Altered cytokine expression by macrophages from HLA-B27-positive spondyloarthritis patients without evidence of endoplasmic reticulum stress

Altered cytokine expression by macrophages from HLA-B27-positive spondyloarthritis patients... Objectives: We investigated endoplasmic reticulum (ER) stress and cytokine expression in peripheral blood-derived macrophages and synovial tissue from HLA-B27+ spondyloarthritis patients. Methods: Macrophages from healthy donors, spondyloarthritis (SpA) and rheumatoid arthritis (RA) patients were polarized with IFN-γ or IL-10 and activated with LPS. Expression of ER stress markers (BiP, CHOP, ERdj4) and cytokines (IL-23, IL-12, TNF, IL-10) was measured by qRT-PCR. Expression of ER stress markers and cytokines in synovial tissue from SpA patients was evaluated by microarray analysis. Results: Macrophages from HLA-B27+ spondyloarthritis patients did not show elevated ER stress markers. However, the expression of IL-23 and IL-12 by peripheral blood-derived macrophages was higher in HLA-B27+ SpA in comparison to healthy donors. Synovial tissue from HLA-B27+ SpA patients showed higher expression of TNF compared to HLA-B27- SpA patients. Conclusions: HLA-B27+ spondyloarthritis showed increased expression of IL-23, IL-12 and TNF without evidence of ER stress. Keywords: spondyloarthritis, HLA-B27, endoplasmic reticulum stress Key message: No evidence of endoplasmic reticulum stress in activated peripheral blood- derived macrophages from HLA-B27-positive spondyloarthritis patients Acknowledgements: D. Baeten is supported by a VICI grant from The Netherlands Organization for Scientific Research (NWO) and by a Consolidator grant from the European Research Council (ERC). https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Introduction HLA-B27 has the highest contribution to the inherited risk of developing ankylosing spondylitis (AS), and also plays a dominant role in the other spondyloarthritis (SpA) subtypes (1). One of the theories for the pathogenic role of HLA-B27 is based on the tendency of HLA- B27 to misfold inside the endoplasmic reticulum (ER) and thereby generating ER stress. This so-called unfolded protein response (UPR) can inhibit protein translation, upregulate ER chaperone molecules such as BiP and ERdj4, and activate transcription factors like CHOP, followed by increased production of pro-inflammatory cytokines (in particular IL-23). Based on the accumulating evidence for the involvement of the IL-23/IL-17 axis in SpA pathogenesis (2), a number of studies have focused on the role of ER stress (3). Induction of the UPR was shown in the B27/hβ2m rats as a result of HLA-B27 overexpression and was characterized by a predominant increase in IL-23 production and Th17 activation (4). Studies in humans showed enhanced expression of BiP and CHOP in synovial fluid-derived (5, 6) and peripheral blood-derived macrophages (PBDM) (7) from SpA patients. However, the question whether ER stress is responsible for the IL-23/IL-17 activation remains unanswered, since recent reports on the relation between IL-23 production and ER stress in HLA-B27+ SpA show conflicting findings (8, 9). It was previously stated that IFN-γ contributes to the UPR in SpA by upregulating HLA-B27 (7). However, we and others showed an alternative macrophage activation signature (prototyped by IL-10 polarized macrophages, MΦ ) in SpA versus a classical macrophage IL-10 signature (prototyped by IFN-γ polarized macrophages, MΦ ) in RA synovitis (10-12). IFN-γ Therefore, this study aimed to investigate whether the UPR could explain an altered cytokine expression in MΦ and MΦ derived from peripheral blood or in synovial tissue of IL-10 IFN-γ HLA-B27+ SpA patients. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Materials and methods Patients Peripheral blood samples were obtained from 6 healthy donors (HD), 17 SpA (9 HLA-B27+ and 8 HLA-B27-) and 10 RA patients. Synovial tissue biopsies were obtained from 11 SpA patients (7 HLA-B27+ and 4 HLA-B27-). The patients fulfilled the Assessment of SpondyloArthritis international Society (ASAS) criteria for SpA and the ACR classification criteria for RA. All patients had active disease as defined by at least one swollen joint and/or inflammatory back pain and none of the patients was treated with biologicals. All patients and HD gave written informed consent to participate to the study, as approved by the Medical Ethics Committee of the Academic Medical Centre/University of Amsterdam (reference number METC 2013_057). Monocyte isolation and in vitro polarization and stimulation Monocytes were isolated from peripheral blood by gradient centrifugation as previously described (10). Freshly isolated monocytes were polarized for 4 days in the presence of human recombinant IFN-γ (50 ng/ml; R&D Systems, Abingdon, UK) or IL-10 (50 ng/ml; R&D Systems). Macrophages were activated with 500 ng/ml LPS for an