A loop-mediated isothermal amplification procedure targeting the sodA gene for rapid and specific identification of Gallibacterium anatis

A loop-mediated isothermal amplification procedure targeting the sodA gene for rapid and specific... Abstract This paper reports on the development and validation of a real-time loop-mediated isothermal amplification assay (LAMP) for rapid and specific identification of Gallibacterium anatis. To design a set of 6 primers using the LAMP technique, the conserved region of the G. anatis sodA gene was selected as a target. To evaluate primer specificity we used 120 field strains, the reference strain G. anatis ATCC 43329, and 9 non-G. anatis bacteria. The results confirmed positive reactions for all G. anatis strains tested by LAMP at 63°C for 60 min, with no cross-reactivity observed for the negative control bacteria, i.e., Haemophilus parainfluenzae (ATCC 51505 and ATCC 33392), Aggregatibacter aphrophilus ATCC 7901, Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale, and Escherichia coli. The lowest detectable amount of DNA for the LAMP reaction was 0.2561 pg, which was detected in about 34 min, while the highest available concentration of the G. anatis reference strain was detected in about 10 min. The lowest detectable amount of DNA for the real-time PCR reaction was 21.24 pg, which was detected in about 20 min, while the highest available concentration of the G. anatis reference strain was detected in about 7 min. Moreover, using the real-time LAMP assay the reaction could be effectively carried out in a volume of just 13 μL, about half the officially recommended reaction volume (25 μL). The aim of this study was to develop a highly sensitive and specific G. anatis real-time LAMP assay that is less time-consuming and less costly than quantitative PCR. INTRODUCTION Gallibacterium anatis is a gram-negative, facultative anerobic, rod-shaped or pleomorphic bacterium. The genus Gallibacterium currently includes 4 species (Bisgaard et al. 2009). The most common of these is Gallibacterium anatis biovar haemolytica, which causes salpingitis, oophoritis, peritonitis, septicemia, pericarditis, hepatitis, enteritis, and lung lesions in poultry (Neubauer et al., 2009; Paudel et al., 2013). G. anatis is usually isolated from breeding and laying hens, but also can cause lesions in the upper respiratory tract of turkeys (Bojesen and Shivaprasad, 2007). There is also evidence that this bacterium can infect human beings (Gautier et al., 2005; Aubin et al., 2013). While G. anatis is a member of the normal flora of the upper respiratory tract and lower reproductive tract, diseased birds are more susceptible to secondary infections, especially those associated with Escherichia coli (Neubauer et al., 2009; Johnson et al., 2013). Therefore, it has a significant negative economic impact in the poultry industry, resulting from reduced egg production, inadequate animal welfare, and increased mortality. Although G. anatis often infects laying hens, it is rarely isolated from dead chickens with typical lesions during routine diagnostic bacteriological examination (Wang et al., 2016). The genus Gallibacterium is a phenotypically heterogeneous group (Bojesen et al., 2007), and biochemical identification involves laborious and time-consuming methods, the results of which may be inconclusive due to the variable properties of these microorganisms (Dousse et al., 2008). For this reason, molecular techniques producing clear results in a short time are used for rapid and accurate species identification. The loop-mediated isothermal amplification (LAMP) method has recently been included among diagnostic methods based on nucleic acid amplification, which are officially recommended for routine identification and analysis of many pathogens (Mori and Notomi, 2002). LAMP can be a specific method to detect the genetic material of selected pathogens that are difficult to isolate and/or identify from a microbial culture or tissues (Iwamoto et al., 2003; Mair et al., 2013; Kursa et al, 2015; Liu et al., 2015). It provides highly specific and accurate identification of pathogen DNA in a very short time (up to 1 h for the DNA isolation and the LAMP reaction). The LAMP method uses a set of inner primers (forward [FIP] and backward [BIP]), outer primers (F3 and B3) and forward and backward loop primers (FL and BL), which enable faster formation of loop and hairpin structures and thus faster detection of specific DNA. Amplification is performed under isothermal conditions of 60 to 65°C. The final products form cauliflower-like structures with multiple overhangs (Woźniakowski et al., 2011). The aim of this study was to develop a G. anatis assay based on the LAMP technique. To the best of our knowledge, there is no publication describing this method of identification of G. anatis. The paper describes the first use of the real-time LAMP method for rapid and highly specific identification of G. anatis isolated from hens and turkeys. MATERIAL AND METHODS Bacterial Strains A total of 120 field isolates of G. anatis biovar haemolytica, collected in the years 2013 to 2016, were used in the study. The bacteria were isolated from the internal organs (heart, liver, ovary, oviduct; tracheal, peritoneal cloacal and air sac swabs) of laying and breeding hens and turkeys during diagnostic examinations. These isolates were previously identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) (Alispahic et al., 2011; Stępień-Pyśniak et al., 2017) and Gallibacterium species-specific polymerase chain reaction (PCR) (Bojesen et al., 2007). If species-specific PCR was insufficient, Gallibacterium isolates were identified and assigned to specific Gallibacterium species by partial sequencing of the rpoB gene (Korczak et al., 2004). The reference strain Gallibacterium anatis ATCC 43329 was used as a positive control. Primer specificity was evaluated using the reference strains Haemophilus parainfluenzae ATCC 51505 and ATCC 33392 and Aggregatibacter aphrophilus ATCC 7901, as well as strains of Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale, and Escherichia coli. DNA Extraction Genomic DNA was extracted from the test strains using the Novabeads Bacterial DNA Mini Kit (Novazym, Poznan, Poland). The DNA samples were stored at −70°C until further analysis. Loop-Mediated Isothermal Amplification (LAMP) The species-specific G. anatis LAMP assay was designed based on the sodA sequence of a G. anatis strain (Accession number: CP002667.1). Six complementary primers were designed using PrimerExplorer V4 (Eiken Chemical Co. Ltd., Japan) and by manual assignment: F3, forward outer primer; B3, backward outer primer; FIP (F1C+F2), forward inner primer; BIP (B1c+B2), backward inner primer; LoopF, forward loop primer; LoopB, backward