvis ANWC B21141 (holotype), Hunter Island; (G) tarsometatarsus ANWC B21143, Hunter Island; (H) synsacrum ANWC B22669, Hunter Island. Scale bar is 50 mm. In describing T. hunteri, van Tets & O’Connor (1983) compared morphological characteristics of the Hunter Island bones to those of 16 fossil and extant penguin species. They claimed that the T. hunteri bones were morphologically distinct, yet most closely resembled those of Megadyptes, Eudyptes and Eudyptula. The diagnosis of T. hunteri considered that the caudal part of the synsacrum differed from the three above-mentioned genera in having relatively broader fused vertebrae and longer, more slender lateral processes. Moreover, the lateral foramen vasculare proximale was situated more distally than the medial foramen vasculare proximale on the plantar surface of the tarsometatarsus (van Tets & O’Connor, 1983; Park & Fitzgerald, 2012). The distinctiveness of the taxon T. hunteri, however, has been questioned by several authors (e.g. Fordyce & Jones, 1990; Ksepka & Clarke, 2010; Park & Fitzgerald, 2012) on multiple grounds. First, the remains are fragmentary (e.g. the holotype was found in three separate parts). Second, the coracoid and the tarsometatarsus are indistinguishable from those of Eudyptes spp. Third, the four bones were excavated from different stratigraphic horizons of the archaeological site and so may not represent a single taxon (Park & Fitzgerald, 2012). Unfortunately, discrimination of Eudyptes species (and even between Eudyptes and Megadyptes) based on post-cranial bones is challenging given the high osteological similarities between species and extreme sexual dimorphism within species. This problem is further exacerbated when skeletal remains are fragmentary. Worthy (1997), for example, highlighted challenges in identifying differences between post-cranial elements of Eudyptes pachyrhynchus, E. robustus, E. sclateri and M. antipodes. He found many osteological features of these taxa to be very similar, noting that elements overlapped in size between species in these two genera. Molecular analyses offer an alternative approach for elucidating the taxonomic relationships of morphologically similar remains. Here, we present ancient DNA analyses of all archaeological remains attributed to T. hunteri in order to assess the phylogenetic status of this taxon. In doing so we also present new penguin-specific primers designed to amplify a diagnostic 499 bp fragment of the mitochondrial cytochrome c oxidase 1 (COI) gene, a marker which has been widely used to delineate bird species and, in some cases, identify cryptic species (Hebert et al., 2004). METHODS DNA extraction Ancient DNA extractions were performed in ancient DNA facilities at the Department of Zoology (University of Otago, Dunedin), Landcare Research (Lincoln) and the Museum of New Zealand Te Papa Tongarewa (Wellington). Standard ancient DNA protocols [as advocated by Cooper & Poinar (2000)] were used, including the use of physically isolated dedicated ancient DNA facilities and extraction and PCR controls. Genomic DNA was extracted from each specimen using the Qiagen DNeasy Tissue Kit (Qiagen) following a modified protocol adapted for bone collagen (Thomson et al., 2014). Primer design, PCR and sequencing We designed penguin-specific internal primers (Table 1) to amplify a 499 bp long diagnostic region of the mitochondrial COI gene in four short overlapping fragments, suitable for ancient or degraded DNA. Primers were tested on 22 historical tissue samples from all Eudyptes taxa except Eudyptes moseleyi and Eudyptes chrysocome (Supporting Information, Table S2). The primers were also used to amplify COI from each T. hunteri specimen, with each of the four fragments being amplified and sequenced at least twice for each specimen. PCRs (12.5 µL) were performed using 2 mg/mL RSA (Sigma), 1× PCR buffer, 2 mM MgSO4, 80 µM dNTP, 0.4 µM each primer, 0.625 U HiFi Platinum Taq (Invitrogen) and 1 µL DNA extract on a BIO-RAD MyCycler thermal cycler with an initial denaturation of 94 °C for 3 min, followed by 55 cycles of 94 °C for 30 s, 59 °C for 30 s and 68 °C for 45 s, and a final extension at 68 °C for 10 min. PCR products were purified using SPRIselect (Beckman Coulter, Inc., Indianapolis, IN, USA) and sequenced at the Landcare Research sequencing facility on an Applied Biosystems 3500xL Genetic Analyzer. Table 1. Primers designed for amplifying species-diagnostic mitochondrial COI region in penguins Primer name  Primer sequence (5′–3′)  3′ position on Eudyptes chrysocome reference mt genome (Genbank accession NC_008138.1)  Amplicon length (bp)  Eud_COI_1  GNGACGACCAAATCTACAACGTAA  5666  142  Eud_COI_1a  GTAGGAAGGAAGGGGGGAGT  5809  Eud_COI_2  GACATAGCATTCCCCCGCATG  5788  140  Eud_COI_2a  GGTGGAGTGAGAARATRGCTAAG  5929  Eud_COI_3  GCTGGYACAGGATGRACTGTA  5881  141  Eud_COI_3a  RGGGGTTTGRTACTGTGAGAG  6023  Eud_COI_4  ATTAACTTCATCACCACCGCC  6001  164  Eud_COI_4a  ATTGGGTCACCTCCTCCG  6166  Primer name  Primer sequence (5′–3′)  3′ position on Eudyptes chrysocome reference mt genome (Genbank accession NC_008138.1)  Amplicon length (bp)  Eud_COI_1  GNGACGACCAAATCTACAACGTAA  5666  142  Eud_COI_1a  GTAGGAAGGAAGGGGGGAGT  5809  Eud_COI_2  GACATAGCATTCCCCCGCATG  5788  140  Eud_COI_2a  GGTGGAGTGAGAARATRGCTAAG  5929  Eud_COI_3  GCTGGYACAGGATGRACTGTA  5881  141  Eud_COI_3a  RGGGGTTTGRTACTGTGAGAG  6023  Eud_COI_4  ATTAACTTCATCACCACCGCC  6001  164  Eud_COI_4a  ATTGGGTCACCTCCTCCG  6166  Amplicon length excludes primer sequences. View Large Data analysis We used the program Geneious R8 (Biomatters) to examine, edit and align forward and reverse consensus sequences for each specimen. We used MEGA v.6 to align sequences with the same region of COI for all penguin species obtained from GenBank and BOLD databases (Supporting Information, Table S3). A maximum credibility phylogeny was created using BEAST, with a HKY model with four gamma categories, yule-speciation prior and MCMC chain length of 30 000 000 (recording every 1000 states with a 10% burn-in). RESULTS We successfully amplified between 296 and 499 bp of the mitochondrial COI gene from all specimens using the four overlapping primer pairs. With the exception of the Eudyptes schlegeli/Eudyptes chrysolophus complex (which some authors have considered to represent a single species; e.g. Christidis & Boles, 2008), our primers successfully differentiated every Eudyptes species including the occasionally merged E. pachyrhynchus/E. robustus (Christidis & Boles, 2008). In addition, these primers also amplified sequences effective in distinguishing between Eudyptes and Eudyptula penguin remains (GenBank accession numbers MF469854-MF469881). Based on mitochondrial DNA relationships, the results from our analysis suggest that the bones referred to T. hunteri are an artificial assemblage comprising three extant penguin species in two genera (Fig. 3): the holotype (Hunter Island pelvis: ANWC B21141), paratype (Hunter Island tarsometatarsus: ANWC B21143), Hunter Island coracoid (ANWC B21142) and Louisa River coracoid (ANWC BS6618) are phylogenetically attributable to Fiordland crested penguin (E. pachyrhynchus); the coracoid from Prion Beach (ANWC B21144) is attributable to Snares crested penguin (E. robustus); and the Hunter Island synsacrum (ANWC B22669) is attributable to the Australian little penguin (Eudyptula novaehollandiae). Figure 3. View largeDownload slide Maximum credibility phylogeny of penguin mitochondrial COI sequences from GenBank and BOLD, and sequences from Tasidyptes hunteri bones sequenced in this project. Figure 3. View largeDownload slide Maximum credibility phylogeny of penguin mitochondrial COI sequences from GenBank and BOLD, and sequences from Tasidyptes hunteri bones sequenced in this project. DISCUSSION Ancient DNA results of the current analysis strongly indicate that T. hunteri is not a valid taxon, but instead represents an artificial assemblage of remains from extant penguin taxa. Moreover, where preserved, osteological characters of each bone [following Bertelli & Giannini (2005)] reflected the states present in the species to which it was assigned based on DNA. These findings contradict van Tets & O’Connor’s (1983) claim of a Holocene penguin extinction in southern Australia. Based on our analysis of the type material, we place T. hunterivan Tets & O’Connor, 1983 in synonymy with E. pachyrhynchus G.R. Gray, 1845. The presence of three species of penguin (including two New Zealand Eudyptes taxa) (formerly attributed to Tasidyptes) in Tasmania’s archaeological record is not surprising given the distributions and movement patterns of these species within the Australasian region. For example, Eudyptula is distributed along the southern coastline of Australia including Tasmania, Bass Strait Islands and New Zealand. Recent research by Grosser et al. (2015) and Grosser et al. (2017) has revealed that Eudyptula comprises two distinct lineages accorded species status: Eudyptula novaehollandiae, historically endemic to Australia (but now also on the Otago coast of New Zealand), and Eudyptula minor, endemic to New Zealand. Our results reveal that