Age, phosphorus, and 25-hydroxycholecalciferol regulate mRNA expression of vitamin D receptor and sodium-phosphate cotransporter in the small intestine of broiler chickens

Age, phosphorus, and 25-hydroxycholecalciferol regulate mRNA expression of vitamin D receptor and... Abstract Four experiments were conducted in this study. Experiment 1 was carried out to examine mRNA expressions of nuclear vitamin D receptor (nVDR), membrane vitamin D receptor (mVDR), and type IIb sodium-phosphate cotransporter (NaPi-IIb) in the small intestine of broiler chickens. Experiments 2, 3, and 4 were implemented to evaluate effects of age, non-phytate phosphorus (NPP), and 25-hydroxycholecalciferol (25-OH-D3) on mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum of chickens. Results showed that mRNA expression levels of nVDR and NaPi-IIb were highest in the duodenum of 21-day-old broilers, lower in the jejunum, and lowest in the ileum. By contrast, no differences in mRNA expression levels of mVDR were detected among the duodenum, jejunum, and ileum. Age quadratically affected mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum and 25-hydroxylase in the liver of 7- to 42-day-old broilers, with the highest levels observed at 21 d of age. By contrast, age linearly decreased mRNA expression level of 1α-hydroxylase in kidneys. Dietary NPP levels quadratically affected mRNA expression levels of nVDR and mVDR in the duodenum and 25-hydroxylase in the liver of 21-day-old broilers. The highest mRNA expression levels of nVDR and mVDR and lowest mRNA level of 25-hydroxylase were observed at 0.55% NPP. mRNA expression level of NaPi-IIb linearly declined when dietary NPP levels increased from 0.25 to 0.65%. Addition of 12.5 μg/kg of 25-OH-D3 increased mRNA expression level of 1α-hydroxylase in kidneys and those of nVDR, mVDR, and NaPi-IIb in the duodenum of broilers compared with birds fed the diet without 25-OH-D3. These data indicate that mRNA expressions of nVDR and NaPi-IIb are highest in the duodenum, and the greatest mRNA levels of nVDR, mVDR, and NaPi-IIb are observed at 21 d of age. Dietary NPP levels quadratically increase mRNA expressions of nVDR and mVDR but linearly decrease NaPi-IIb mRNA level. 25-OH-D3 up-regulates the above gene transcription. INTRODUCTION Cholecalciferol (vitamin D3) is used as a feed additive to regulate calcium (Ca) and phosphorus (P) metabolism and bone development in poultry. It undergoes 25-hydroxylation in the liver to transform into 25-hydroxycholecalciferol (25-OH-D3) and then undergoes 1α-hydroxylation in kidneys to form the final active product 1,25-dihydroxycholecalciferol [1,25-(OH)2-D3]. 1,25-(OH)2-D3 binded to 2 vitamin D receptors (VDRs) to regulate P absorption in the small intestine of poultry, which were nuclear VDR (nVDR) and membrane VDR (mVDR) (Nemere et al., 2004). The former nVDR was located in the nucleus of intestinal cells and activates mitogen-activated protein kinase (MAPK) pathway in chickens (Boland and Norman, 1998). mVDR was located in basal-lateral membranes of intestinal cells [also named membrane-associated rapid-response steroid-binding (MARRS) protein] (Nemere et al., 2000) and promoted P uptake via protein kinase C (PKC) signaling pathway in chicks (Tunsophon and Nemere, 2010). Type IIb sodium-phosphate cotransporter (NaPi-IIb) was the only protein that transports P in brush-border membranes of small intestinal cells of poultry (Yan et al., 2007). Expressions of nVDR, mVDR, and NaPi-IIb in animal intestine are affected by age, P, and vitamin D. Research has shown that active P absorption was highest in the duodenum, followed by the jejunum and ileum of chickens (Liu et al., 2016). These data suggest differences in gene expression in relation to site in the small intestine. In mice, the highest mRNA expression level of nVDR was observed in the duodenum, followed by the jejunum and ileum (Chow et al., 2013). Opposite results were observed for mVDR, whose mRNA expression levels were highest in the ileum, followed by the jejunum and duodenum in rats (Tudpor et al., 2008). Research has shown the differences in mRNA expression levels of NaPi-IIb in the duodenum, jejunum, and ileum of chickens (Yan et al., 2007; Han et al., 2009; Liu et al., 2016). However, mRNA expression levels of nVDR and mVDR in the small intestine of chickens have not been examined. Sodium-dependent phosphate absorption in the small intestine decreased with age in rats (Xu et al., 2002) and is related to gene expression levels of nVDR, mVDR, and NaPi-IIb. Aged rats exhibited lower protein abundance of nVDR in the duodenum than young rats (Gonzalez Pardo et al., 2008). Protein abundance of duodenal mVDR also decreased with age of leghorn cockerels (Larsson and Nemere, 2003). Furthermore, mRNA expression levels of NaPi-IIb declined with aging of rats (Xu et al., 2002). By contrast, Li et al. (2017) reported that nVDR protein abundance linearly increased in chickens from 1 to 42 d of age. mRNA expressions of nVDR and mVDR in small intestines of broiler chickens with aging should be clarified. Low dietary P stimulated active phosphate absorption and increased protein abundance and mRNA expression level of NaPi-IIb in the jejunum of rats (Giral et al., 2009). These data suggest that dietary P levels regulate gene expression of NaPi-IIb and phosphate absorption in the small intestine of mammals. Studies in poultry also have shown the regulation of dietary P levels on gene expressions of nVDR and NaPi-IIb (Yan et al., 2007; Li et al., 2011; Nie et al., 2013; Liu et al., 2017). However, effects of dietary P levels on mRNA expressions of mVDR have not been evaluated. 25-OH-D3 has been authorized as a feed additive in poultry in China. This compound is hydroxylated by 1α-hydroxylase in kidneys to its active form 1,25-(OH)2-D3 (Fraser and Kodicek, 1973). 1α-Hydroxycholecalciferol (1α-OH-D3), the derivative of 25-OH-D3, up-regulated mRNA expression levels of NaPi-IIb in the small intestine of chickens (Han et al., 2009). However, effects of 25-OH-D3 on mRNA expressions of nVDR, mVDR, and NaPi-IIb in the small intestine of broiler chickens have not been investigated. Therefore, the objective of this study was to evaluate effects of age, P, and 25-OH-D3 on mRNA expressions of nVDR, mVDR, and NaPi-IIb in the small intestine of broiler chickens. MATERIALS AND METHODS Birds, diets, and management All of the procedures used in this study were approved by the Animal Care Committee of Shangqiu Normal University. Experiment 1 was conducted to investigate differences in mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum, jejunum, and ileum of 21-day-old broilers. On the d of hatch, 72 male Ross 308 broilers were randomly allotted to 6 replicate cages of 12 birds per cage. Broilers were fed with diets with adequate nutrients (Table 1). At 21 d of age, 2 chickens per replicate cage (12 birds in total) were randomly selected and euthanized by cervical dislocation for collection of mucosa samples from the duodenum, jejunum, and ileum. Table 1. Ingredients and nutrient composition of experimental diets (as-fed basis). Item  Exp. 1  Exp. 2  Exp. 3  Exp. 4    Day  Day  Day  Day  Day    1 to 21  1 to 21  22 to 42  1 to 21  1 to 14  Ingredient (%)   Corn  58.10  58.08  63.26  58.70  58.20  57.74  57.26  56.77  58.09   Soybean meal (45% CP)  32.07  32.07  27.52  32.00  32.00  32.00  32.00  32.00  32.07   Soybean oil  2.20  2.22  3.00  1.20  1.20  1.20  1.20  1.20  2.22   Swine lard  –  –  –  0.97  1.15  1.31  1.48  1.65  –   Soy protein powder (65% CP)  3.50  3.50  2.74  3.49  3.55  3.62  3.68  3.75  3.50   Limestone  1.36  1.36  1.47  2.09  1.73  1.36  1.00  0.64  1.36   Dicalcium phosphate  1.94  1.94  1.35  0.72  1.34  1.94  2.55  3.16  1.94   L-Lysine·HCl (98%)  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14   DL-Methionine (98%)  0.14  0.14  0.08  0.14  0.14  0.14  0.14  0.14  0.14   Trace mineral premix1  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01   Vitamin premix2,3  0.04  0.04  0.03  0.04  0.04  0.04  0.04  0.04  0.03   Choline chloride (50%)  0.20  0.20  0.10  0.20  0.20  0.20  0.20  0.20  0.20   Sodium chloride  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  Nutrient composition (%)   Metabolizable energy (kcal/kg)  2951  2951  3053  2954  2954  2954  2954  2954  2951   Crude protein  21.07  21.07  19.08  21.08  21.08  21.08  21.08  21.08  21.07   Calcium (Ca)  1.00  1.00  0.90  1.00  1.00  1.00  1.00  1.00  1.00   Analyzed Ca  0.97  1.02  0.87  1.03  0.99  1.01  1.02  0.97  0.99   Total phosphorus (tP)  0.69  0.69  0.57  0.49  0.59  0.69  0.79  0.89  0.69   Analyzed tP  0.67  0.67  0.56  0.49  0.59  0.68  0.81  0.87  0.66   Non-phytate phosphorus (NPP)  0.45  0.45  0.35  0.25  0.35  0.45  0.55  0.65  0.45   Lysine  1.10  1.10  0.99  1.10  1.10  1.09  1.09  1.09  1.10   Methionine  0.50  0.50  0.41  0.50  0.50  0.50  0.50  0.50  0.50  Item  Exp. 1  Exp. 2  Exp. 3  Exp. 4    Day  Day  Day  Day  Day    1 to 21  1 to 21  22 to 42  1 to 21  1 to 14  Ingredient (%)   Corn  58.10  58.08  63.26  58.70  58.20  57.74  57.26  56.77  58.09   Soybean meal (45% CP)  32.07  32.07  27.52  32.00  32.00  32.00  32.00  32.00  32.07   Soybean oil  2.20  2.22  3.00  1.20  1.20  1.20  1.20  1.20  2.22   Swine lard  –  –  –  0.97  1.15  1.31  1.48  1.65  –   Soy protein powder (65% CP)  3.50  3.50  2.74  3.49  3.55  3.62  3.68  3.75  3.50   Limestone  1.36  1.36  1.47  2.09  1.73  1.36  1.00  0.64  1.36   Dicalcium phosphate  1.94  1.94  1.35  0.72  1.34  1.94  2.55  3.16  1.94   L-Lysine·HCl (98%)  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14   DL-Methionine (98%)  0.14  0.14  0.08  0.14  0.14  0.14  0.14  0.14  0.14   Trace mineral premix1  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01   Vitamin premix2,3  0.04  0.04  0.03  0.04  0.04  0.04  0.04  0.04  0.03   Choline chloride (50%)  0.20  0.20  0.10  0.20  0.20  0.20  0.20  0.20  0.20   Sodium chloride  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  Nutrient composition (%)   Metabolizable energy (kcal/kg)  2951  2951  3053  2954  2954  2954  2954  2954  2951   Crude protein  21.07  21.07  19.08  21.08  21.08  21.08  21.08  21.08  21.07   Calcium (Ca)  1.00  1.00  0.90  1.00  1.00  1.00  1.00  1.00  1.00   Analyzed Ca  0.97  1.02  0.87  1.03  0.99  1.01  1.02  0.97  0.99   Total phosphorus (tP)  0.69  0.69  0.57  0.49  0.59  0.69  0.79  0.89  0.69   Analyzed tP  0.67  0.67  0.56  0.49  0.59  0.68  0.81  0.87  0.66   Non-phytate phosphorus (NPP)  0.45  0.45  0.35  0.25  0.35  0.45  0.55  0.65  0.45   Lysine  1.10  1.10  0.99  1.10  1.10  1.09  1.09  1.09  1.10   Methionine  0.50  0.50  0.41  0.50  0.50  0.50  0.50  0.50  0.50  1Trace mineral premix provided the following (per kilogram of diet): 80 mg iron, 40 mg zinc, 8 mg copper, 60 mg manganese, 0.35 mg iodine, and 0.15 mg selenium. 2In experiments 1, 2, and 3, the vitamin premix provided the following (per kilogram of diet): 8,000 IU vitamin A, 25 μg cholecalciferol, 20 IU vitamin E, 0.5 mg menadione, 2.0 mg thiamine, 8.0 mg riboflavin, 35 mg niacin, 3.5 mg pyridoxine, 0.01 mg vitamin B12, 10.0 mg pantothenic acid, 0.55 mg folic acid, and 0.18 mg biotin. 3In experiment 4, the vitamin premix did not contain cholecalciferol. Other vitamins were the same as those of experiments 1, 2, and 3. View Large Experiment 2 was conducted to evaluate effects of age on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of 7- to 42-day-old broilers. On the d of hatch, 144 male Ross 308 broilers were randomly allotted to 12 cages of 12 birds per cage. Broilers were fed diets with adequate nutrients (Table 1). At 7, 14, 21, 28, 35, and 42 d of age, 2 chickens per replicate (12 birds per age) were randomly selected and euthanized by cervical dislocation for collection of liver, kidney, and duodenal mucosa samples. Experiment 3 was conducted to explore effects of dietary non-phytate phosphorus (NPP) levels on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of 1- to 21-day-old chickens. On the d of hatch, 360 male Ross 308 broilers were randomly allotted to 5 treatments with 6 replicate cages of 12 birds per cage. Dietary NPP levels were 0.25, 0.35, 0.45, 0.55, and 0.65% (Table 1). At 21 d of age, all chickens were weighed, and feed intake was calculated. Two birds per replicate cage (12 birds in group) were randomly selected and euthanized by cervical dislocation for collection of tibia, liver, kidney, and duodenal mucosa samples. Experiment 4 was conducted to examine effects of 25-OH-D3 on mRNA expressions of 1α-hydroxylase in kidneys and nVDR, mVDR, and NaPi-IIb in the duodenum of 1- to 14-day-old broilers. On the d of hatch, 144 male Ross 308 broilers were randomly allotted to 2 treatments with 6 replicate cages of 12 birds per cage. Dietary 25-OH-D3 levels were 0 and 12.5 μg/kg (Table 1). At 14 d of age, all chickens were weighed, and feed intake was calculated. Two birds per replicate cage (12 birds per group) were randomly selected and euthanized by cervical dislocation for collection of tibia, kidney, and duodenal mucosa samples. Broiler chickens from 1 to 21 and 22 to 42 d of age were reared in stainless steel cages (190 cm × 50 cm × 35 cm). Birds were provided ad libitum access to mash feed and water during experiments with 20 h of light and 4 h of darkness. Room temperature was controlled at 33°C from d 0 to 3, 30°C from d 4 to 7, 27°C from d 8 to 14, and 24°C from d 15 to 42. 