loop primer (Table 1). LAMP reactions were conducted in 13 μL of reaction mixtures: 7.5 μL of Isothermal Mastermix Fluorescence Dye (OptiGene Ltd., UK), 3.5 μL of Primers Mix (amounts in reaction: Table 1), 1 μL of ddH2O and 1 μL of DNA template. The reaction mixtures were incubated at 63°C for 60 min with fluorescence recording/detection every 45 sec and subsequently, to melt the reaction products, heated to 95°C for 15 sec, with fluorescence recorded after every temperature change of 0.5°C. The LAMP products were detected with the Line Gene-K Fluorescent Quantitative Detection System (Hangzou Bioer Technology Co. Ltd.). Table 1. Sequences of LAMP primers used in the study. Primer  Sequence (5΄–3΄)  pmol in LAMP reaction  SodGA-F3  AACACCACCAAGCTTATGTAA  2.5  SodGA-B3  TCAATGGGTTGTCTTGGTTT  2.5  SodGA-FIP (F1c+F2)  TCTGCTGGCACTTTGTCTAAGTTTTTACTTGAAGGCTTATCTGAAGAA  10  SodGA-BIP (B1c+B2)  TTCGGTTCTGTTGATGCCTTCATTTAATACTAACCACGCCCAG  10  SodGA-LoopF  TCCTGGGCACATTGCTTT  5  SodGA-LoopB  GCAACTCGTTTCGGTTCAG  5  Primer  Sequence (5΄–3΄)  pmol in LAMP reaction  SodGA-F3  AACACCACCAAGCTTATGTAA  2.5  SodGA-B3  TCAATGGGTTGTCTTGGTTT  2.5  SodGA-FIP (F1c+F2)  TCTGCTGGCACTTTGTCTAAGTTTTTACTTGAAGGCTTATCTGAAGAA  10  SodGA-BIP (B1c+B2)  TTCGGTTCTGTTGATGCCTTCATTTAATACTAACCACGCCCAG  10  SodGA-LoopF  TCCTGGGCACATTGCTTT  5  SodGA-LoopB  GCAACTCGTTTCGGTTCAG  5  View Large Analytical Specificity and Sensitivity of the G. anatis LAMP Assay The analytical specificity was tested using DNA extracted from various members of the family Pasteurellaceae described in the “Bacterial strains” section. To evaluate the sensitivity of the LAMP assay, a 10-fold serial dilutions of DNA isolated from randomly selected G. anatis field strains and the reference strain were tested. The amount of DNA in the undiluted samples (100) was estimated with a Nanodrop™ 2000 UV/VIS Spectrophotometer (Thermo Fisher Scientific, Waltham, MA). The amplification rate and the sensitivity of the LAMP reaction were calculated by serial dilutions analysis of the DNA isolated from the G. anatis strains. The LAMP results were given as the threshold cycle (Ct), assigned by the Fit Point method, and the melting temperature. Quantitative PCR (qPCR) Selected samples tested with the LAMP assay were also tested in real-time PCR based on DNA-intercalating dye, using the LAMP outer F3 and B3 primers. The 10 μL reaction volumes contained 5 μL AmpliQ qPCR OptiGreen Buffer (2x) (Novazym, Poznań, Poland), 0.5 μL F3 and 0.5 μL B3 (10 μM each primer), 1 μL of the DNA sample, and Milli-Q water to final volume. Reactions were performed in the Line Gene-K system, and included an initial denaturation at 95°C for 10 min followed by 45 cycles of 20 sec at 95°C, 20 sec at 58°C, 20 sec at 72°C, and the melting step. The real-time PCR results were given in the same parameters as in the LAMP procedure. RESULTS The LAMP Assay and Quantitative PCR All 120 G. anatis field isolates and the reference strain G. anatis ATCC 43329 were correctly identified by the G. anatis LAMP assay (Figure 1). No amplifications of the other test bacteria of the family Pasteurellaceae or E. coli were observed (Figure 2). No significant differences among the bacteria were obtained by melting curve analysis compared to G. anatis reference strain. The LAMP amplicons showed similar melting curves that indicated a product melting temperature (Tm) of about 85.5°C (± 0.5°C), suggesting amplicons of a similar sequence (Figure 1). Figure 1. View largeDownload slide Accuracy of the Gallibacterium anatis real-time LAMP assay: Comparison of G. anatis field strains in the LAMP assay; the melting products had a melting temp. of 85.5 ± 0.5°C indicating amplicons of similar sequences. Figure 1. View largeDownload slide Accuracy of the Gallibacterium anatis real-time LAMP assay: Comparison of G. anatis field strains in the LAMP assay; the melting products had a melting temp. of 85.5 ± 0.5°C indicating amplicons of similar sequences. Figure 2. View largeDownload slide Gallibacterium anatis real-time LAMP assay specificity (A and B) and sensitivity (C and D). A) Amplification curves illustrate a comparison of the LAMP results for G. anatis and other bacterial species: Haemophilus parainfluenzae (ATCC 51505), Aggregatibacter aphrophilus (ATCC 7901), Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale and Escherichia coli; B) Melting curves of amplicons of the above strains; C) Comparison of the LAMP amplification curves of serial dilutions of G. anatis strains (reference and no. 3771/3/14); D) Reaction efficiency—serial dilutions of field strain no. 3771/3/14 (example). Figure 2. View largeDownload slide Gallibacterium anatis real-time LAMP assay specificity (A and B) and sensitivity (C and D). A) Amplification curves illustrate a comparison of the LAMP results for G. anatis and other bacterial species: Haemophilus parainfluenzae (ATCC 51505), Aggregatibacter aphrophilus (ATCC 7901), Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale and Escherichia coli; B) Melting curves of amplicons of the above strains; C) Comparison of the LAMP amplification curves of serial dilutions of G. anatis strains (reference and no. 3771/3/14); D) Reaction efficiency—serial dilutions of field strain no. 3771/3/14 (example). The DNA concentrations of strains selected for sensitivity testing ranged from 139.9 to 656.1 ng/μL. The lowest detectable amount of DNA for the LAMP reaction was 0.2561 pg, which was detected in about 34 min, while the highest available concentration of the G. anatis reference strain was detected in about 10 minutes (Table 2). The technique was able to detect 106-fold dilutions 2 of the 4 samples. A graphical representation of the LAMP data (amplification analysis and reaction efficiency), using serial dilutions of the reference strain and field strain no. 3771/3/14 as an example, is presented in Figure 2 (C and D). Table 2. Performance characteristics of the LAMP assay in comparison with qPCR. G. anatis strain  Dilution step  DNA amount ng/μL  LAMP  qPCR        Cta  Tmb (°C)  Cta  Tmb (°C)  ATCC 43329  100  656.1  10.31  86  6.96  85    10−1  65.61  13.93  86  9.92  85    10−2  6.561  16.62  85.5  14.46  85    10−3  0.6561  18.74  85.5  17.91  85    10−4  0.06561  22.20  85.5  19.82  86.5    10−5  0.006561  25.69  85.5  nd  nd    10−6  0.0006561  28.30  85.5  nd  nd  Field strain No. 3771/3/14  100  256.1  14.58  85.5  7.29  84.5    10−1  25.61  17.41  85.5  9.31  84.5    10−2  2.561  21.01  85.5  15.36  85    10−3  0.2561  24.95  85.5  17.74  86    10−4  0.02561  29.62  85.5  19.38  86    10−5  0.002561  31.81  85.5  nd  nd    10−6  0.0002561  33.71  85.5  nd  nd  Field strain No. 1866/4/14  100  212.4  25.35  85  7.17  84    10−1  21.24  27.86  85  10.36  84    10−2  2.124  29.92  85  15.43  