A Molecular Survey of Rickettsias in Shelter Dogs and Distribution of Rhipicephalus sanguineus (Acari: Ixodidae) sensu lato in Southeast Turkey

A Molecular Survey of Rickettsias in Shelter Dogs and Distribution of Rhipicephalus sanguineus... Abstract Canine tick-borne pathogens are the source of emerging diseases and have important zoonotic relevance. Dogs play a major role in the transmission of several zoonotic tick-borne pathogens, as reservoirs and/or sentinels. To simultaneously detect Anaplasma and Ehrlichia species, a reverse line blot assay was conducted on 219 blood samples collected from autochthonous asymptomatic shelter dogs. One hundred and three (47.0%, CI 40.3–53.9) dogs were positive for one or both rickettsial pathogens. Seventy-one (32.4%, CI 26.3–39.0) dogs were infected with Anaplasma platys and 23 (10.5%, CI 6.8–15.3) with Ehrlichia canis. Concurrent infection with A. platys and E. canis was detected in nine (4.1%, CI 1.9–7.6) dogs. Partial sequences of the 16S ribosomal RNA gene shared 100% identity with the corresponding published sequences for A. platys and E. canis. Infection with Anaplasma phagocytophilum was not detected in the examined dogs. In total, 1018 (range 1–70, mean intensity 13.1, mean abundance 4.6) Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) sensu lato ticks (45.7% nymphs, 54.3% adults) were collected from the dogs. There was no significant association between Anaplasma/Ehrlichia infection and dog sex or age, but a significant correlation was found between rickettsia infection and presence of R. sanguineus. Improved tick control strategies to reduce the risk of these pathogens spreading among dogs and humans are needed in the region. Anaplasma platys, Ehrlichia canis, Rhipicephalus sanguineus sensu lato, dog, Reverse line blot Tick-borne disease is an emerging cosmopolitan problem associated with sub-clinical infections or serious disease in hosts (Nicholson et al. 2010, Dantas-Torres and Otranto 2016). Anaplasmosis and ehrlichiosis are two important tick-borne diseases of dogs caused by a bacterium of the family Anaplasmataceae (Little 2010). Some are particularly significant due to their zoonotic potential because companion animals can be reservoirs for human tick-borne infectious agents (Colwell et al. 2011, Dantas-Torres and Otranto 2015). Anaplasma platys, Anaplasma phagocytophilum, and Ehrlichia canis are the main Anaplasmataceae detected and are associated with acute or non-clinical canine infections in many countries (Little 2010). A. phagocytophilum is the pathogen of human granulocytic anaplasmosis (Bakken and Dumler 2015). A. platys and E. canis are also recognised as emerging human pathogens (Perez et al. 2006, Arraga-Alvarado et al. 2014, Breitschwerdt et al. 2014). A. phagocytophilum is associated with the occurrence of Ixodes ricinus, a common tick species in European countries (Aktas et al. 2010, Estrada-Pena et al. 2013). A. platys and E. canis are transmitted by Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) (Ramos et al. 2014, Moraes-Filho et al. 2015). Apart from a few reports of the occurrence of canine anaplasmosis and ehrlichiosis (Ulutas et al. 2007, Aktas 2014, Aktas et al. 2015, Cetinkaya et al. 2016), information about tick-borne rickettsia in Turkey remains limited. This work aimed to assess the occurrence and frequency of canine rickettsias in dogs from a municipal shelter in the Diyarbakır Province of Turkey and to identify ixodid ticks found on dogs in the region. Materials and Methods In total, 219 dogs from a shelter located in Diyarbakır Province (37° 55′ N, 40° 69 12′ E) of south-eastern Turkey were included in the study. The province has a typical continental climate with extremely hot summers, cold winters, and little precipitation. The mean annual rainfall and temperature are 630 mm and 22.5° C, respectively. Before being taken to the shelter, the animals had freely roamed urban and rural areas and apparently did not receive any tick or flea control treatment. On the basis of behaviour and appearance, the dogs were healthy. Sampling was performed from May to June 2015. The sampled dogs were divided into categories based on sex, age, and presence or absence of tick infestation. Age of the dogs was estimated from body size and teeth (6 mo–1 yr and 1–7 yr). Blood samples (3 ml) were collected in EDTA-tubes and stored at −20°C until processing. Each dog was examined for ticks, with attention paid to the ears, neck, inguinal region, and under the tail. In total, 1018 ticks were removed, and identified following Estrade-Peña et al. (2004). Prevalence and intensity of the tick infestations were estimated (Bush et al. 1997). Genomic DNA was extracted with a QIAamp DNA Blood Minikit (Qiagen, Hilden, Germany) from the collected 219 blood samples. A nested polymerase chain reaction (PCR) was utilized using universal primers with described protocols indicated in Table 1. Nested PCR products were hybridized on the reverse line blot (RLB) membrane. Details of primer pairs and probes are provided in Table 1. PCR was performed as previously described (Aktas et al. 2015). PCR products were electrophoresed in 1.5% agarose gel. DNA from E. canis, A. phagocytophilum, and A. platys, previously detected by RLB and DNA sequencing (GenBank accession nos. KP745632, KP745629, KF038320, respectively), were used as positive controls. RNase-free water and canine genomic DNA from blood of an uninfected dog were used as negative controls. Five microliter of PCR product was electrophorezed, and the remaining products were stored at +4°C until used in the RLB. Table 1. Primers and probes used in this study Primer and probe specificity  Nucleotid sequence (5′–3′)  Target gene  Primer name  Product size  Reference  Primer  Anaplasma spp., Ehrlichia spp.  First reaction  TGATCCTGGCTCAGAACGAACG TACCTTGTTACGACTT  16S rRNA  EC12A EC9  1462  Chen et al. (1994)    Second reaction  GGAATTCAGAGTTGGATCMTGGYTCAG Biotin-CGGGATCCCGAGTTTGCCGGGACTTYTTCT  16S rRNA  16S8FE BGA1B-new  492–498  Bekker et al. (2002)   Probe  Ehrlichia/Anaplasma catch-all  AmMC6-GGGGGAAAGATTTATCGCTA        Bekker et al.(2002)   Anaplasma/Ehrlichia  AmMC6-TTATCGCTATTAGATGAGCC        Schouls et al. (1999)   E. canis  AmMC6-TCTGGCTATAGGAAATTGTTA        Schouls et al. (1999)   A. platys  AmMC6-GATTTTTGTCGTAGCTTGCTATG        Anda et al. (2006)   A. phagocytophilum 1  AmMC6-TTGCTATAAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 3  AmMC6-TTGCTATGAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 5  AmMC6-TTGCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum 7  AmMC6-TTGCTATAGAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-HGE  AmMC6-GCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-D- HGE  AmMC6-GCTATGAAGAATAGTTAGTG        Schouls et al.(1999)   Primer and probe specificity  Nucleotid sequence (5′–3′)  Target gene  Primer name  Product size  Reference  Primer  Anaplasma spp., Ehrlichia spp.  First reaction  TGATCCTGGCTCAGAACGAACG TACCTTGTTACGACTT  16S rRNA  EC12A EC9  1462  Chen et al. (1994)    Second reaction  GGAATTCAGAGTTGGATCMTGGYTCAG Biotin-CGGGATCCCGAGTTTGCCGGGACTTYTTCT  16S rRNA  16S8FE BGA1B-new  492–498  Bekker et al. (2002)   Probe  Ehrlichia/Anaplasma catch-all  AmMC6-GGGGGAAAGATTTATCGCTA        Bekker et al.