25-OH-D3 Crystalline 25-OH-D3 was supplied by Changzhou Book Chemical Co., Ltd. (Changzhou, China). 25-OH-D3 solution was prepared as described by Biehl and Baker (1997). Crystalline 25-OH-D3 was weighed, dissolved in ethanol, and then diluted by propylene glycol (5% ethanol:95% propylene glycol). Solution concentration was analyzed by high-performance liquid chromatography (HPLC) method in Shanghai Fuxin Analysis Technology Center (Shanghai, China). The determined concentration of 25-OH-D3 solution was 9.51 μg/mL. 25-OH-D3 solution was then added to broiler diets in experiment 4. Sample collection Randomly selected chickens were euthanized, and the whole small intestine was isolated immediately from the gastrointestinal tract and cut into 3 pieces based on the following physiological marks: duodenum (distal to the gizzard to 1 cm distal to the bile duct), jejunum (1 cm distal to the bile duct to Meckel's diverticulum), and ileum (Meckel's diverticulum to 1 cm proximal to ileocecal junction) (Han et al., 2009). These segments were rinsed with ice-cold 0.9% NaCl. Mucosa was scraped off 3 cm at the center of individual segments (duodenum, jejunum, and ileum) with a glass microscope slide, immediately frozen in liquid nitrogen, and then kept at −80°C. After chickens were euthanized, liver and kidney samples also were immediately collected. Samples were frozen in liquid nitrogen and then stored at –80°C until further analysis. Tibia bones were collected and stored at –20°C. The weight, length, ash weight, and the percentage of ash, Ca, and P of tibia bones were measured with the method of Han et al. (2009). Ca and total P (tP) contents in diets were determined as described by Han et al. (2009). Total RNA extraction, reverse transcription, and quantitative real-time polymerase chain reaction Total RNA was isolated from the liver, kidney, and mucosa of the duodenum, jejunum, and ileum of chickens with TRIzol reagent (Tiangen Biotech Co. Ltd., Beijing, China) in accordance with manufacturer's instructions. RNA concentration was determined spectrophotometrically. OD260/280 values ranged from 1.8 to 2.0 to assure purity of total RNA. All samples were stored at –80°C. Reverse transcription was performed using 1 μg of total RNA with the Primescript Reverse Transcription Reagent Kit (Takara Biotechnology Co. Ltd., Dalian, China) in accordance with manufacturer's instructions. Primers of nVDR, mVDR, NaPi-IIb, 25-hydroxylase, 1α-hydroxylase, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China, Table 2). Table 2. Primer sequences for quantitative real-time PCR. Gene  Accession  Orientation  Primer sequence (5΄–3΄)  Size (bp)  nVDR  AF011356.1  Forward  AAGTCATCGACACCCTCCTG  173      Reverse  GCCAAAGACATCGTTGGAGT    mVDR  NM_204,110.3  Forward  CTACTGGCGCAACCGAGTTA  136      Reverse  CTCACCCACGCTGTTGTCTA    NaPi-IIb  NM_204,474.1  Forward  TCGGTCCGTTCACTCTGTTG  164      Reverse  GCCACGTTGCCTTTGTGATT    25-hydroxylase  NM_0,012,77354.1  Forward  GCTGTCACTGGGATTCTTTGC  160      Reverse  CCAACCGAAAGGCACAAGTC    1α-hydroxylase  XM_422,077.4  Forward  ATGATTGGCGTCCCCTTCAG  177      Reverse  TCCACGCTTTCACTCACACA    GAPDH  NM_204,305.1  Forward  GAACATCATCCCAGCGTCCA  133      Reverse  ACGGCAGGTCAGGTCAACAA    Gene  Accession  Orientation  Primer sequence (5΄–3΄)  Size (bp)  nVDR  AF011356.1  Forward  AAGTCATCGACACCCTCCTG  173      Reverse  GCCAAAGACATCGTTGGAGT    mVDR  NM_204,110.3  Forward  CTACTGGCGCAACCGAGTTA  136      Reverse  CTCACCCACGCTGTTGTCTA    NaPi-IIb  NM_204,474.1  Forward  TCGGTCCGTTCACTCTGTTG  164      Reverse  GCCACGTTGCCTTTGTGATT    25-hydroxylase  NM_0,012,77354.1  Forward  GCTGTCACTGGGATTCTTTGC  160      Reverse  CCAACCGAAAGGCACAAGTC    1α-hydroxylase  XM_422,077.4  Forward  ATGATTGGCGTCCCCTTCAG  177      Reverse  TCCACGCTTTCACTCACACA    GAPDH  NM_204,305.1  Forward  GAACATCATCCCAGCGTCCA  133      Reverse  ACGGCAGGTCAGGTCAACAA    View Large Quantitative real-time PCR was performed with the SYBR Premix PCR Kit (Takara Biotechnology Co. Ltd., Dalian, China) on a Thermo Scientific PikoReal Real-Time PCR System (Thermo Fisher Scientific, Waltham, Massachusetts). Reactions were conducted in a 10 μL reaction system containing 5 μL of SYBR Green Premix I PCR mix (Tli RNaseH Plus) (2×), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), 1.0 μL of cDNA, and 3.2 μL of RNase-free water. The program was set at 95°C for 60 s, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 30 seconds. Each gene was amplified in triplicate. The standard curve was determined using pooled samples. Gene expressions relative to endogenous control of GAPDH for each sample were calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). Statistical analysis Replicate means served as experimental units in statistical analysis. Data were analyzed using one-way analysis of variance (ANOVA) of SAS software (SAS Institute, 2002). Polynomial comparisons were performed to determine linear and quadratic effects of age or dietary NPP levels on growth, bone, and mRNA expression levels of nVDR, mVDR, NaPi-IIb, 25-hydroxylase, and 1α-hydroxylase. RESULTS AND DISCUSSION Intestinal segment Experiment 1 was conducted to investigate mRNA expressions of nVDR, mVDR, and NaPi-IIb in small intestine segments (duodenum, jejunum, and ileum) of broiler chickens. Results showed that the highest mRNA expression levels of nVDR and NaPi-IIb were in the duodenum of 21-day-old broilers, followed by the jejunum, and then ileum (Table 3). By contrast, no differences in mRNA expression levels of mVDR were observed among the 3 intestinal segments. The duodenum was considered for sample collection in experiments 2, 3, and 4. Table 3. mRNA expressions of nVDR, mVDR, and NaPi-IIb in the small intestine of broiler chickens at 21 d of age (experiment 1).1 Intestine  nVDR  mVDR  NaPi-IIb  Duodenum  1.00a  1.01  1.05a  Jejunum  0.76a,b  0.87  0.50b  Ileum  0.54b  1.11  0.13c  SEM  0.06  0.05  0.10  P-value  0.001  0.109  <0.001  Intestine  nVDR  mVDR  NaPi-IIb  Duodenum  1.00a  1.01  1.05a  Jejunum  0.76a,b  0.87  0.50b  Ileum  0.54b  1.11  0.13c  SEM  0.06  0.05  0.10  P-value  0.001  0.109  <0.001  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). Average body weight of broiler chickens at 21 d of age was 711 g/bird. View Large Phosphate absorption in the intestine is regulated by 1,25-(OH)2-D3 after its binding to nVDR and mVDR. Studies have shown that immunoreactions of nVDR were greatest in duodenal mucosa, lower in the jejunum, and lowest in the ileum of cows (Liesegang et al., 2008), sheep (Riner et al., 2008), and goats (Sidler-Lauff et al., 2010). In mice, mRNA expression levels of nVDR were also highest in the duodenum, followed by the jejunum and ileum (Chow et al., 2013). These data suggest that protein abundance and mRNA expression levels of nVDR differ in the 3 segments of the small intestine of mammals. The present study showed that mRNA expression levels of nVDR were highest in the duodenum of 21-day-old broilers, lower in the jejunum, and lowest in the ileum. These data indicate similarity of intestinal nVDR gene expression in poultry to that in mammals. mVDR was mainly expressed in basal-lateral membranes of intestinal cells of chickens and featured a molecular weight of 64.5 kDa (Nemere et al., 2000). The lowest and highest mRNA expression levels of mVDR were observed in the duodenum and in the ileum of rats, respectively (Tudpor et al., 2008). The present study showed no significant difference in mRNA expression levels of mVDR in the duodenum, jejunum, and ileum of chickens. Among the 3 intestine segments, the duodenum is the main site for phosphate absorption in chickens. Phosphate absorption in the duodenum was greater than that in the jejunum or in the ileum of broilers (Liu et al., 2016). The highest mRNA expression level of NaPi-IIb occurred in the duodenum of chickens, followed by the jejunum and ileum (Yan et al., 2007; Han et al., 2009; Liu et al., 2016). The present study obtained similar results. Our results showed the highest levels of NaPi-IIb mRNA in the duodenum, followed by the jejunum, and ileum in broilers. Opposite results were observed in mammals. Sodium-dependent phosphate absorption and mRNA expression levels and protein abundance of NaPi-IIb were lowest in the duodenum, at intermediate levels in the jejunum, and highest in the ileum of mice and rats (Radanovic et al., 2005; Marks et al., 2006). In small intestines of Holstein cows, mRNA expression of NaPi-IIb was also highest in the distal jejunum and ileum and almost absent in the duodenum and proximal jejunum (Foote et al., 2011). The NaPi-IIb gene expression affects active phosphate absorption in 3 intestinal segments. Sodium-dependent phosphate was absorbed mainly in the duodenum of chickens; by contrast, the ileum was the main site for active phosphate absorption in mice (Radanovic et al., 2005; Liu et al., 2016). Age Experiment 2 was conducted to investigate effects of age (7, 14, 21, 28, 35, and 42 d of age) on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens. Results showed that age quadratically affected mRNA expression levels of 25-hydroxylase in the liver and nVDR, mVDR, and NaPi-IIb in the duodenum of birds (Table 4). mRNA expression level of 25-hydroxylase in the liver increased from 1 to 21 d of age and then declined from 28 to 42 d of age. The highest level was noted at 21 d of age. Similar results were observed in mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum. By contrast, mRNA expression level of 1α-hydroxylase in kidneys of broilers linearly decreased from 7 to 42 d of age. Chicken samples were collected at 14 to 21 d of age in experiments 3 and 4. Table 4. mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens from 7 to 42 d of age (experiment 2).1 Age (d)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  7  1.02b  1.00a  1.07a-c  1.06b  1.05c  14  2.27a  0.95a  0.99b,c  1.01b  1.92b  21  2.36a  0.81a  1.82a  2.00a  2.73a  28  2.00a  0.77a  1.56a,b  1.86a  2.40a,b  35  0.50b  0.30b  1.34a-c  1.65a,b  2.41a,b  42  0.41b  0.18b  0.70c  1.61a,b  1.00c  SEM  0.15  0.06  0.10  0.09  0.13  P-value  Linear  <0.001  <0.001  0.517  0.002  0.588  Quadratic  <0.001  0.016  <0.001  0.002  <0.001  Age (d)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  7  1.02b  1.00a  1.07a-c  1.06b  1.05c  14  2.27a  0.95a  0.99b,c  1.01b  1.92b  21  2.36a  0.81a  1.82a  2.00a  2.73a  28  2.00a  0.77a  1.56a,b  1.86a  2.40a,b  35  0.50b  0.30b  1.34a-c  1.65a,b  2.41a,b  42  0.41b  0.18b  0.70c  1.61a,b  1.00c  SEM  0.15  0.06  0.10  0.09  0.13  P-value  Linear  <0.001  <0.001  0.517  0.002  0.588  Quadratic  <0.001  0.016  <0.001  0.002  <0.001  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). Average body weights of broiler chickens were 134, 366, 764, 1,227, 1,979, and 2,571 g/bird at 7, 14, 21, 28, 35, and 42 d of age, respectively. View Large Age affects gene expression of nVDR in the small intestine of animals. Protein abundance of nVDR in the duodenum of 24-month-old rats was lower than that of 3-month-old rats (Gonzalez Pardo et al., 2008). Research on chickens has shown that protein abundance of nVDR in the duodenum and jejunum linearly increased in broilers from 1 to 35 d of age but declined at 42 d of age (Li et al., 2017). The present study showed that age quadratically affected mRNA expressions of nVDR in the duodenum of chickens, with the highest mRNA expression level observed at 21 d of age. mVDR expression also changes with aging. Protein abundance of mVDR in the duodenum linearly decreased in 7- to 58-week-old leghorn cockerels (Larsson and Nemere, 2003). The present study showed that age quadratically affected mRNA expressions of mVDR in the duodenum of chickens. The highest mRNA levels of mVDR in the duodenum were observed at 21 d of age and then decreased from 28 to 42 d of age. Previous research has shown that mRNA expressions of NaPi-IIb in the duodenum quadratically correlate to age, and the highest levels of NaPi-IIb mRNA are observed in 21-day-old chickens (Li et al., 2017). Similar results were observed in the present study. mRNA levels of NaPi-IIb in the duodenum increased from 7 to 21 d of age and then declined from 28 to 42 d of age. Both the NaPi-IIb gene expression and active phosphate absorption decreased with aging of rats (Xu et al., 2002). The change of intestinal phosphate absorption with age of chickens should be clarified. 