additional 4 h. Quantitative real-time PCR The adherent monocyte-derived macrophages were washed with phosphate buffered saline TM and subsequently lysed on the plate for RNA isolation using GeneElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich) according to the manufacturer’s instructions. Quantitative TM real-time PCR was performed using StepOnePlus Real-Time PCR System (Applied Biosystems). The mRNA levels were normalized to those of the human housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Oligonucleotide primers were https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 designed using the online tool for Real-time PCR (TaqMan) Primer Design (Genscript): IL-10 (forward 5’-GATGCCTTCAGCAGAGTGAA, reverse 5’- CCCAGGTAACCCTTAAAGTCC), IL-12p35 (forward 5’- ACCAGGTGGAGTTCAAGACC, reverse 5’-TGGCACAGTCTCACTGTTGA), p-12/- 23p40 (forward 5’-AAGGAGGCGAGGTTCTAAGC, reverse 5’- TGGGTTCTTTCTGGTCCTTT), IL-23p19 (forward 5’-TTCTCTGCTCCCTGATAGCC, reverse 5’-CCTCAGGCTGCAGGAGTT) and TNF (forward 5’- CCCATGTTGTAGCAAACCCT, reverse 5’-TGAGGTACAGGCCCTCTGAT) and the online tool qPrimerDepot of the National Institutes of Health: BiP (forward 5’- CATCACGCCGTCCTATGTCG, reverse 5’-CGTCAAAGACCGTGTTCTCG), CHOP (forward 5’-AGCCAAAATCAGAGCTGGAA, reverse 5’- TGGATCAGTCTGGAAAAGCA) and ERdj4 (forward 5’- AATGCAGATTGCAAAGATGAAA, reverse 5’-CAGCTCTGTGGAGGAGCAG). Primers were obtained from Invitrogen. Microarray analysis RNA was obtained from synovial tissue biopsies, followed by cDNA synthesis and labelling using a 2-color microarray-based gene expression protocol according to the manufacturer’s instructions (Agilent). Microarray data analysis was performed as previously described (13). Statistics Statistical analysis was performed using Prism software (GraphPad, La Jolla, CA). Data were expressed as mean ± SEM. A Kruskal Wallis test followed by Dunn’s Multiple Comparison test was used for comparisons between the groups. A P value of less than 0.05 was considered statistically significant. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Results Expression of BiP is not increased in MΦ and MΦ from HLA-B27+ SpA in IFN-γ IL-10 comparison to HLA-B27- SpA, RA patients and HD PBDM from HLA-B27+ SpA, HLA-B27- SpA, RA patients and HD were polarized with IFN-γ and IL-10 (MΦ and MΦ ), followed by no stimulation or LPS stimulation. In the IFN-γ IL-10 absence of LPS stimulation BiP mRNA levels were very low (data not shown). As expected, in the presence of LPS BiP mRNA levels were higher in MΦ compared to MΦ IFN-γ IL-10 (p<0,01). However, for both MΦ and MΦ there were no significant differences IFN-γ IL-10 between HLA-B27+ SpA and HLA-B27- SpA, RA patients and HD (Figure 1A). Expression of CHOP and ERdj4 is not increased in MΦ from HLA-B27+ SpA IFN-γ patients in comparison to HLA-B27- SpA, RA patients and HD Since IFN-γ is known to up-regulate the expression of HLA-B27, thus increasing the risk for ER stress, we additionally measured the mRNA levels of CHOP and ERdj4 in LPS-stimulated MΦ and again found no significant differences between activated MΦ from HLA- IFN-γ IFN-γ B27+ SpA compared to HLA-B27- SpA, RA patients and HD (Figure 1B). Expression of IL-23 and IL-12 is increased in MΦ from HLA-B27+ SpA patients in IFN-γ comparison to HD In the absence of LPS stimulation MΦ expressed significantly higher levels of IL-23 IL-10 compared with MΦ , but overall expression of all measured cytokines was low and there IFN-γ were no differences between the arthritis patients and HD. Upon LPS stimulation the cytokine expression of MΦ remained low (data not shown). On the other hand, MΦ showed a IL-10 IFN-γ strong increase in the expression of all cytokines after LPS activation. MΦ from HLA- IFN-γ https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 B27+ SpA expressed significantly higher levels of IL-23p19 (p < 0,05), IL-12p40 (p < 0,05) and IL-12p35 (p < 0.01) compared to HD. There was no significant difference between IL-23 and IL-12 mRNA levels between MΦ from HLA-B27+ SpA and HLA-B27- SpA or RA IFN-γ (Figure 2). The levels of TNF and IL-10 expression were similar in LPS activated MΦ IFN-γ from all groups. Expression of TNF is increased in synovial tissue from HLA-B27+ SpA in comparison to HLA-B27- SpA without increased expression of ER stress markers In order to correlate our findings in PBDM with expression of ER stress markers and cytokines at tissue level we performed a supplemental microarray analysis of synovial tissue biopsies from SpA patients. There was no significant difference in the expression of BiP, CHOP, ERdj4 and XBP1 between HLA-B27+ and HLA-B27- SpA. However, synovial tissue of HLA-B27+ SpA showed significantly more expression of TNF than HLA-B27- SpA. The levels of IL-23 and IL-10 were similar in both groups (Supplementary table). Since it was previously shown that autophagy (and not the UPR) regulates cytokine expression in the gut of