(2002)   Anaplasma/Ehrlichia  AmMC6-TTATCGCTATTAGATGAGCC        Schouls et al. (1999)   E. canis  AmMC6-TCTGGCTATAGGAAATTGTTA        Schouls et al. (1999)   A. platys  AmMC6-GATTTTTGTCGTAGCTTGCTATG        Anda et al. (2006)   A. phagocytophilum 1  AmMC6-TTGCTATAAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 3  AmMC6-TTGCTATGAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 5  AmMC6-TTGCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum 7  AmMC6-TTGCTATAGAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-HGE  AmMC6-GCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-D- HGE  AmMC6-GCTATGAAGAATAGTTAGTG        Schouls et al.(1999)   AmMC6, C6 amino linker linked to the 5′. View Large RLB assay was performed on the nested PCR amplicons as previously reported (Aktas and Ozubek 2015a,b; Aktas et al. 2015). To confirm PCR results, two amplicons comprising A. platys and E. canis were sequenced and comparative sequence analyses were performed. Shortly after, PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen GmbH) by following the manufacturer’s instructions and sequenced by the commercial company. They were manually edited by Chromas-Lite (www.technelysium.com.au). The prevalence and 95% binomial exact CIs were calculated using Sourceforge net (http://sampsize.sourceforge.net/iface). The data obtained from dogs were compared by Pearson chi-square tests using SPSS 15.00 software for correlated proportions. Association of rickettsial pathogens with sex, age, and presence of tick infestation was assessed. P-values ≤0.05 were considered significant. This study was carried out according to the regulations on animal welfare issued by the Turkish legislation for the protection of animals (Animal Experiment Ethics Committee, 71156/2009). Results Amplification using primers 16S8FE/BGA1B-new yielded PCR products of the expected size (~500 bp) from positive control samples. The PCR products obtained from both positive controls and field samples were hybridized and observed for signal to catch all, genus- and species-specific oligonucleotide probes in RLB (Table 1). All positive products (positive control and field samples) produced a signal. Frequencies of single and combined A. paltys and E. canis in dogs relative to sex, age, and presence of tick infestation are shown in Table 2. About 103 (47.0%, CI 40.3–53.9) out of 219 blood samples were positive by the 16S rRNA PCR for Anaplasmataceae. Seventy-one (32.4%, CI 26.3–39.0) and 23 (10.5%, CI 6.8–15.3) dogs were also found positive for A. platys and E. canis, respectively in RLB assay. Co-existence of A. platys and E. canis was detected in nine (4.1%, CI 1.9–7.6) dogs. No dog was positive for A. phagocytophilum. Table 2. Frequency (%), 95% CI (lower, upper intervals) and association of canine tick-borne rickettsial pathogens detected by RLB relative to sex, age, and presence or absence of tick infestation (Rhipicephalus sanguineus sensu lato) Variables  Sample  Anaplasma/Ehrlichia (%, 95% CI)  P-value  Identified pathogen  Co-infection (%, 95% CI)  Single infection (%, 95% CI)  A. platys  E. canis  A. platys + E. canis    219  103 (47.0, 40.3–53.9)    71 (32.4, 26.3–39.0)  23 (10.5, 6.8–15.3)  9 (4.1, 1.9–7.6)  Sex   Female  109  55 (50.4, 40.7–60.2)  > 0.05  39 (35.8, 26.8–45.5)  11 (10.1, 5.1–17.3)  5 (4.6, 1.5–10.4)   Male  110  48 (43.6, 34.2–53.4)  32 (29.1, 20.8–38.5)  12 (10.9, 5.8–18.3)  4 (3.6, 1.0–9.0)  Age   Juvenile (6–12 mo)  69  27 (39.1, 27.6–51.6)  > 0.05  16 (23.2, 13.9–34.9)  8 (11.6, 5.1–21.6)  3 (4.3, 0.9–12.2)   Adult (1–7 yr)  150  76 (50.7, 42.4–58.9)  55 (36.7, 28.9–44.9)  15 (10, 5.7–15.9)  6 (4, 1.5–8.5)  Presence of ticks   Absent  141  48 (34.0, 26.3–42.5)  < 0.05  33 (23.4, 16.7–31.3)  12 (8.5, 4.5–14.4)  3 (2.1, 0.4–6.1)   Present  78  55 (70.5, 59.1–80.3)  38 (48.7, 37.2–60.3)  11 (14.1, 7.2–23.8)  6 (7.7, 2.9–16.0)  Variables  Sample  Anaplasma/Ehrlichia (%, 95% CI)  P-value  Identified pathogen  Co-infection (%, 95% CI)  Single infection (%, 95% CI)  A. platys  E. canis  A. platys + E. canis    219  103 (47.0, 40.3–53.9)    71 (32.4, 26.3–39.0)  23 (10.5, 6.8–15.3)  9 (4.1, 1.9–7.6)  Sex   Female  109  55 (50.4, 40.7–60.2)  > 0.05  39 (35.8, 26.8–45.5)  11 (10.1, 5.1–17.3)  5 (4.6, 1.5–10.4)   Male  110  48 (43.6, 34.2–53.4)  32 (29.1, 20.8–38.5)  12 (10.9, 5.8–18.3)  4 (3.6, 1.0–9.0)  Age   Juvenile (6–12 mo)  69  27 (39.1, 27.6–51.6)  > 0.05  16 (23.2, 13.9–34.9)  8 (11.6, 5.1–21.6)  3 (4.3, 0.9–12.2)   Adult (1–7 yr)  150  76 (50.7, 42.4–58.9)  55 (36.7, 28.9–44.9)  15 (10, 5.7–15.9)  6 (4, 1.5–8.5)  Presence of ticks   Absent  141  48 (34.0, 26.3–42.5)  < 0.05  33 (23.4, 16.7–31.3)  12 (8.5, 4.5–14.4)  3 (2.1, 0.4–6.1)   Present  78  55 (70.5, 59.1–80.3)  38 (48.7, 37.2–60.3)  11 (14.1, 7.2–23.8)  6 (7.7, 2.9–16.0)  View Large No significant differences were observed in tick-borne pathogen positivity of male and female dogs (P > 0.05). The difference in infection rate of young and adult dogs was also not significant (P > 0.05). Among the 103 PCR-positive dogs, 55 (70.5%, CI 59.1–80.3) were infested with R. sanguineus s.l. (45.7% nymphs, 54.3% adults). Presence of this tick was significantly associated with canine rickettsia infection (P < 0.05). Seventy-eight out of 219 (35.6%) examined dogs carried at least one tick. Abundance (mean number of ticks per dog) and intensity (mean number of ticks per infested dog) were 4.64 and 13.05, respectively. The number of ticks per animal ranged from 1 to 70. All ticks were identified as R. sanguineus s.l. The partial sequences of the 16S rRNA genes determined for A. platys (1389 bp) and E. canis (1380 bp) were deposited in the EMBL/GenBank databases under accession numbers KY594914 and KY594915, respectively. A BLAST search showed the obtained sequences to be 100% identical to the corresponding published sequences for A. platys strain Okinawa 1 from Japan (AF536828) and E. canis isolate TrKysEcan3 from Turkey (KJ513197). Discussion We described here a molecular survey detecting canine tick-borne rickettsial agents and found shelter dogs in Diyarbakır Province, Turkey to be exposed to A. platys and E. canis. Both pathogens from dogs and ticks were previously reported in Turkey (Ulutas et al. 2007, Sen et al. 2011, Aktas 2014). However, a high infection frequency (47.0%, CI 40.3–53.9) was detected compared with previous reports in Turkey of 14.5% (Duzlu et al. 2014), 5.4% (Aktas et al. 2015), and 6% (Çetinkaya et al. 2016), 6.4% in Nigeria (Dahmani et al. 2015), 1.9% in Portugal (Maia et al. 2015), 3.7% in Iran (Maazi et al. 2014), 14.5% in Algeria (Bessas et al. 2016), and 6.5% in India (Abd Rani et al. 2011). The differences in frequency may be related to geographic region, environmental conditions, sample size, sampling periods, or diagnostic methods, as well as to the primary characteristics of the targeted dog population such as outdoor, indoor, shelter, stray, or pet (Inokuma et al. 2006, Volgina et al. 2013, Dahmani et al. 2015, Cetinkaya et al. 2016). High abundance and intensity of R. sanguineus s.l., a vector of A. platys and E. canis (Dantas-Torres 2008, 2010, Ramos et al. 2014, Dantas-Torres and Otranto 2015), might explain the higher positive rate of these pathogens in this study. Probes specific for A. phagocytophilum were included in our study, but no positive signals were obtained by PCR. This result is not surprising, as A. phagocytophilum is transmitted by Ixodes (Silaghi et al. 2012), which has never been reported on domestic animals, including dogs, in the studied area (Aktas et al. 2006; 2013). Similar findings have been reported in a study conducted in Maio Island of Cape Verde, where the only hard tick reported is R. sanguineus s.l. (Lauzi et al. 2016). R. sanguineus is common in the Mediterranean countries. This tick species is associated with shelters such as kennels, gardens, or