25-Hydroxylation in the liver and 1α-hydroxylation in kidneys are necessary for conversion of vitamin D3 into 1,25-(OH)2-D3. Thus, the present study examined effects of age on mRNA expressions of 25-hydroxylase in the liver and 1α-hydroxylase in kidneys. Previous research has shown that 25-hydroxylase activity in the liver increased with age in male rats (Saarem and Pedersen, 1988). The present study showed that age quadratically affected mRNA level of 25-hydroxylase. The highest mRNA level of 25-hydroxylase in the liver was observed in 21-day-old broilers, but it declined from 28 to 42 d of age. These data suggest that age affects gene transcription of 25-hydroxylase in the liver. Among chicken organs, mRNA expression level of 1α-hydroxylase was highest in kidneys (Shanmugasundaram and Selvaraj, 2012). Kidney 1α-hydroxylase activity peaked at 8 to 18 d of age in 6- to 46-day-old turkeys (Stevens et al., 1984). The present study showed that mRNA levels of 1α-hydroxylase in chicken kidneys linearly decreased from 7 to 42 d of age. These data suggest that gene transcription of 1α-hydroxylase in kidneys of broilers declines with age. Another research on swine showed that 1α-hydroxylase activity in kidneys of newborn pigs was lower than that in adult pigs (Hosseinpour et al., 2002). Dietary NPP levels Experiment 3 was conducted to explore effects of dietary NPP levels (0.25, 0.35, 0.45, 0.55, and 0.65%) on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens. Results showed that the FI and BWG of broiler chickens from 1 to 21 d of age increased with 0.25 to 0.45% dietary NPP levels (Table 5). No significant differences in growth were observed from 0.45 to 0.65% NPP. Similar results were found in tibia mineralization in chickens at 21 d of age (Table 6). Dietary NPP levels quadratically affected mRNA expressions of 25-hydroxylase in the liver and nVDR and mVDR in the duodenum of 1- to 21-day-old broilers (Table 7). mRNA expression level of 25-hydroxylase in the liver decreased when dietary NPP levels increased from 0.25 to 0.55% but then enhanced at 0.65% NPP. The lowest mRNA level of 25-hydroxylase was observed at 0.55% NPP. Opposite results were observed in mRNA expressions of nVDR and mVDR. mRNA expression levels of nVDR and mVDR in the duodenum increased when the NPP levels increased from 0.25 to 0.55% but then declined at 0.65% NPP. The highest mRNA level was found at 0.55% NPP. A total of 0.35 to 0.55% NPP levels decreased mRNA expression level of 1α-hydroxylase in kidneys. By contrast, mRNA levels of NaPi-IIb linearly declined when dietary NPP levels increased from 0.25 to 0.65%. Table 5. Effects of dietary non-phytate phosphorus (NPP) levels on growth performance of broiler chickens from 1 to 21 d of age (experiment 3).1 NPP (%)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0.25  979c  432c  2.27a  16.5a  0.35  1059b  569b  1.86b  5.5b  0.45  1138a  667a  1.71c  5.8b  0.55  1131a  627a  1.80b,c  4.0b  0.65  1074a,b  633a  1.70c  4.0b  SEM  13  16  0.04  1.5  P-value  Linear  <0.001  <0.001  <0.001  0.011  Quadratic  <0.001  <0.001  <0.001  0.093  NPP (%)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0.25  979c  432c  2.27a  16.5a  0.35  1059b  569b  1.86b  5.5b  0.45  1138a  667a  1.71c  5.8b  0.55  1131a  627a  1.80b,c  4.0b  0.65  1074a,b  633a  1.70c  4.0b  SEM  13  16  0.04  1.5  P-value  Linear  <0.001  <0.001  <0.001  0.011  Quadratic  <0.001  <0.001  <0.001  0.093  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 12 chickens per replicate (n = 6). View Large Table 6. Effects of dietary non-phytate phosphorus (NPP) levels on tibia mineralization of broiler chickens at 21 d of age (experiment 3).1 NPP (%)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0.25  1.08c  5.10b  0.42c  39.3b  14.3b  6.32b  0.35  1.42b  5.89a  0.68b  47.0a  18.2a  8.02a  0.45  1.83a  6.15a  0.88a  47.8a  17.9a  8.36a  0.55  1.72a  6.23a  0.81a,b  46.5a  17.2a  8.25a  0.65  1.62a,b  6.00a  0.81a,b  49.5a  18.2a  8.70a  SEM  0.06  0.09  0.03  0.8  0.3  0.18  P-value  Linear  <0.001  <0.001  <0.001  <0.001  <0.001  <0.001  Quadratic  <0.001  <0.001  <0.001  0.007  <0.001  <0.001  NPP (%)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0.25  1.08c  5.10b  0.42c  39.3b  14.3b  6.32b  0.35  1.42b  5.89a  0.68b  47.0a  18.2a  8.02a  0.45  1.83a  6.15a  0.88a  47.8a  17.9a  8.36a  0.55  1.72a  6.23a  0.81a,b  46.5a  17.2a  8.25a  0.65  1.62a,b  6.00a  0.81a,b  49.5a  18.2a  8.70a  SEM  0.06  0.09  0.03  0.8  0.3  0.18  P-value  Linear  <0.001  <0.001  <0.001  <0.001  <0.001  <0.001  Quadratic  <0.001  <0.001  <0.001  0.007  <0.001  <0.001  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large Table 7. Effects of dietary non-phytate phosphorus (NPP) levels on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens from 1 to 21 d of age (experiment 3).1 NPP (%)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  0.25  1.00a  1.00a-c  1.08b  1.03b  1.09a  0.35  0.94a  1.44a  1.04b  1.13b  1.03a  0.45  0.35b  0.73b,c  1.56a,b  1.08b  0.96a  0.55  0.32b  0.52c  1.96a  1.52a  0.90a  0.65  1.34a  1.06a,b  1.25b  0.94b  0.54b  SEM  0.09  0.08  0.09  0.05  0.05  P-value  Linear  0.892  0.037  0.023  0.450  <0.001  Quadratic  <0.001  0.119  0.028  0.008  0.023  NPP (%)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  0.25  1.00a  1.00a-c  1.08b  1.03b  1.09a  0.35  0.94a  1.44a  1.04b  1.13b  1.03a  0.45  0.35b  0.73b,c  1.56a,b  1.08b  0.96a  0.55  0.32b  0.52c  1.96a  1.52a  0.90a  0.65  1.34a  1.06a,b  1.25b  0.94b  0.54b  SEM  0.09  0.08  0.09  0.05  0.05  P-value  Linear  0.892  0.037  0.023  0.450  <0.001  Quadratic  <0.001  0.119  0.028  0.008  0.023  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large NRC (1994) has recommended that NPP requirement is 0.45% in 1- to 21-day-old broiler chickens. NPP at 0.45% was the medium level. Two lower (0.25 and 0.35%) and 2 higher levels of NPP (0.55 and 0.65%) were designed in the present study. Research has shown that a low-P diet increases mRNA levels and protein abundance of nVDR in the small intestine of chickens and rats (Meyer et al., 1992; Sriussadaporn et al., 1995). The present study showed that dietary NPP levels quadratically affected mRNA levels of nVDR. mRNA levels of nVDR increased from 0.25 to 0.45% NPP and then declined from 0.55 to 0.65% NPP. These results agreed with those reported by Nie et al. (2013), who observed that mRNA and protein expression of duodenal nVDR increased at 0.20 to 0.30% NPP and then decreased from 0.35 to 0.40% NPP in laying hens. These data indicate that nVDR expression reaches the highest levels at P requirement and then declines when dietary P far exceeds its optimal amount. mVDR was essential for regulation of phosphate uptake by 1,25-(OH)2-D3 in intestinal cells of mice (Nemere et al., 2012). The effect of dietary P levels on mRNA expression of mVDR has not been examined previously. The present study showed that dietary P quadratically affected mRNA levels of mVDR. The highest mRNA levels of mVDR were observed at 0.55% NPP and then declined at 0.65% NPP in 21-day-old broilers. These data suggest that dietary P levels regulate mVDR transcription. Low dietary P stimulated mRNA expression of NaPi-IIb and active phosphate transport in the small intestine of mice (Radanovic et al., 2005). mRNA expression level of NaPi-IIb in the distal jejunum of Holstein cows was negatively correlated with fecal P concentration (Foote et al., 2011). Further research has shown that dietary P affected NaPi-IIb mRNA expression in chickens (Yan et al., 2007; Li et al., 2012; Huber et al., 2015). Increasing dietary P linearly decreased mRNA expression levels of NaPi-IIb in the duodenum of broiler chickens (Liu et al., 2017) and laying hens (Nie et al., 2013). Similar results were noted in the present study. mRNA expression levels of NaPi-IIb linearly declined when dietary NPP increased from 0.25 to 0.65%. 25-Hydroxylase in the liver transforms vitamin D3 to 25-OH-D3. High dietary P levels decreased plasma 1,25-(OH)2-D3 concentration in laying hens and rats (Frost et al., 1991; Sriussadaporn et al., 1995), contributing to activity inhibition of 25-hydroxylase in the liver and 1α-hydroxylase in kidneys. NPP requirements for 1- to 21-day-old broiler chickens reached 0.45% (NRC, 1994) and 0.39% (Liu et al., 2017), respectively. In the present study, 0.55% NPP exceeded P requirement of chickens. mRNA levels of 25-hydroxylase declined when dietary NPP levels increased from 0.35 to 0.55%. 1α-Hydroxylase in kidneys converts 25-OH-D3 to 1,25-(OH)2-D3. The present study showed that mRNA levels of 1α-hydroxylase in kidneys decreased when NPP levels increased from 0.35 to 0.55%. These results agreed with those reported by Azam et al. (2003), who observed that low dietary P increased mRNA levels of 1α-hydroxylase in mouse kidneys. Protein abundance of 1α-hydroxylase in kidneys of young rats also increased when they were fed with low-P diets (Cheung et al., 2002). These data suggest that dietary P levels transcriptionally regulate gene expression of 1α-hydroxylase in kidneys. However, 0.65% NPP increased mRNA levels of 1α-hydroxylase compared with that of birds fed diets with 0.55% NPP. The cause of this finding should be further clarified. 25-OH-D3 Experiment 4 was conducted to examine effects of 25-OH-D3 (0 and 12.5 μg/kg) on mRNA expressions of 1α-hydroxylase in kidneys and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens. Results showed that supplementation of 12.5 μg/kg of 25-OH-D3 improved growth performance and tibia mineralization and decreased mortality of chickens from 1 to 14 d of age (Tables 8 and 9). 25-OH-D3 also increased mRNA expression level of 1α-hydroxylase in kidneys and those of nVDR, mVDR, and NaPi-IIb in the duodenum of 1- to 14-day-old broiler chickens compared with birds fed the diet without 25-OH-D3 (Table 10). Table 8. Effects of 25-OH-D3 on growth performance of broiler chickens from 1 to 14 d of age (experiment 4).1 25-OH-D3 (μg/kg)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0  392b  229b  1.71  8.3a  12.5  451a  267a  1.69  1.7b  SEM  12  9  0.04  1.5  P-value  0.008  0.033  0.748  0.018  25-OH-D3 (μg/kg)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0  392b  229b  1.71  8.3a  12.5  451a  267a  1.69  1.7b  SEM  12  9  0.04  1.5  P-value  0.008  0.033  0.748  0.018  a–bMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 12 chickens per replicate (n = 6). View Large Table 9. Effects of 25-OH-D3 on tibia mineralization of broiler chickens at 14 d of age (experiment 4).1 25-OH-D3 (μg/kg)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0  0.45b  4.46b  0.19b  41.21b  15.18b  7.36b  12.5  0.67a  4.89a  0.31a  46.43a  16.79a  8.13a  SEM  0.04  0.08  0.02  0.91  0.30  0.19  P-value  <0.001  0.004  <0.001  <0.001  0.001  0.038  25-OH-D3 (μg/kg)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0  0.45b  4.46b  0.19b  41.21b  15.18b  7.36b  12.5  0.67a  4.89a  0.31a  46.43a  16.79a  8.13a  SEM  0.04  0.08  0.02  0.91  0.30  0.19  P-value  <0.001  0.004  <0.001  <0.001  0.001  0.038  a–bMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large Table 10. Effects of 25-OH-D3 on mRNA expressions of 1α-hydroxylase in kidneys and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens from 1 to 14 d of age (experiment 4).1 25-OH-D3  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  (μg/kg)          0  1.03b  1.05b  1.01b  1.00b  12.5  1.67a  1.72a  1.70a  1.86a  SEM  0.15  0.12  0.15  0.18  P-value  0.029  0.001  0.012  0.006  25-OH-D3  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  (μg/kg)          0  1.03b  1.05b  1.01b  1.00b  12.5  1.67a  1.72a  1.70a  1.86a  SEM  0.15  0.12  0.15  0.18  P-value  0.029  0.001  0.012  0.006  a–bMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large Research has shown the absence of differences in body weight gain, feed intake, bone ash content, and tibial dyschondroplasia severity in broilers fed diets with 12.5 to 100 μg/kg of 25-OH-D3 (Fritts and Waldroup, 2003). Our recent research has shown that 12.5 μg/kg of 25-OH-D3 is sufficient for growth performance and bone mineralization in 1- to 42-day-old broilers (Chen et al., 2017). Thus, the present study evaluated effects of 12.5 μg/kg of 25-OH-D3 on mRNA expressions of phosphate absorption genes. 25-OH-D3 was hydroxylated by 1α-hydroxylase in kidneys to its active form 1,25-(OH)2-D3 (Fraser and Kodicek, 1973). The present study showed that addition of 12.5 μg/kg of 25-OH-D3 increased mRNA expression level of 1α-hydroxylase in kidneys of birds. These data suggest that 25-OH-D3 promotes 1α-hydroxylase transcription. When 25-OH-D3 was hydroxylated and transformed to 1,25-(OH)2-D3, the latter binded to nVDR to activate the MAPK pathway in intestinal cells of chickens (Boland and Norman, 1998). Two d after injection of 1,25-(OH)2-D3, mRNA expression levels of nVDR in the ileum of mice increased (Chow et al., 2013). In the present study, 25-OH-D3 also up-regulated nVDR mRNA levels in chickens. After binding to mVDR, 1,25-(OH)2-D3 activated the PKC signal pathway in the small intestine of chickens (Nemere et al., 2004). PKCα and PKCβ participated in regulation of phosphate uptake by 1,25-(OH)2-D3 in chickens (Tunsophon and Nemere, 2010). Protein abundance of mVDR in the duodenum of chickens fed diets with vitamin D3 was lower than in those fed diets without vitamin D3 (Nemere and Campbell, 2000). Opposite results were observed in the present study. 