the synsacrum from Hunter Island belonged to the primarily Australian Eudyptula novaehollandiae. It is likely that this bone may have been from a local colony, given that other Eudyptula bones were also recorded in the Hunter Island site (van Tets & O’Connor, 1983). Although other penguin species do not breed in Australia, at least eight have been recorded as vagrants in Tasmania (Iredale & Cayley, 1925; Hindwood, 1938; Woehler, 1992; Simpson, 2008; Woehler E, personal communication). Of these, E. robustus has regularly been recorded in the Southern Ocean waters near Australia during winter (a distance of around 15 000 km from their breeding colonies on the Snares Islands) (Woehler, 1992; Simpson, 2008; Thompson D, personal communication). A similar winter movement pattern may be exhibited by E. pachyrhynchus, where immature birds frequently disperse to southern Australian waters from their natal grounds along the southern New Zealand coast (Warham, 1974). These winter dispersal patterns may explain both the relatively frequent occurrence of these species in Tasmania and southern mainland Australia (44 records of E. pachyrhynchus and five of E. robustus, in Tasmania between 1970 and 1991; Woehler, 1992) (Fig. 1), and their presence in archaeological deposits from this region. Our finding that the Hunter Island penguin bones include two vagrant species is not without precedent. Vagrant species, particularly medium- to large-sized birds, have been recorded previously from archaeological and prehistoric midden deposits around the world. For example, bones from at least ten individuals of the Australian pelican (Pelecanus conspicillatus) known from eight prehistoric midden deposits throughout New Zealand are considered to represent vagrant individuals (Lalas et al., 2014). A single vagrant Subantarctic yellow-eyed penguin has also been identified in a prehistoric midden deposit from New Zealand prior to the extinction of the Waitaha penguin (Boessenkool et al., 2009). It is thought that cinereous vulture (Aegypius monachus) remains from the Roman period of the Netherlands and Belgium may also represent vagrant individuals (Groot, Ervynck & Pigière, 2010). We suggest that there could even be a bias towards over-representation of large vagrant bird species in midden deposits. Such individuals may have attracted the attention of hunters due to being ‘out of the ordinary’ and may have temporarily been more docile and hence easier to catch due to the state of exhaustion commonly exhibited by long-distance vagrants (e.g. Bried, 2003; Lees & Gilroy, 2009). CONCLUSION Mitochondrial DNA sequences reveal that the assemblage of bones upon which the Hunter Island penguin (T. hunteri) was described includes more than one taxon [supporting the suggestion of Park & Fitzgerald (2012)]. In fact, the assemblage represents three extant species: Eudyptula novaehollandiae, E. pachyrhynchus and E. robustus. The holotype of T. hunteri (pelvis ANWC B21141) was demonstrated to be from E. pachyrhynchus, and so T. hunterivan Tets & O’Connor, 1983 is placed in the synonymy of E. pachyrhynchus G.R. Gray 1845. Eudyptula novaehollandiae remains the only penguin species known to have bred around mainland Australia during the Holocene. Our study provides a further example of how ancient DNA analyses can help resolve issues around the taxonomic identity of prehistoric remains. SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Table S1. Details of Tasidyptes hunteri specimens. ANWC – Australian National Wildlife Collection, CSIRO, Canberra. Table S2. Primer success of 22 Eudyptes tissue samples. Table S3. Samples obtained from GenBank and BOLD databases. ACKNOWLEDGEMENTS The authors thank Alan Tennyson (Museum of New Zealand Te Papa Tongarewa) and Paul Scofield (Canterbury Museum) for providing tissue samples. Robert Palmer (Australian National Wildlife Collection) assisted with arranging loans of specimens from that collection. The authors are grateful to Trevor Worthy for providing useful comments on taxonomy. TLC was supported by an Otago University Postgraduate Scholarship and the Otago Ecology Fund. REFERENCES Bertelli S, Giannini NP. 2005. A phylogeny of extant penguins (Aves: Sphenisciformes) combining morphology and mitochondrial sequences. Cladistics  21: 209– 239. Google Scholar CrossRef Search ADS   Boessenkool S, Austin JA, Worthy TH, Scofield P, Cooper A, Seddon PJ, Waters JM. 2009. Relict or colonizer? Extinction and range expansion of penguins in southern New Zealand. Proceedings of the Royal Society B  276: 815– 821. Google