cracks in walls of human habitations (Gray et al. 2013). The abundance of infestation by R. sanguineus in dogs can vary geographically and seasonally, as well as depending upon the application of acaricides (Dantas-Torres 2010, Lorusso et al. 2010, Gray et al. 2013). In this study, the occurrence of R. sanguineus s.l. confirms a previous report identifying the majority of ticks found on dogs as this species (Aktas et al. 2013). Tick-transmitted infections generally involve multiple pathogens (De Tommasi et al. 2013, Sainz et al. 2015). Reverse line blotting is a powerful and practical tool allowing simultaneous detection of tick-borne pathogens (Schouls et al. 1999, Bekker et al. 2002). Our survey revealed nine dogs (4.1%, CI 1.9–7.6) presenting co-infections with A. platys and E. canis (Table 2). Similar findings have been reported in a previous study in Turkey (Pasa et al. 2009). Co-infection was also reported by Yisaschar-Mekuzas et al. (2013), Aktas et al. (2015), and Aktas and Ozubek (2015b). Our survey found no significant differences in the prevalence of bacteria in adult and young dogs (P > 0.05), or in dogs of different genders (P > 0.05). These results agree with findings that the frequency of infection is not related to sex and age (Santos et al. 2013, Maazi et al. 2014, Dahmani et al. 2015, Lauzi et al. 2016, Maia et al. 2015), suggesting that tick intensity and geographic distribution affect the prevalence of pathogens in all dogs, regardless of sex or age. A correlation between the occurrence of A. platys and E. canis and the presence of R. sanguineus s.l. was observed (P < 0.05), consistent with a survey conducted on dogs in which 155/286 samples showed antibodies reactive to E. canis. Among the seropositive dogs, 58% had ticks at the time of sampling (M’ghirbi et al. 2009). In Sudan, the frequency of E. canis and A. platys was found to be 80.8 and 24.4%, respectively, and R. sanguineus was found on all dogs (Inokuma et al. 2006). On the contrary, in Algeria, frequency of E. canis and A. platys was found to be 6.3% (7/110) and 5.4% (4/110), respectively. The low prevalence was attributed to the fact that the survey was carried out in late winter and early spring, periods of low tick activity (Dahmani et al. 2015). These results suggest that infestation by ticks is a main determinant of tick-borne rickettsial infection rates. E. canis is reported to be transmitted by R. sanguineus s.l. (Moraes-Filho et al. 2015), which is also presumed to be the main vector of A. platys (Sanogo et al. 2003). However, the only study attempting to confirm R. sanguineus as vector of A. platys was unsuccessful (Simpson et al. 1991), possibly due to the low sensitivity of the detection method or the tick strain or species used (Ramos et al. 2014). Further studies of the role of R. sanguineus s.l. as a vector of A. platys and E. canis in field conditions are needed to confirm our results. A. platys and E. canis were detected in apparently healthy dogs from a municipal dog shelter where dogs were in close contact and therefore at an increased risk of exposure to ticks, which, in turn, increases the risk of human infection. The prevalence of the pathogens in dogs in the region is high. Our results reinforce the importance of introducing effective control strategies throughout the country. Considering their zoonotic relevance, it also should reinforce the importance of this information to public health authorities. References Cited Abd Rani, P. A. M., Irwin P. J., Coleman G. T., Gatne M., and Traub R. J.. 2011. A survey of canine tick-borne diseases in India. Parasit. Vector  4: 141. Aktas, M. 2014. A survey of ixodid tick species and molecular identification of tick-borne pathogens. Vet. Parasitol . 200: 276– 283. Google Scholar CrossRef Search ADS PubMed  Aktas, M., and Ozubek S.. 2015a. Bovine anaplasmosis in Turkey: first laboratory confirmed clinical cases caused by Anaplasma phagocytophilum. Vet. Microbiol . 178: 246– 251. Google Scholar CrossRef Search ADS   Aktas, M., and Ozubek S.. 2015b. Molecular and parasitological survey of bovine piroplasms in the Black Sea Region, including the first report of babesiosis associated with Babesia divergens in Turkey. J. Med. Entomol . 52: 1344– 1350. Google Scholar CrossRef Search ADS   Aktas, M., Altay K., and Dumanli N.. 2006. A molecular survey of bovine Theileria parasites among apparently healthy cattle and with a note on the distribution of ticks in eastern Turkey. Vet. Parasitol . 138: 179– 185. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Altay K., and Dumanli N.. 2011. Molecular detection and identification of Anaplasma and Ehrlichia species in cattle from Turkey. Ticks Tick-Borne Dis . 2: 62– 65. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Ozubek S., and Ipek D. N. S.. 2013. Molecular investigations of Hepatozoon species in dogs and developmental stages of Rhipicephalus sanguineus. Parasitol. Res . 112: 2381– 2385. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Vatansever Z., Altay K., Aydin M. F., and Dumanli N.. 2010. Molecular evidence for Anaplasma phagocytophilum in Ixodes ricinus from Turkey. Trans. R. Soc. Trop. Med. Hyg . 104: 10– 15. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Ozubek S., Altay K., Ipek N. D. S., Balkaya I., Utuk A. E., Kirbas A., Simsek S., and Dumanli N.. 2015. Molecular detection of tick-borne rickettsial and protozoan pathogens in domestic dogs from Turkey. Parasit. Vector  8: 157. Anda, P., Escudero, R., Rodríguez-Moreno, I., Jado, I., Jıménez-Alonso, M.I., 2006. Method and kit for the detection of bacterial species by means of DNA . U.S. patent WO/2006/136639: 2–28. Arraga-Alvarado, C. M., Qurollo B. A., Parra O. C., Berrueta M. A., Hegarty B. C., and Breitschwerdt E. B.. 2014. Case report: molecular evidence of Anaplasma platys infection in two women from Venezuela. Am. J. Trop. Med. Hyg . 91: 1161– 1165. Google Scholar CrossRef Search ADS PubMed  Bakken, J. S., and Dumler J. S.. 2015. Human granulocytic anaplasmosis. Infect. Dis. Clin. N. Am . 29: 341. Google Scholar CrossRef Search ADS   Bekker, C. P. J., de Vos S., Taoufik A., Sparagano O. A. E., and Jongejan F.. 2002. Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Vet. Microbiol . 89: 223– 238. Google Scholar CrossRef Search ADS PubMed  Bessas, A., Leulmi H., Bitam I., Zaidi S., Ait-Oudhia K., Raoult D., and Parola P.. 2016. Molecular evidence of vector-borne pathogens in dogs and cats and their ectoparasites in Algiers, Algeria. Comp. Immunol. Microb . 45: 23– 28. Google Scholar CrossRef Search ADS   Breitschwerdt, E. B., Hegarty B. C., Qurollo B. A., Saito T. B., Maggi R. G., Blanton L. S., and Bouyer D. H.. 2014. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasit. Vector  7: 298. Bush, A. O., Lafferty K. D., Lotz J. M., and Shostak A. W.. 1997. Parasitology meets ecology on its own terms: Margolis et al revisited. J. Parasitol . 83: 575– 583. Google Scholar CrossRef Search ADS PubMed  Cetinkaya, H., Matur E., Akyazi I., Ekiz E. E., Aydin L., and Toparlak M.. 2016. Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of Turkey. Ticks Tick-Borne Dis . 7: 706– 714. Google Scholar CrossRef Search ADS PubMed  Chen, S. M., Dumler J. S., Bakken J. S., and Walker D. H.. 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human-disease. J. Clin. Microbiol . 32: 589– 595. Google Scholar PubMed  Colwell, D. D., Dantas-Torres F., and Otranto D.. 2011. Vector-borne parasitic zoonoses: emerging scenarios and new perspectives. Vet. Parasitol . 