25-OH-D3 up-regulated mRNA expression levels of mVDR in the duodenum of broilers. 1,25-(OH)2-D3 treatment increased mRNA expression levels of NaPi-IIb in 14-day-old rats but exerted no effect on mRNA expression in 90-day-old rats (Xu et al., 2002). 1α-OH-D3 also elevated NaPi-IIb mRNA levels in the jejunum and ileum of 21-day-old broilers (Han et al., 2009). These data suggest that 1,25-(OH)2-D3 or 1α-OH-D3 regulates NaPi-IIb gene transcription in young animals. The present study showed that 25-OH-D3 increased NaPi-IIb mRNA level in 14-day-old chickens, thereby promoting active phosphate absorption in the duodenum of broilers. In summary, the highest mRNA expression levels of nVDR and NaPi-IIb were observed in the duodenum of 21-day-old broilers, followed the jejunum, and then the ileum. By contrast, no difference in mVDR mRNA expression level was observed among the 3 intestine segments. Age quadratically affected mRNA expression levels of nVDR, mVDR, and NaPi-IIb in the duodenum and 25-hydroxylase in the liver of 7- to 42-day-old broilers, with the highest mRNA levels observed at 21d of age. By contrast, age linearly decreased mRNA expression levels of 1α-hydroxylase in kidneys. Dietary NPP levels quadratically affected mRNA levels of nVDR, mVDR, and 25-hydroxylase. The highest mRNA expression levels of nVDR and mVDR and lowest mRNA level of 25-hydroxylase were observed at 0.55% NPP. mRNA levels of NaPi-IIb linearly declined when dietary NPP levels increased from 0.25 to 0.65%. Addition of 12.5 μg/kg of 25-OH-D3 increased mRNA expression level of 1α-hydroxylase in kidneys and those of nVDR, mVDR, and NaPi-IIb in the duodenum compared with those of birds fed diets without 25-OH-D3. These data indicate that mRNA expressions of nVDR and NaPi-IIb are highest in the duodenum and the greatest mRNA levles of nVDR, mVDR, and NaPi-IIb are observed at 21 d of age. Dietary NPP levels quadratically increase mRNA expressions of nVDR and mVDR but linearly decrease NaPi-IIb mRNA level. 25-OH-D3 up-regulates the above gene transcription. Acknowledgements This work was supported by the National Natural Science Foundation of China (31101732 and U1704107), the Innovation Scientists and Technicians Troop Construction Projects of Henan Province (C20130058), and the Foundation of the Education Department of Henan Province (16A230003). REFERENCES Azam N., Zhang M. Y., Wang X., Tenenhouse H. S., Portale A. A.. 2003. Disordered regulation of renal 25-hydroxyvitamin D-1α-hydroxylase gene expression by phosphorus in X-linked hypophosphatemic (Hyp) mice. Endocrinology  144: 3463– 3468. Google Scholar CrossRef Search ADS PubMed  Biehl R. R., Baker D. H.. 1997. Utilization of phytate and nonphytate phosphorus in chicks as affected by source and amount of vitamin D3. J. Anim. Sci.  75: 2986– 2993. Boland A. R. D., Norman A. W.. 1998. 1α,25(OH)2-vitamin D3 signaling in chick enterocytes: enhancement of tyrosine phosphorylation and rapid stimulation of mitogen-activated protein (MAP) kinase. J. Cell. Biochem.  69: 470– 482. Google Scholar CrossRef Search ADS PubMed  Chen G. H., Zhang J. L., Wang J. G., Zhang N., Qu H. X., Wang Z. X., Yan Y. F., Han J. C.. 2017. Requirement of 25-hydroxycholecalciferol for broilers. Chinese J. Anim. Nutr.  29: 2335– 2347. Cheung P. Y., Lai W. P., Lau H. Y., Lo S. C., Wong M. S.. 2002. Acute and chronic effect of dietary phosphorus restriction on protein expression in young rat renal proximal tubules. Proteomics  2: 1211– 1219. Google Scholar CrossRef Search ADS PubMed  Chow E. C., Quach H. P., Vieth R., Pang K. S.. 2013. Temporal changes in tissue 1α,25-dihydroxyvitamin D3, vitamin D receptor target genes, and calcium and PTH levels after 1,25(OH)2D3 treatment in mice. Am. J. Physiol. Endocrinol. Metab.  304: 977– 989. Google Scholar CrossRef Search ADS   Foote A. P., Lambert B. D., Brady J. A., Muir J. P.. 2011. Phosphate transporter expression in Holstein cows. J. Dairy Sci.  94: 1913– 1916. Google Scholar CrossRef Search ADS PubMed  Fraser D. R., Kodicek E.. 1973. Regulation of 25-hydroxycholecalciferol-1-hydroxylase activity in kidney by parathyroid hormone. Nat. New Biol.  241: 163– 166. Google Scholar CrossRef Search ADS PubMed  Fritts C. A., Waldroup P. W.. 2003. Effect of source and level of vitamin D on live performance and bone development in growing broilers. J. Appl. Poult. Res.  12: 45– 52. Google Scholar CrossRef Search ADS   Frost T. J., Roland D. A., Marple D. N.. 1991. The effects of various dietary phosphorus levels on the circadian patterns of plasma 1,25-dihydroxycholecalciferol, total calcium, ionized calcium, and phosphorus in laying hens. Poult. Sci.  70: 1564– 1570. Google Scholar CrossRef Search ADS PubMed  Giral H., Caldas Y., Sutherland E., Wilson P., Breusegem S., Barry N., Blaine J., Jiang T., Wang X. X., Levi M.. 2009. Regulation of rat intestinal Na-dependent phosphate transporters by dietary phosphate. Am. J. Physiol. Renal. Physiol.  297: 1466– 1475. Google Scholar CrossRef Search ADS   Gonzalez Pardo V., Boland R., de Boland A. R.. 2008. Vitamin D receptor levels and binding are reduced in aged rat intestinal subcellular fractions. Biogerontology  9: 109– 118. Google Scholar CrossRef Search ADS PubMed  Han J. C., Yang X. D., Zhang T., Li H., Li W. L., Zhang Z. Y., Yao J. H.. 2009. Effects of 1α-hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-one-day-old broilers. Poult. Sci.  88: 323– 329. Google Scholar CrossRef Search ADS PubMed  Hosseinpour F., Norlin M., Wikvall K.. 2002. Kidney microsomal 25- and 1alpha-hydroxylase in vitamin D metabolism: Catalytic properties, molecular cloning, cellular localization and expression during development. Biochim. Biophys. Acta.  1580: 133– 144. Google Scholar CrossRef Search ADS PubMed  Huber K., Zeller E., Rodehutscord M.. 2015. Modulation of small intestinal phosphate transporter by dietary supplements of mineral phosphorus and phytase in broilers. Poult. Sci.  94: 1009– 1017. Google Scholar CrossRef Search ADS PubMed  Larsson B., Nemere I.. 2003. Effect of growth and maturation on membrane-initiated actions of 1,25-dihydroxyvitamin D3. I. Calcium transport, receptor kinetics, and signal transduction in intestine of male chickens. Endocrinology  144: 1726– 1735. Google Scholar CrossRef Search ADS PubMed  Li J., Yuan J., Guo Y., Sun Q., Hu X.. 2012. The influence of dietary calcium and phosphorus imbalance on intestinal NaPi-IIb and calbindin mRNA expression and tibia parameters of broilers. Asian-Australas. J. Anim. Sci.  25: 552– 558. Google Scholar CrossRef Search ADS PubMed  Li J., Yuan J., Miao Z., Guo Y.. 2017. Effects of age on intestinal phosphate transport and biochemical values of broiler chickens. Asian-Australas. J. Anim. Sci.  30: 221– 228. Google Scholar CrossRef Search ADS PubMed  Li J., Yuan J., Guo Y., Yang Y., Bun S., Hu X., Yi D.. 2011. The effect of dietary nutrient density on growth performance, physiological parameters, and small intestinal type IIb sodium phosphate co-transporter expression in broilers. J. Anim. Sci. Biotech.  2: 102– 110. Liesegang A., Singer K., Boos A.. 2008. Vitamin D receptor amounts across different segments of the gastrointestinal tract in Brown Swiss and Holstein Frisean cows of different age. J. Anim. Physiol. Anim. Nutr.  92: 316– 323. Google Scholar CrossRef Search ADS   Liu S. B., Hu Y. X., Liao X. D., Lu L., Li S. F., Zhang L. Y., Tan H. Z., Yang L., Suo H. Q., Luo X. G.. 2016. Kinetics of phosphorus absorption in ligated small intestinal segments of broilers. J. Anim. Sci.  94: 3312– 3320. Google Scholar CrossRef Search ADS PubMed  Liu S. B., Liao X. D., Lu L., Li S. F., Wang L., Zhang L. Y., Jiang Y., Luo X. G.. 2017. Dietary non-phytate phosphorus requirement of broilers fed a conventional corn-soybean meal diet from 1 to 21 d of age. Poult. Sci.  96: 151– 159. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −$$\vartriangle$$$$\vartriangle$$Ct method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Marks J., Srai S. K., Biber J., Murer H., Unwin R. J., Debnam E. S.. 2006. Intestinal phosphate absorption and the effect of vitamin D: A comparison of rats with mice. Exp. Physiol.  91: 531– 537. Google Scholar CrossRef Search ADS PubMed  Meyer J., Fullmer C. S., Wasserman R. H., Komm B. S., Haussler M. R.. 1992. Dietary restriction of calcium, phosphorus, and vitamin D elicits differential regulation of the mRNAs for avian intestinal calbindin-D28k and the 1,25-dihydroxyvitamin D3 receptor. J. Bone Miner. Res.  7: 441– 448. Google Scholar CrossRef Search ADS PubMed  National Research Council. 1994. Nutrient Requirements of Poultry . 9th rev. ed.   Natl. Acad. Press, Washington, DC. Nemere I., Campbell K.. 2000. Immunochemical studies on the putative plasmalemmal receptor for 1,25-dihydroxyvitamin D3. III. Vitamin D status. Steroids  65: 451– 457. Google Scholar CrossRef Search ADS PubMed  Nemere I., Larsson D., Sundell K.. 2000. A specific binding moiety for 1,25-dihydroxyvitamin D3 in basal lateral membranes of carp enterocytes. Am. J. Physiol. Endocrinol. Metab.  279: 614– 621. Google Scholar CrossRef Search ADS   Nemere I., Farach-Carson M. C., Rohe B., Sterling T. M., Norman A. W., Boyan B. D., Safford S. E.. 2004. Ribozyme knockdown functionally links a 1,25(OH)2D3 membrane binding protein (1,25D3-MARRS) and phosphate uptake in intestinal cells. Proc. Natl. Acad. Sci. USA.  101: 7392– 7397. Google Scholar CrossRef Search ADS   Nemere I., Garcia-Garbi N., Hämmerling G. J., Winger Q.. 2012. Intestinal cell phosphate uptake and the targeted knockout of the 1,25D3-MARRS receptor/PDIA3/ERp57. Endocrinology  153: 1609– 1615. Nie W., Yang Y., Yuan J., Wang Z., Guo Y.. 2013. Effect of dietary nonphytate phosphorus on laying performance and small intestinal epithelial phosphate transporter expression in Dwarf pink-shell laying hens. J. Anim. Sci. Biotechnol.  4: 34. Google Scholar CrossRef Search ADS PubMed  Radanovic T., Wagner C. A., Murer H., Biber J.. 2005. Regulation of intestinal phosphate transport. I. Segmental expression and adaptation to low-Pi diet of the type IIb Na+-Pi cotransporter in mouse small intestine. Am. J. Physiol. Gastrointest. Liver Physiol.  288: 496– 500. Google Scholar CrossRef Search ADS   Riner K., Boos A., Hässig M., Liesegang A.. 2008. Vitamin D receptor distribution in intestines of domesticated sheep Ovis ammon f. aries. J. Morphol.  269: 144– 152. Google Scholar CrossRef Search ADS PubMed  Saarem K., Pedersen J. I.. 1988. Effect of age, gonadectomy and hypophysectomy on mitochondrial hydroxylation of vitamin D3 (cholecalciferol) and of 5β-cholestane-3α,7α,12α-triol in female and male rat liver. Biochem. J.  251: 475– 481. Google Scholar CrossRef Search ADS PubMed  SAS Institute. 2002. SAS User's Guide . Version 9 ed. SAS Inst. Inc., Cary, NC, USA. Shanmugasundaram R., Selvaraj R. K.. 2012. Vitamin D-1α-hydroxylase and vitamin D-24-hydroxylase mRNA studies in chickens. Poult. Sci.  91: 1819– 1824. Google Scholar CrossRef Search ADS PubMed  Sidler-Lauff K., Boos A., Kraenzlin M., Liesegang A.. 2010. Influence of different calcium supplies and a single vitamin D injection on vitamin D receptor andcalbindin D9k immunoreactivities in the gastrointestinal tract of goat kids. J. Anim. Sci.  88: 3598– 3610. Google Scholar CrossRef Search ADS PubMed  Sriussadaporn S., Wong M. S., Pike J. W., Favus M. J.. 1995. Tissue specificity and mechanism of vitamin D receptor up-regulation during dietary phosphorus restriction in the rat. J. Bone Miner. Res.  10: 271– 280. Google Scholar CrossRef Search ADS PubMed  Stevens V. I., Blair R., Salmon R. E.. 1984. Influence of maternal vitamin D3 carry-over on kidney 25-hydroxyvitamin D3-1-hydroxylase activity of poults. Poult. Sci.  63: 765– 774. Google Scholar CrossRef Search ADS PubMed  Tudpor K., Teerapornpuntakit J., Jantarajit W., Krishnamra N., Charoenphandhu N.. 2008. 1,25-dihydroxyvitamin D3 rapidly stimulates the solvent drag-induced paracellular calcium transport in the duodenum of female rats. J. Physiol. Sci.  58: 297– 307. Google Scholar CrossRef Search ADS PubMed  Tunsophon S., Nemere I.. 2010. Protein kinase C isotypes in signal transduction for the 1,25D3-MARRS receptor (ERp57/PDIA3) in steroid hormone-stimulated phosphate uptake. Steroids  75: 307– 313. Google Scholar CrossRef Search ADS PubMed  Xu H., Bai L., Collins J. F., Ghishan F. K.. 2002. Age-dependent regulation of rat intestinal type IIb sodium phosphate cotransporter by 1,25-(OH)2 vitamin D3. Am. J. Physiol. Cell Physiol. 282: 487– 493. Yan F., Angel R., Ashwell C. M.. 2007. Characterization of the chicken small intestine type IIb sodium phosphate cotransporter. Poult. Sci.  86: 67– 76. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Age, phosphorus, and 25-hydroxycholecalciferol regulate mRNA expression of vitamin D receptor and sodium-phosphate cotransporter in the small intestine of broiler chickens

Loading next page...