HLA-B27+ SpA patients (14) we also evaluated the expression of autophagy genes HSPA8, HSP90AA1, ATG5, ATG12, ATG16L1 and MAP1LC3A in synovial tissue of SpA patients. The expression of HSPA8 in HLA-B27+ SpA was significantly higher compared to HLA-B27- SpA. On the contrary, there was a significantly lower expression of ATG5 in HLA-B27+ SpA compared to HLA-B27- SpA (Supplementary table). https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Discussion In this study we aimed to assess the potential impact of ER stress on cytokine expression by PBDM in human HLA-B27+ SpA. Experimental studies have indicated that HLA-B27 misfolding can lead to ER stress and thereby altered TLR-induced cytokine production by myeloid cells. Of particular interest is the upregulation of IL-23 as there is a genetic association of AS with genes involved in type IL-17 immune responses and microbial sensing and genes coding for ER aminopeptidases (15). The data gathered from in vitro (8, 9, 16, 17) and animal models (4, 18) suggest that aberrant IL-23 signalling plays a key role in the pathogenesis of SpA. A number of previous in vitro (16) and animal studies (4) made use of strong chemical agents or non-physiological HLA-B27 overexpression for the induction of ER stress. Studies in which more physiological stimulation of cells was used, showed conflicting results. Two recent studies questioned the relevance of ER stress-induced IL-23 production in human SpA as: a) not only IL-23 but also other pro- and anti-inflammatory cytokines (including IL-10) were upregulated in HLA-B27+ SpA (8) and b) there was no preferential increase in the expression of ER stress markers by macrophages from HLA-B27+ SpA patients (8, 19). Our experiments with MΦ and MΦ partially reproduce the findings of Zeng et al in IFN-γ IL-10 MΦ (8) as our data indicate a selective increase in IL-23 and IL-12 expression by MΦ M-CSF IFN- from HLA-B27+ SpA versus HD rather than a global increase of pro- and anti-inflammatory cytokines. This discrepancy may relate to the previously highlighted functional difference between differentially polarized macrophages. The lack of BiP and cytokine upregulation in MΦ following LPS stimulation further confirms the functional differences between IL-10 macrophage subsets. In agreement with Zeng et al and Neerinckx et al (8, 19), we could not find clear evidence of enhanced ER stress in PBDM or synovial tissue from HLA-B27+ SpA patients. These data https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 should be interpreted with caution, however, as we cannot exclude that this approach is not sensitive enough to detect discrete levels of ER stress and/or that other factors besides HLA- B27 or IFN-γ are required to lead to significant ER stress (16). Furthermore, additional mechanisms are probably involved in IL-23 regulation besides the UPR. Among these mechanisms, autophagy is an innate immune response which was earlier reported to regulate IL-23 expression in the gut (15), but not in the synovial tissue or PBDM of SpA patients (20). Our microarray analysis of synovial tissue from a small cohort of SpA patients shows higher expression of HSPA8 and lower expression of ATG5 in HLA-B27+ SpA compared to HLA- B27- SpA. This finding suggests a differential involvement of macroautophagy and chaperone-mediated autophagy in the HLA-B27+ SpA. However, due to the limited cohort size and the absence of noninflammatory controle tissue, we cannot draw clear conclusions based on these observations. Furthermore, in contrast to the gut microenvironment, the absence of bacterial interactions could explain a differential expression of autophagy genes in synovial compared to gut tissue. Future analysis of selected synovial cell populations should further elucidate the role of autophagy in synovial inflammation. In conclusion, we show that IFN-γ polarized and LPS stimulated PBDM of HLA-B27+ SpA patients express higher levels of IL-23 and IL-12 compared to HD, without evidence of increased ER stress. Similarly, additional analysis of synovial tissue from HLA-B27+ SpA fails to demonstrate increased levels of ER stress in comparison to HLA-B27- SpA patients. References (1) Bowness P. HLA-B27. Annu Rev Immunol 2015;33:29-48. (2) Yeremenko N, Paramarta J, Baeten D. The interleukin-23/interleukin-17 immune axis as a promising new target in the treatment of spondyloarthritis. Curr Opin Rheumatol 2014;26:361-370. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 (3) Smith JA. The role of the unfolded protein response in axial spondyloarthritis. Clin Rheumatol 2016;35:1425-1431. (4) DeLay ML, Turner MJ, Klenk EI, Smith JA, Sowders DP, Colbert RA. HLA-B27 misfolding and the unfolded protein response augment interleukin-23 production and are associated with Th17 activation in transgenic rats. Arthritis Rheum 2009;60:2633- (5) Gu J, Rihl M, Marker-Hermann E, Baeten D, Kuipers JG, Song YW et al. Clues to pathogenesis of spondylarthropathy derived from synovial fluid mononuclear cell gene expression profiles. J Rheumatol 2002;29:2159-64. (6) Dong W, Zhang Y, Yan M, Liu H, Chen Z, Zhu P. Upregulation of 78-kDa glucose- regulated protein in macrophages in peripheral joints of active ankylosing spondylitis. Scand J Rheumatol 2008;37:427-34. (7) Feng Y, Ding J, Fan CM, Zhu P. Interferon-γ contributes to HLA-B27-associated unfolded protein response in spondyloarthropathies. J Rheumatol 2012;39:574-82. (8) Zeng L, Lindstrom MJ, Smith JA. Ankylosing spondylitis macrophage production of higher levels of interleukin-23 in response to lipopolysaccharide without induction of a significant unfolded protein response. Arthritis Rheum 2011;63:3807-17. (9) Rezaiemanesh A, Mahmoudi M, Amirzargar AA, Vojdanian M, Jamshidi AR, Nicknam MH. Ankylosing spondylitis M-CSF-derived macrophages are undergoing unfolded protein response (UPR) and express higher levels of interleukin-23. Mod Rheumatol 2016;15:1-6. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 (10) Ambarus CA, Noordenbos T, de Hair MJ, Tak PP, Baeten DL. Intimal lining layer macrophages but not synovial sublining macrophages display an IL-10 polarized-like phenotype in chronic synovitis. Arthritis Res Ther 2012;14:R74. (11) Vandooren B, Noordenbos T, Ambarus C, Krausz S, Cantaert T, Yeremenko N et al. Absence of a classically activated macrophage cytokine signature in peripheral spondylarthritis, including psoriatic arthritis. Arthritis Rheum 2009;60:966-75. (12) Smith JA, Barnes MD, Hong D, DeLay ML, Inman RD, Colbert RA. Gene expression analysis of macrophages derived from ankylosing spondylitis patients reveals interferon-gamma dysregulation. Arthritis Rheum 2008;58:1640-9. (13) Yeremenko N, Noordenbos T, Cantaert T, van Tok M, van de Sande M, Canete JD et al. Disease-specific and inflammation-independent stromal alterations in spondylarthritis synovitis. Arthritis Rheum. 2013;65:174-85. (14) Ciccia F, Accardo-Palumbo A, Rizzo A, Guggino G, Raimondo S, Giardina A et al. Evidence that autophagy, but not the unfolded protein response, regulates the expression of IL-23 in the gut of patients with ankylosing spondylitis and subclinical gut inflammation. Ann Rheum Dis 2014;73:1566-74. (15) International Genetics of Ankylosing Spondylitis Consortium (IGAS). Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci. Nat Genet 2013;45:730-8. (16) Goodall JC, Wu C, Zhang Y, McNeill L, Ellis L, Saudek V, Gaston JS. Endoplasmic reticulum stress-induced transcription factor, CHOP, is crucial for dendritic cell IL- 23 expression. Proc Natl Acad Sci U S A 2010;107:17698-703. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 (17) Prevosto C, Goodall JC, Hill Gaston JS. Cytokine secretion by pathogen recognition receptor-stimulated dendritic cells in rheumatoid arthritis and ankylosing spondylitis. J Rheumatol 2012;39:1918-28. (18) Sherlock JP, Joyce-Shaikh B, Turner SP, Chao CC, Sathe M, Grein J et al. IL-23 induces spondyloarthropathy by acting on ROR-gammat(+) CD3(+)CD4(-)CD8(-) entheseal resident T cells. Nat Med 2012;18:1069-76. (19) Neerinckx B, Carter S, Lories RJ. No evidence for a critical role of the unfolded protein response in synovium and blood of patients with ankylosing spondylitis. Ann Rheum Dis 2014;73:629-30. (20) Neerinckx B, Carter S, Lories R. IL-23 expression and activation of autophagy in synovium and PBMCs of HLA-B27 positive patients with ankylosing spondylitis. Response to: 'Evidence that autophagy, but not the unfolded protein response, regulates the expression of IL-23 in the gut of patients with ankylosing spondylitis and subclinical gut inflammation' by Ciccia et al. Ann Rheum Dis 2014;73:e68. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Figure 1. ER stress marker expression by macrophages from HLA-B27+ SpA compared to HLA-B27- SpA, RA and HD. Graphs represent mRNA expression of BiP by MΦIFN-γ and MΦIL-10 (A), and respectively mRNA expression of CHOP and ERdj4 by MΦIFN-γ (B), following LPS stimulation. mRNA levels were measured by qRT-PCR, normalized to the expression of GAPDH. Bars represent the mean (SEM). **p<0,01 ***p<0,001 175x162mm (150 x 150 DPI) https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Figure 2. Cytokine expression by MΦIFN-γ from HLA-B27+ SpA compared to HLA-B27- SpA, RA and HD. Graphs represent mRNA expression of IL-23p19, IL-12p35, IL-12p40, IL-10 and TNF by MΦIFN-γ following LPS stimulation. mRNA levels were measured by qRT-PCR, normalized to the expression of GAPDH. Bars represent the mean (SEM). *p<0,05 **p<0,01. 245x154mm (150 x 150 DPI) https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Rheumatology Advances in Practice Oxford University Press

Altered cytokine expression by macrophages from HLA-B27-positive spondyloarthritis patients without evidence of endoplasmic reticulum stress

Free
14 pages

Loading next page...
