Analysis of Escherichia coli STs and resistance mechanisms in sewage from Islamabad, Pakistan indicates a difference in E. coli carriage types between South Asia and Europe

Analysis of Escherichia coli STs and resistance mechanisms in sewage from Islamabad, Pakistan... Abstract Objectives To discover the Escherichia coli STs and associated resistance mechanisms in the community in Islamabad, Pakistan by analysis of E. coli isolates in sewage. Methods One hundred and ten E. coli were isolated from sewage across the city of Islamabad without antibiotic bias and confirmed as E. coli by MALDI-TOF MS. Isolates were characterized by fumC/fimH (CH) typing and core-genome MLST. Resistance mechanisms, virulence genes, phylotypes and plasmid incompatibility types were determined in a subset of isolates by in silico analysis. The genomic position of blaCTX-M-15 was determined using S1-PFGE, probing and Nanopore MinION sequencing. Results and conclusions The most prevalent STs were ST394, ST10 and ST648, accounting for 39% of all isolates collected and were found at many sites across Islamabad. Carbapenemase genes were absent and only a single isolate of ST131 was found. The most prevalent resistance mechanisms were qnrS1 and blaCTX-M-15, with blaCTX-M-15 penetrating many STs and found in 31% of all collected isolates. However, the majority of the successful STs were blaCTX-M-15 negative indicating that resistance is not the main driver of prevalence. Twenty-three percent of blaCTX-M-15 genes were chromosomally encoded and large ISEcp1-mediated insertions included qnrS1 and several plasmid genes. In all chromosomally encoded isolates no plasmid copies of blaCTX-M-15 were found. The most prevalent ST (ST394) contained many enteroaggregative E. coli virulence genes and the fimH30 variant allele previously linked to the success of ST131. Introduction Antibiotic resistance in Escherichia coli is a major concern as E. coli is both a leading cause of human infection and an ever-present gut colonist. Carriage of ESBL-positive E. coli can lead to difficult-to-treat urinary tract infections (UTIs), delay appropriate therapy and lead to poor outcomes.1 The E. coli species consists of many different STs (>7000; http://pubmlst.org/databases.shtml) and strains.2 Individual strains vary in their ability to cause disease and to resist antibiotics. Several molecular methodologies have enabled comparisons of strains between diverse geographical locations, including MLST, fumC/fimH typing (CH typing),3 phylotyping4 and WGS. Comparisons have revealed that resistance is associated with a small number of successful strains and STs, e.g. E. coli ST131 belonging to phylogroup B25 and E. coli ST101 belonging to phylogroup B1.6 We have also seen expansion of ESBL-positive E. coli ST131 causing severe infections.7 A recent study investigating ESBL-positive E. coli in the UK found ST131 was the primary cause of cephalosporin-resistant bacteraemia and the most prevalent ST in faeces and sewage (H. Cadden, P. Cleary, M. Day, M. Doumith, M. Ellington, N. Elviss, J. Findlay, K. Hopkins, B. Jones, D. Livermore, L. Randall, C. Teale, M. Toleman, D. Wareham, C. Wiuff and N. Woodford, unpublished results). This suggests that analysis of E. coli in sewage is a good proxy for gut carriage in the community. In this study, we sought to determine the carriage of E. coli STs/resistance mechanisms by analysis of E. coli collected, without antibiotic selection, from 18 sewage outfall sites across the city of Islamabad. Materials and methods Collection of samples Samples (30 mL) were collected from 18 sites in nine sectors of Islamabad (Figure S2, available as Supplementary data at JAC Online). Bacterial isolation and identification Samples were centrifuged, pelleted and resuspended in 0.5 mL of LB broth. Fifty microlitres was spread on MacConkey plates without antibiotics and grown at 37°C overnight. Ten colonies with typical E. coli morphology were randomly collected from each site with a total of 110 colonies confirmed as E. coli by MALDI-TOF MS. Detection of blaCTX-M and blaNDM-1 genes PCR utilized custom primers and ReddyMix Extensor PCR Master Mix 1 (Thermo Scientific) with appropriate controls. Two-locus CH typing fumC and fimH genes were amplified by PCR as described by Weissman et al.3fumC and fimH alleles were assigned using http://mlst.warwick.ac.uk/mlst/dbs/Ecoli and https://cge.cbs.dtu.dk/services/FimTyper/ web sites, respectively. blaCTX-M-15 genomic location S1-PFGE was performed as described previously.8 The probe was amplified using primers CTXMF/R (GTTCACGCTGATGGCGACGGC, ACGCTAATACATCGCGACGGC) and radiolabelled using [32P]dCTP as described previously.8 Genomic DNA extraction Genomic DNA was extracted using the QIAGEN genomic DNA kit. MiSeq sequencing DNA libraries were prepared using the Nextera XT sample kit and sequenced (20–30× coverage) with a standard 2 × 100 base protocol on a MiSeq Instrument (Illumina, San Diego, CA, USA) in-house at the Department of Infection and Immunity, Cardiff University. ST and resistance/virulence gene detection MLST was performed with stringMLST using short-read data in FASTQ format and Ridom SeqSphere+ (version 3.5.0) using assembled data in FASTA format. E. coli strains were clustered based on core-genome MLST (cgMLST) with SeqSphere+. A cgMLST scheme was based on E. coli ATCC 25922 with 1907 targets. Antimicrobial resistance genes were detected using CLC-Biogenomic workbench. Plasmid and virulence genes were detected using PlasmidFinder (https://cge.cbs.dtu.dk/services/PlasmidFinder/) and VirulenceFinder (https://cge.cbs.dtu.dk/services/VirulenceFinder/). MinION sequencing Isolates with chromosomally encoded blaCTX-M-15 were sequenced using the Nanopore MinION SQK RAD-002 rapid sequencing kit following isolation of high-molecular-weight DNA by the hexadecyltrimethylammonium bromide (CTAB) method.9 Single reads were used as scaffold to assemble MiSeq data and annotated using Geneious. Phylogroup analysis The E. coli phylogroups were determined with in silico searches for chuA, yjaA, tspE4.C2, arpAgpE and tnpAgpC using Geneious software based on the Clermont method.4 Results and discussion This study was designed to determine the STs and resistance mechanisms of E. coli in Islamabad. We collected E. coli at sewage outfalls across the city and isolated 110 E. coli strains without antibiotic selection. PCR indicated 34 isolates carried blaCTX-M-15 and a single isolate carried blaCTX-M-27. All isolates were blaNDM-1 negative and carbapenem susceptible, indicating low carbapenemase carriage rates in Islamabad as compared with other South Asian sites.10–13 CH typing revealed 24 known MLST STs in the collection of 110 E. coli. CH typing results were: 35-30 (ST394), 11-54 (ST10), 4-0 (ST648), 65-32/54-0 (ST1431) and 7-54 (ST45) (which accounted for 15%, 13%, 7%, 3.6% and 2.7% of isolates, respectively), 4-27 (ST88), 29-38 (ST156), 6-0 (ST688), 7-54 (ST2325), 636-34 (ST5176) and 11-24 (ST43) [which each accounted for two isolates (equating to a prevalence of 1% each)] and 11-27 (ST93), 40-30 (ST131), 6-31 (ST154), 4-32 (ST155), 23-54 (ST205), 11-69 (ST216), 4-61 (ST224), 7-25 (ST398), 136-331 (ST543), 65-32 (ST1128) and 27-0 (ST4121) (which each accounted for a single isolate) (Figure S1). Details of location, numbers of STs and respective clonotypes are shown in Figure S2. Of 110 E. coli isolates, 33 were whole-genome sequenced, including examples of all MLST STs and multiple examples of common ones (Tables S1 and S2). The in silico MLST agreed 100% with MLST derived from CH typing. Most frequently found STs were ST394, ST10, ST648 and ST1431 found at 44%, 44%, 28% and 11% of the sampling sites, respectively (Figures S1 and S2). Interestingly, ST131 was particularly rare (a single isolate, <1%). Isolation of E. coli without antibiotic selection enabled us to measure penetration of resistance mechanisms through this species. The blaCTX-M-15 gene is highly prevalent worldwide14 and was found to have colonized 31% of E. coli isolates in Islamabad, including 63% of MLST STs (Table S1). However, it was found only in 14%, 24% and 50% of individual isolates of the most prevalent types: ST648, ST394 and ST10, respectively. This indicates that blaCTX-M-15-carrying E. coli are less fit overall than parental isolates and that the prevalence of individual E. coli STs is not directly related to cephalosporin resistance. WGS revealed resistance and virulence mechanisms in 33 of the isolates, of which 24 carried blaCTX-M genes (Tables S1 and S2). The qnrS1 gene was most common, found in 80 isolates by PCR. This was often associated with blaCTX-M-15 (91%). Other prevalent mechanisms were: dhfr genes found in 55%, blaTEM-1B in 30%, tet(A) in 51%, sul2 in 36%, sul1 in 21% and tet(B) in 12% of whole-genome sequenced isolates. Other mechanisms were rarely found: blaOXA-1 in three isolates, blaTEM-199 in two isolates and blaTEM-158, blaCMY-42 and blaCMY-44 in individual isolates (Table S1). WGS detected 19 different virulence genes (Table S2). Overall the majority of isolates were commensals with few virulence factors belonging to phylogroups A, C and B1 (Figure 1). The ST394 isolates belonged to phylogroup E and harboured enteroaggregative virulence factors typical of enteroaggregative E. coli (Figure 1). ST394 is associated with diarrhoeal disease but is also commonly recovered from healthy people and has been implicated in acute and persistent sporadic diarrhoea, and outbreaks, in both industrialized and developing countries.15 ST131 and ST648 were the only ExPEC pathogens recovered belonging to phylogroups B2 and D, respectively. They are known to cause UTIs and sepsis, though they do not carry the classical ExPEC virulence gene repertoire.16 Figure 1. View largeDownload slide cgMLST of Islamabad sewage isolates. cgMLST was performed using a core genome