 
/lp/ou_press/age-phosphorus-and-25-hydroxycholecalciferol-regulate-mrna-expression-0PwGox6cNC
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex407
Publisher site
See Article on Publisher Site

Abstract

Abstract Four experiments were conducted in this study. Experiment 1 was carried out to examine mRNA expressions of nuclear vitamin D receptor (nVDR), membrane vitamin D receptor (mVDR), and type IIb sodium-phosphate cotransporter (NaPi-IIb) in the small intestine of broiler chickens. Experiments 2, 3, and 4 were implemented to evaluate effects of age, non-phytate phosphorus (NPP), and 25-hydroxycholecalciferol (25-OH-D3) on mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum of chickens. Results showed that mRNA expression levels of nVDR and NaPi-IIb were highest in the duodenum of 21-day-old broilers, lower in the jejunum, and lowest in the ileum. By contrast, no differences in mRNA expression levels of mVDR were detected among the duodenum, jejunum, and ileum. Age quadratically affected mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum and 25-hydroxylase in the liver of 7- to 42-day-old broilers, with the highest levels observed at 21 d of age. By contrast, age linearly decreased mRNA expression level of 1α-hydroxylase in kidneys. Dietary NPP levels quadratically affected mRNA expression levels of nVDR and mVDR in the duodenum and 25-hydroxylase in the liver of 21-day-old broilers. The highest mRNA expression levels of nVDR and mVDR and lowest mRNA level of 25-hydroxylase were observed at 0.55% NPP. mRNA expression level of NaPi-IIb linearly declined when dietary NPP levels increased from 0.25 to 0.65%. Addition of 12.5 μg/kg of 25-OH-D3 increased mRNA expression level of 1α-hydroxylase in kidneys and those of nVDR, mVDR, and NaPi-IIb in the duodenum of broilers compared with birds fed the diet without 25-OH-D3. These data indicate that mRNA expressions of nVDR and NaPi-IIb are highest in the duodenum, and the greatest mRNA levels of nVDR, mVDR, and NaPi-IIb are observed at 21 d of age. Dietary NPP levels quadratically increase mRNA expressions of nVDR and mVDR but linearly decrease NaPi-IIb mRNA level. 25-OH-D3 up-regulates the above gene transcription. INTRODUCTION Cholecalciferol (vitamin D3) is used as a feed additive to regulate calcium (Ca) and phosphorus (P) metabolism and bone development in poultry. It undergoes 25-hydroxylation in the liver to transform into 25-hydroxycholecalciferol (25-OH-D3) and then undergoes 1α-hydroxylation in kidneys to form the final active product 1,25-dihydroxycholecalciferol [1,25-(OH)2-D3]. 1,25-(OH)2-D3 binded to 2 vitamin D receptors (VDRs) to regulate P absorption in the small intestine of poultry, which were nuclear VDR (nVDR) and membrane VDR (mVDR) (Nemere et al., 2004). The former nVDR was located in the nucleus of intestinal cells and activates mitogen-activated protein kinase (MAPK) pathway in chickens (Boland and Norman, 1998). mVDR was located in basal-lateral membranes of intestinal cells [also named membrane-associated rapid-response steroid-binding (MARRS) protein] (Nemere et al., 2000) and promoted P uptake via protein kinase C (PKC) signaling pathway in chicks (Tunsophon and Nemere, 2010). Type IIb sodium-phosphate cotransporter (NaPi-IIb) was the only protein that transports P in brush-border membranes of small intestinal cells of poultry (Yan et al., 2007). Expressions of nVDR, mVDR, and NaPi-IIb in animal intestine are affected by age, P, and vitamin D. Research has shown that active P absorption was highest in the duodenum, followed by the jejunum and ileum of chickens (Liu et al., 2016). These data suggest differences in gene expression in relation to site in the small intestine. In mice, the highest mRNA expression level of nVDR was observed in the duodenum, followed by the jejunum and ileum (Chow et al., 2013). Opposite results were observed for mVDR, whose mRNA expression levels were highest in the ileum, followed by the jejunum and duodenum in rats (Tudpor et al., 2008). Research has shown the differences in mRNA expression levels of NaPi-IIb in the duodenum, jejunum, and ileum of chickens (Yan et al., 2007; Han et al., 2009; Liu et al., 2016). However, mRNA expression levels of nVDR and mVDR in the small intestine of chickens have not been examined. Sodium-dependent phosphate absorption in the small intestine decreased with age in rats (Xu et al., 2002) and is related to gene expression levels of nVDR, mVDR, and NaPi-IIb. Aged rats exhibited lower protein abundance of nVDR in the duodenum than young rats (Gonzalez Pardo et al., 2008). Protein abundance of duodenal mVDR also decreased with age of leghorn cockerels (Larsson and Nemere, 2003). Furthermore, mRNA expression levels of NaPi-IIb declined with aging of rats (Xu et al., 2002). By contrast, Li et al. (2017) reported that nVDR protein abundance linearly increased in chickens from 1 to 42 d of age. mRNA expressions of nVDR and mVDR in small intestines of broiler chickens with aging should be clarified. Low dietary P stimulated active phosphate absorption and increased protein abundance and mRNA expression level of NaPi-IIb in the jejunum of rats (Giral et al., 2009). These data suggest that dietary P levels regulate gene expression of NaPi-IIb and phosphate absorption in the small intestine of mammals. Studies in poultry also have shown the regulation of dietary P levels on gene expressions of nVDR and NaPi-IIb (Yan et al., 2007; Li et al., 2011; Nie et al., 2013; Liu et al., 2017). However, effects of dietary P levels on mRNA expressions of mVDR have not been evaluated. 25-OH-D3 has been authorized as a feed additive in poultry in China. This compound is hydroxylated by 1α-hydroxylase in kidneys to its active form 1,25-(OH)2-D3 (Fraser and Kodicek, 1973). 1α-Hydroxycholecalciferol (1α-OH-D3), the derivative of 25-OH-D3, up-regulated mRNA expression levels of NaPi-IIb in the small intestine of chickens (Han et al., 2009). However, effects of 25-OH-D3 on mRNA expressions of nVDR, mVDR, and NaPi-IIb in the small intestine of broiler chickens have not been investigated. Therefore, the objective of this study was to evaluate effects of age, P, and 25-OH-D3 on mRNA expressions of nVDR, mVDR, and NaPi-IIb in the small intestine of broiler chickens. MATERIALS AND METHODS Birds, diets, and management All of the procedures used in this study were approved by the Animal Care Committee of Shangqiu Normal University. Experiment 1 was conducted to investigate differences in mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum, jejunum, and ileum of 21-day-old broilers. On the d of hatch, 72 male Ross 308 broilers were randomly allotted to 6 replicate cages of 12 birds per cage. Broilers were fed with diets with adequate nutrients (Table 1). At 21 d of age, 2 chickens per replicate cage (12 birds in total) were randomly selected and euthanized by cervical dislocation for collection of mucosa samples from the duodenum, jejunum, and ileum. Table 1. Ingredients and nutrient composition of experimental diets (as-fed basis). Item  Exp. 1  Exp. 2  Exp. 3  Exp. 4    Day  Day  Day  Day  Day    1 to 21  1 to 21  22 to 42  1 to 21  1 to 14  Ingredient (%)   Corn  58.10  58.08  63.26  58.70  58.20  57.74  57.26  56.77  58.09   Soybean meal (45% CP)  32.07  32.07  27.52  32.00  32.00  32.00  32.00  32.00  32.07   Soybean oil  2.20  2.22  3.00  1.20  1.20  1.20  1.20  1.20  2.22   Swine lard  –  –  –  0.97  1.15  1.31  1.48  1.65  –   Soy protein powder (65% CP)  3.50  3.50  2.74  3.49  3.55  3.62  3.68  3.75  3.50   Limestone  1.36  1.36  1.47  2.09  1.73  1.36  1.00  0.64  1.36   Dicalcium phosphate  1.94  1.94  1.35  0.72  1.34  1.94  2.55  3.16  1.94   L-Lysine·HCl (98%)  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14   DL-Methionine (98%)  0.14  0.14  0.08  0.14  0.14  0.14  0.14  0.14  0.14   Trace mineral premix1  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01   Vitamin premix2,3  0.04  0.04  0.03  0.04  0.04  0.04  0.04  0.04  0.03   Choline chloride (50%)  0.20  0.20  0.10  0.20  0.20  0.20  0.20  0.20  0.20   Sodium chloride  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  Nutrient composition (%)   Metabolizable energy (kcal/kg)  2951  2951  3053  2954  2954  2954  2954  2954  2951   Crude protein  21.07  21.07  19.08  21.08  21.08  21.08  21.08  21.08  21.07   Calcium (Ca)  1.00  1.00  0.90  1.00  1.00  1.00  1.00  1.00  1.00   Analyzed Ca  0.97  1.02  0.87  1.03  0.99  1.01  1.02  0.97  0.99   Total phosphorus (tP)  0.69  0.69  0.57  0.49  0.59  0.69  0.79  0.89  0.69   Analyzed tP  0.67  0.67  0.56  0.49  0.59  0.68  0.81  0.87  0.66   Non-phytate phosphorus (NPP)  0.45  0.45  0.35  0.25  0.35  0.45  0.55  0.65  0.45   Lysine  1.10  1.10  0.99  1.10  1.10  1.09  1.09  1.09  1.10   Methionine  0.50  0.50  0.41  0.50  0.50  0.50  0.50  0.50  0.50  Item  Exp. 1  Exp. 2  Exp. 3  Exp. 4    Day  Day  Day  Day  Day    1 to 21  1 to 21  22 to 42  1 to 21  1 to 14  Ingredient (%)   Corn  58.10  58.08  63.26  58.70  58.20  57.74  57.26  56.77  58.09   Soybean meal (45% CP)  32.07  32.07  27.52  32.00  32.00  32.00  32.00  32.00  32.07   Soybean oil  2.20  2.22  3.00  1.20  1.20  1.20  1.20  1.20  2.22   Swine lard  –  –  –  0.97  1.15  1.31  1.48  1.65  –   Soy protein powder (65% CP)  3.50  3.50  2.74  3.49  3.55  3.62  3.68  3.75  3.50   Limestone  1.36  1.36  1.47  2.09  1.73  1.36  1.00  0.64  1.36   Dicalcium phosphate  1.94  1.94  1.35  0.72  1.34  1.94  2.55  3.16  1.94   L-Lysine·HCl (98%)  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14  0.14   DL-Methionine (98%)  0.14  0.14  0.08  0.14  0.14  0.14  0.14  0.14  0.14   Trace mineral premix1  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01  0.01   Vitamin premix2,3  0.04  0.04  0.03  0.04  0.04  0.04  0.04  0.04  0.03   Choline chloride (50%)  0.20  0.20  0.10  0.20  0.20  0.20  0.20  0.20  0.20   Sodium chloride  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  0.30  Nutrient composition (%)   Metabolizable energy (kcal/kg)  2951  2951  3053  2954  2954  2954  2954  2954  2951   Crude protein  21.07  21.07  19.08  21.08  21.08  21.08  21.08  21.08  21.07   Calcium (Ca)  1.00  1.00  0.90  1.00  1.00  1.00  1.00  1.00  1.00   Analyzed Ca  0.97  1.02  0.87  1.03  0.99  1.01  1.02  0.97  0.99   Total phosphorus (tP)  0.69  0.69  0.57  0.49  0.59  0.69  0.79  0.89  0.69   Analyzed tP  0.67  0.67  0.56  0.49  0.59  0.68  0.81  0.87  0.66   Non-phytate phosphorus (NPP)  0.45  0.45  0.35  0.25  0.35  0.45  0.55  0.65  0.45   Lysine  1.10  1.10  0.99  1.10  1.10  1.09  1.09  1.09  1.10   Methionine  0.50  0.50  0.41  0.50  0.50  0.50  0.50  0.50  0.50  1Trace mineral premix provided the following (per kilogram of diet): 80 mg iron, 40 mg zinc, 8 mg copper, 60 mg manganese, 0.35 mg iodine, and 0.15 mg selenium. 2In experiments 1, 2, and 3, the vitamin premix provided the following (per kilogram of diet): 8,000 IU vitamin A, 25 μg cholecalciferol, 20 IU vitamin E, 0.5 mg menadione, 2.0 mg thiamine, 8.0 mg riboflavin, 35 mg niacin, 3.5 mg pyridoxine, 0.01 mg vitamin B12, 10.0 mg pantothenic acid, 0.55 mg folic acid, and 0.18 mg biotin. 3In experiment 4, the vitamin premix did not contain cholecalciferol. Other vitamins were the same as those of experiments 1, 2, and 3. View Large Experiment 2 was conducted to evaluate effects of age on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of 7- to 42-day-old broilers. On the d of hatch, 144 male Ross 308 broilers were randomly allotted to 12 cages of 12 birds per cage. Broilers were fed diets with adequate nutrients (Table 1). At 7, 14, 21, 28, 35, and 42 d of age, 2 chickens per replicate (12 birds per age) were randomly selected and euthanized by cervical dislocation for collection of liver, kidney, and duodenal mucosa samples. Experiment 3 was conducted to explore effects of dietary non-phytate phosphorus (NPP) levels on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of 1- to 21-day-old chickens. On the d of hatch, 360 male Ross 308 broilers were randomly allotted to 5 treatments with 6 replicate cages of 12 birds per cage. Dietary NPP levels were 0.25, 0.35, 0.45, 0.55, and 0.65% (Table 1). At 21 d of age, all chickens were weighed, and feed intake was calculated. Two birds per replicate cage (12 birds in group) were randomly selected and euthanized by cervical dislocation for collection of tibia, liver, kidney, and duodenal mucosa samples. Experiment 4 was conducted to examine effects of 25-OH-D3 on mRNA expressions of 1α-hydroxylase in kidneys and nVDR, mVDR, and NaPi-IIb in the duodenum of 1- to 14-day-old broilers. On the d of hatch, 144 male Ross 308 broilers were randomly allotted to 2 treatments with 6 replicate cages of 12 birds per cage. Dietary 25-OH-D3 levels were 0 and 12.5 μg/kg (Table 1). At 14 d of age, all chickens were weighed, and feed intake was calculated. Two birds per replicate cage (12 birds per group) were randomly selected and euthanized by cervical dislocation for collection of tibia, kidney, and duodenal mucosa samples. Broiler chickens from 1 to 21 and 22 to 42 d of age were reared in stainless steel cages (190 cm × 50 cm × 35 cm). Birds were provided ad libitum access to mash feed and water during experiments with 20 h of light and 4 h of darkness. Room temperature was controlled at 33°C from d 0 to 3, 30°C from d 4 to 7, 27°C from d 8 to 14, and 24°C from d 15 to 42. 