84    10−3  0.2124  32.20  85  18.39  85.5    10−4  0.02124  35.41  85  19.33  86    10−5  0.002124  37.89  85  nd  nd    10−6  0.0002124  nd  nd  nd  nd  Field strain No. 5146/1/15  100  139.9  23.75  85  10.82  84    10−1  13.99  24.65  85  11.41  84    10−2  1.399  25.41  85  16.77  85.5    10−3  0.1399  26.00  85  18.96  85.5    10−4  0.01399  27.43  85  nd  nd    10−5  0.001399  28.23  85  nd  nd    10−6  0.0001399  nd  nd  nd  nd  G. anatis strain  Dilution step  DNA amount ng/μL  LAMP  qPCR        Cta  Tmb (°C)  Cta  Tmb (°C)  ATCC 43329  100  656.1  10.31  86  6.96  85    10−1  65.61  13.93  86  9.92  85    10−2  6.561  16.62  85.5  14.46  85    10−3  0.6561  18.74  85.5  17.91  85    10−4  0.06561  22.20  85.5  19.82  86.5    10−5  0.006561  25.69  85.5  nd  nd    10−6  0.0006561  28.30  85.5  nd  nd  Field strain No. 3771/3/14  100  256.1  14.58  85.5  7.29  84.5    10−1  25.61  17.41  85.5  9.31  84.5    10−2  2.561  21.01  85.5  15.36  85    10−3  0.2561  24.95  85.5  17.74  86    10−4  0.02561  29.62  85.5  19.38  86    10−5  0.002561  31.81  85.5  nd  nd    10−6  0.0002561  33.71  85.5  nd  nd  Field strain No. 1866/4/14  100  212.4  25.35  85  7.17  84    10−1  21.24  27.86  85  10.36  84    10−2  2.124  29.92  85  15.43  84    10−3  0.2124  32.20  85  18.39  85.5    10−4  0.02124  35.41  85  19.33  86    10−5  0.002124  37.89  85  nd  nd    10−6  0.0002124  nd  nd  nd  nd  Field strain No. 5146/1/15  100  139.9  23.75  85  10.82  84    10−1  13.99  24.65  85  11.41  84    10−2  1.399  25.41  85  16.77  85.5    10−3  0.1399  26.00  85  18.96  85.5    10−4  0.01399  27.43  85  nd  nd    10−5  0.001399  28.23  85  nd  nd    10−6  0.0001399  nd  nd  nd  nd  aCt, detection cycle; b Tm, annealing temperature; nd, not detected; bold font, the lowest amount of DNA detected by LAMP; italics, the lowest amount of DNA detected by qPCR. View Large The lowest detectable amount of DNA for the real-time PCR reaction was 21.24 pg, which could be detected in about 20 min, while the highest available concentration of the G. anatis reference strain was detected in about 7 minutes (Table 2). Using this technique it was possible to detect 104-fold dilutions of 3 of the 4 samples. DISCUSSION Several methods have been developed for identification of Gallibacterium. They include phenotypic identification (Dousse et al., 2008), fluorescence in situ hybridization (Bojesen et al., 2003), MALDI-TOF mass spectrometry (Alispahic et al., 2011), conventional Gallibacterium PCR (Bojesen et al., 2007), and a quantitative PCR assay based on the gtxA gene (Huangfu et al., 2012). However, it is difficult to uniquely identify the species G. anatis by any of these methods. The purpose of our study was to develop a real-time LAMP assay based on the sodA gene. This housekeeping gene, which encodes manganese-dependent superoxide dismutase (sodA), has proved very useful for investigating phylogeny within Pasteurellaceae. Gautier et al. (2005) described the construction of a sodA library of 24 species of the genera Pasteurella, Gallibacterium, and Mannheimia, and demonstrated its usefulness for rapid sequence-based identification of human clinical isolates. Król et al. (2011) developed a species-specific PCR technique based on the sodA gene for identification of clinically relevant Pasteurellaceae isolated from cats and dogs. Therefore, in this study, the conserved region of the sodA gene was used as the specific primer amplification region to design the 3 primer pairs needed in the LAMP technique. The specificity of the LAMP assay is high, because it employs 6 specially designed primers recognizing 6 regions on the sodA gene sequence, which is specific to G. anatis. Thus the LAMP assay successfully detected all tested G. anatis strains, in good agreement with previous identification results obtained by MALDI-TOF MS and a G. anatis-specific PCR assay or rpoB sequencing (data not shown). Correct species-specific identification of G. anatis by a qPCR method based on the gyrB gene was also presented by Wang et al. (2016), who noted that the qPCR reactions require small quantities of DNA template than conventional PCR. In the current study, however, the LAMP reactions generally required even lower amounts of DNA template, enabling detection of nearly 80 times less DNA than the qPCR technique. Previous investigations have also found the LAMP assay to be more sensitive than conventional PCR assays for detection of Haemophilus parasuis (Zhang et al., 2011), Pasteurella multocida (Sun et al., 2010; Bhimani et al., 2015), Riemerella anatipestifer (Han et al., 2011) and Actinobacillus pleuropneumoniae (Ji et al., 2012). Furthermore, the result of the real-time LAMP assay is easy to interpret, especially for evaluation of DNA concentrations from test samples. In addition, the present study showed that the LAMP results were available after a shorter reaction time, which was consistent with results obtained by Bhimani et al. (2015) and Han et al. (2011). The results of our report also showed that the LAMP test gave negative reactions in all other bacterial species analysed for the evaluation of primer specificity. In conclusion, the results of our study demonstrate that the G. anatis real-time LAMP assay is a useful molecular test for rapid, reliable, and accurate identification of G. anatis strains. Comparison of the 2 assays used indicates better sensitivity for the LAMP method and a shorter reaction time than for quantitative PCR. The LAMP technique is highly specific due to the use of a set of 6 primers and is comparatively inexpensive, especially as it successfully performs reactions in a reaction volume half of the officially recommended volume (13 μL final volume instead 25 μL). It therefore seems that this simple and reliable test can be applied in routine diagnosis in the clinical laboratory. A potentially attractive alternative to identification of G. anatis by real-time LAMP is a LAMP technique in which the results are read with the naked eye or under UV light, which is easy to implement and requires no additional thermal cyclers. It can be useful for veterinarians without access to the PCR technique. Moreover, this method can be extended to detect the pathogen directly from tissues or swabs. Therefore, further research will be undertaken to demonstrate the effectiveness and sensitivity of the LAMP method in detecting G. anatis in this type of material without conventional or real-time PCR equipment. REFERENCES Alispahic M., Christensen H., Hess C., Razzazi-Fazeli E., Bisgaard M., Hess M.. 2011. Identification of Gallibacterium species by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evaluated by multilocus sequence analysis. Int. J. Med. Microbiol.  