 
/lp/ou_press/altered-cytokine-expression-by-macrophages-from-hla-b27-positive-1EG6eEwO6V
Publisher
British Society for Rheumatology
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of the British Society for Rheumatology.
eISSN
2514-1775
D.O.I.
10.1093/rap/rky014
Publisher site
See Article on Publisher Site

Abstract

Objectives: We investigated endoplasmic reticulum (ER) stress and cytokine expression in peripheral blood-derived macrophages and synovial tissue from HLA-B27+ spondyloarthritis patients. Methods: Macrophages from healthy donors, spondyloarthritis (SpA) and rheumatoid arthritis (RA) patients were polarized with IFN-γ or IL-10 and activated with LPS. Expression of ER stress markers (BiP, CHOP, ERdj4) and cytokines (IL-23, IL-12, TNF, IL-10) was measured by qRT-PCR. Expression of ER stress markers and cytokines in synovial tissue from SpA patients was evaluated by microarray analysis. Results: Macrophages from HLA-B27+ spondyloarthritis patients did not show elevated ER stress markers. However, the expression of IL-23 and IL-12 by peripheral blood-derived macrophages was higher in HLA-B27+ SpA in comparison to healthy donors. Synovial tissue from HLA-B27+ SpA patients showed higher expression of TNF compared to HLA-B27- SpA patients. Conclusions: HLA-B27+ spondyloarthritis showed increased expression of IL-23, IL-12 and TNF without evidence of ER stress. Keywords: spondyloarthritis, HLA-B27, endoplasmic reticulum stress Key message: No evidence of endoplasmic reticulum stress in activated peripheral blood- derived macrophages from HLA-B27-positive spondyloarthritis patients Acknowledgements: D. Baeten is supported by a VICI grant from The Netherlands Organization for Scientific Research (NWO) and by a Consolidator grant from the European Research Council (ERC). https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Introduction HLA-B27 has the highest contribution to the inherited risk of developing ankylosing spondylitis (AS), and also plays a dominant role in the other spondyloarthritis (SpA) subtypes (1). One of the theories for the pathogenic role of HLA-B27 is based on the tendency of HLA- B27 to misfold inside the endoplasmic reticulum (ER) and thereby generating ER stress. This so-called unfolded protein response (UPR) can inhibit protein translation, upregulate ER chaperone molecules such as BiP and ERdj4, and activate transcription factors like CHOP, followed by increased production of pro-inflammatory cytokines (in particular IL-23). Based on the accumulating evidence for the involvement of the IL-23/IL-17 axis in SpA pathogenesis (2), a number of studies have focused on the role of ER stress (3). Induction of the UPR was shown in the B27/hβ2m rats as a result of HLA-B27 overexpression and was characterized by a predominant increase in IL-23 production and Th17 activation (4). Studies in humans showed enhanced expression of BiP and CHOP in synovial fluid-derived (5, 6) and peripheral blood-derived macrophages (PBDM) (7) from SpA patients. However, the question whether ER stress is responsible for the IL-23/IL-17 activation remains unanswered, since recent reports on the relation between IL-23 production and ER stress in HLA-B27+ SpA show conflicting findings (8, 9). It was previously stated that IFN-γ contributes to the UPR in SpA by upregulating HLA-B27 (7). However, we and others showed an alternative macrophage activation signature (prototyped by IL-10 polarized macrophages, MΦ ) in SpA versus a classical macrophage IL-10 signature (prototyped by IFN-γ polarized macrophages, MΦ ) in RA synovitis (10-12). IFN-γ Therefore, this study aimed to investigate whether the UPR could explain an altered cytokine expression in MΦ and MΦ derived from peripheral blood or in synovial tissue of IL-10 IFN-γ HLA-B27+ SpA patients. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Materials and methods Patients Peripheral blood samples were obtained from 6 healthy donors (HD), 17 SpA (9 HLA-B27+ and 8 HLA-B27-) and 10 RA patients. Synovial tissue biopsies were obtained from 11 SpA patients (7 HLA-B27+ and 4 HLA-B27-). The patients fulfilled the Assessment of SpondyloArthritis international Society (ASAS) criteria for SpA and the ACR classification criteria for RA. All patients had active disease as defined by at least one swollen joint and/or inflammatory back pain and none of the patients was treated with biologicals. All patients and HD gave written informed consent to participate to the study, as approved by the Medical Ethics Committee of the Academic Medical Centre/University of Amsterdam (reference number METC 2013_057). Monocyte isolation and in vitro polarization and stimulation Monocytes were isolated from peripheral blood by gradient centrifugation as previously described (10). Freshly isolated monocytes were polarized for 4 days in the presence of human recombinant IFN-γ (50 ng/ml; R&D Systems, Abingdon, UK) or IL-10 (50 ng/ml; R&D