25-OH-D3 Crystalline 25-OH-D3 was supplied by Changzhou Book Chemical Co., Ltd. (Changzhou, China). 25-OH-D3 solution was prepared as described by Biehl and Baker (1997). Crystalline 25-OH-D3 was weighed, dissolved in ethanol, and then diluted by propylene glycol (5% ethanol:95% propylene glycol). Solution concentration was analyzed by high-performance liquid chromatography (HPLC) method in Shanghai Fuxin Analysis Technology Center (Shanghai, China). The determined concentration of 25-OH-D3 solution was 9.51 μg/mL. 25-OH-D3 solution was then added to broiler diets in experiment 4. Sample collection Randomly selected chickens were euthanized, and the whole small intestine was isolated immediately from the gastrointestinal tract and cut into 3 pieces based on the following physiological marks: duodenum (distal to the gizzard to 1 cm distal to the bile duct), jejunum (1 cm distal to the bile duct to Meckel's diverticulum), and ileum (Meckel's diverticulum to 1 cm proximal to ileocecal junction) (Han et al., 2009). These segments were rinsed with ice-cold 0.9% NaCl. Mucosa was scraped off 3 cm at the center of individual segments (duodenum, jejunum, and ileum) with a glass microscope slide, immediately frozen in liquid nitrogen, and then kept at −80°C. After chickens were euthanized, liver and kidney samples also were immediately collected. Samples were frozen in liquid nitrogen and then stored at –80°C until further analysis. Tibia bones were collected and stored at –20°C. The weight, length, ash weight, and the percentage of ash, Ca, and P of tibia bones were measured with the method of Han et al. (2009). Ca and total P (tP) contents in diets were determined as described by Han et al. (2009). Total RNA extraction, reverse transcription, and quantitative real-time polymerase chain reaction Total RNA was isolated from the liver, kidney, and mucosa of the duodenum, jejunum, and ileum of chickens with TRIzol reagent (Tiangen Biotech Co. Ltd., Beijing, China) in accordance with manufacturer's instructions. RNA concentration was determined spectrophotometrically. OD260/280 values ranged from 1.8 to 2.0 to assure purity of total RNA. All samples were stored at –80°C. Reverse transcription was performed using 1 μg of total RNA with the Primescript Reverse Transcription Reagent Kit (Takara Biotechnology Co. Ltd., Dalian, China) in accordance with manufacturer's instructions. Primers of nVDR, mVDR, NaPi-IIb, 25-hydroxylase, 1α-hydroxylase, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China, Table 2). Table 2. Primer sequences for quantitative real-time PCR. Gene  Accession  Orientation  Primer sequence (5΄–3΄)  Size (bp)  nVDR  AF011356.1  Forward  AAGTCATCGACACCCTCCTG  173      Reverse  GCCAAAGACATCGTTGGAGT    mVDR  NM_204,110.3  Forward  CTACTGGCGCAACCGAGTTA  136      Reverse  CTCACCCACGCTGTTGTCTA    NaPi-IIb  NM_204,474.1  Forward  TCGGTCCGTTCACTCTGTTG  164      Reverse  GCCACGTTGCCTTTGTGATT    25-hydroxylase  NM_0,012,77354.1  Forward  GCTGTCACTGGGATTCTTTGC  160      Reverse  CCAACCGAAAGGCACAAGTC    1α-hydroxylase  XM_422,077.4  Forward  ATGATTGGCGTCCCCTTCAG  177      Reverse  TCCACGCTTTCACTCACACA    GAPDH  NM_204,305.1  Forward  GAACATCATCCCAGCGTCCA  133      Reverse  ACGGCAGGTCAGGTCAACAA    Gene  Accession  Orientation  Primer sequence (5΄–3΄)  Size (bp)  nVDR  AF011356.1  Forward  AAGTCATCGACACCCTCCTG  173      Reverse  GCCAAAGACATCGTTGGAGT    mVDR  NM_204,110.3  Forward  CTACTGGCGCAACCGAGTTA  136      Reverse  CTCACCCACGCTGTTGTCTA    NaPi-IIb  NM_204,474.1  Forward  TCGGTCCGTTCACTCTGTTG  164      Reverse  GCCACGTTGCCTTTGTGATT    25-hydroxylase  NM_0,012,77354.1  Forward  GCTGTCACTGGGATTCTTTGC  160      Reverse  CCAACCGAAAGGCACAAGTC    1α-hydroxylase  XM_422,077.4  Forward  ATGATTGGCGTCCCCTTCAG  177      Reverse  TCCACGCTTTCACTCACACA    GAPDH  NM_204,305.1  Forward  GAACATCATCCCAGCGTCCA  133      Reverse  ACGGCAGGTCAGGTCAACAA    View Large Quantitative real-time PCR was performed with the SYBR Premix PCR Kit (Takara Biotechnology Co. Ltd., Dalian, China) on a Thermo Scientific PikoReal Real-Time PCR System (Thermo Fisher Scientific, Waltham, Massachusetts). Reactions were conducted in a 10 μL reaction system containing 5 μL of SYBR Green Premix I PCR mix (Tli RNaseH Plus) (2×), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), 1.0 μL of cDNA, and 3.2 μL of RNase-free water. The program was set at 95°C for 60 s, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 30 seconds. Each gene was amplified in triplicate. The standard curve was determined using pooled samples. Gene expressions relative to endogenous control of GAPDH for each sample were calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). Statistical analysis Replicate means served as experimental units in statistical analysis. Data were analyzed using one-way analysis of variance (ANOVA) of SAS software (SAS Institute, 2002). Polynomial comparisons were performed to determine linear and quadratic effects of age or dietary NPP levels on growth, bone, and mRNA expression levels of nVDR, mVDR, NaPi-IIb, 25-hydroxylase, and 1α-hydroxylase. RESULTS AND DISCUSSION Intestinal segment Experiment 1 was conducted to investigate mRNA expressions of nVDR, mVDR, and NaPi-IIb in small intestine segments (duodenum, jejunum, and ileum) of broiler chickens. Results showed that the highest mRNA expression levels of nVDR and NaPi-IIb were in the duodenum of 21-day-old broilers, followed by the jejunum, and then ileum (Table 3). By contrast, no differences in mRNA expression levels of mVDR were observed among the 3 intestinal segments. The duodenum was considered for sample collection in experiments 2, 3, and 4. Table 3. mRNA expressions of nVDR, mVDR, and NaPi-IIb in the small intestine of broiler chickens at 21 d of age (experiment 1).1 Intestine  nVDR  mVDR  NaPi-IIb  Duodenum  1.00a  1.01  1.05a  Jejunum  0.76a,b  0.87  0.50b  Ileum  0.54b  1.11  0.13c  SEM  0.06  0.05  0.10  P-value  0.001  0.109  <0.001  Intestine  nVDR  mVDR  NaPi-IIb  Duodenum  1.00a  1.01  1.05a  Jejunum  0.76a,b  0.87  0.50b  Ileum  0.54b  1.11  0.13c  SEM  0.06  0.05  0.10  P-value  0.001  0.109  <0.001  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). Average body weight of broiler chickens at 21 d of age was 711 g/bird. View Large Phosphate absorption in the intestine is regulated by 1,25-(OH)2-D3 after its binding to nVDR and mVDR. Studies have shown that immunoreactions of nVDR were greatest in duodenal mucosa, lower in the jejunum, and lowest in the ileum of cows (Liesegang et al., 2008), sheep (Riner et al., 2008), and goats (Sidler-Lauff et al., 2010). In mice, mRNA expression levels of nVDR were also highest in the duodenum, followed by the jejunum and ileum (Chow et al., 2013). These data suggest that protein abundance and mRNA expression levels of nVDR differ in the 3 segments of the small intestine of mammals. The present study showed that mRNA expression levels of nVDR were highest in the duodenum of 21-day-old broilers, lower in the jejunum, and lowest in the ileum. These data indicate similarity of intestinal nVDR gene expression in poultry to that in mammals. mVDR was mainly expressed in basal-lateral membranes of intestinal cells of chickens and featured a molecular weight of 64.5 kDa (Nemere et al., 2000). The lowest and highest mRNA expression levels of mVDR were observed in the duodenum and in the ileum of rats, respectively (Tudpor et al., 2008). The present study showed no significant difference in mRNA expression levels of mVDR in the duodenum, jejunum, and ileum of chickens. Among the 3 intestine segments, the duodenum is the main site for phosphate absorption in chickens. Phosphate absorption in the duodenum was greater than that in the jejunum or in the ileum of broilers (Liu et al., 2016). The highest mRNA expression level of NaPi-IIb occurred in the duodenum of chickens, followed by the jejunum and ileum (Yan et al., 2007; Han et al., 2009; Liu et al., 2016). The present study obtained similar results. Our results showed the highest levels of NaPi-IIb mRNA in the duodenum, followed by the jejunum, and ileum in broilers. Opposite results were observed in mammals. Sodium-dependent phosphate absorption and mRNA expression levels and protein abundance of NaPi-IIb were lowest in the duodenum, at intermediate levels in the jejunum, and highest in the ileum of mice and rats (Radanovic et al., 2005; Marks et al., 2006). In small intestines of Holstein cows, mRNA expression of NaPi-IIb was also highest in the distal jejunum and ileum and almost absent in the duodenum and proximal jejunum (Foote et al., 2011). The NaPi-IIb gene expression affects active phosphate absorption in 3 intestinal segments. Sodium-dependent phosphate was absorbed mainly in the duodenum of chickens; by contrast, the ileum was the main site for active phosphate absorption in mice (Radanovic et al., 2005; Liu et al., 2016). Age Experiment 2 was conducted to investigate effects of age (7, 14, 21, 28, 35, and 42 d of age) on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens. Results showed that age quadratically affected mRNA expression levels of 25-hydroxylase in the liver and nVDR, mVDR, and NaPi-IIb in the duodenum of birds (Table 4). mRNA expression level of 25-hydroxylase in the liver increased from 1 to 21 d of age and then declined from 28 to 42 d of age. The highest level was noted at 21 d of age. Similar results were observed in mRNA expressions of nVDR, mVDR, and NaPi-IIb in the duodenum. By contrast, mRNA expression level of 1α-hydroxylase in kidneys of broilers linearly decreased from 7 to 42 d of age. Chicken samples were collected at 14 to 21 d of age in experiments 3 and 4. Table 4. mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens from 7 to 42 d of age (experiment 2).1 Age (d)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  7  1.02b  1.00a  1.07a-c  1.06b  1.05c  14  2.27a  0.95a  0.99b,c  1.01b  1.92b  21  2.36a  0.81a  1.82a  2.00a  2.73a  28  2.00a  0.77a  1.56a,b  1.86a  2.40a,b  35  0.50b  0.30b  1.34a-c  1.65a,b  2.41a,b  42  0.41b  0.18b  0.70c  1.61a,b  1.00c  SEM  0.15  0.06  0.10  0.09  0.13  P-value  Linear  <0.001  <0.001  0.517  0.002  0.588  Quadratic  <0.001  0.016  <0.001  0.002  <0.001  Age (d)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  7  1.02b  1.00a  1.07a-c  1.06b  1.05c  14  2.27a  0.95a  0.99b,c  1.01b  1.92b  21  2.36a  0.81a  1.82a  2.00a  2.73a  28  2.00a  0.77a  1.56a,b  1.86a  2.40a,b  35  0.50b  0.30b  1.34a-c  1.65a,b  2.41a,b  42  0.41b  0.18b  0.70c  1.61a,b  1.00c  SEM  0.15  0.06  0.10  0.09  0.13  P-value  Linear  <0.001  <0.001  0.517  0.002  0.588  Quadratic  <0.001  0.016  <0.001  0.002  <0.001  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). Average body weights of broiler chickens were 134, 366, 764, 1,227, 1,979, and 2,571 g/bird at 7, 14, 21, 28, 35, and 42 d of age, respectively. View Large Age affects gene expression of nVDR in the small intestine of animals. Protein abundance of nVDR in the duodenum of 24-month-old rats was lower than that of 3-month-old rats (Gonzalez Pardo et al., 2008). Research on chickens has shown that protein abundance of nVDR in the duodenum and jejunum linearly increased in broilers from 1 to 35 d of age but declined at 42 d of age (Li et al., 2017). The present study showed that age quadratically affected mRNA expressions of nVDR in the duodenum of chickens, with the highest mRNA expression level observed at 21 d of age. mVDR expression also changes with aging. Protein abundance of mVDR in the duodenum linearly decreased in 7- to 58-week-old leghorn cockerels (Larsson and Nemere, 2003). The present study showed that age quadratically affected mRNA expressions of mVDR in the duodenum of chickens. The highest mRNA levels of mVDR in the duodenum were observed at 21 d of age and then decreased from 28 to 42 d of age. Previous research has shown that mRNA expressions of NaPi-IIb in the duodenum quadratically correlate to age, and the highest levels of NaPi-IIb mRNA are observed in 21-day-old chickens (Li et al., 2017). Similar results were observed in the present study. mRNA levels of NaPi-IIb in the duodenum increased from 7 to 21 d of age and then declined from 28 to 42 d of age. Both the NaPi-IIb gene expression and active phosphate absorption decreased with aging of rats (Xu et al., 2002). The change of intestinal phosphate absorption with age of chickens should be clarified. 