301: 513– 522. Google Scholar CrossRef Search ADS PubMed  Aubin G. G., Haloun A., Treilhaud M., Reynaud A., Corvec S.. 2013. Gallibacterium anatis bacteremia in a human. J. Clin. Microbiol . 51: 3897– 3899. Google Scholar CrossRef Search ADS PubMed  Bhimani M., Bhanderi B., Roy A.. 2015. Loop-mediated Isothermal Amplification assay (LAMP) based detection of Pasteurella multocida in cases of haemorrhagic septicaemia and fowl cholera. Vet. Ital.  51: 115– 121. Google Scholar PubMed  Bisgaard M., Korczak B. M., Busse H. J., Kuhnert P., Bojesen A. M., Christensen H.. 2009. Classification of the taxon 2 and taxon 3 complex of Bisgaard within Gallibacterium and description of Gallibacterium melopsittaci sp. nov., Gallibacterium trehalosifermentans sp. nov. and Gallibacterium salpingitidis sp. nov. Int. J. Syst. Evol. Microbiol . 59: 735– 744. Google Scholar CrossRef Search ADS PubMed  Bojesen A. M., Shivaprasad H. L.. 2007. Genetic diversity of Gallibacterium isolates from California turkey. Avian Pathol . 36: 227– 230. Google Scholar CrossRef Search ADS PubMed  Bojesen A. M., Vazquez M. E., Robles F., Gonzalez C., Soriano E. V., Olsen J. E., Christensen H.. 2007. Specific identification of Gallibacterium by a PCR using primers targeting the 16S rRNA and 23S rRNA genes. Vet. Microbiol.  123: 262– 268. Google Scholar CrossRef Search ADS PubMed  Bojesen A. M., Christensen H., Nielsen O. L., Olsen J. E., Bisgaard M.. 2003. Detection of Gallibacterium spp. in chickens by fluorescent 16S rRNA in situ hybridization. J. Clin. Microbiol.  41: 5167– 5172. Google Scholar CrossRef Search ADS PubMed  Dousse F., Thomann A., Brodard I., Korczak B. M., Schlatter Y., Kuhnert P., Miserez R., Frey J.. 2008. Routine phenotypic identification of bacterial species of the family Pasteurellaceae isolated from animals. J. Vet. Diagn. Invest.  20: 716– 724. Google Scholar CrossRef Search ADS PubMed  Gautier A. L., Dubois D., Escande F., Avril J. L., Trieu-Cuot P., Gaillot O.. 2005. Rapid and accurate identification of human isolates of Pasteurella and related species by sequencing the sodA gene. J. Clin. Microbiol.  43: 2307– 2314. Google Scholar CrossRef Search ADS PubMed  Han X., Ding C., He L., Hu Q., Yu S.. 2011. Development of loop-mediated isothermal amplification (LAMP) targeting the GroEL gene for rapid detection of Riemerella anatipestifer. Avian Dis . 55: 379– 383. Google Scholar CrossRef Search ADS PubMed  Huangfu H., Zhao J., Yang X., Chen L., Chang H., Wang X., Li Q., Yao H., Wang C.. 2012. Development and preliminary application of a quantitative PCR assay for detecting gtxA-containing Gallibacterium species in chickens. Avian Dis . 56: 315– 320. Google Scholar CrossRef Search ADS PubMed  Iwamoto T., Sonobe T., Hayashi K.. 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum sample. J. Clin. Microbiol . 41: 2616– 2622. Google Scholar CrossRef Search ADS PubMed  Ji H., Li H., Zhu L., Zhang H., Wang Y., Zuo Z., Guo W., Xu Z.. 2012. Development and evaluation of a loop–mediated isothermal amplification (LAMP) assay for rapid detection of Actinobacillus pleuropneumoniae based the dsbE–like gene1. Pesq. Vet. Bras.  32: 757– 760. Google Scholar CrossRef Search ADS   Johnson T. J., Danzeisen J. L., Trampel D., Nolan L. K., Seemann T., Bager R. J., Bojesen A. M.. 2013. Genome analysis and phylogenetic relatedness of Gallibacterium anatis strains from poultry. PLoS One . 8: e54844. Google Scholar CrossRef Search ADS PubMed  Korczak B., Christensen H., Emler S., Frey J., Kuhnert P.. 2004. Phylogeny of the family Pasteurellaceae based on rpoB sequences. Int. J. Syst. Evol. Microbiol.  54: 1393– 1399. Google Scholar CrossRef Search ADS PubMed  Król J., Bania J., Florek M., Pliszczak-Król A., Staroniewicz Z.. 2011. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland. J. Vet. Diagn. Invest.  23: 532– 537. Google Scholar CrossRef Search ADS PubMed  Kursa O., Woźniakowski G., Tomczyk G., Sawicka A., Minta Z.. 2015. Rapid detection of Mycoplasma synoviae by loop-mediated isothermal amplification. Arch. Microbiol.  197: 319– 325. Google Scholar CrossRef Search ADS PubMed  Liu M. J., Du G. M., Bai F. F., Wu Y. Z., Xiong Q. Y., Feng Z. X., Li B., Shao G. Q.. 2015. A rapid and sensitive loop-mediated isothermal amplification procedure (LAMP) for Mycoplasma hyopneumoniae detection based on the p36 gene. Genet. Mol. Res.  14: 4677– 4686. Google Scholar CrossRef Search ADS PubMed  Mair G., Vilei E. M., Wade A., Frey J., Unger H.. 2013. Isothermal loop-mediated amplification (LAMP) for diagnosis of contagious bovine pleuro-pneumonia. BMC Vet. Res. 27 : 9: 108. Google Scholar CrossRef Search ADS   Mori Y., Notomi T.. 2002. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother.  15: 62– 69. Google Scholar CrossRef Search ADS   Neubauer C., De Souza-Pilz M., Bojesen A. M., Bisgaard M., Hess M.. 2009. Tissue distribution of haemolytic Gallibacterium anatis isolates in laying birds with reproductive disorders. Avian Pathol . 38: 1– 7. Google Scholar CrossRef Search ADS PubMed  Paudel S., Alispahic M., Liebhart D., Hess M., Hess C.. 2013. Assessing pathogenicity of Gallibacterium anatis in a natural infection model: the respiratory and reproductive tracts of chickens are targets for bacterial colonization. Avian Pathol . 42: 527– 535. Google Scholar CrossRef Search ADS PubMed  Stępień-Pyśniak D., Hauschild T., Różański P., Marek A.. 2017. MALDI-TOF mass spectrometry as a useful tool for identification of Enterococcus spp. from wild birds and differentiation of closely related species. J. Microbiol. Biotechnol.  27: 1128– 1137. Google Scholar PubMed  Sun D., Wang J., Wu R., Wang C., He X., Zheng J., Yang H.. 2010. Development of a novel LAMP diagnostic method for visible detection of swine Pasteurella multocida. Vet. Res. Commun.  34: 649– 657. Google Scholar CrossRef Search ADS PubMed  Wang C. H., Robles F., Ramirez S., Brinch Riber A., Bojesen A. M.. 2016. Culture-independent identification and quantification of Gallibacterium anatis (G. anatis) by Real-Time quantitative PCR. Avian Pathol.  45: 538– 544. Google Scholar CrossRef Search ADS PubMed  Woźniakowski G., Samorek-Salamonowicz E., Kozdruń W.. 2011. Rapid detection of Marek's disease virus in feather follicles by loop-mediated amplification. Avian Dis . 55: 462– 467. Google Scholar CrossRef Search ADS PubMed  Zhang J. M., Shen H. Y., Xu G. G., Guo L. L., Zhang B., Li J. Y., Chen J. D., Fan H. Y., Liao M.. 2011. Development and application of a loop-mediated isothermal amplification method for rapid detection of Haemophilus parasuis. Afr. J. Biotechnol.  10: 10263– 10270. Google Scholar CrossRef Search ADS   © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

A loop-mediated isothermal amplification procedure targeting the sodA gene for rapid and specific identification of Gallibacterium anatis

Loading next page...