of 1907 target genes identified in each sequenced isolate using Ridom SeqSphere+ software. Phylogroup analysis was based on in silico PCR using targets identified by Clermont et al.4 (2013). Figure 1. View largeDownload slide cgMLST of Islamabad sewage isolates. cgMLST was performed using a core genome of 1907 target genes identified in each sequenced isolate using Ridom SeqSphere+ software. Phylogroup analysis was based on in silico PCR using targets identified by Clermont et al.4 (2013). S1-PFGE analysis revealed one to four plasmids present in each strain. Plasmids were of a range of incompatibility groups (Table S2). The blaCTX-M-15 plasmids ranged in size from 50 to 150 kb. We found blaCTX-M-15 genes on the chromosome in eight isolates (23%) and six STs. We determined the insertion sites in four isolates, including identical sites in ST394 and a unique insertion in ST4121 (Figure 2). In all cases, movement to the chromosome was ISEcp1-mediated and confirmed by the presence of direct repeats generated at the site of insertion (Figure 2). Notably these movement events not only transposed blaCTX-M-15 to the chromosome but also sections of a common plasmid containing qnrS1. Movement to the chromosome is typically associated with subsequent loss of the blaCTX-M-15 plasmid as evidenced by the lack of blaCTX-M-15-harbouring plasmids in these strains. This process likely enhances the fitness of the strain overall.17 Figure 2. View largeDownload slide Chromosomal insertion sites of blaCTX-M-15. Chromosomal insertion sites were identified using a combination of MiSeq and Nanopore MinION single-read sequences. (a) Insertion site found in ST4121 (isolate 8). (b) Insertion site found in ST394 (isolates 2, 12 and 15). The 11 389 bp insertion found in isolates 2, 12 and 15 included blaCTX-M-15 and qnrS1 and was identical to the first 11 389 bp of the 23 174 bp insertion in ST4121 (isolate 8). The larger insertion in ST4121 (isolate 8) included additional tet(A) and tet(R) resistance genes as well as several other genes of plasmid origin. The chromosomal insertion in the ST394 isolates was in a low GC% intergenic region between ydcS and ydcR genes encoding a putative DNA-binding transcriptional regulator and a putative spermidine/putrescine transporter subunit, respectively. The insertion in the ST4121 isolate was in a hydrolase gene. Each insertion had the mobile element ISEcp1 at the left-hand terminus and was flanked by target-site direct repeats of TATGA for isolate 8 and TTAAA for isolates 2, 12 and 15. This figure appears in colour in the online version of JAC and in black and white in the print version of JAC. Figure 2. View largeDownload slide Chromosomal insertion sites of blaCTX-M-15. Chromosomal insertion sites were identified using a combination of MiSeq and Nanopore MinION single-read sequences. (a) Insertion site found in ST4121 (isolate 8). (b) Insertion site found in ST394 (isolates 2, 12 and 15). The 11 389 bp insertion found in isolates 2, 12 and 15 included blaCTX-M-15 and qnrS1 and was identical to the first 11 389 bp of the 23 174 bp insertion in ST4121 (isolate 8). The larger insertion in ST4121 (isolate 8) included additional tet(A) and tet(R) resistance genes as well as several other genes of plasmid origin. The chromosomal insertion in the ST394 isolates was in a low GC% intergenic region between ydcS and ydcR genes encoding a putative DNA-binding transcriptional regulator and a putative spermidine/putrescine transporter subunit, respectively. The insertion in the ST4121 isolate was in a hydrolase gene. Each insertion had the mobile element ISEcp1 at the left-hand terminus and was flanked by target-site direct repeats of TATGA for isolate 8 and TTAAA for isolates 2, 12 and 15. This figure appears in colour in the online version of JAC and in black and white in the print version of JAC. We used cgMLST to relate the various E. coli to each other (Figure 1). STs were correctly grouped together. The Clermont PCR phylogroup analysis gave good agreement in general with cgMLST. Interestingly, cgMLST aligned the ST648 isolates as group F instead of D, confirming the recent observation of Johnson et al.18 and highlighting the superior discriminatory power of cgMLST. Analysis of the fimH data revealed that several strains were fimH null. This included all ST648 isolates and is typical of this ST.6 Its prevalence as an ExPEC pathogen suggests that another adhesion is substituting for fimH. The worldwide success of the blaCTX-M-15 gene in E. coli ST131 has been closely linked to a highly adherent fimH variant allele, fimH30.5 In this study, despite ST131 being particularly rare, fimH30 was the second most prevalent variant of fimH and was present in all ST394 isolates. The possession of fimH30 by ST394 is likely advantageous. However, the fact that E. coli ST131 fimH30 is particularly rare suggests that other as-yet-unknown factors are responsible for the success