182: 14– 21. Google Scholar CrossRef Search ADS PubMed  Dahmani, M., Loudahi A., Mediannikov O., Fenollar F., Raoult D., and Davoust B.. 2015. Molecular detection of Anaplasma platys and Ehrlichia canis in dogs from Kabylie, Algeria. Ticks Tick-Borne Dis . 6: 198– 203. Google Scholar CrossRef Search ADS PubMed  Dantas-Torres, F. 2008. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Vet. Parasitol . 152: 173– 185. Google Scholar CrossRef Search ADS PubMed  Dantas-Torres, F. 2010. Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasit. Vector  3: 26. Dantas-Torres, F., and Otranto D.. 2015. Further thoughts on the taxonomy and vector role of Rhipicephalus sanguineus group ticks. Vet. Parasitol . 208: 9– 13. Google Scholar CrossRef Search ADS PubMed  Dantas-Torres, F., and Otranto D.. 2016. Best practices for preventing vector-borne diseases in dogs and humans. Trends Parasitol . 32: 43– 55. Google Scholar CrossRef Search ADS PubMed  De Tommasi, A. S., Otranto D., Dantas-Torres F., Capelli G., Breitschwerdt E. B., and de Caprariis D.. 2013. Are vector-borne pathogen co-infections complicating the clinical presentation in dogs? Parasit. Vector  6: 97. Duzlu, O., Inci A., Yildirim A., Onder Z., and Ciloglu A.. 2014. The investigation of some tick-borne protozoon and rickettsial infections in dogs by real time PCR and the molecular characterizations of the detected isolates. Ankara Univ. Vet. Fak . 61: 275– 282. Estrada-Pena, A., Farkas R., Jaenson T. G. T., Koenen F., Madder M., Pascucci I., Salman M., Tarres-Call J., and Jongejan F.. 2013. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set. Exp. Appl. Acarol . 59: 351– 366. Google Scholar CrossRef Search ADS   Gray, J., Dantas-Torres F., Estrada-Pena A., and Levin M.. 2013. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick-Borne Dis . 4: 171– 180. Google Scholar CrossRef Search ADS PubMed  Inokuma, H., Oyamada M., Davoust B., Boni M., Dereure J., Bucheton B., Hammad A., Watanabe M., Itamoto K., Okuda M.,et al.   2006. Epidemiological survey of Ehrlichia canis and related species infection in dogs in eastern Sudan. Ann. N. Y. Acad. Sci . 1078: 461– 463. Google Scholar CrossRef Search ADS PubMed  Lauzi, S., Maia J. P., Epis S., Marcos R., Pereira C., Luzzago C., Santos M., Puente-Payo P., Giordano A., Pajoro M.,et al.   2016. Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago. Ticks Tick-Borne Dis . 7: 964– 969. Google Scholar CrossRef Search ADS PubMed  Little, S. E. 2010. Ehrlichiosis and anaplasmosis in dogs and cats. Vet. Clin. North. Am. Small Anim. Pract . 40: 1121– 40. Google Scholar CrossRef Search ADS PubMed  Lorusso, V., Dantas-Torres F., Lia R. P., Tarallo V. D., Mencke N., Capelli G., and Otranto D.. 2010. Seasonal dynamics of the brown dog tick, Rhipicephalus sanguineus, on a confined dog population in Italy. Med. Vet. Entomol . 24: 309– 315. Google Scholar PubMed  M’Ghirbi, Y., Ghorbel A., Amouri M., Nebaoui A., Haddad S., and Bouattour A.. 2009. Clinical, serological, and molecular evidence of ehrlichiosis and anaplasmosis in dogs in Tunisia. Parasitol. Res . 104: 767– 774. Google Scholar CrossRef Search ADS PubMed  Maazi, N., Malmasi A., Shayan P., Nassiri S. M., Salehi T. Z., and Fard M. S.. 2014. Molecular and serological detection of Ehrlichia canis in naturally exposed dogs in Iran: an analysis on associated risk factors. Rev. Bras Parasitol. V . 23: 16– 22. Google Scholar CrossRef Search ADS   Maia, C., Almeida B., Coimbra M., Fernandes M. C., Cristovao J. M., Ramos C., Martins A., Martinho F., Silva P., Neves N.,et al.   2015. Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasit. Vector  8: 138. Moraes-Filho, J., Krawczak F. S., Costa F. B., Soares J. F., and Labruna M. B.. 2015. Comparative evaluation of the vector competence of four South American populations of the Rhipicephalus sanguineus group for the bacterium Ehrlichia canis, the agent of Canine Monocytic Ehrlichiosis. PLoS One  10: 1371. Nicholson, W. L., Allen K. E., McQuiston J. H., Breitschwerdt E. B., and Little S. E.. 2010. The increasing recognition of rickettsial pathogens in dogs and people. Trends Parasitol . 26: 205– 212. Google Scholar CrossRef Search ADS PubMed  Pasa, S., Kiral F., Karagenc T., Atasoy A., and Seyrek K.. 2009. Description of dogs naturally infected with Hepatozoon canis in the Aegean region of Turkey. Turk J. Vet. Anim. Sci . 33: 289– 295. Perez, M., Bodor M., Zhang C. B., Xiong Q. M., and Rikihisa Y.. 2006. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann. N. Y. Acad. Sci . 1078: 110– 117. Google Scholar CrossRef Search ADS PubMed  Ramos, R. A. N., Latrofa M. S., Giannelli A., Lacasella V., Campbell B. E., Dantas-Torres F., and Otranto D.. 2014. Detection of Anaplasma platys in dogs and Rhipicephalus sanguineus group ticks by a quantitative real-time PCR. Vet. Parasitol . 205: 285– 288. Google Scholar CrossRef Search ADS PubMed  Sainz, A., Roura X., Miro G., Estrada-Pena A., Kohn B., Harrus S., and Solano-Gallego L.. 2015. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasit. Vector  8: 75. Sanogo, Y., Davoust B., Inokuma H., Camicas J. L., Parola P., and Brouqui P.. 2003. First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa. Onderstepoort J. Vet . 70: 205– 212. Santos, H. A., Thome S. M. G., Baldani C. D., Silva C. B., Peixoto M. P., Pires M. S., Vitari G. L. V., Costa R. L., Santos T. M., Angelo I. C.,et al.   2013. Molecular epidemiology of the emerging zoonosis agent Anaplasma phagocytophilum (Foggie, 1949) in dogs and ixodid ticks in Brazil. Parasit. Vector  6: 348. Schouls, L. M., Van de Pol I., Rijpkema S. G. T., and Schot C. S.. 1999. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J. Clin. Microbiol . 37: 2215– 2222. Google Scholar PubMed  Sen, E., Uchishima Y., Okamoto Y., Fukui T., Kadosaka T., Ohashi N., and Masuzawa T.. 2011. Molecular detection of Anaplasma phagocytophilum and Borrelia burgdorferi in Ixodes ricinus ticks from Istanbul metropolitan area and rural Trakya (Thrace) region of north-western Turkey. Ticks Tick-Borne Dis . 2: 94– 98. Google Scholar CrossRef Search ADS PubMed  Silaghi, C., Woll D., Hamel D., Pfister K., Mahling M., and Pfeffer M.. 2012. Babesia spp. and Anaplasma phagocytophilum in questing ticks, ticks parasitizing rodents and the parasitized rodents analyzing the host-pathogen-vector interface in a metropolitan area. Parasit. Vector  5: 191. Simpson, R. M., Gaunt S. D., Hair J. A., Kocan K. M., Henk W. G., and Casey H. W.. 1991. Evaluation of Rhipicephalus sanguineus as a potential biologic vector of Ehrlichia platys. Am. J. Vet. Res . 52: 1537– 1541. Google Scholar PubMed  Ulutas, B., Bayramli G., and Karagenc T.. 2007. First case of Anaplasma (Ehrlichia) platys infection in a dog in Turkey. Turk J. Vet. Anim. Sci . 31: 279– 282. Volgina, N. S., Romashov B. V., Romashova N. B., and Shtannikov A. V.. 2013. Prevalence of borreliosis, anaplasmosis, ehrlichiosis and Dirofilaria immitis in dogs and vectors in Voronezh Reserve (Russia). Comp. Immunol. Microb . 36: 567– 574. Google Scholar CrossRef Search ADS   Yisaschar-Mekuzas, Y., Jaffe C. L., Pastor J., Cardoso L., and Baneth G.. 2013. Identification of Babesia species infecting dogs using reverse line blot hybridization for six canine piroplasms, and evaluation of co-infection by other vector-borne pathogens. Vet. Parasitol . 191: 367– 373. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Medical Entomology Oxford University Press

A Molecular Survey of Rickettsias in Shelter Dogs and Distribution of Rhipicephalus sanguineus (Acari: Ixodidae) sensu lato in Southeast Turkey

Loading next page...