 
/lp/ou_press/a-loop-mediated-isothermal-amplification-procedure-targeting-the-soda-iqHOUVknz2
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex420
Publisher site
See Article on Publisher Site

Abstract

Abstract This paper reports on the development and validation of a real-time loop-mediated isothermal amplification assay (LAMP) for rapid and specific identification of Gallibacterium anatis. To design a set of 6 primers using the LAMP technique, the conserved region of the G. anatis sodA gene was selected as a target. To evaluate primer specificity we used 120 field strains, the reference strain G. anatis ATCC 43329, and 9 non-G. anatis bacteria. The results confirmed positive reactions for all G. anatis strains tested by LAMP at 63°C for 60 min, with no cross-reactivity observed for the negative control bacteria, i.e., Haemophilus parainfluenzae (ATCC 51505 and ATCC 33392), Aggregatibacter aphrophilus ATCC 7901, Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale, and Escherichia coli. The lowest detectable amount of DNA for the LAMP reaction was 0.2561 pg, which was detected in about 34 min, while the highest available concentration of the G. anatis reference strain was detected in about 10 min. The lowest detectable amount of DNA for the real-time PCR reaction was 21.24 pg, which was detected in about 20 min, while the highest available concentration of the G. anatis reference strain was detected in about 7 min. Moreover, using the real-time LAMP assay the reaction could be effectively carried out in a volume of just 13 μL, about half the officially recommended reaction volume (25 μL). The aim of this study was to develop a highly sensitive and specific G. anatis real-time LAMP assay that is less time-consuming and less costly than quantitative PCR. INTRODUCTION Gallibacterium anatis is a gram-negative, facultative anerobic, rod-shaped or pleomorphic bacterium. The genus Gallibacterium currently includes 4 species (Bisgaard et al. 2009). The most common of these is Gallibacterium anatis biovar haemolytica, which causes salpingitis, oophoritis, peritonitis, septicemia, pericarditis, hepatitis, enteritis, and lung lesions in poultry (Neubauer et al., 2009; Paudel et al., 2013). G. anatis is usually isolated from breeding and laying hens, but also can cause lesions in the upper respiratory tract of turkeys (Bojesen and Shivaprasad, 2007). There is also evidence that this bacterium can infect human beings (Gautier et al., 2005; Aubin et al., 2013). While G. anatis is a member of the normal flora of the upper respiratory tract and lower reproductive tract, diseased birds are more susceptible to secondary infections, especially those associated with Escherichia coli (Neubauer et al., 2009; Johnson et al., 2013). Therefore, it has a significant negative economic impact in the poultry industry, resulting from reduced egg production, inadequate animal welfare, and increased mortality. Although G. anatis often infects laying hens, it is rarely isolated from dead chickens with typical lesions during routine diagnostic bacteriological examination (Wang et al., 2016). The genus Gallibacterium is a phenotypically heterogeneous group (Bojesen et al., 2007), and biochemical identification involves laborious and time-consuming methods, the results of which may be inconclusive due to the variable properties of these microorganisms (Dousse et al., 2008). For this reason, molecular techniques producing clear results in a short time are used for rapid and accurate species identification. The loop-mediated isothermal amplification (LAMP) method has recently been included among diagnostic methods based on nucleic acid amplification, which are officially recommended for routine identification and analysis of many pathogens (Mori and Notomi, 2002). LAMP can be a specific method to detect the genetic material of selected pathogens that are difficult to isolate and/or identify from a microbial culture or tissues (Iwamoto et al., 2003; Mair et al., 2013; Kursa et al, 2015; Liu et al., 2015). It provides highly specific and accurate identification of pathogen DNA in a very short time (up to 1 h for the DNA isolation and the LAMP reaction). The LAMP method uses a set of inner primers (forward [FIP] and backward [BIP]), outer primers (F3 and B3) and forward and backward loop primers (FL and BL), which enable faster formation of loop and hairpin structures and thus faster detection of specific DNA. Amplification is performed under isothermal conditions of 60 to 65°C. The final products form cauliflower-like structures with multiple overhangs (Woźniakowski et al., 2011). The aim of this study was to develop a G. anatis assay based on the LAMP technique. To the best of our knowledge, there is no publication describing this method of identification of G. anatis. The paper describes the first use of the real-time LAMP method for rapid and highly specific identification of G. anatis isolated from hens and turkeys. MATERIAL AND METHODS Bacterial Strains A total of 120 field isolates of G. anatis biovar haemolytica, collected in the years 2013 to 2016, were used in the study. The bacteria were isolated from the internal organs (heart, liver, ovary, oviduct; tracheal, peritoneal cloacal and air sac swabs) of laying and breeding hens and turkeys during diagnostic examinations. These isolates were previously identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) (Alispahic et al., 2011; Stępień-Pyśniak et al., 2017) and Gallibacterium species-specific polymerase chain reaction (PCR) (Bojesen et al., 2007). If species-specific PCR was insufficient, Gallibacterium isolates were identified and assigned to specific Gallibacterium species by partial sequencing of the rpoB gene (Korczak et al., 2004). The reference strain Gallibacterium anatis ATCC 43329 was used as a positive control. Primer specificity was evaluated using the reference strains Haemophilus parainfluenzae ATCC 51505 and ATCC 33392 and Aggregatibacter aphrophilus ATCC 7901, as well as strains of Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale, and Escherichia coli. DNA Extraction Genomic DNA was extracted from the test strains using the Novabeads Bacterial DNA Mini Kit (Novazym, Poznan, Poland). The DNA samples were stored at −70°C until further analysis. Loop-Mediated Isothermal Amplification (LAMP) The species-specific G. anatis LAMP assay was designed based on the sodA sequence of a G. anatis strain (Accession number: CP002667.1). Six complementary primers were designed using PrimerExplorer V4 (Eiken Chemical Co. Ltd., Japan) and by manual assignment: F3, forward outer primer; B3, backward outer primer; FIP (F1C+F2), forward inner primer; BIP (B1c+B2), backward inner primer; LoopF, forward loop primer; LoopB, backward