of ST394 in Islamabad. Acknowledgements This study was presented as a poster at the BSAC Spring Meeting, 2017 (‘Association of antibiotic genes with successful ST of Escherichia coli in the environment’). Funding This project was funded by a Commonwealth Academic Fellowship grant (PKCF-2016–156) awarded to R. Z. Transparency declarations None to declare. Supplementary data Figures S1 and S2 and Tables S1 and S2 are available as Supplementary data at JAC Online. References 1 Abernethy JK , Johnson AP , Guy R et al. Thirty day all-cause mortality in patients with Escherichia coli bacteraemia in England . Clin Microbiol Infect 2015 ; 21 : 251.e1 – 8 . Google Scholar CrossRef Search ADS 2 Johnson JR , Nicolas-Chanoine MH , DebRoy C et al. Comparison of Escherichia coli ST131 pulsotypes, by epidemiologic traits, 1967-2009 . Emerg Infect Dis 2012 ; 18 : 598 – 607 . Google Scholar CrossRef Search ADS PubMed 3 Weissman SJ , Johnson JR , Tchesnokova V et al. High-resolution two-locus clonal typing of extraintestinal pathogenic Escherichia coli . Appl Environ Microbiol 2012 ; 78 : 1353 – 60 . Google Scholar CrossRef Search ADS PubMed 4 Clermont O , Christenson JK , Denamur E et al. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups . Env Microbiol Rep 2013 ; 5 : 58 – 65 . Google Scholar CrossRef Search ADS 5 Johnson JR , Tchesnokova V , Johnston B et al. Abrupt emergence of a single dominant multidrug-resistant strain of Escherichia coli . J Infect Dis 2013 ; 207 : 919 – 28 . Google Scholar CrossRef Search ADS PubMed 6 Toleman MA , Bugert JJ , Nizam SA. Extensively drug-resistant New Delhi metallo-β-lactamase-encoding bacteria in the environment, Dhaka, Bangladesh, 2012 . Emerg Infect Dis 2015 ; 21 : 1027 – 30 . Google Scholar CrossRef Search ADS PubMed 7 Day MJ , Doumith M , Abernethy J et al. Population structure of Escherichia coli causing bacteraemia in the UK and Ireland between 2001 and 2010 . J Antimicrob Chemother 2016 ; 71 : 2139 – 42 . Google Scholar CrossRef Search ADS PubMed 8 Patzer JA , Walsh TR , Weeks J et al. Emergence and persistence of integron structures harbouring VIM genes in the Children’s Memorial Health Institute, Warsaw, Poland, 1998-2006 . J Antimicrob Chemother 2009 ; 63 : 269 – 73 . Google Scholar CrossRef Search ADS PubMed 9 Sambrook J. Molecular Cloning: A Laboratory Manual . New York : Cold Spring Harbor Laboratory Press , 2001 . 10 Hawser SP , Bouchillon SK , Hoban DJ et al. Emergence of high levels of extended-spectrum-β-lactamase-producing Gram-negative bacilli in the Asia-Pacific region: data from the Study for Monitoring Antimicrobial Resistance Trends (SMART) program, 2007 . Antimicrob Agents Chemother 2009 ; 53 : 3280 – 4 . Google Scholar CrossRef Search ADS PubMed 11 Diwan V , Chandran SP , Tamhankar AJ et al. Identification of extended-spectrum β-lactamase and quinolone resistance genes in Escherichia coli isolated from hospital wastewater from central India . J Antimicrob Chemother 2012 ; 67 : 857 – 9 . Google Scholar CrossRef Search ADS PubMed 12 Kumarasamy KK , Toleman MA , Walsh TR et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study . Lancet Infect Dis 2010 ; 10 : 597 – 602 . Google Scholar CrossRef Search ADS PubMed 13 Perry JD , Naqvi SH , Mirza IA et al. Prevalence of faecal carriage of Enterobacteriaceae with NDM-1 carbapenemase at military hospitals in Pakistan, and evaluation of two chromogenic media . J Antimicrob Chemother 2011 ; 66 : 2288 – 94 . Google Scholar CrossRef Search ADS PubMed 14 Woodford N , Turton JF , Livermore DM. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance . FEMS Microbiol Rev 2011 ; 35 : 736 – 55 . Google Scholar CrossRef Search ADS PubMed 15 Okeke IN , Wallace-Gadsden F , Simons HR et al. Multi-locus sequence typing of enteroaggregative Escherichia coli isolates from Nigerian children uncovers multiple lineages . PLoS One 2010 ; 5 : e14093 . Google Scholar CrossRef Search ADS PubMed 16 Johnson JR , Porter S , Johnston B et al. Host characteristics and bacterial traits predict experimental virulence for Escherichia coli bloodstream isolates from patients with urosepsis . Open Forum Infect Dis 2015 ; 2 : ofv083 . Google Scholar PubMed 17 MacLean RC , San Millan A. Microbial evolution: towards resolving the plasmid paradox . Curr Biol 2015 ; 25 : R764 – 7 . Google Scholar CrossRef Search ADS PubMed 18 Johnson JR , Johnston BD , Gordon DM. Rapid and specific detection of the Escherichia coli sequence type 648 complex within phylogroup F . J Clin Microbiol 2017 ; 55 : 1116 – 21 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For permissions, please email: journals.permissions@oup.com. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Antimicrobial Chemotherapy Oxford University Press

Analysis of Escherichia coli STs and resistance mechanisms in sewage from Islamabad, Pakistan indicates a difference in E. coli carriage types between South Asia and Europe

Loading next page...