 
/lp/ou_press/a-molecular-survey-of-rickettsias-in-shelter-dogs-and-distribution-of-HPrtlWPwgQ
Publisher
Oxford University Press
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
ISSN
0022-2585
eISSN
1938-2928
D.O.I.
10.1093/jme/tjx213
Publisher site
See Article on Publisher Site

Abstract

Abstract Canine tick-borne pathogens are the source of emerging diseases and have important zoonotic relevance. Dogs play a major role in the transmission of several zoonotic tick-borne pathogens, as reservoirs and/or sentinels. To simultaneously detect Anaplasma and Ehrlichia species, a reverse line blot assay was conducted on 219 blood samples collected from autochthonous asymptomatic shelter dogs. One hundred and three (47.0%, CI 40.3–53.9) dogs were positive for one or both rickettsial pathogens. Seventy-one (32.4%, CI 26.3–39.0) dogs were infected with Anaplasma platys and 23 (10.5%, CI 6.8–15.3) with Ehrlichia canis. Concurrent infection with A. platys and E. canis was detected in nine (4.1%, CI 1.9–7.6) dogs. Partial sequences of the 16S ribosomal RNA gene shared 100% identity with the corresponding published sequences for A. platys and E. canis. Infection with Anaplasma phagocytophilum was not detected in the examined dogs. In total, 1018 (range 1–70, mean intensity 13.1, mean abundance 4.6) Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) sensu lato ticks (45.7% nymphs, 54.3% adults) were collected from the dogs. There was no significant association between Anaplasma/Ehrlichia infection and dog sex or age, but a significant correlation was found between rickettsia infection and presence of R. sanguineus. Improved tick control strategies to reduce the risk of these pathogens spreading among dogs and humans are needed in the region. Anaplasma platys, Ehrlichia canis, Rhipicephalus sanguineus sensu lato, dog, Reverse line blot Tick-borne disease is an emerging cosmopolitan problem associated with sub-clinical infections or serious disease in hosts (Nicholson et al. 2010, Dantas-Torres and Otranto 2016). Anaplasmosis and ehrlichiosis are two important tick-borne diseases of dogs caused by a bacterium of the family Anaplasmataceae (Little 2010). Some are particularly significant due to their zoonotic potential because companion animals can be reservoirs for human tick-borne infectious agents (Colwell et al. 2011, Dantas-Torres and Otranto 2015). Anaplasma platys, Anaplasma phagocytophilum, and Ehrlichia canis are the main Anaplasmataceae detected and are associated with acute or non-clinical canine infections in many countries (Little 2010). A. phagocytophilum is the pathogen of human granulocytic anaplasmosis (Bakken and Dumler 2015). A. platys and E. canis are also recognised as emerging human pathogens (Perez et al. 2006, Arraga-Alvarado et al. 2014, Breitschwerdt et al. 2014). A. phagocytophilum is associated with the occurrence of Ixodes ricinus, a common tick species in European countries (Aktas et al. 2010, Estrada-Pena et al. 2013). A. platys and E. canis are transmitted by Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) (Ramos et al. 2014, Moraes-Filho et al. 2015). Apart from a few reports of the occurrence of canine anaplasmosis and ehrlichiosis (Ulutas et al. 2007, Aktas 2014, Aktas et al. 2015, Cetinkaya et al. 2016), information about tick-borne rickettsia in Turkey remains limited. This work aimed to assess the occurrence and frequency of canine rickettsias in dogs from a municipal shelter in the Diyarbakır Province of Turkey and to identify ixodid ticks found on dogs in the region. Materials and Methods In total, 219 dogs from a shelter located in Diyarbakır Province (37° 55′ N, 40° 69 12′ E) of south-eastern Turkey were included in the study. The province has a typical continental climate with extremely hot summers, cold winters, and little precipitation. The mean annual rainfall and temperature are 630 mm and 22.5° C, respectively. Before being taken to the shelter, the animals had freely roamed urban and rural areas and apparently did not receive any tick or flea control treatment. On the basis of behaviour and appearance, the dogs were healthy. Sampling was performed from May to June 2015. The sampled dogs were divided into categories based on sex, age, and presence or absence of tick infestation. Age of the dogs was estimated from body size and teeth (6 mo–1 yr and 1–7 yr). Blood samples (3 ml) were collected in EDTA-tubes and stored at −20°C until processing. Each dog was examined for ticks, with attention paid to the ears, neck, inguinal region, and under the tail. In total, 1018 ticks were removed, and identified following Estrade-Peña et al. (2004). Prevalence and intensity of the tick infestations were estimated (Bush et al. 1997). Genomic DNA was extracted with a QIAamp DNA Blood Minikit (Qiagen, Hilden, Germany) from the collected 219 blood samples. A nested polymerase chain reaction (PCR) was utilized using universal primers with described protocols indicated in Table 1. Nested PCR products were hybridized on the reverse line blot (RLB) membrane. Details of primer pairs and probes are provided in Table 1. PCR was performed as previously described (Aktas et al. 2015). PCR products were electrophoresed in 1.5% agarose gel. DNA from E. canis, A. phagocytophilum, and A. platys, previously detected by RLB and DNA sequencing (GenBank accession nos. KP745632, KP745629, KF038320, respectively), were used as positive controls. RNase-free water and canine genomic DNA from blood of an uninfected dog were used as negative controls. Five microliter of PCR product was electrophorezed, and the remaining products were stored at +4°C until used in the RLB. Table 1. Primers and probes used in this study Primer and probe specificity  Nucleotid sequence (5′–3′)  Target gene  Primer name  Product size  Reference  Primer  Anaplasma spp., Ehrlichia spp.  First reaction  TGATCCTGGCTCAGAACGAACG TACCTTGTTACGACTT  16S rRNA  EC12A EC9  1462  Chen et al. (1994)    Second reaction  GGAATTCAGAGTTGGATCMTGGYTCAG Biotin-CGGGATCCCGAGTTTGCCGGGACTTYTTCT  16S rRNA  16S8FE BGA1B-new  492–498  Bekker et al. (2002)   Probe  Ehrlichia/Anaplasma catch-all  AmMC6-GGGGGAAAGATTTATCGCTA        Bekker et al.(2002)   Anaplasma/Ehrlichia  AmMC6-TTATCGCTATTAGATGAGCC        Schouls et al. (1999)   E. canis  AmMC6-TCTGGCTATAGGAAATTGTTA        Schouls et al. (1999)   A. platys  AmMC6-GATTTTTGTCGTAGCTTGCTATG        Anda et al. (2006)   A. phagocytophilum 1  AmMC6-TTGCTATAAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 3  AmMC6-TTGCTATGAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 5  AmMC6-TTGCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum 7  AmMC6-TTGCTATAGAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-HGE  AmMC6-GCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-D- HGE  AmMC6-GCTATGAAGAATAGTTAGTG        Schouls et al.(1999)   Primer and probe specificity  Nucleotid sequence (5′–3′)  Target gene  Primer name  Product size  Reference  Primer  Anaplasma spp., Ehrlichia spp.  First reaction  TGATCCTGGCTCAGAACGAACG TACCTTGTTACGACTT  16S rRNA  EC12A EC9  1462  Chen et al. (1994)    Second reaction  GGAATTCAGAGTTGGATCMTGGYTCAG Biotin-CGGGATCCCGAGTTTGCCGGGACTTYTTCT  16S rRNA  16S8FE BGA1B-new  492–498  Bekker et al. (2002)   Probe  Ehrlichia/Anaplasma catch-all  AmMC6-GGGGGAAAGATTTATCGCTA        Bekker et al.(2002)   Anaplasma/Ehrlichia  AmMC6-TTATCGCTATTAGATGAGCC        Schouls et al. (1999)   E. canis  AmMC6-TCTGGCTATAGGAAATTGTTA        Schouls et al. (1999)   A. platys  AmMC6-GATTTTTGTCGTAGCTTGCTATG        Anda et al. (2006)   A. phagocytophilum 1  AmMC6-TTGCTATAAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 3  AmMC6-TTGCTATGAAGAATAATTAGTGG        Schouls et al.