loop primer (Table 1). LAMP reactions were conducted in 13 μL of reaction mixtures: 7.5 μL of Isothermal Mastermix Fluorescence Dye (OptiGene Ltd., UK), 3.5 μL of Primers Mix (amounts in reaction: Table 1), 1 μL of ddH2O and 1 μL of DNA template. The reaction mixtures were incubated at 63°C for 60 min with fluorescence recording/detection every 45 sec and subsequently, to melt the reaction products, heated to 95°C for 15 sec, with fluorescence recorded after every temperature change of 0.5°C. The LAMP products were detected with the Line Gene-K Fluorescent Quantitative Detection System (Hangzou Bioer Technology Co. Ltd.). Table 1. Sequences of LAMP primers used in the study. Primer  Sequence (5΄–3΄)  pmol in LAMP reaction  SodGA-F3  AACACCACCAAGCTTATGTAA  2.5  SodGA-B3  TCAATGGGTTGTCTTGGTTT  2.5  SodGA-FIP (F1c+F2)  TCTGCTGGCACTTTGTCTAAGTTTTTACTTGAAGGCTTATCTGAAGAA  10  SodGA-BIP (B1c+B2)  TTCGGTTCTGTTGATGCCTTCATTTAATACTAACCACGCCCAG  10  SodGA-LoopF  TCCTGGGCACATTGCTTT  5  SodGA-LoopB  GCAACTCGTTTCGGTTCAG  5  Primer  Sequence (5΄–3΄)  pmol in LAMP reaction  SodGA-F3  AACACCACCAAGCTTATGTAA  2.5  SodGA-B3  TCAATGGGTTGTCTTGGTTT  2.5  SodGA-FIP (F1c+F2)  TCTGCTGGCACTTTGTCTAAGTTTTTACTTGAAGGCTTATCTGAAGAA  10  SodGA-BIP (B1c+B2)  TTCGGTTCTGTTGATGCCTTCATTTAATACTAACCACGCCCAG  10  SodGA-LoopF  TCCTGGGCACATTGCTTT  5  SodGA-LoopB  GCAACTCGTTTCGGTTCAG  5  View Large Analytical Specificity and Sensitivity of the G. anatis LAMP Assay The analytical specificity was tested using DNA extracted from various members of the family Pasteurellaceae described in the “Bacterial strains” section. To evaluate the sensitivity of the LAMP assay, a 10-fold serial dilutions of DNA isolated from randomly selected G. anatis field strains and the reference strain were tested. The amount of DNA in the undiluted samples (100) was estimated with a Nanodrop™ 2000 UV/VIS Spectrophotometer (Thermo Fisher Scientific, Waltham, MA). The amplification rate and the sensitivity of the LAMP reaction were calculated by serial dilutions analysis of the DNA isolated from the G. anatis strains. The LAMP results were given as the threshold cycle (Ct), assigned by the Fit Point method, and the melting temperature. Quantitative PCR (qPCR) Selected samples tested with the LAMP assay were also tested in real-time PCR based on DNA-intercalating dye, using the LAMP outer F3 and B3 primers. The 10 μL reaction volumes contained 5 μL AmpliQ qPCR OptiGreen Buffer (2x) (Novazym, Poznań, Poland), 0.5 μL F3 and 0.5 μL B3 (10 μM each primer), 1 μL of the DNA sample, and Milli-Q water to final volume. Reactions were performed in the Line Gene-K system, and included an initial denaturation at 95°C for 10 min followed by 45 cycles of 20 sec at 95°C, 20 sec at 58°C, 20 sec at 72°C, and the melting step. The real-time PCR results were given in the same parameters as in the LAMP procedure. RESULTS The LAMP Assay and Quantitative PCR All 120 G. anatis field isolates and the reference strain G. anatis ATCC 43329 were correctly identified by the G. anatis LAMP assay (Figure 1). No amplifications of the other test bacteria of the family Pasteurellaceae or E. coli were observed (Figure 2). No significant differences among the bacteria were obtained by melting curve analysis compared to G. anatis reference strain. The LAMP amplicons showed similar melting curves that indicated a product melting temperature (Tm) of about 85.5°C (± 0.5°C), suggesting amplicons of a similar sequence (Figure 1). Figure 1. View largeDownload slide Accuracy of the Gallibacterium anatis real-time LAMP assay: Comparison of G. anatis field strains in the LAMP assay; the melting products had a melting temp. of 85.5 ± 0.5°C indicating amplicons of similar sequences. Figure 1. View largeDownload slide Accuracy of the Gallibacterium anatis real-time LAMP assay: Comparison of G. anatis field strains in the LAMP assay; the melting products had a melting temp. of 85.5 ± 0.5°C indicating amplicons of similar sequences. Figure 2. View largeDownload slide Gallibacterium anatis real-time LAMP assay specificity (A and B) and sensitivity (C and D). A) Amplification curves illustrate a comparison of the LAMP results for G. anatis and other bacterial species: Haemophilus parainfluenzae (ATCC 51505), Aggregatibacter aphrophilus (ATCC 7901), Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale and Escherichia coli; B) Melting curves of amplicons of the above strains; C) Comparison of the LAMP amplification curves of serial dilutions of G. anatis strains (reference and no. 3771/3/14); D) Reaction efficiency—serial dilutions of field strain no. 3771/3/14 (example). Figure 2. View largeDownload slide Gallibacterium anatis real-time LAMP assay specificity (A and B) and sensitivity (C and D). A) Amplification curves illustrate a comparison of the LAMP results for G. anatis and other bacterial species: Haemophilus parainfluenzae (ATCC 51505), Aggregatibacter aphrophilus (ATCC 7901), Avibacterium endocarditis, Pasteurella multocida, Actinobacillus pleuropneumoniae, Avibacterium paragallinarum, Ornithobacterium rhinotracheale and Escherichia coli; B) Melting curves of amplicons of the above strains; C) Comparison of the LAMP amplification curves of serial dilutions of G. anatis strains (reference and no. 3771/3/14); D) Reaction efficiency—serial dilutions of field strain no. 3771/3/14 (example). The DNA concentrations of strains selected for sensitivity testing ranged from 139.9 to 656.1 ng/μL. The lowest detectable amount of DNA for the LAMP reaction was 0.2561 pg, which was detected in about 34 min, while the highest available concentration of the G. anatis reference strain was detected in about 10 minutes (Table 2). The technique was able to detect 106-fold dilutions 2 of the 4 samples. A graphical representation of the LAMP data (amplification analysis and reaction efficiency), using serial dilutions of the reference strain and field strain no. 3771/3/14 as an example, is presented in Figure 2 (C and D). Table 2. Performance characteristics of the LAMP assay in comparison with qPCR. G. anatis strain  Dilution step  DNA amount ng/μL  LAMP  qPCR        Cta  Tmb (°C)  Cta  Tmb (°C)  ATCC 43329  100  656.1  10.31  86  6.96  85    10−1  65.61  13.93  86  9.92  85    10−2  6.561  16.62  85.5  14.46  85    10−3  0.6561  18.74  85.5  17.91  85    10−4  0.06561  22.20  85.5  19.82  86.5    10−5  0.006561  25.69  85.5  nd  nd    10−6  0.0006561  28.30  85.5  nd  nd  Field strain No. 3771/3/14  100  256.1  14.58  85.5  7.29  84.5    10−1  25.61  17.41  85.5  9.31  84.5    10−2  2.561  21.01  85.5  15.36  85    10−3  0.2561  24.95  85.5  17.74  86    10−4  0.02561  29.62  85.5  19.38  86    10−5  0.002561  31.81  85.5  nd  nd    10−6  0.0002561  33.71  85.5  nd  nd  Field strain No. 