 
/lp/ou_press/analysis-of-escherichia-coli-sts-and-resistance-mechanisms-in-sewage-ZjI0au10Nf
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For permissions, please email: journals.permissions@oup.com.
ISSN
0305-7453
eISSN
1460-2091
D.O.I.
10.1093/jac/dky109
Publisher site
See Article on Publisher Site

Abstract

Abstract Objectives To discover the Escherichia coli STs and associated resistance mechanisms in the community in Islamabad, Pakistan by analysis of E. coli isolates in sewage. Methods One hundred and ten E. coli were isolated from sewage across the city of Islamabad without antibiotic bias and confirmed as E. coli by MALDI-TOF MS. Isolates were characterized by fumC/fimH (CH) typing and core-genome MLST. Resistance mechanisms, virulence genes, phylotypes and plasmid incompatibility types were determined in a subset of isolates by in silico analysis. The genomic position of blaCTX-M-15 was determined using S1-PFGE, probing and Nanopore MinION sequencing. Results and conclusions The most prevalent STs were ST394, ST10 and ST648, accounting for 39% of all isolates collected and were found at many sites across Islamabad. Carbapenemase genes were absent and only a single isolate of ST131 was found. The most prevalent resistance mechanisms were qnrS1 and blaCTX-M-15, with blaCTX-M-15 penetrating many STs and found in 31% of all collected isolates. However, the majority of the successful STs were blaCTX-M-15 negative indicating that resistance is not the main driver of prevalence. Twenty-three percent of blaCTX-M-15 genes were chromosomally encoded and large ISEcp1-mediated insertions included qnrS1 and several plasmid genes. In all chromosomally encoded isolates no plasmid copies of blaCTX-M-15 were found. The most prevalent ST (ST394) contained many enteroaggregative E. coli virulence genes and the fimH30 variant allele previously linked to the success of ST131. Introduction Antibiotic resistance in Escherichia coli is a major concern as E. coli is both a leading cause of human infection and an ever-present gut colonist. Carriage of ESBL-positive E. coli can lead to difficult-to-treat urinary tract infections (UTIs), delay appropriate therapy and lead to poor outcomes.1 The E. coli species consists of many different STs (>7000; http://pubmlst.org/databases.shtml) and strains.2 Individual strains vary in their ability to cause disease and to resist antibiotics. Several molecular methodologies have enabled comparisons of strains between diverse geographical locations, including MLST, fumC/fimH typing (CH typing),3 phylotyping4 and WGS. Comparisons have revealed that resistance is associated with a small number of successful strains and STs, e.g. E. coli ST131 belonging to phylogroup B25 and E. coli ST101 belonging to phylogroup B1.6 We have also seen expansion of ESBL-positive E. coli ST131 causing severe infections.7 A recent study investigating ESBL-positive E. coli in the UK found ST131 was the primary cause of cephalosporin-resistant bacteraemia and the most prevalent ST in faeces and sewage (H. Cadden, P. Cleary, M. Day, M. Doumith, M. Ellington, N. Elviss, J. Findlay, K. Hopkins, B. Jones, D. Livermore, L. Randall, C. Teale, M. Toleman, D. Wareham, C. Wiuff and N. Woodford, unpublished results). This suggests that analysis of E. coli in sewage is a good proxy for gut carriage in the community. In this study, we sought to determine the carriage of E. coli STs/resistance mechanisms by analysis of E. coli collected, without antibiotic selection, from 18 sewage outfall sites across the city of Islamabad. Materials and methods Collection of samples Samples (30 mL) were collected from 18 sites in nine sectors of Islamabad (Figure S2, available as Supplementary data at JAC Online). Bacterial isolation and identification Samples were centrifuged, pelleted and resuspended in 0.5 mL of LB broth. Fifty microlitres was spread on MacConkey plates without antibiotics and grown at 37°C overnight. Ten colonies with typical E. coli morphology were randomly collected from each site with a total of 110 colonies confirmed as E. coli by MALDI-TOF MS. Detection of blaCTX-M and blaNDM-1 genes PCR utilized custom primers and ReddyMix Extensor PCR Master Mix 1 (Thermo Scientific) with appropriate controls. Two-locus CH typing fumC and fimH genes were amplified by PCR as described by Weissman et al.3fumC and fimH alleles were assigned using http://mlst.warwick.ac.uk/mlst/dbs/Ecoli and https://cge.cbs.dtu.dk/services/FimTyper/ web sites, respectively. blaCTX-M-15 genomic location S1-PFGE was performed as described previously.8 The probe was amplified using primers CTXMF/R (GTTCACGCTGATGGCGACGGC, ACGCTAATACATCGCGACGGC) and radiolabelled using [32P]dCTP as described previously.8 Genomic DNA extraction Genomic DNA was extracted using the QIAGEN genomic DNA kit. MiSeq sequencing DNA libraries were prepared using the Nextera XT sample kit and sequenced (20–30× coverage) with