(1999)   A. phagocytophilum 5  AmMC6-TTGCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum 7  AmMC6-TTGCTATAGAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-HGE  AmMC6-GCTATAAAGAATAGTTAGTGG        Schouls et al.(1999)   A. phagocytophilum A-D- HGE  AmMC6-GCTATGAAGAATAGTTAGTG        Schouls et al.(1999)   AmMC6, C6 amino linker linked to the 5′. View Large RLB assay was performed on the nested PCR amplicons as previously reported (Aktas and Ozubek 2015a,b; Aktas et al. 2015). To confirm PCR results, two amplicons comprising A. platys and E. canis were sequenced and comparative sequence analyses were performed. Shortly after, PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen GmbH) by following the manufacturer’s instructions and sequenced by the commercial company. They were manually edited by Chromas-Lite (www.technelysium.com.au). The prevalence and 95% binomial exact CIs were calculated using Sourceforge net (http://sampsize.sourceforge.net/iface). The data obtained from dogs were compared by Pearson chi-square tests using SPSS 15.00 software for correlated proportions. Association of rickettsial pathogens with sex, age, and presence of tick infestation was assessed. P-values ≤0.05 were considered significant. This study was carried out according to the regulations on animal welfare issued by the Turkish legislation for the protection of animals (Animal Experiment Ethics Committee, 71156/2009). Results Amplification using primers 16S8FE/BGA1B-new yielded PCR products of the expected size (~500 bp) from positive control samples. The PCR products obtained from both positive controls and field samples were hybridized and observed for signal to catch all, genus- and species-specific oligonucleotide probes in RLB (Table 1). All positive products (positive control and field samples) produced a signal. Frequencies of single and combined A. paltys and E. canis in dogs relative to sex, age, and presence of tick infestation are shown in Table 2. About 103 (47.0%, CI 40.3–53.9) out of 219 blood samples were positive by the 16S rRNA PCR for Anaplasmataceae. Seventy-one (32.4%, CI 26.3–39.0) and 23 (10.5%, CI 6.8–15.3) dogs were also found positive for A. platys and E. canis, respectively in RLB assay. Co-existence of A. platys and E. canis was detected in nine (4.1%, CI 1.9–7.6) dogs. No dog was positive for A. phagocytophilum. Table 2. Frequency (%), 95% CI (lower, upper intervals) and association of canine tick-borne rickettsial pathogens detected by RLB relative to sex, age, and presence or absence of tick infestation (Rhipicephalus sanguineus sensu lato) Variables  Sample  Anaplasma/Ehrlichia (%, 95% CI)  P-value  Identified pathogen  Co-infection (%, 95% CI)  Single infection (%, 95% CI)  A. platys  E. canis  A. platys + E. canis    219  103 (47.0, 40.3–53.9)    71 (32.4, 26.3–39.0)  23 (10.5, 6.8–15.3)  9 (4.1, 1.9–7.6)  Sex   Female  109  55 (50.4, 40.7–60.2)  > 0.05  39 (35.8, 26.8–45.5)  11 (10.1, 5.1–17.3)  5 (4.6, 1.5–10.4)   Male  110  48 (43.6, 34.2–53.4)  32 (29.1, 20.8–38.5)  12 (10.9, 5.8–18.3)  4 (3.6, 1.0–9.0)  Age   Juvenile (6–12 mo)  69  27 (39.1, 27.6–51.6)  > 0.05  16 (23.2, 13.9–34.9)  8 (11.6, 5.1–21.6)  3 (4.3, 0.9–12.2)   Adult (1–7 yr)  150  76 (50.7, 42.4–58.9)  55 (36.7, 28.9–44.9)  15 (10, 5.7–15.9)  6 (4, 1.5–8.5)  Presence of ticks   Absent  141  48 (34.0, 26.3–42.5)  < 0.05  33 (23.4, 16.7–31.3)  12 (8.5, 4.5–14.4)  3 (2.1, 0.4–6.1)   Present  78  55 (70.5, 59.1–80.3)  38 (48.7, 37.2–60.3)  11 (14.1, 7.2–23.8)  6 (7.7, 2.9–16.0)  Variables  Sample  Anaplasma/Ehrlichia (%, 95% CI)  P-value  Identified pathogen  Co-infection (%, 95% CI)  Single infection (%, 95% CI)  A. platys  E. canis  A. platys + E. canis    219  103 (47.0, 40.3–53.9)    71 (32.4, 26.3–39.0)  23 (10.5, 6.8–15.3)  9 (4.1, 1.9–7.6)  Sex   Female  109  55 (50.4, 40.7–60.2)  > 0.05  39 (35.8, 26.8–45.5)  11 (10.1, 5.1–17.3)  5 (4.6, 1.5–10.4)   Male  110  48 (43.6, 34.2–53.4)  32 (29.1, 20.8–38.5)  12 (10.9, 5.8–18.3)  4 (3.6, 1.0–9.0)  Age   Juvenile (6–12 mo)  69  27 (39.1, 27.6–51.6)  > 0.05  16 (23.2, 13.9–34.9)  8 (11.6, 5.1–21.6)  3 (4.3, 0.9–12.2)   Adult (1–7 yr)  150  76 (50.7, 42.4–58.9)  55 (36.7, 28.9–44.9)  15 (10, 5.7–15.9)  6 (4, 1.5–8.5)  Presence of ticks   Absent  141  48 (34.0, 26.3–42.5)  < 0.05  33 (23.4, 16.7–31.3)  12 (8.5, 4.5–14.4)  3 (2.1, 0.4–6.1)   Present  78  55 (70.5, 59.1–80.3)  38 (48.7, 37.2–60.3)  11 (14.1, 7.2–23.8)  6 (7.7, 2.9–16.0)  View Large No significant differences were observed in tick-borne pathogen positivity of male and female dogs (P > 0.05). The difference in infection rate of young and adult dogs was also not significant (P > 0.05). Among the 103 PCR-positive dogs, 55 (70.5%, CI 59.1–80.3) were infested with R. sanguineus s.l. (45.7% nymphs, 54.3% adults). Presence of this tick was significantly associated with canine rickettsia infection (P < 0.05). Seventy-eight out of 219 (35.6%) examined dogs carried at least one tick. Abundance (mean number of ticks per dog) and intensity (mean number of ticks per infested dog) were 4.64 and 13.05, respectively. The number of ticks per animal ranged from 1 to 70. All ticks were identified as R. sanguineus s.l. The partial sequences of the 16S rRNA genes determined for A. platys (1389 bp) and E. canis (1380 bp) were deposited in the EMBL/GenBank databases under accession numbers KY594914 and KY594915, respectively. A BLAST search showed the obtained sequences to be 100% identical to the corresponding published sequences for A. platys strain Okinawa 1 from Japan (AF536828) and E. canis isolate TrKysEcan3 from Turkey (KJ513197). Discussion We described here a molecular survey detecting canine tick-borne rickettsial agents and found shelter dogs in Diyarbakır Province, Turkey to be exposed to A. platys and E. canis. Both pathogens from dogs and ticks were previously reported in Turkey (Ulutas et al. 2007, Sen et al. 2011, Aktas 2014). However, a high infection frequency (47.0%, CI 40.3–53.9) was detected compared with previous reports in Turkey of 14.5% (Duzlu et al. 2014), 5.4% (Aktas et al. 2015), and 6% (Çetinkaya et al. 2016), 6.4% in Nigeria (Dahmani et al. 2015), 1.9% in Portugal (Maia et al. 2015), 3.7% in Iran (Maazi et al. 2014), 14.5% in Algeria (Bessas et al. 2016), and 6.5% in India (Abd Rani et al. 2011). The differences in frequency may be related to geographic region, environmental conditions, sample size, sampling periods, or diagnostic methods, as well as to the primary characteristics of the targeted dog population such as outdoor, indoor, shelter, stray, or pet (Inokuma et al. 2006, Volgina et al. 2013, Dahmani et al. 2015, Cetinkaya et al. 2016). High abundance and intensity of R. sanguineus s.l., a vector of A. platys and E. canis (Dantas-Torres 2008, 2010, Ramos et al. 2014, Dantas-Torres and Otranto 2015), might explain the higher positive rate of these pathogens in this study. Probes specific for A. phagocytophilum were included in our study, but no positive signals were obtained by PCR. This result is not surprising, as A. phagocytophilum is transmitted by Ixodes (Silaghi et al. 2012), which has never been reported on domestic animals, including dogs, in the studied area (Aktas et al. 2006; 2013). Similar findings have been reported in a study conducted in Maio Island of Cape Verde, where the only hard tick reported is R. sanguineus s.l. (Lauzi et al. 2016). R. sanguineus is common