Scholar CrossRef Search ADS PubMed  Bried J. 2003. Impact of vagrant predators on the native fauna: a short-eared owl (Asio flammeus) preying on Madeiran storm petrels (Oceanodroma castro) in the Azores. Life and Marine Sciences  20A: 57– 60. Christidis L, Boles WE. 2008. Systematics and taxonomy of Australian birds . Canberra: CSIRO Publishing, 98. Cooper A, Poinar HN. 2000. Ancient DNA: do it right or not at all. Science  289: 1139. Google Scholar CrossRef Search ADS PubMed  Fordyce RE, Jones CM. 1990. Penguin history and new fossil material from New Zealand. In: Davis LS, Darby JT, eds. Penguin biology . Academic Press: San Diego, 419– 446. Google Scholar CrossRef Search ADS   Groot M, Ervynck A, Pigière F. 2010. Vagrant vultures: archaeological evidence for the cinereous vulture (Aegypius monachus) in the Low Countries. In: Prummel W, Zeiler JT, Brinkhuizen D, eds. Birds in archaeology. Proceedings of the 6th Meeting of the ICAZ Bird Working Group in Groningen , Groningen (Groningen Archaeological Studies 10), 241– 253, 23 August to 27 August 2008. Grosser S, Burridge CP, Peucker AJ, Waters JM. 2015. Coalescent modelling suggests recent secondary-contact of cryptic penguin species. PLoS ONE  10: e0144966. Google Scholar CrossRef Search ADS PubMed  Grosser S, Scofield RP, Waters J. 2017. Multivariate skeletal analyses support a taxonomic distinction between New Zealand and Australian Eudyptula penguins (Sphenisciformes: Spheniscidae). Emu - Austral Ornithology  177: 176– 283. Hebert PD, Stoeckle MY, Zemlak TS, Francis CM. 2004. Identification of birds through DNA barcodes. PLoS Biology  2: e312. Google Scholar CrossRef Search ADS PubMed  Hindwood KA. 1938. The occurrence of crested penguins in Australian waters: with particular reference to Eudyptes pachyrhynchus. Emu  38: 377– 379. Google Scholar CrossRef Search ADS   Iredale T, Cayley NW. 1925. Australian crested penguins. Emu  25: 1– 6. Google Scholar CrossRef Search ADS   Ksepka D, Clarke JA. 2010. The basal penguin (Aves: Sphenisciformes) Perudypes devriesi and a phylogenetic evaluation of the penguin fossil record. Bulletin of the American Museum of Natural History  337: 77. Google Scholar CrossRef Search ADS   Lalas C, Hamel J, Tennyson AJD, Worthy TH. 2014. Southern extensions for Holocene records of Australian pelican (Pelecanus conspicillatus) and New Zealand musk duck (Biziura delautouri) in New Zealand. Notornis  61: 106– 108. Lees AC, Gilroy JJ. 2009. Vagrancy mechanisms in passerines and near-passerines. In: Slack R, ed. Rare birds, where and when: an analysis of status and distribution in Britain and Ireland. Volume 1: sandgrouse to New World orioles . York: Rare Bird Books, 3–4. Park T, Fitzgerald EMG. 2012. A review of Australian fossil penguins (Aves: Sphenisciformes). Memoirs of Museum Victoria  69: 309– 325. Google Scholar CrossRef Search ADS   Rawlence NJ, Perry GLW, Smith IWG, Scofield RP, Tennyson AD, Matisso-Smith EA, Boessenkool S, Austin JJ, Waters JM. 2015. Radiocarbon-dating and ancient DNA reveal rapid replacement of extinct prehistoric penguins. Quaternary Science Reviews  112: 59– 65. Google Scholar CrossRef Search ADS   Simpson KNG. 2008. The ‘Mystery Penguin’: an additional Snares penguin Eudyptes pachyrhynchus robustus for Tasmania. The Tasmanian Naturalist  130: 42– 51. Thomson VA, Lebrasseur O, Austin JJ, Hunt TL, Burney DA, Denham T, Rawlence NJ, Wood JR, Gongora J, Girland Flink L, Linderholm A, Dobney K, Larson G, Cooper A. 2014. Using ancient DNA to study the origins and dispersal of ancestral Polynesian chickens across the Pacific. Proceedings of the National Academy of Sciences USA  111: 4826– 4831. Google Scholar CrossRef Search ADS   van Tets GF, O’Connor S. 1983. The Hunter Island penguin, an extinct new genus and species from a Tasmanian midden. Records of the Queen Victoria Museum  81: 1– 11. Warham J. 1974. The Fiordland crested penguin Eudyptes pachyrhynchus. The Ibis  116: 1– 27. Google Scholar CrossRef Search ADS   Woehler E. 1992. Records of vagrant penguins from Tasmania. Marine Ornithology  20: 61– 73. Worthy TH. 1997. The identification of fossil Eudyptes and Megadyptes bones at Marfells Beach, Marlborough, South Island. New Zealand Natural Sciences  23: 71– 85. © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society

Journal

Zoological Journal of the Linnean SocietyOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from
Google Scholar,
PubMed
Create lists to
organize your research
Export lists, citations
Read DeepDyve articles
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off