a standard 2 × 100 base protocol on a MiSeq Instrument (Illumina, San Diego, CA, USA) in-house at the Department of Infection and Immunity, Cardiff University. ST and resistance/virulence gene detection MLST was performed with stringMLST using short-read data in FASTQ format and Ridom SeqSphere+ (version 3.5.0) using assembled data in FASTA format. E. coli strains were clustered based on core-genome MLST (cgMLST) with SeqSphere+. A cgMLST scheme was based on E. coli ATCC 25922 with 1907 targets. Antimicrobial resistance genes were detected using CLC-Biogenomic workbench. Plasmid and virulence genes were detected using PlasmidFinder (https://cge.cbs.dtu.dk/services/PlasmidFinder/) and VirulenceFinder (https://cge.cbs.dtu.dk/services/VirulenceFinder/). MinION sequencing Isolates with chromosomally encoded blaCTX-M-15 were sequenced using the Nanopore MinION SQK RAD-002 rapid sequencing kit following isolation of high-molecular-weight DNA by the hexadecyltrimethylammonium bromide (CTAB) method.9 Single reads were used as scaffold to assemble MiSeq data and annotated using Geneious. Phylogroup analysis The E. coli phylogroups were determined with in silico searches for chuA, yjaA, tspE4.C2, arpAgpE and tnpAgpC using Geneious software based on the Clermont method.4 Results and discussion This study was designed to determine the STs and resistance mechanisms of E. coli in Islamabad. We collected E. coli at sewage outfalls across the city and isolated 110 E. coli strains without antibiotic selection. PCR indicated 34 isolates carried blaCTX-M-15 and a single isolate carried blaCTX-M-27. All isolates were blaNDM-1 negative and carbapenem susceptible, indicating low carbapenemase carriage rates in Islamabad as compared with other South Asian sites.10–13 CH typing revealed 24 known MLST STs in the collection of 110 E. coli. CH typing results were: 35-30 (ST394), 11-54 (ST10), 4-0 (ST648), 65-32/54-0 (ST1431) and 7-54 (ST45) (which accounted for 15%, 13%, 7%, 3.6% and 2.7% of isolates, respectively), 4-27 (ST88), 29-38 (ST156), 6-0 (ST688), 7-54 (ST2325), 636-34 (ST5176) and 11-24 (ST43) [which each accounted for two isolates (equating to a prevalence of 1% each)] and 11-27 (ST93), 40-30 (ST131), 6-31 (ST154), 4-32 (ST155), 23-54 (ST205), 11-69 (ST216), 4-61 (ST224), 7-25 (ST398), 136-331 (ST543), 65-32 (ST1128) and 27-0 (ST4121) (which each accounted for a single isolate) (Figure S1). Details of location, numbers of STs and respective clonotypes are shown in Figure S2. Of 110 E. coli isolates, 33 were whole-genome sequenced, including examples of all MLST STs and multiple examples of common ones (Tables S1 and S2). The in silico MLST agreed 100% with MLST derived from CH typing. Most frequently found STs were ST394, ST10, ST648 and ST1431 found at 44%, 44%, 28% and 11% of the sampling sites, respectively (Figures S1 and S2). Interestingly, ST131 was particularly rare (a single isolate, <1%). Isolation of E. coli without antibiotic selection enabled us to measure penetration of resistance mechanisms through this species. The blaCTX-M-15 gene is highly prevalent worldwide14 and was found to have colonized 31% of E. coli isolates in Islamabad, including 63% of MLST STs (Table S1). However, it was found only in 14%, 24% and 50% of individual isolates of the most prevalent types: ST648, ST394 and ST10, respectively. This indicates that blaCTX-M-15-carrying E. coli are less fit overall than parental isolates and that the prevalence of individual E. coli STs is not directly related to cephalosporin resistance. WGS revealed resistance and virulence mechanisms in 33 of the isolates, of which 24 carried blaCTX-M genes (Tables S1 and S2). The qnrS1 gene was most common, found in 80 isolates by PCR. This was often associated with blaCTX-M-15 (91%). Other prevalent mechanisms were: dhfr genes found in 55%, blaTEM-1B in 30%, tet(A) in 51%, sul2 in 36%, sul1 in 21% and tet(B) in 12% of whole-genome sequenced isolates. Other mechanisms were rarely found: blaOXA-1 in three isolates, blaTEM-199 in two isolates and blaTEM-158, blaCMY-42 and blaCMY-44 in individual isolates (Table S1). WGS detected 19 different virulence genes (Table S2). Overall the majority of isolates were commensals with few virulence factors belonging to phylogroups A, C and B1 (Figure 1). The ST394 isolates belonged to phylogroup E and harboured enteroaggregative virulence factors typical of enteroaggregative E. coli (Figure 1). ST394 is associated with diarrhoeal disease but is also commonly recovered from healthy people and has been implicated in acute and persistent sporadic diarrhoea, and outbreaks, in both industrialized and developing countries.15 ST131 and ST648 were the only ExPEC pathogens recovered belonging to phylogroups B2 and D, respectively. They are known to cause UTIs and sepsis, though they do not carry the classical ExPEC virulence gene repertoire.16 Figure 1. View largeDownload