in the Mediterranean countries. This tick species is associated with shelters such as kennels, gardens, or cracks in walls of human habitations (Gray et al. 2013). The abundance of infestation by R. sanguineus in dogs can vary geographically and seasonally, as well as depending upon the application of acaricides (Dantas-Torres 2010, Lorusso et al. 2010, Gray et al. 2013). In this study, the occurrence of R. sanguineus s.l. confirms a previous report identifying the majority of ticks found on dogs as this species (Aktas et al. 2013). Tick-transmitted infections generally involve multiple pathogens (De Tommasi et al. 2013, Sainz et al. 2015). Reverse line blotting is a powerful and practical tool allowing simultaneous detection of tick-borne pathogens (Schouls et al. 1999, Bekker et al. 2002). Our survey revealed nine dogs (4.1%, CI 1.9–7.6) presenting co-infections with A. platys and E. canis (Table 2). Similar findings have been reported in a previous study in Turkey (Pasa et al. 2009). Co-infection was also reported by Yisaschar-Mekuzas et al. (2013), Aktas et al. (2015), and Aktas and Ozubek (2015b). Our survey found no significant differences in the prevalence of bacteria in adult and young dogs (P > 0.05), or in dogs of different genders (P > 0.05). These results agree with findings that the frequency of infection is not related to sex and age (Santos et al. 2013, Maazi et al. 2014, Dahmani et al. 2015, Lauzi et al. 2016, Maia et al. 2015), suggesting that tick intensity and geographic distribution affect the prevalence of pathogens in all dogs, regardless of sex or age. A correlation between the occurrence of A. platys and E. canis and the presence of R. sanguineus s.l. was observed (P < 0.05), consistent with a survey conducted on dogs in which 155/286 samples showed antibodies reactive to E. canis. Among the seropositive dogs, 58% had ticks at the time of sampling (M’ghirbi et al. 2009). In Sudan, the frequency of E. canis and A. platys was found to be 80.8 and 24.4%, respectively, and R. sanguineus was found on all dogs (Inokuma et al. 2006). On the contrary, in Algeria, frequency of E. canis and A. platys was found to be 6.3% (7/110) and 5.4% (4/110), respectively. The low prevalence was attributed to the fact that the survey was carried out in late winter and early spring, periods of low tick activity (Dahmani et al. 2015). These results suggest that infestation by ticks is a main determinant of tick-borne rickettsial infection rates. E. canis is reported to be transmitted by R. sanguineus s.l. (Moraes-Filho et al. 2015), which is also presumed to be the main vector of A. platys (Sanogo et al. 2003). However, the only study attempting to confirm R. sanguineus as vector of A. platys was unsuccessful (Simpson et al. 1991), possibly due to the low sensitivity of the detection method or the tick strain or species used (Ramos et al. 2014). Further studies of the role of R. sanguineus s.l. as a vector of A. platys and E. canis in field conditions are needed to confirm our results. A. platys and E. canis were detected in apparently healthy dogs from a municipal dog shelter where dogs were in close contact and therefore at an increased risk of exposure to ticks, which, in turn, increases the risk of human infection. The prevalence of the pathogens in dogs in the region is high. Our results reinforce the importance of introducing effective control strategies throughout the country. Considering their zoonotic relevance, it also should reinforce the importance of this information to public health authorities. References Cited Abd Rani, P. A. M., Irwin P. J., Coleman G. T., Gatne M., and Traub R. J.. 2011. A survey of canine tick-borne diseases in India. Parasit. Vector  4: 141. Aktas, M. 2014. A survey of ixodid tick species and molecular identification of tick-borne pathogens. Vet. Parasitol . 200: 276– 283. Google Scholar CrossRef Search ADS PubMed  Aktas, M., and Ozubek S.. 2015a. Bovine anaplasmosis in Turkey: first laboratory confirmed clinical cases caused by Anaplasma phagocytophilum. Vet. Microbiol . 178: 246– 251. Google Scholar CrossRef Search ADS   Aktas, M., and Ozubek S.. 2015b. Molecular and parasitological survey of bovine piroplasms in the Black Sea Region, including the first report of babesiosis associated with Babesia divergens in Turkey. J. Med. Entomol . 52: 1344– 1350. Google Scholar CrossRef Search ADS   Aktas, M., Altay K., and Dumanli N.. 2006. A molecular survey of bovine Theileria parasites among apparently healthy cattle and with a note on the distribution of ticks in eastern Turkey. Vet. Parasitol . 138: 179– 185. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Altay K., and Dumanli N.. 2011. Molecular detection and identification of Anaplasma and Ehrlichia species in cattle from Turkey. Ticks Tick-Borne Dis . 2: 62– 65. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Ozubek S., and Ipek D. N. S.. 2013. Molecular investigations of Hepatozoon species in dogs and developmental stages of Rhipicephalus sanguineus. Parasitol. Res . 112: 2381– 2385. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Vatansever Z., Altay K., Aydin M. F., and Dumanli N.. 2010. Molecular evidence for Anaplasma phagocytophilum in Ixodes ricinus from Turkey. Trans. R. Soc. Trop. Med. Hyg . 104: 10– 15. Google Scholar CrossRef Search ADS PubMed  Aktas, M., Ozubek S., Altay K., Ipek N. D. S., Balkaya I., Utuk A. E., Kirbas A., Simsek S., and Dumanli N.. 2015. Molecular detection of tick-borne rickettsial and protozoan pathogens in domestic dogs from Turkey. Parasit. Vector  8: 157. Anda, P., Escudero, R., Rodríguez-Moreno, I., Jado, I., Jıménez-Alonso, M.I., 2006. Method and kit for the detection of bacterial species by means of DNA . U.S. patent WO/2006/136639: 2–28. Arraga-Alvarado, C. M., Qurollo B. A., Parra O. C., Berrueta M. A., Hegarty B. C., and Breitschwerdt E. B.. 2014. Case report: molecular evidence of Anaplasma platys infection in two women from Venezuela. Am. J. Trop. Med. Hyg . 91: 1161– 1165. Google Scholar CrossRef Search ADS PubMed  Bakken, J. S., and Dumler J. S.. 2015. Human granulocytic anaplasmosis. Infect. Dis. Clin. N. Am . 29: 341. Google Scholar CrossRef Search ADS   Bekker, C. P. J., de Vos S., Taoufik A., Sparagano O. A. E., and Jongejan F.. 2002. Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Vet. Microbiol . 89: 223– 238. Google Scholar CrossRef Search ADS PubMed  Bessas, A., Leulmi H., Bitam I., Zaidi S., Ait-Oudhia K., Raoult D., and Parola P.. 2016. Molecular evidence of vector-borne pathogens in dogs and cats and their ectoparasites in Algiers, Algeria. Comp. Immunol. Microb . 45: 23– 28. Google Scholar CrossRef Search ADS   Breitschwerdt, E. B., Hegarty B. C., Qurollo B. A., Saito T. B., Maggi R. G., Blanton L. S., and Bouyer D. H.. 2014. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasit. Vector  7: 298. Bush, A. O., Lafferty K. D., Lotz J. M., and Shostak A. W.. 1997. Parasitology meets ecology on its own terms: Margolis et al revisited. J. Parasitol . 83: 575– 583. Google Scholar CrossRef Search ADS PubMed  Cetinkaya, H., Matur E., Akyazi I., Ekiz E. E., Aydin L., and Toparlak M.. 2016. Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of Turkey. Ticks Tick-Borne Dis . 7: 706– 714. Google Scholar CrossRef Search ADS PubMed  Chen, S. M., Dumler J. S., Bakken J. S., and Walker D. H.. 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human-disease. J. Clin. Microbiol . 32: 589– 595. Google Scholar PubMed  Colwell, D. D., Dantas-Torres F., and Otranto D.. 2011. Vector-borne parasitic zoonoses: emerging scenarios and new perspectives. Vet. Parasitol . 