25-Hydroxylation in the liver and 1α-hydroxylation in kidneys are necessary for conversion of vitamin D3 into 1,25-(OH)2-D3. Thus, the present study examined effects of age on mRNA expressions of 25-hydroxylase in the liver and 1α-hydroxylase in kidneys. Previous research has shown that 25-hydroxylase activity in the liver increased with age in male rats (Saarem and Pedersen, 1988). The present study showed that age quadratically affected mRNA level of 25-hydroxylase. The highest mRNA level of 25-hydroxylase in the liver was observed in 21-day-old broilers, but it declined from 28 to 42 d of age. These data suggest that age affects gene transcription of 25-hydroxylase in the liver. Among chicken organs, mRNA expression level of 1α-hydroxylase was highest in kidneys (Shanmugasundaram and Selvaraj, 2012). Kidney 1α-hydroxylase activity peaked at 8 to 18 d of age in 6- to 46-day-old turkeys (Stevens et al., 1984). The present study showed that mRNA levels of 1α-hydroxylase in chicken kidneys linearly decreased from 7 to 42 d of age. These data suggest that gene transcription of 1α-hydroxylase in kidneys of broilers declines with age. Another research on swine showed that 1α-hydroxylase activity in kidneys of newborn pigs was lower than that in adult pigs (Hosseinpour et al., 2002). Dietary NPP levels Experiment 3 was conducted to explore effects of dietary NPP levels (0.25, 0.35, 0.45, 0.55, and 0.65%) on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens. Results showed that the FI and BWG of broiler chickens from 1 to 21 d of age increased with 0.25 to 0.45% dietary NPP levels (Table 5). No significant differences in growth were observed from 0.45 to 0.65% NPP. Similar results were found in tibia mineralization in chickens at 21 d of age (Table 6). Dietary NPP levels quadratically affected mRNA expressions of 25-hydroxylase in the liver and nVDR and mVDR in the duodenum of 1- to 21-day-old broilers (Table 7). mRNA expression level of 25-hydroxylase in the liver decreased when dietary NPP levels increased from 0.25 to 0.55% but then enhanced at 0.65% NPP. The lowest mRNA level of 25-hydroxylase was observed at 0.55% NPP. Opposite results were observed in mRNA expressions of nVDR and mVDR. mRNA expression levels of nVDR and mVDR in the duodenum increased when the NPP levels increased from 0.25 to 0.55% but then declined at 0.65% NPP. The highest mRNA level was found at 0.55% NPP. A total of 0.35 to 0.55% NPP levels decreased mRNA expression level of 1α-hydroxylase in kidneys. By contrast, mRNA levels of NaPi-IIb linearly declined when dietary NPP levels increased from 0.25 to 0.65%. Table 5. Effects of dietary non-phytate phosphorus (NPP) levels on growth performance of broiler chickens from 1 to 21 d of age (experiment 3).1 NPP (%)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0.25  979c  432c  2.27a  16.5a  0.35  1059b  569b  1.86b  5.5b  0.45  1138a  667a  1.71c  5.8b  0.55  1131a  627a  1.80b,c  4.0b  0.65  1074a,b  633a  1.70c  4.0b  SEM  13  16  0.04  1.5  P-value  Linear  <0.001  <0.001  <0.001  0.011  Quadratic  <0.001  <0.001  <0.001  0.093  NPP (%)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0.25  979c  432c  2.27a  16.5a  0.35  1059b  569b  1.86b  5.5b  0.45  1138a  667a  1.71c  5.8b  0.55  1131a  627a  1.80b,c  4.0b  0.65  1074a,b  633a  1.70c  4.0b  SEM  13  16  0.04  1.5  P-value  Linear  <0.001  <0.001  <0.001  0.011  Quadratic  <0.001  <0.001  <0.001  0.093  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 12 chickens per replicate (n = 6). View Large Table 6. Effects of dietary non-phytate phosphorus (NPP) levels on tibia mineralization of broiler chickens at 21 d of age (experiment 3).1 NPP (%)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0.25  1.08c  5.10b  0.42c  39.3b  14.3b  6.32b  0.35  1.42b  5.89a  0.68b  47.0a  18.2a  8.02a  0.45  1.83a  6.15a  0.88a  47.8a  17.9a  8.36a  0.55  1.72a  6.23a  0.81a,b  46.5a  17.2a  8.25a  0.65  1.62a,b  6.00a  0.81a,b  49.5a  18.2a  8.70a  SEM  0.06  0.09  0.03  0.8  0.3  0.18  P-value  Linear  <0.001  <0.001  <0.001  <0.001  <0.001  <0.001  Quadratic  <0.001  <0.001  <0.001  0.007  <0.001  <0.001  NPP (%)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0.25  1.08c  5.10b  0.42c  39.3b  14.3b  6.32b  0.35  1.42b  5.89a  0.68b  47.0a  18.2a  8.02a  0.45  1.83a  6.15a  0.88a  47.8a  17.9a  8.36a  0.55  1.72a  6.23a  0.81a,b  46.5a  17.2a  8.25a  0.65  1.62a,b  6.00a  0.81a,b  49.5a  18.2a  8.70a  SEM  0.06  0.09  0.03  0.8  0.3  0.18  P-value  Linear  <0.001  <0.001  <0.001  <0.001  <0.001  <0.001  Quadratic  <0.001  <0.001  <0.001  0.007  <0.001  <0.001  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large Table 7. Effects of dietary non-phytate phosphorus (NPP) levels on mRNA expressions of 25-hydroxylase in the liver, 1α-hydroxylase in kidneys, and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens from 1 to 21 d of age (experiment 3).1 NPP (%)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  0.25  1.00a  1.00a-c  1.08b  1.03b  1.09a  0.35  0.94a  1.44a  1.04b  1.13b  1.03a  0.45  0.35b  0.73b,c  1.56a,b  1.08b  0.96a  0.55  0.32b  0.52c  1.96a  1.52a  0.90a  0.65  1.34a  1.06a,b  1.25b  0.94b  0.54b  SEM  0.09  0.08  0.09  0.05  0.05  P-value  Linear  0.892  0.037  0.023  0.450  <0.001  Quadratic  <0.001  0.119  0.028  0.008  0.023  NPP (%)  25-hydroxylase  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  0.25  1.00a  1.00a-c  1.08b  1.03b  1.09a  0.35  0.94a  1.44a  1.04b  1.13b  1.03a  0.45  0.35b  0.73b,c  1.56a,b  1.08b  0.96a  0.55  0.32b  0.52c  1.96a  1.52a  0.90a  0.65  1.34a  1.06a,b  1.25b  0.94b  0.54b  SEM  0.09  0.08  0.09  0.05  0.05  P-value  Linear  0.892  0.037  0.023  0.450  <0.001  Quadratic  <0.001  0.119  0.028  0.008  0.023  a–cMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large NRC (1994) has recommended that NPP requirement is 0.45% in 1- to 21-day-old broiler chickens. NPP at 0.45% was the medium level. Two lower (0.25 and 0.35%) and 2 higher levels of NPP (0.55 and 0.65%) were designed in the present study. Research has shown that a low-P diet increases mRNA levels and protein abundance of nVDR in the small intestine of chickens and rats (Meyer et al., 1992; Sriussadaporn et al., 1995). The present study showed that dietary NPP levels quadratically affected mRNA levels of nVDR. mRNA levels of nVDR increased from 0.25 to 0.45% NPP and then declined from 0.55 to 0.65% NPP. These results agreed with those reported by Nie et al. (2013), who observed that mRNA and protein expression of duodenal nVDR increased at 0.20 to 0.30% NPP and then decreased from 0.35 to 0.40% NPP in laying hens. These data indicate that nVDR expression reaches the highest levels at P requirement and then declines when dietary P far exceeds its optimal amount. mVDR was essential for regulation of phosphate uptake by 1,25-(OH)2-D3 in intestinal cells of mice (Nemere et al., 2012). The effect of dietary P levels on mRNA expression of mVDR has not been examined previously. The present study showed that dietary P quadratically affected mRNA levels of mVDR. The highest mRNA levels of mVDR were observed at 0.55% NPP and then declined at 0.65% NPP in 21-day-old broilers. These data suggest that dietary P levels regulate mVDR transcription. Low dietary P stimulated mRNA expression of NaPi-IIb and active phosphate transport in the small intestine of mice (Radanovic et al., 2005). mRNA expression level of NaPi-IIb in the distal jejunum of Holstein cows was negatively correlated with fecal P concentration (Foote et al., 2011). Further research has shown that dietary P affected NaPi-IIb mRNA expression in chickens (Yan et al., 2007; Li et al., 2012; Huber et al., 2015). Increasing dietary P linearly decreased mRNA expression levels of NaPi-IIb in the duodenum of broiler chickens (Liu et al., 2017) and laying hens (Nie et al., 2013). Similar results were noted in the present study. mRNA expression levels of NaPi-IIb linearly declined when dietary NPP increased from 0.25 to 0.65%. 25-Hydroxylase in the liver transforms vitamin D3 to 25-OH-D3. High dietary P levels decreased plasma 1,25-(OH)2-D3 concentration in laying hens and rats (Frost et al., 1991; Sriussadaporn et al., 1995), contributing to activity inhibition of 25-hydroxylase in the liver and 1α-hydroxylase in kidneys. NPP requirements for 1- to 21-day-old broiler chickens reached 0.45% (NRC, 1994) and 0.39% (Liu et al., 2017), respectively. In the present study, 0.55% NPP exceeded P requirement of chickens. mRNA levels of 25-hydroxylase declined when dietary NPP levels increased from 0.35 to 0.55%. 1α-Hydroxylase in kidneys converts 25-OH-D3 to 1,25-(OH)2-D3. The present study showed that mRNA levels of 1α-hydroxylase in kidneys decreased when NPP levels increased from 0.35 to 0.55%. These results agreed with those reported by Azam et al. (2003), who observed that low dietary P increased mRNA levels of 1α-hydroxylase in mouse kidneys. Protein abundance of 1α-hydroxylase in kidneys of young rats also increased when they were fed with low-P diets (Cheung et al., 2002). These data suggest that dietary P levels transcriptionally regulate gene expression of 1α-hydroxylase in kidneys. However, 0.65% NPP increased mRNA levels of 1α-hydroxylase compared with that of birds fed diets with 0.55% NPP. The cause of this finding should be further clarified. 25-OH-D3 Experiment 4 was conducted to examine effects of 25-OH-D3 (0 and 12.5 μg/kg) on mRNA expressions of 1α-hydroxylase in kidneys and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens. Results showed that supplementation of 12.5 μg/kg of 25-OH-D3 improved growth performance and tibia mineralization and decreased mortality of chickens from 1 to 14 d of age (Tables 8 and 9). 25-OH-D3 also increased mRNA expression level of 1α-hydroxylase in kidneys and those of nVDR, mVDR, and NaPi-IIb in the duodenum of 1- to 14-day-old broiler chickens compared with birds fed the diet without 25-OH-D3 (Table 10). Table 8. Effects of 25-OH-D3 on growth performance of broiler chickens from 1 to 14 d of age (experiment 4).1 25-OH-D3 (μg/kg)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0  392b  229b  1.71  8.3a  12.5  451a  267a  1.69  1.7b  SEM  12  9  0.04  1.5  P-value  0.008  0.033  0.748  0.018  25-OH-D3 (μg/kg)  Feed intake (g)  Weight gain (g)  Feed conversion ratio (g/g)  Mortality (%)  0  392b  229b  1.71  8.3a  12.5  451a  267a  1.69  1.7b  SEM  12  9  0.04  1.5  P-value  0.008  0.033  0.748  0.018  a–bMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 12 chickens per replicate (n = 6). View Large Table 9. Effects of 25-OH-D3 on tibia mineralization of broiler chickens at 14 d of age (experiment 4).1 25-OH-D3 (μg/kg)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0  0.45b  4.46b  0.19b  41.21b  15.18b  7.36b  12.5  0.67a  4.89a  0.31a  46.43a  16.79a  8.13a  SEM  0.04  0.08  0.02  0.91  0.30  0.19  P-value  <0.001  0.004  <0.001  <0.001  0.001  0.038  25-OH-D3 (μg/kg)  Weight (g)  Length (cm)  Ash (g)  Ash (%)  Calcium (%)  Phosphorus (%)  0  0.45b  4.46b  0.19b  41.21b  15.18b  7.36b  12.5  0.67a  4.89a  0.31a  46.43a  16.79a  8.13a  SEM  0.04  0.08  0.02  0.91  0.30  0.19  P-value  <0.001  0.004  <0.001  <0.001  0.001  0.038  a–bMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large Table 10. Effects of 25-OH-D3 on mRNA expressions of 1α-hydroxylase in kidneys and nVDR, mVDR, and NaPi-IIb in the duodenum of broiler chickens from 1 to 14 d of age (experiment 4).1 25-OH-D3  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  (μg/kg)          0  1.03b  1.05b  1.01b  1.00b  12.5  1.67a  1.72a  1.70a  1.86a  SEM  0.15  0.12  0.15  0.18  P-value  0.029  0.001  0.012  0.006  25-OH-D3  1α-hydroxylase  nVDR  mVDR  NaPi-IIb  (μg/kg)          0  1.03b  1.05b  1.01b  1.00b  12.5  1.67a  1.72a  1.70a  1.86a  SEM  0.15  0.12  0.15  0.18  P-value  0.029  0.001  0.012  0.006  a–bMeans in the same column without a common superscript differ (P < 0.05). 1Values are means of 6 replicates of 2 chickens per replicate (n = 6). View Large Research has shown the absence of differences in body weight gain, feed intake, bone ash content, and tibial dyschondroplasia severity in broilers fed diets with 12.5 to 100 μg/kg of 25-OH-D3 (Fritts and Waldroup, 2003). Our recent research has shown that 12.5 μg/kg of 25-OH-D3 is sufficient for growth performance and bone mineralization in 1- to 42-day-old broilers (Chen et al., 2017). Thus, the present study evaluated effects of 12.5 μg/kg of 25-OH-D3 on mRNA expressions of phosphate absorption genes. 25-OH-D3 was hydroxylated by 1α-hydroxylase in kidneys to its active form 1,25-(OH)2-D3 (Fraser and Kodicek, 1973). The present study showed that addition of 12.5 μg/kg of 25-OH-D3 increased mRNA expression level of 1α-hydroxylase in kidneys of birds. These data suggest that 25-OH-D3 promotes 1α-hydroxylase transcription. When 25-OH-D3 was hydroxylated and transformed to 1,25-(OH)2-D3, the latter binded to nVDR to activate the MAPK pathway in intestinal cells of chickens (Boland and Norman, 1998). Two d after injection of 1,25-(OH)2-D3, mRNA expression levels of nVDR in the ileum of mice increased (Chow et al., 2013). In the present study, 25-OH-D3 also up-regulated nVDR mRNA levels in chickens. After binding to mVDR, 1,25-(OH)2-D3 activated the PKC signal pathway in the small intestine of chickens (Nemere et al., 2004). PKCα and PKCβ participated in regulation of phosphate uptake by 1,25-(OH)2-D3 in chickens (Tunsophon and Nemere, 2010). Protein abundance of mVDR in the duodenum of chickens fed diets with vitamin D3 was lower than in those fed diets without vitamin D3 (Nemere and Campbell, 2000). Opposite results were observed in the present study. 