slide cgMLST of Islamabad sewage isolates. cgMLST was performed using a core genome of 1907 target genes identified in each sequenced isolate using Ridom SeqSphere+ software. Phylogroup analysis was based on in silico PCR using targets identified by Clermont et al.4 (2013). Figure 1. View largeDownload slide cgMLST of Islamabad sewage isolates. cgMLST was performed using a core genome of 1907 target genes identified in each sequenced isolate using Ridom SeqSphere+ software. Phylogroup analysis was based on in silico PCR using targets identified by Clermont et al.4 (2013). S1-PFGE analysis revealed one to four plasmids present in each strain. Plasmids were of a range of incompatibility groups (Table S2). The blaCTX-M-15 plasmids ranged in size from 50 to 150 kb. We found blaCTX-M-15 genes on the chromosome in eight isolates (23%) and six STs. We determined the insertion sites in four isolates, including identical sites in ST394 and a unique insertion in ST4121 (Figure 2). In all cases, movement to the chromosome was ISEcp1-mediated and confirmed by the presence of direct repeats generated at the site of insertion (Figure 2). Notably these movement events not only transposed blaCTX-M-15 to the chromosome but also sections of a common plasmid containing qnrS1. Movement to the chromosome is typically associated with subsequent loss of the blaCTX-M-15 plasmid as evidenced by the lack of blaCTX-M-15-harbouring plasmids in these strains. This process likely enhances the fitness of the strain overall.17 Figure 2. View largeDownload slide Chromosomal insertion sites of blaCTX-M-15. Chromosomal insertion sites were identified using a combination of MiSeq and Nanopore MinION single-read sequences. (a) Insertion site found in ST4121 (isolate 8). (b) Insertion site found in ST394 (isolates 2, 12 and 15). The 11 389 bp insertion found in isolates 2, 12 and 15 included blaCTX-M-15 and qnrS1 and was identical to the first 11 389 bp of the 23 174 bp insertion in ST4121 (isolate 8). The larger insertion in ST4121 (isolate 8) included additional tet(A) and tet(R) resistance genes as well as several other genes of plasmid origin. The chromosomal insertion in the ST394 isolates was in a low GC% intergenic region between ydcS and ydcR genes encoding a putative DNA-binding transcriptional regulator and a putative spermidine/putrescine transporter subunit, respectively. The insertion in the ST4121 isolate was in a hydrolase gene. Each insertion had the mobile element ISEcp1 at the left-hand terminus and was flanked by target-site direct repeats of TATGA for isolate 8 and TTAAA for isolates 2, 12 and 15. This figure appears in colour in the online version of JAC and in black and white in the print version of JAC. Figure 2. View largeDownload slide Chromosomal insertion sites of blaCTX-M-15. Chromosomal insertion sites were identified using a combination of MiSeq and Nanopore MinION single-read sequences. (a) Insertion site found in ST4121 (isolate 8). (b) Insertion site found in ST394 (isolates 2, 12 and 15). The 11 389 bp insertion found in isolates 2, 12 and 15 included blaCTX-M-15 and qnrS1 and was identical to the first 11 389 bp of the 23 174 bp insertion in ST4121 (isolate 8). The larger insertion in ST4121 (isolate 8) included additional tet(A) and tet(R) resistance genes as well as several other genes of plasmid origin. The chromosomal insertion in the ST394 isolates was in a low GC% intergenic region between ydcS and ydcR genes encoding a putative DNA-binding transcriptional regulator and a putative spermidine/putrescine transporter subunit, respectively. The insertion in the ST4121 isolate was in a hydrolase gene. Each insertion had the mobile element ISEcp1 at the left-hand terminus and was flanked by target-site direct repeats of TATGA for isolate 8 and TTAAA for isolates 2, 12 and 15. This figure appears in colour in the online version of JAC and in black and white in the print version of JAC. We used cgMLST to relate the various E. coli to each other (Figure 1). STs were correctly grouped together. The Clermont PCR phylogroup analysis gave good agreement in general with cgMLST. Interestingly, cgMLST aligned the ST648 isolates as group F instead of D, confirming the recent observation of Johnson et al.18 and highlighting the superior discriminatory power of cgMLST. Analysis of the fimH data revealed that several strains were fimH null. This included all ST648 isolates and is typical of this ST.6 Its prevalence as an ExPEC pathogen suggests that another adhesion is substituting for fimH. The worldwide success of the blaCTX-M-15 gene in E. coli ST131 has been closely linked to a highly adherent fimH variant allele, fimH30.5 In this study, despite ST131 being particularly rare, fimH30 was the second most prevalent variant of fimH and was present in all ST394 isolates. The possession of fimH30 by ST394 is likely advantageous. However, the fact that E. coli ST131 fimH30 