1866/4/14  100  212.4  25.35  85  7.17  84    10−1  21.24  27.86  85  10.36  84    10−2  2.124  29.92  85  15.43  84    10−3  0.2124  32.20  85  18.39  85.5    10−4  0.02124  35.41  85  19.33  86    10−5  0.002124  37.89  85  nd  nd    10−6  0.0002124  nd  nd  nd  nd  Field strain No. 5146/1/15  100  139.9  23.75  85  10.82  84    10−1  13.99  24.65  85  11.41  84    10−2  1.399  25.41  85  16.77  85.5    10−3  0.1399  26.00  85  18.96  85.5    10−4  0.01399  27.43  85  nd  nd    10−5  0.001399  28.23  85  nd  nd    10−6  0.0001399  nd  nd  nd  nd  G. anatis strain  Dilution step  DNA amount ng/μL  LAMP  qPCR        Cta  Tmb (°C)  Cta  Tmb (°C)  ATCC 43329  100  656.1  10.31  86  6.96  85    10−1  65.61  13.93  86  9.92  85    10−2  6.561  16.62  85.5  14.46  85    10−3  0.6561  18.74  85.5  17.91  85    10−4  0.06561  22.20  85.5  19.82  86.5    10−5  0.006561  25.69  85.5  nd  nd    10−6  0.0006561  28.30  85.5  nd  nd  Field strain No. 3771/3/14  100  256.1  14.58  85.5  7.29  84.5    10−1  25.61  17.41  85.5  9.31  84.5    10−2  2.561  21.01  85.5  15.36  85    10−3  0.2561  24.95  85.5  17.74  86    10−4  0.02561  29.62  85.5  19.38  86    10−5  0.002561  31.81  85.5  nd  nd    10−6  0.0002561  33.71  85.5  nd  nd  Field strain No. 1866/4/14  100  212.4  25.35  85  7.17  84    10−1  21.24  27.86  85  10.36  84    10−2  2.124  29.92  85  15.43  84    10−3  0.2124  32.20  85  18.39  85.5    10−4  0.02124  35.41  85  19.33  86    10−5  0.002124  37.89  85  nd  nd    10−6  0.0002124  nd  nd  nd  nd  Field strain No. 5146/1/15  100  139.9  23.75  85  10.82  84    10−1  13.99  24.65  85  11.41  84    10−2  1.399  25.41  85  16.77  85.5    10−3  0.1399  26.00  85  18.96  85.5    10−4  0.01399  27.43  85  nd  nd    10−5  0.001399  28.23  85  nd  nd    10−6  0.0001399  nd  nd  nd  nd  aCt, detection cycle; b Tm, annealing temperature; nd, not detected; bold font, the lowest amount of DNA detected by LAMP; italics, the lowest amount of DNA detected by qPCR. View Large The lowest detectable amount of DNA for the real-time PCR reaction was 21.24 pg, which could be detected in about 20 min, while the highest available concentration of the G. anatis reference strain was detected in about 7 minutes (Table 2). Using this technique it was possible to detect 104-fold dilutions of 3 of the 4 samples. DISCUSSION Several methods have been developed for identification of Gallibacterium. They include phenotypic identification (Dousse et al., 2008), fluorescence in situ hybridization (Bojesen et al., 2003), MALDI-TOF mass spectrometry (Alispahic et al., 2011), conventional Gallibacterium PCR (Bojesen et al., 2007), and a quantitative PCR assay based on the gtxA gene (Huangfu et al., 2012). However, it is difficult to uniquely identify the species G. anatis by any of these methods. The purpose of our study was to develop a real-time LAMP assay based on the sodA gene. This housekeeping gene, which encodes manganese-dependent superoxide dismutase (sodA), has proved very useful for investigating phylogeny within Pasteurellaceae. Gautier et al. (2005) described the construction of a sodA library of 24 species of the genera Pasteurella, Gallibacterium, and Mannheimia, and demonstrated its usefulness for rapid sequence-based identification of human clinical isolates. Król et al. (2011) developed a species-specific PCR technique based on the sodA gene for identification of clinically relevant Pasteurellaceae isolated from cats and dogs. Therefore, in this study, the conserved region of the sodA gene was used as the specific primer amplification region to design the 3 primer pairs needed in the LAMP technique. The specificity of the LAMP assay is high, because it employs 6 specially designed primers recognizing 6 regions on the sodA gene sequence, which is specific to G. anatis. Thus the LAMP assay successfully detected all tested G. anatis strains, in good agreement with previous identification results obtained by MALDI-TOF MS and a G. anatis-specific PCR assay or rpoB sequencing (data not shown). Correct species-specific identification of G. anatis by a qPCR method based on the gyrB gene was also presented by Wang et al. (2016), who noted that the qPCR reactions require small quantities of DNA template than conventional PCR. In the current study, however, the LAMP reactions generally required even lower amounts of DNA template, enabling detection of nearly 80 times less DNA than the qPCR technique. Previous investigations have also found the LAMP assay to be more sensitive than conventional PCR assays for detection of Haemophilus parasuis (Zhang et al., 2011), Pasteurella multocida (Sun et al., 2010; Bhimani et al., 2015), Riemerella anatipestifer (Han et al., 2011) and Actinobacillus pleuropneumoniae (Ji et al., 2012). Furthermore, the result of the real-time LAMP assay is easy to interpret, especially for evaluation of DNA concentrations from test samples. In addition, the present study showed that the LAMP results were available after a shorter reaction time, which was consistent with results obtained by Bhimani et al. (2015) and Han et al. (2011). The results of our report also showed that the LAMP test gave negative reactions in all other bacterial species analysed for the evaluation of primer specificity. In conclusion, the results of our study demonstrate that the G. anatis real-time LAMP assay is a useful molecular test for rapid, reliable, and accurate identification of G. anatis strains. Comparison of the 2 assays used indicates better sensitivity for the LAMP method and a shorter reaction time than for quantitative PCR. The LAMP technique is highly specific due to the use of a set of 6 primers and is comparatively inexpensive, especially as it successfully performs reactions in a reaction volume half of the officially recommended volume (13 μL final volume instead 25 μL). It therefore seems that this simple and reliable test can be applied in routine diagnosis in the clinical laboratory. A potentially attractive alternative to identification of G. anatis by real-time LAMP is a LAMP technique in which the results are read with the naked eye or under UV light, which is easy to implement and requires no additional thermal cyclers. It can be useful for veterinarians without access to the PCR technique. Moreover, this method can be extended to detect the pathogen directly from tissues or swabs. Therefore, further research will be undertaken to demonstrate the effectiveness and sensitivity of the LAMP method in detecting G. anatis in this type of material without conventional or real-time PCR equipment. REFERENCES Alispahic M., Christensen H., Hess C., Razzazi-Fazeli E., Bisgaard M., Hess M.. 2011. Identification of Gallibacterium species by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evaluated by multilocus sequence analysis. Int. J. Med. Microbiol.  