25-OH-D3 up-regulated mRNA expression levels of mVDR in the duodenum of broilers. 1,25-(OH)2-D3 treatment increased mRNA expression levels of NaPi-IIb in 14-day-old rats but exerted no effect on mRNA expression in 90-day-old rats (Xu et al., 2002). 1α-OH-D3 also elevated NaPi-IIb mRNA levels in the jejunum and ileum of 21-day-old broilers (Han et al., 2009). These data suggest that 1,25-(OH)2-D3 or 1α-OH-D3 regulates NaPi-IIb gene transcription in young animals. The present study showed that 25-OH-D3 increased NaPi-IIb mRNA level in 14-day-old chickens, thereby promoting active phosphate absorption in the duodenum of broilers. In summary, the highest mRNA expression levels of nVDR and NaPi-IIb were observed in the duodenum of 21-day-old broilers, followed the jejunum, and then the ileum. By contrast, no difference in mVDR mRNA expression level was observed among the 3 intestine segments. Age quadratically affected mRNA expression levels of nVDR, mVDR, and NaPi-IIb in the duodenum and 25-hydroxylase in the liver of 7- to 42-day-old broilers, with the highest mRNA levels observed at 21d of age. By contrast, age linearly decreased mRNA expression levels of 1α-hydroxylase in kidneys. Dietary NPP levels quadratically affected mRNA levels of nVDR, mVDR, and 25-hydroxylase. The highest mRNA expression levels of nVDR and mVDR and lowest mRNA level of 25-hydroxylase were observed at 0.55% NPP. mRNA levels of NaPi-IIb linearly declined when dietary NPP levels increased from 0.25 to 0.65%. Addition of 12.5 μg/kg of 25-OH-D3 increased mRNA expression level of 1α-hydroxylase in kidneys and those of nVDR, mVDR, and NaPi-IIb in the duodenum compared with those of birds fed diets without 25-OH-D3. These data indicate that mRNA expressions of nVDR and NaPi-IIb are highest in the duodenum and the greatest mRNA levles of nVDR, mVDR, and NaPi-IIb are observed at 21 d of age. Dietary NPP levels quadratically increase mRNA expressions of nVDR and mVDR but linearly decrease NaPi-IIb mRNA level. 25-OH-D3 up-regulates the above gene transcription. Acknowledgements This work was supported by the National Natural Science Foundation of China (31101732 and U1704107), the Innovation Scientists and Technicians Troop Construction Projects of Henan Province (C20130058), and the Foundation of the Education Department of Henan Province (16A230003). REFERENCES Azam N., Zhang M. Y., Wang X., Tenenhouse H. S., Portale A. A.. 2003. Disordered regulation of renal 25-hydroxyvitamin D-1α-hydroxylase gene expression by phosphorus in X-linked hypophosphatemic (Hyp) mice. Endocrinology  144: 3463– 3468. Google Scholar CrossRef Search ADS PubMed  Biehl R. R., Baker D. H.. 1997. Utilization of phytate and nonphytate phosphorus in chicks as affected by source and amount of vitamin D3. J. Anim. Sci.  75: 2986– 2993. Boland A. R. D., Norman A. W.. 1998. 1α,25(OH)2-vitamin D3 signaling in chick enterocytes: enhancement of tyrosine phosphorylation and rapid stimulation of mitogen-activated protein (MAP) kinase. J. Cell. Biochem.  69: 470– 482. Google Scholar CrossRef Search ADS PubMed  Chen G. H., Zhang J. L., Wang J. G., Zhang N., Qu H. X., Wang Z. X., Yan Y. F., Han J. C.. 2017. Requirement of 25-hydroxycholecalciferol for broilers. Chinese J. Anim. Nutr.  29: 2335– 2347. Cheung P. Y., Lai W. P., Lau H. Y., Lo S. C., Wong M. S.. 2002. Acute and chronic effect of dietary phosphorus restriction on protein expression in young rat renal proximal tubules. Proteomics  2: 1211– 1219. Google Scholar CrossRef Search ADS PubMed  Chow E. C., Quach H. P., Vieth R., Pang K. S.. 2013. Temporal changes in tissue 1α,25-dihydroxyvitamin D3, vitamin D receptor target genes, and calcium and PTH levels after 1,25(OH)2D3 treatment in mice. Am. J. Physiol. Endocrinol. Metab.  304: 977– 989. Google Scholar CrossRef Search ADS   Foote A. P., Lambert B. D., Brady J. A., Muir J. P.. 2011. Phosphate transporter expression in Holstein cows. J. Dairy Sci.  94: 1913– 1916. Google Scholar CrossRef Search ADS PubMed  Fraser D. R., Kodicek E.. 1973. Regulation of 25-hydroxycholecalciferol-1-hydroxylase activity in kidney by parathyroid hormone. Nat. New Biol.  241: 163– 166. Google Scholar CrossRef Search ADS PubMed  Fritts C. A., Waldroup P. W.. 2003. Effect of source and level of vitamin D on live performance and bone development in growing broilers. J. Appl. Poult. Res.  12: 45– 52. Google Scholar CrossRef Search ADS   Frost T. J., Roland D. A., Marple D. N.. 1991. The effects of various dietary phosphorus levels on the circadian patterns of plasma 1,25-dihydroxycholecalciferol, total calcium, ionized calcium, and phosphorus in laying hens. Poult. Sci.  70: 1564– 1570. Google Scholar CrossRef Search ADS PubMed  Giral H., Caldas Y., Sutherland E., Wilson P., Breusegem S., Barry N., Blaine J., Jiang T., Wang X. X., Levi M.. 2009. Regulation of rat intestinal Na-dependent phosphate transporters by dietary phosphate. Am. J. Physiol. Renal. Physiol.  297: 1466– 1475. Google Scholar CrossRef Search ADS   Gonzalez Pardo V., Boland R., de Boland A. R.. 2008. Vitamin D receptor levels and binding are reduced in aged rat intestinal subcellular fractions. Biogerontology  9: 109– 118. Google Scholar CrossRef Search ADS PubMed  Han J. C., Yang X. D., Zhang T., Li H., Li W. L., Zhang Z. Y., Yao J. H.. 2009. Effects of 1α-hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-one-day-old broilers. Poult. Sci.  88: 323– 329. Google Scholar CrossRef Search ADS PubMed  Hosseinpour F., Norlin M., Wikvall K.. 2002. Kidney microsomal 25- and 1alpha-hydroxylase in vitamin D metabolism: Catalytic properties, molecular cloning, cellular localization and expression during development. Biochim. Biophys. Acta.  1580: 133– 144. Google Scholar CrossRef Search ADS PubMed  Huber K., Zeller E., Rodehutscord M.. 2015. Modulation of small intestinal phosphate transporter by dietary supplements of mineral phosphorus and phytase in broilers. Poult. Sci.  94: 1009– 1017. Google Scholar CrossRef Search ADS PubMed  Larsson B., Nemere I.. 2003. Effect of growth and maturation on membrane-initiated actions of 1,25-dihydroxyvitamin D3. I. Calcium transport, receptor kinetics, and signal transduction in intestine of male chickens. Endocrinology  144: 1726– 1735. Google Scholar CrossRef Search ADS PubMed  Li J., Yuan J., Guo Y., Sun Q., Hu X.. 2012. The influence of dietary calcium and phosphorus imbalance on intestinal NaPi-IIb and calbindin mRNA expression and tibia parameters of broilers. Asian-Australas. J. Anim. Sci.  25: 552– 558. Google Scholar CrossRef Search ADS PubMed  Li J., Yuan J., Miao Z., Guo Y.. 2017. Effects of age on intestinal phosphate transport and biochemical values of broiler chickens. Asian-Australas. J. Anim. Sci.  30: 221– 228. Google Scholar CrossRef Search ADS PubMed  Li J., Yuan J., Guo Y., Yang Y., Bun S., Hu X., Yi D.. 2011. The effect of dietary nutrient density on growth performance, physiological parameters, and small intestinal type IIb sodium phosphate co-transporter expression in broilers. J. Anim. Sci. Biotech.  2: 102– 110. Liesegang A., Singer K., Boos A.. 2008. Vitamin D receptor amounts across different segments of the gastrointestinal tract in Brown Swiss and Holstein Frisean cows of different age. J. Anim. Physiol. Anim. Nutr.  92: 316– 323. Google Scholar CrossRef Search ADS   Liu S. B., Hu Y. X., Liao X. D., Lu L., Li S. F., Zhang L. Y., Tan H. Z., Yang L., Suo H. Q., Luo X. G.. 2016. Kinetics of phosphorus absorption in ligated small intestinal segments of broilers. J. Anim. Sci.  94: 3312– 3320. Google Scholar CrossRef Search ADS PubMed  Liu S. B., Liao X. D., Lu L., Li S. F., Wang L., Zhang L. Y., Jiang Y., Luo X. G.. 2017. Dietary non-phytate phosphorus requirement of broilers fed a conventional corn-soybean meal diet from 1 to 21 d of age. Poult. Sci.  96: 151– 159. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −$$\vartriangle$$$$\vartriangle$$Ct method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Marks J., Srai S. K., Biber J., Murer H., Unwin R. J., Debnam E. S.. 2006. Intestinal phosphate absorption and the effect of vitamin D: A comparison of rats with mice. Exp. Physiol.  91: 531– 537. Google Scholar CrossRef Search ADS PubMed  Meyer J., Fullmer C. S., Wasserman R. H., Komm B. S., Haussler M. R.. 1992. Dietary restriction of calcium, phosphorus, and vitamin D elicits differential regulation of the mRNAs for avian intestinal calbindin-D28k and the 1,25-dihydroxyvitamin D3 receptor. J. Bone Miner. Res.  7: 441– 448. Google Scholar CrossRef Search ADS PubMed  National Research Council. 1994. Nutrient Requirements of Poultry . 9th rev. ed.   Natl. Acad. Press, Washington, DC. Nemere I., Campbell K.. 2000. Immunochemical studies on the putative plasmalemmal receptor for 1,25-dihydroxyvitamin D3. III. Vitamin D status. Steroids  65: 451– 457. Google Scholar CrossRef Search ADS PubMed  Nemere I., Larsson D., Sundell K.. 2000. A specific binding moiety for 1,25-dihydroxyvitamin D3 in basal lateral membranes of carp enterocytes. Am. J. Physiol. Endocrinol. Metab.  279: 614– 621. Google Scholar CrossRef Search ADS   Nemere I., Farach-Carson M. C., Rohe B., Sterling T. M., Norman A. W., Boyan B. D., Safford S. E.. 2004. Ribozyme knockdown functionally links a 1,25(OH)2D3 membrane binding protein (1,25D3-MARRS) and phosphate uptake in intestinal cells. Proc. Natl. Acad. Sci. USA.  101: 7392– 7397. Google Scholar CrossRef Search ADS   Nemere I., Garcia-Garbi N., Hämmerling G. J., Winger Q.. 2012. Intestinal cell phosphate uptake and the targeted knockout of the 1,25D3-MARRS receptor/PDIA3/ERp57. Endocrinology  153: 1609– 1615. Nie W., Yang Y., Yuan J., Wang Z., Guo Y.. 2013. Effect of dietary nonphytate phosphorus on laying performance and small intestinal epithelial phosphate transporter expression in Dwarf pink-shell laying hens. J. Anim. Sci. Biotechnol.  4: 34. Google Scholar CrossRef Search ADS PubMed  Radanovic T., Wagner C. A., Murer H., Biber J.. 2005. Regulation of intestinal phosphate transport. I. Segmental expression and adaptation to low-Pi diet of the type IIb Na+-Pi cotransporter in mouse small intestine. Am. J. Physiol. Gastrointest. Liver Physiol.  288: 496– 500. Google Scholar CrossRef Search ADS   Riner K., Boos A., Hässig M., Liesegang A.. 2008. Vitamin D receptor distribution in intestines of domesticated sheep Ovis ammon f. aries. J. Morphol.  269: 144– 152. Google Scholar CrossRef Search ADS PubMed  Saarem K., Pedersen J. I.. 1988. Effect of age, gonadectomy and hypophysectomy on mitochondrial hydroxylation of vitamin D3 (cholecalciferol) and of 5β-cholestane-3α,7α,12α-triol in female and male rat liver. Biochem. J.  251: 475– 481. Google Scholar CrossRef Search ADS PubMed  SAS Institute. 2002. SAS User's Guide . Version 9 ed. SAS Inst. Inc., Cary, NC, USA. Shanmugasundaram R., Selvaraj R. K.. 2012. Vitamin D-1α-hydroxylase and vitamin D-24-hydroxylase mRNA studies in chickens. Poult. Sci.  91: 1819– 1824. Google Scholar CrossRef Search ADS PubMed  Sidler-Lauff K., Boos A., Kraenzlin M., Liesegang A.. 2010. Influence of different calcium supplies and a single vitamin D injection on vitamin D receptor andcalbindin D9k immunoreactivities in the gastrointestinal tract of goat kids. J. Anim. Sci.  88: 3598– 3610. Google Scholar CrossRef Search ADS PubMed  Sriussadaporn S., Wong M. S., Pike J. W., Favus M. J.. 1995. Tissue specificity and mechanism of vitamin D receptor up-regulation during dietary phosphorus restriction in the rat. J. Bone Miner. Res.  10: 271– 280. Google Scholar CrossRef Search ADS PubMed  Stevens V. I., Blair R., Salmon R. E.. 1984. Influence of maternal vitamin D3 carry-over on kidney 25-hydroxyvitamin D3-1-hydroxylase activity of poults. Poult. Sci.  63: 765– 774. Google Scholar CrossRef Search ADS PubMed  Tudpor K., Teerapornpuntakit J., Jantarajit W., Krishnamra N., Charoenphandhu N.. 2008. 1,25-dihydroxyvitamin D3 rapidly stimulates the solvent drag-induced paracellular calcium transport in the duodenum of female rats. J. Physiol. Sci.  58: 297– 307. Google Scholar CrossRef Search ADS PubMed  Tunsophon S., Nemere I.. 2010. Protein kinase C isotypes in signal transduction for the 1,25D3-MARRS receptor (ERp57/PDIA3) in steroid hormone-stimulated phosphate uptake. Steroids  75: 307– 313. Google Scholar CrossRef Search ADS PubMed  Xu H., Bai L., Collins J. F., Ghishan F. K.. 2002. Age-dependent regulation of rat intestinal type IIb sodium phosphate cotransporter by 1,25-(OH)2 vitamin D3. Am. J. Physiol. Cell Physiol. 282: 487– 493. Yan F., Angel R., Ashwell C. M.. 2007. Characterization of the chicken small intestine type IIb sodium phosphate cotransporter. Poult. Sci.  86: 67– 76. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from
Google Scholar,
PubMed
Create lists to
organize your research
Export lists, citations
Read DeepDyve articles
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off