182: 14– 21. Google Scholar CrossRef Search ADS PubMed  Dahmani, M., Loudahi A., Mediannikov O., Fenollar F., Raoult D., and Davoust B.. 2015. Molecular detection of Anaplasma platys and Ehrlichia canis in dogs from Kabylie, Algeria. Ticks Tick-Borne Dis . 6: 198– 203. Google Scholar CrossRef Search ADS PubMed  Dantas-Torres, F. 2008. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Vet. Parasitol . 152: 173– 185. Google Scholar CrossRef Search ADS PubMed  Dantas-Torres, F. 2010. Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasit. Vector  3: 26. Dantas-Torres, F., and Otranto D.. 2015. Further thoughts on the taxonomy and vector role of Rhipicephalus sanguineus group ticks. Vet. Parasitol . 208: 9– 13. Google Scholar CrossRef Search ADS PubMed  Dantas-Torres, F., and Otranto D.. 2016. Best practices for preventing vector-borne diseases in dogs and humans. Trends Parasitol . 32: 43– 55. Google Scholar CrossRef Search ADS PubMed  De Tommasi, A. S., Otranto D., Dantas-Torres F., Capelli G., Breitschwerdt E. B., and de Caprariis D.. 2013. Are vector-borne pathogen co-infections complicating the clinical presentation in dogs? Parasit. Vector  6: 97. Duzlu, O., Inci A., Yildirim A., Onder Z., and Ciloglu A.. 2014. The investigation of some tick-borne protozoon and rickettsial infections in dogs by real time PCR and the molecular characterizations of the detected isolates. Ankara Univ. Vet. Fak . 61: 275– 282. Estrada-Pena, A., Farkas R., Jaenson T. G. T., Koenen F., Madder M., Pascucci I., Salman M., Tarres-Call J., and Jongejan F.. 2013. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set. Exp. Appl. Acarol . 59: 351– 366. Google Scholar CrossRef Search ADS   Gray, J., Dantas-Torres F., Estrada-Pena A., and Levin M.. 2013. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick-Borne Dis . 4: 171– 180. Google Scholar CrossRef Search ADS PubMed  Inokuma, H., Oyamada M., Davoust B., Boni M., Dereure J., Bucheton B., Hammad A., Watanabe M., Itamoto K., Okuda M.,et al.   2006. Epidemiological survey of Ehrlichia canis and related species infection in dogs in eastern Sudan. Ann. N. Y. Acad. Sci . 1078: 461– 463. Google Scholar CrossRef Search ADS PubMed  Lauzi, S., Maia J. P., Epis S., Marcos R., Pereira C., Luzzago C., Santos M., Puente-Payo P., Giordano A., Pajoro M.,et al.   2016. Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago. Ticks Tick-Borne Dis . 7: 964– 969. Google Scholar CrossRef Search ADS PubMed  Little, S. E. 2010. Ehrlichiosis and anaplasmosis in dogs and cats. Vet. Clin. North. Am. Small Anim. Pract . 40: 1121– 40. Google Scholar CrossRef Search ADS PubMed  Lorusso, V., Dantas-Torres F., Lia R. P., Tarallo V. D., Mencke N., Capelli G., and Otranto D.. 2010. Seasonal dynamics of the brown dog tick, Rhipicephalus sanguineus, on a confined dog population in Italy. Med. Vet. Entomol . 24: 309– 315. Google Scholar PubMed  M’Ghirbi, Y., Ghorbel A., Amouri M., Nebaoui A., Haddad S., and Bouattour A.. 2009. Clinical, serological, and molecular evidence of ehrlichiosis and anaplasmosis in dogs in Tunisia. Parasitol. Res . 104: 767– 774. Google Scholar CrossRef Search ADS PubMed  Maazi, N., Malmasi A., Shayan P., Nassiri S. M., Salehi T. Z., and Fard M. S.. 2014. Molecular and serological detection of Ehrlichia canis in naturally exposed dogs in Iran: an analysis on associated risk factors. Rev. Bras Parasitol. V . 23: 16– 22. Google Scholar CrossRef Search ADS   Maia, C., Almeida B., Coimbra M., Fernandes M. C., Cristovao J. M., Ramos C., Martins A., Martinho F., Silva P., Neves N.,et al.   2015. Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasit. Vector  8: 138. Moraes-Filho, J., Krawczak F. S., Costa F. B., Soares J. F., and Labruna M. B.. 2015. Comparative evaluation of the vector competence of four South American populations of the Rhipicephalus sanguineus group for the bacterium Ehrlichia canis, the agent of Canine Monocytic Ehrlichiosis. PLoS One  10: 1371. Nicholson, W. L., Allen K. E., McQuiston J. H., Breitschwerdt E. B., and Little S. E.. 2010. The increasing recognition of rickettsial pathogens in dogs and people. Trends Parasitol . 26: 205– 212. Google Scholar CrossRef Search ADS PubMed  Pasa, S., Kiral F., Karagenc T., Atasoy A., and Seyrek K.. 2009. Description of dogs naturally infected with Hepatozoon canis in the Aegean region of Turkey. Turk J. Vet. Anim. Sci . 33: 289– 295. Perez, M., Bodor M., Zhang C. B., Xiong Q. M., and Rikihisa Y.. 2006. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann. N. Y. Acad. Sci . 1078: 110– 117. Google Scholar CrossRef Search ADS PubMed  Ramos, R. A. N., Latrofa M. S., Giannelli A., Lacasella V., Campbell B. E., Dantas-Torres F., and Otranto D.. 2014. Detection of Anaplasma platys in dogs and Rhipicephalus sanguineus group ticks by a quantitative real-time PCR. Vet. Parasitol . 205: 285– 288. Google Scholar CrossRef Search ADS PubMed  Sainz, A., Roura X., Miro G., Estrada-Pena A., Kohn B., Harrus S., and Solano-Gallego L.. 2015. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasit. Vector  8: 75. Sanogo, Y., Davoust B., Inokuma H., Camicas J. L., Parola P., and Brouqui P.. 2003. First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa. Onderstepoort J. Vet . 70: 205– 212. Santos, H. A., Thome S. M. G., Baldani C. D., Silva C. B., Peixoto M. P., Pires M. S., Vitari G. L. V., Costa R. L., Santos T. M., Angelo I. C.,et al.   2013. Molecular epidemiology of the emerging zoonosis agent Anaplasma phagocytophilum (Foggie, 1949) in dogs and ixodid ticks in Brazil. Parasit. Vector  6: 348. Schouls, L. M., Van de Pol I., Rijpkema S. G. T., and Schot C. S.. 1999. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J. Clin. Microbiol . 37: 2215– 2222. Google Scholar PubMed  Sen, E., Uchishima Y., Okamoto Y., Fukui T., Kadosaka T., Ohashi N., and Masuzawa T.. 2011. Molecular detection of Anaplasma phagocytophilum and Borrelia burgdorferi in Ixodes ricinus ticks from Istanbul metropolitan area and rural Trakya (Thrace) region of north-western Turkey. Ticks Tick-Borne Dis . 2: 94– 98. Google Scholar CrossRef Search ADS PubMed  Silaghi, C., Woll D., Hamel D., Pfister K., Mahling M., and Pfeffer M.. 2012. Babesia spp. and Anaplasma phagocytophilum in questing ticks, ticks parasitizing rodents and the parasitized rodents analyzing the host-pathogen-vector interface in a metropolitan area. Parasit. Vector  5: 191. Simpson, R. M., Gaunt S. D., Hair J. A., Kocan K. M., Henk W. G., and Casey H. W.. 1991. Evaluation of Rhipicephalus sanguineus as a potential biologic vector of Ehrlichia platys. Am. J. Vet. Res . 52: 1537– 1541. Google Scholar PubMed  Ulutas, B., Bayramli G., and Karagenc T.. 2007. First case of Anaplasma (Ehrlichia) platys infection in a dog in Turkey. Turk J. Vet. Anim. Sci . 31: 279– 282. Volgina, N. S., Romashov B. V., Romashova N. B., and Shtannikov A. V.. 2013. Prevalence of borreliosis, anaplasmosis, ehrlichiosis and Dirofilaria immitis in dogs and vectors in Voronezh Reserve (Russia). Comp. Immunol. Microb . 36: 567– 574. Google Scholar CrossRef Search ADS   Yisaschar-Mekuzas, Y., Jaffe C. L., Pastor J., Cardoso L., and Baneth G.. 2013. Identification of Babesia species infecting dogs using reverse line blot hybridization for six canine piroplasms, and evaluation of co-infection by other vector-borne pathogens. Vet. Parasitol . 191: 367– 373. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Journal

Journal of Medical EntomologyOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off