301: 513– 522. Google Scholar CrossRef Search ADS PubMed  Aubin G. G., Haloun A., Treilhaud M., Reynaud A., Corvec S.. 2013. Gallibacterium anatis bacteremia in a human. J. Clin. Microbiol . 51: 3897– 3899. Google Scholar CrossRef Search ADS PubMed  Bhimani M., Bhanderi B., Roy A.. 2015. Loop-mediated Isothermal Amplification assay (LAMP) based detection of Pasteurella multocida in cases of haemorrhagic septicaemia and fowl cholera. Vet. Ital.  51: 115– 121. Google Scholar PubMed  Bisgaard M., Korczak B. M., Busse H. J., Kuhnert P., Bojesen A. M., Christensen H.. 2009. Classification of the taxon 2 and taxon 3 complex of Bisgaard within Gallibacterium and description of Gallibacterium melopsittaci sp. nov., Gallibacterium trehalosifermentans sp. nov. and Gallibacterium salpingitidis sp. nov. Int. J. Syst. Evol. Microbiol . 59: 735– 744. Google Scholar CrossRef Search ADS PubMed  Bojesen A. M., Shivaprasad H. L.. 2007. Genetic diversity of Gallibacterium isolates from California turkey. Avian Pathol . 36: 227– 230. Google Scholar CrossRef Search ADS PubMed  Bojesen A. M., Vazquez M. E., Robles F., Gonzalez C., Soriano E. V., Olsen J. E., Christensen H.. 2007. Specific identification of Gallibacterium by a PCR using primers targeting the 16S rRNA and 23S rRNA genes. Vet. Microbiol.  123: 262– 268. Google Scholar CrossRef Search ADS PubMed  Bojesen A. M., Christensen H., Nielsen O. L., Olsen J. E., Bisgaard M.. 2003. Detection of Gallibacterium spp. in chickens by fluorescent 16S rRNA in situ hybridization. J. Clin. Microbiol.  41: 5167– 5172. Google Scholar CrossRef Search ADS PubMed  Dousse F., Thomann A., Brodard I., Korczak B. M., Schlatter Y., Kuhnert P., Miserez R., Frey J.. 2008. Routine phenotypic identification of bacterial species of the family Pasteurellaceae isolated from animals. J. Vet. Diagn. Invest.  20: 716– 724. Google Scholar CrossRef Search ADS PubMed  Gautier A. L., Dubois D., Escande F., Avril J. L., Trieu-Cuot P., Gaillot O.. 2005. Rapid and accurate identification of human isolates of Pasteurella and related species by sequencing the sodA gene. J. Clin. Microbiol.  43: 2307– 2314. Google Scholar CrossRef Search ADS PubMed  Han X., Ding C., He L., Hu Q., Yu S.. 2011. Development of loop-mediated isothermal amplification (LAMP) targeting the GroEL gene for rapid detection of Riemerella anatipestifer. Avian Dis . 55: 379– 383. Google Scholar CrossRef Search ADS PubMed  Huangfu H., Zhao J., Yang X., Chen L., Chang H., Wang X., Li Q., Yao H., Wang C.. 2012. Development and preliminary application of a quantitative PCR assay for detecting gtxA-containing Gallibacterium species in chickens. Avian Dis . 56: 315– 320. Google Scholar CrossRef Search ADS PubMed  Iwamoto T., Sonobe T., Hayashi K.. 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum sample. J. Clin. Microbiol . 41: 2616– 2622. Google Scholar CrossRef Search ADS PubMed  Ji H., Li H., Zhu L., Zhang H., Wang Y., Zuo Z., Guo W., Xu Z.. 2012. Development and evaluation of a loop–mediated isothermal amplification (LAMP) assay for rapid detection of Actinobacillus pleuropneumoniae based the dsbE–like gene1. Pesq. Vet. Bras.  32: 757– 760. Google Scholar CrossRef Search ADS   Johnson T. J., Danzeisen J. L., Trampel D., Nolan L. K., Seemann T., Bager R. J., Bojesen A. M.. 2013. Genome analysis and phylogenetic relatedness of Gallibacterium anatis strains from poultry. PLoS One . 8: e54844. Google Scholar CrossRef Search ADS PubMed  Korczak B., Christensen H., Emler S., Frey J., Kuhnert P.. 2004. Phylogeny of the family Pasteurellaceae based on rpoB sequences. Int. J. Syst. Evol. Microbiol.  54: 1393– 1399. Google Scholar CrossRef Search ADS PubMed  Król J., Bania J., Florek M., Pliszczak-Król A., Staroniewicz Z.. 2011. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland. J. Vet. Diagn. Invest.  23: 532– 537. Google Scholar CrossRef Search ADS PubMed  Kursa O., Woźniakowski G., Tomczyk G., Sawicka A., Minta Z.. 2015. Rapid detection of Mycoplasma synoviae by loop-mediated isothermal amplification. Arch. Microbiol.  197: 319– 325. Google Scholar CrossRef Search ADS PubMed  Liu M. J., Du G. M., Bai F. F., Wu Y. Z., Xiong Q. Y., Feng Z. X., Li B., Shao G. Q.. 2015. A rapid and sensitive loop-mediated isothermal amplification procedure (LAMP) for Mycoplasma hyopneumoniae detection based on the p36 gene. Genet. Mol. Res.  14: 4677– 4686. Google Scholar CrossRef Search ADS PubMed  Mair G., Vilei E. M., Wade A., Frey J., Unger H.. 2013. Isothermal loop-mediated amplification (LAMP) for diagnosis of contagious bovine pleuro-pneumonia. BMC Vet. Res. 27 : 9: 108. Google Scholar CrossRef Search ADS   Mori Y., Notomi T.. 2002. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother.  15: 62– 69. Google Scholar CrossRef Search ADS   Neubauer C., De Souza-Pilz M., Bojesen A. M., Bisgaard M., Hess M.. 2009. Tissue distribution of haemolytic Gallibacterium anatis isolates in laying birds with reproductive disorders. Avian Pathol . 38: 1– 7. Google Scholar CrossRef Search ADS PubMed  Paudel S., Alispahic M., Liebhart D., Hess M., Hess C.. 2013. Assessing pathogenicity of Gallibacterium anatis in a natural infection model: the respiratory and reproductive tracts of chickens are targets for bacterial colonization. Avian Pathol . 42: 527– 535. Google Scholar CrossRef Search ADS PubMed  Stępień-Pyśniak D., Hauschild T., Różański P., Marek A.. 2017. MALDI-TOF mass spectrometry as a useful tool for identification of Enterococcus spp. from wild birds and differentiation of closely related species. J. Microbiol. Biotechnol.  27: 1128– 1137. Google Scholar PubMed  Sun D., Wang J., Wu R., Wang C., He X., Zheng J., Yang H.. 2010. Development of a novel LAMP diagnostic method for visible detection of swine Pasteurella multocida. Vet. Res. Commun.  34: 649– 657. Google Scholar CrossRef Search ADS PubMed  Wang C. H., Robles F., Ramirez S., Brinch Riber A., Bojesen A. M.. 2016. Culture-independent identification and quantification of Gallibacterium anatis (G. anatis) by Real-Time quantitative PCR. Avian Pathol.  45: 538– 544. Google Scholar CrossRef Search ADS PubMed  Woźniakowski G., Samorek-Salamonowicz E., Kozdruń W.. 2011. Rapid detection of Marek's disease virus in feather follicles by loop-mediated amplification. Avian Dis . 55: 462– 467. Google Scholar CrossRef Search ADS PubMed  Zhang J. M., Shen H. Y., Xu G. G., Guo L. L., Zhang B., Li J. Y., Chen J. D., Fan H. Y., Liao M.. 2011. Development and application of a loop-mediated isothermal amplification method for rapid detection of Haemophilus parasuis. Afr. J. Biotechnol.  10: 10263– 10270. Google Scholar CrossRef Search ADS   © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off