is particularly rare suggests that other as-yet-unknown factors are responsible for the success of ST394 in Islamabad. Acknowledgements This study was presented as a poster at the BSAC Spring Meeting, 2017 (‘Association of antibiotic genes with successful ST of Escherichia coli in the environment’). Funding This project was funded by a Commonwealth Academic Fellowship grant (PKCF-2016–156) awarded to R. Z. Transparency declarations None to declare. Supplementary data Figures S1 and S2 and Tables S1 and S2 are available as Supplementary data at JAC Online. References 1 Abernethy JK , Johnson AP , Guy R et al. Thirty day all-cause mortality in patients with Escherichia coli bacteraemia in England . Clin Microbiol Infect 2015 ; 21 : 251.e1 – 8 . Google Scholar CrossRef Search ADS 2 Johnson JR , Nicolas-Chanoine MH , DebRoy C et al. Comparison of Escherichia coli ST131 pulsotypes, by epidemiologic traits, 1967-2009 . Emerg Infect Dis 2012 ; 18 : 598 – 607 . Google Scholar CrossRef Search ADS PubMed 3 Weissman SJ , Johnson JR , Tchesnokova V et al. High-resolution two-locus clonal typing of extraintestinal pathogenic Escherichia coli . Appl Environ Microbiol 2012 ; 78 : 1353 – 60 . Google Scholar CrossRef Search ADS PubMed 4 Clermont O , Christenson JK , Denamur E et al. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups . Env Microbiol Rep 2013 ; 5 : 58 – 65 . Google Scholar CrossRef Search ADS 5 Johnson JR , Tchesnokova V , Johnston B et al. Abrupt emergence of a single dominant multidrug-resistant strain of Escherichia coli . J Infect Dis 2013 ; 207 : 919 – 28 . Google Scholar CrossRef Search ADS PubMed 6 Toleman MA , Bugert JJ , Nizam SA. Extensively drug-resistant New Delhi metallo-β-lactamase-encoding bacteria in the environment, Dhaka, Bangladesh, 2012 . Emerg Infect Dis 2015 ; 21 : 1027 – 30 . Google Scholar CrossRef Search ADS PubMed 7 Day MJ , Doumith M , Abernethy J et al. Population structure of Escherichia coli causing bacteraemia in the UK and Ireland between 2001 and 2010 . J Antimicrob Chemother 2016 ; 71 : 2139 – 42 . Google Scholar CrossRef Search ADS PubMed 8 Patzer JA , Walsh TR , Weeks J et al. Emergence and persistence of integron structures harbouring VIM genes in the Children’s Memorial Health Institute, Warsaw, Poland, 1998-2006 . J Antimicrob Chemother 2009 ; 63 : 269 – 73 . Google Scholar CrossRef Search ADS PubMed 9 Sambrook J. Molecular Cloning: A Laboratory Manual . New York : Cold Spring Harbor Laboratory Press , 2001 . 10 Hawser SP , Bouchillon SK , Hoban DJ et al. Emergence of high levels of extended-spectrum-β-lactamase-producing Gram-negative bacilli in the Asia-Pacific region: data from the Study for Monitoring Antimicrobial Resistance Trends (SMART) program, 2007 . Antimicrob Agents Chemother 2009 ; 53 : 3280 – 4 . Google Scholar CrossRef Search ADS PubMed 11 Diwan V , Chandran SP , Tamhankar AJ et al. Identification of extended-spectrum β-lactamase and quinolone resistance genes in Escherichia coli isolated from hospital wastewater from central India . J Antimicrob Chemother 2012 ; 67 : 857 – 9 . Google Scholar CrossRef Search ADS PubMed 12 Kumarasamy KK , Toleman MA , Walsh TR et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study . Lancet Infect Dis 2010 ; 10 : 597 – 602 . Google Scholar CrossRef Search ADS PubMed 13 Perry JD , Naqvi SH , Mirza IA et al. Prevalence of faecal carriage of Enterobacteriaceae with NDM-1 carbapenemase at military hospitals in Pakistan, and evaluation of two chromogenic media . J Antimicrob Chemother 2011 ; 66 : 2288 – 94 . Google Scholar CrossRef Search ADS PubMed 14 Woodford N , Turton JF , Livermore DM. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance . FEMS Microbiol Rev 2011 ; 35 : 736 – 55 . Google Scholar CrossRef Search ADS PubMed 15 Okeke IN , Wallace-Gadsden F , Simons HR et al. Multi-locus sequence typing of enteroaggregative Escherichia coli isolates from Nigerian children uncovers multiple lineages . PLoS One 2010 ; 5 : e14093 . Google Scholar CrossRef Search ADS PubMed 16 Johnson JR , Porter S , Johnston B et al. Host characteristics and bacterial traits predict experimental virulence for Escherichia coli bloodstream isolates from patients with urosepsis . Open Forum Infect Dis 2015 ; 2 : ofv083 . Google Scholar PubMed 17 MacLean RC , San Millan A. Microbial evolution: towards resolving the plasmid paradox . Curr Biol 2015 ; 25 : R764 – 7 . Google Scholar CrossRef Search ADS PubMed 18 Johnson JR , Johnston BD , Gordon DM. Rapid and specific detection of the Escherichia coli sequence type 648 complex within phylogroup F . J Clin Microbiol 2017 ; 55 : 1116 – 21 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For permissions, please email: journals.permissions@oup.com. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Journal of Antimicrobial ChemotherapyOxford University Press

Published: Apr 10, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off