Systems). Macrophages were activated with 500 ng/ml LPS for an additional 4 h. Quantitative real-time PCR The adherent monocyte-derived macrophages were washed with phosphate buffered saline TM and subsequently lysed on the plate for RNA isolation using GeneElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich) according to the manufacturer’s instructions. Quantitative TM real-time PCR was performed using StepOnePlus Real-Time PCR System (Applied Biosystems). The mRNA levels were normalized to those of the human housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Oligonucleotide primers were https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 designed using the online tool for Real-time PCR (TaqMan) Primer Design (Genscript): IL-10 (forward 5’-GATGCCTTCAGCAGAGTGAA, reverse 5’- CCCAGGTAACCCTTAAAGTCC), IL-12p35 (forward 5’- ACCAGGTGGAGTTCAAGACC, reverse 5’-TGGCACAGTCTCACTGTTGA), p-12/- 23p40 (forward 5’-AAGGAGGCGAGGTTCTAAGC, reverse 5’- TGGGTTCTTTCTGGTCCTTT), IL-23p19 (forward 5’-TTCTCTGCTCCCTGATAGCC, reverse 5’-CCTCAGGCTGCAGGAGTT) and TNF (forward 5’- CCCATGTTGTAGCAAACCCT, reverse 5’-TGAGGTACAGGCCCTCTGAT) and the online tool qPrimerDepot of the National Institutes of Health: BiP (forward 5’- CATCACGCCGTCCTATGTCG, reverse 5’-CGTCAAAGACCGTGTTCTCG), CHOP (forward 5’-AGCCAAAATCAGAGCTGGAA, reverse 5’- TGGATCAGTCTGGAAAAGCA) and ERdj4 (forward 5’- AATGCAGATTGCAAAGATGAAA, reverse 5’-CAGCTCTGTGGAGGAGCAG). Primers were obtained from Invitrogen. Microarray analysis RNA was obtained from synovial tissue biopsies, followed by cDNA synthesis and labelling using a 2-color microarray-based gene expression protocol according to the manufacturer’s instructions (Agilent). Microarray data analysis was performed as previously described (13). Statistics Statistical analysis was performed using Prism software (GraphPad, La Jolla, CA). Data were expressed as mean ± SEM. A Kruskal Wallis test followed by Dunn’s Multiple Comparison test was used for comparisons between the groups. A P value of less than 0.05 was considered statistically significant. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Results Expression of BiP is not increased in MΦ and MΦ from HLA-B27+ SpA in IFN-γ IL-10 comparison to HLA-B27- SpA, RA patients and HD PBDM from HLA-B27+ SpA, HLA-B27- SpA, RA patients and HD were polarized with IFN-γ and IL-10 (MΦ and MΦ ), followed by no stimulation or LPS stimulation. In the IFN-γ IL-10 absence of LPS stimulation BiP mRNA levels were very low (data not shown). As expected, in the presence of LPS BiP mRNA levels were higher in MΦ compared to MΦ IFN-γ IL-10 (p<0,01). However, for both MΦ and MΦ there were no significant differences IFN-γ IL-10 between HLA-B27+ SpA and HLA-B27- SpA, RA patients and HD (Figure 1A). Expression of CHOP and ERdj4 is not increased in MΦ from HLA-B27+ SpA IFN-γ patients in comparison to HLA-B27- SpA, RA patients and HD Since IFN-γ is known to up-regulate the expression of HLA-B27, thus increasing the risk for ER stress, we additionally measured the mRNA levels of CHOP and ERdj4 in LPS-stimulated MΦ and again found no significant differences between activated MΦ from HLA- IFN-γ IFN-γ B27+ SpA compared to HLA-B27- SpA, RA patients and HD (Figure 1B). Expression of IL-23 and IL-12 is increased in MΦ from HLA-B27+ SpA patients in IFN-γ comparison to HD In the absence of LPS stimulation MΦ expressed significantly higher levels of IL-23 IL-10 compared with MΦ , but overall expression of all measured cytokines was low and there IFN-γ were no differences between the arthritis patients and HD. Upon LPS stimulation the cytokine expression of MΦ remained low (data not shown). On the other hand, MΦ showed a IL-10 IFN-γ strong increase in the expression of all cytokines after LPS activation. MΦ from HLA- IFN-γ https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 B27+ SpA expressed significantly higher levels of IL-23p19 (p < 0,05), IL-12p40 (p < 0,05) and IL-12p35 (p < 0.01) compared to HD. There was no significant difference between IL-23 and IL-12 mRNA levels between MΦ from HLA-B27+ SpA and HLA-B27- SpA or RA IFN-γ (Figure 2). The levels of TNF and IL-10 expression were similar in LPS activated MΦ IFN-γ from all groups. Expression of TNF is increased in synovial tissue from HLA-B27+ SpA in comparison to HLA-B27- SpA without increased expression of ER stress markers In order to correlate our findings in PBDM with expression of ER stress markers and cytokines at tissue level we performed a supplemental microarray analysis of synovial tissue biopsies from SpA patients. There was no significant difference in the expression of BiP, CHOP, ERdj4 and XBP1 between HLA-B27+ and HLA-B27- SpA. However, synovial tissue of HLA-B27+ SpA showed significantly more expression of TNF than HLA-B27- SpA. The levels of IL-23 and IL-10 were similar in both groups (Supplementary table). Since it was previously shown that autophagy (and not the UPR) regulates cytokine expression in the gut of HLA-B27+ SpA patients (14) we also evaluated the expression of autophagy genes HSPA8, HSP90AA1, ATG5, ATG12, ATG16L1 and MAP1LC3A in synovial tissue of SpA patients. The expression of HSPA8 in HLA-B27+ SpA was significantly higher compared to HLA-B27- SpA. On the contrary, there was a significantly lower expression of ATG5 in HLA-B27+ SpA compared to HLA-B27- SpA (Supplementary table). https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Discussion In this study we aimed to assess the potential impact of ER stress on cytokine expression by PBDM in human HLA-B27+ SpA. Experimental studies have indicated that HLA-B27 misfolding can lead to ER stress and thereby altered TLR-induced cytokine production by myeloid cells. Of particular interest is the upregulation of IL-23 as there is a genetic association of AS with genes involved in type IL-17 immune responses and microbial sensing and genes coding for ER aminopeptidases (15). The data gathered from in vitro (8, 9, 16, 17) and animal models (4, 18) suggest that aberrant IL-23 signalling plays a key role in the pathogenesis of SpA. A number of previous in vitro (16) and animal studies (4) made use of strong chemical agents or non-physiological HLA-B27 overexpression for the induction of ER stress. Studies in which more physiological stimulation of cells was used, showed conflicting results. Two recent studies questioned the relevance of ER stress-induced IL-23 production in human SpA as: a) not only IL-23 but also other pro- and anti-inflammatory cytokines (including IL-10) were upregulated in HLA-B27+ SpA (8) and b) there was no preferential increase in the expression of ER stress markers by macrophages from HLA-B27+ SpA patients (8, 19). Our experiments with MΦ and MΦ partially reproduce the findings of Zeng et al in IFN-γ IL-10 MΦ (8) as our data indicate a selective increase in IL-23 and IL-12 expression by MΦ M-CSF IFN- from HLA-B27+ SpA versus HD rather than a global increase of pro- and anti-inflammatory cytokines. This discrepancy may relate to the previously highlighted functional difference between differentially polarized macrophages. The lack of BiP and cytokine upregulation in MΦ following LPS stimulation further confirms the functional differences between IL-10 macrophage subsets. In agreement with Zeng et al and Neerinckx et al (8, 19), we could not find clear evidence of enhanced ER stress in PBDM or synovial tissue from HLA-B27+ SpA patients. These data https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 should be interpreted with caution, however, as we cannot exclude that this approach is not sensitive enough to detect discrete levels of ER stress and/or that other factors besides HLA- B27 or IFN-γ are required to lead to significant ER stress (16). Furthermore, additional mechanisms are probably involved in IL-23 regulation besides the UPR. Among these mechanisms, autophagy is an innate immune response which was earlier reported to regulate IL-23 expression in the gut (15), but not in the synovial tissue or PBDM of SpA patients (20). Our microarray analysis of synovial tissue from a small cohort of SpA patients shows higher expression of HSPA8 and lower expression of ATG5 in HLA-B27+ SpA compared to HLA- B27- SpA. This finding suggests a differential involvement of macroautophagy and chaperone-mediated autophagy in the HLA-B27+ SpA. However, due to the limited cohort size and the absence of noninflammatory controle tissue, we cannot draw clear conclusions based on these observations. Furthermore, in contrast to the gut microenvironment, the absence of bacterial interactions could explain a differential expression of autophagy genes in synovial compared to gut tissue. Future analysis of selected synovial cell populations should further elucidate the role of autophagy in synovial inflammation. In conclusion, we show that IFN-γ polarized and LPS stimulated PBDM of HLA-B27+ SpA patients express higher levels of IL-23 and IL-12 compared to HD, without evidence of increased ER stress. Similarly, additional analysis of synovial tissue from HLA-B27+ SpA fails to demonstrate increased levels of ER stress in comparison to HLA-B27- SpA patients. References (1) Bowness P. HLA-B27. Annu Rev Immunol 2015;33:29-48. (2) Yeremenko N, Paramarta J, Baeten D. The interleukin-23/interleukin-17 immune axis as a promising new target in the treatment of spondyloarthritis. Curr Opin Rheumatol 2014;26:361-370. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 (3) Smith JA. The role of the unfolded protein response in axial spondyloarthritis. Clin Rheumatol 2016;35:1425-1431. (4) DeLay ML, Turner MJ, Klenk EI, Smith JA, Sowders DP, Colbert RA. HLA-B27 misfolding and the unfolded protein response augment interleukin-23 production and are associated with Th17 activation in transgenic rats. Arthritis Rheum 2009;60:2633- (5) Gu J, Rihl M, Marker-Hermann E, Baeten D, Kuipers JG, Song YW et al. Clues to pathogenesis of spondylarthropathy derived from synovial fluid mononuclear cell gene expression profiles. J Rheumatol 2002;29:2159-64. (6) Dong W, Zhang Y, Yan M, Liu H, Chen Z, Zhu P. Upregulation of 78-kDa glucose- regulated protein in macrophages in peripheral joints of active ankylosing spondylitis. Scand J Rheumatol 2008;37:427-34. (7) Feng Y, Ding J, Fan CM, Zhu P. Interferon-γ contributes to HLA-B27-associated unfolded protein response in spondyloarthropathies. J Rheumatol 2012;39:574-82. (8) Zeng L, Lindstrom MJ, Smith JA. Ankylosing spondylitis macrophage production of higher levels of interleukin-23 in response to lipopolysaccharide without induction of a significant unfolded protein response. Arthritis Rheum 2011;63:3807-17. (9) Rezaiemanesh A, Mahmoudi M, Amirzargar AA, Vojdanian M, Jamshidi AR, Nicknam MH. Ankylosing spondylitis M-CSF-derived macrophages are undergoing unfolded protein response (UPR) and express higher levels of interleukin-23. Mod Rheumatol 2016;15:1-6. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 (10) Ambarus CA, Noordenbos T, de Hair MJ, Tak PP, Baeten DL. Intimal lining layer macrophages but not synovial sublining macrophages display an IL-10 polarized-like phenotype in chronic synovitis. Arthritis Res Ther 2012;14:R74. (11) Vandooren B, Noordenbos T, Ambarus C, Krausz S, Cantaert T, Yeremenko N et al. Absence of a classically activated macrophage cytokine signature in peripheral spondylarthritis, including psoriatic arthritis. Arthritis Rheum 2009;60:966-75. (12) Smith JA, Barnes MD, Hong D, DeLay ML, Inman RD, Colbert RA. Gene expression analysis of macrophages derived from ankylosing spondylitis patients reveals interferon-gamma dysregulation. Arthritis Rheum 2008;58:1640-9. (13) Yeremenko N, Noordenbos T, Cantaert T, van Tok M, van de Sande M, Canete JD et al. Disease-specific and inflammation-independent stromal alterations in spondylarthritis synovitis. Arthritis Rheum. 2013;65:174-85. (14) Ciccia F, Accardo-Palumbo A, Rizzo A, Guggino G, Raimondo S, Giardina A et al. Evidence that autophagy, but not the unfolded protein response, regulates the expression of IL-23 in the gut of patients with ankylosing spondylitis and subclinical gut inflammation. Ann Rheum Dis 2014;73:1566-74. (15) International Genetics of Ankylosing Spondylitis Consortium (IGAS). Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci. Nat Genet 2013;45:730-8. (16) Goodall JC, Wu C, Zhang Y, McNeill L, Ellis L, Saudek V, Gaston JS. Endoplasmic reticulum stress-induced transcription factor, CHOP, is crucial for dendritic cell IL- 23 expression. Proc Natl Acad Sci U S A 2010;107:17698-703. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 (17) Prevosto C, Goodall JC, Hill Gaston JS. Cytokine secretion by pathogen recognition receptor-stimulated dendritic cells in rheumatoid arthritis and ankylosing spondylitis. J Rheumatol 2012;39:1918-28. (18) Sherlock JP, Joyce-Shaikh B, Turner SP, Chao CC, Sathe M, Grein J et al. IL-23 induces spondyloarthropathy by acting on ROR-gammat(+) CD3(+)CD4(-)CD8(-) entheseal resident T cells. Nat Med 2012;18:1069-76. (19) Neerinckx B, Carter S, Lories RJ. No evidence for a critical role of the unfolded protein response in synovium and blood of patients with ankylosing spondylitis. Ann Rheum Dis 2014;73:629-30. (20) Neerinckx B, Carter S, Lories R. IL-23 expression and activation of autophagy in synovium and PBMCs of HLA-B27 positive patients with ankylosing spondylitis. Response to: 'Evidence that autophagy, but not the unfolded protein response, regulates the expression of IL-23 in the gut of patients with ankylosing spondylitis and subclinical gut inflammation' by Ciccia et al. Ann Rheum Dis 2014;73:e68. https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Figure 1. ER stress marker expression by macrophages from HLA-B27+ SpA compared to HLA-B27- SpA, RA and HD. Graphs represent mRNA expression of BiP by MΦIFN-γ and MΦIL-10 (A), and respectively mRNA expression of CHOP and ERdj4 by MΦIFN-γ (B), following LPS stimulation. mRNA levels were measured by qRT-PCR, normalized to the expression of GAPDH. Bars represent the mean (SEM). **p<0,01 ***p<0,001 175x162mm (150 x 150 DPI) https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018 Figure 2. Cytokine expression by MΦIFN-γ from HLA-B27+ SpA compared to HLA-B27- SpA, RA and HD. Graphs represent mRNA expression of IL-23p19, IL-12p35, IL-12p40, IL-10 and TNF by MΦIFN-γ following LPS stimulation. mRNA levels were measured by qRT-PCR, normalized to the expression of GAPDH. Bars represent the mean (SEM). *p<0,05 **p<0,01. 245x154mm (150 x 150 DPI) https://mc.manuscriptcentral.com/rheumap Downloaded from https://academic.oup.com/rheumap/advance-article-abstract/doi/10.1093/rap/rky014/4989952 by Ed 'DeepDyve' Gillespie user on 08 June 2018

Journal

Rheumatology Advances in PracticeOxford University Press

Published: Apr 27, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off