Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

The Gα13-Rho Signaling Axis Is Required for SDF-1-induced Migration through CXCR4 *

The Gα13-Rho Signaling Axis Is Required for SDF-1-induced Migration through CXCR4 * THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 51, pp. 39542–39549, December 22, 2006 Printed in the U.S.A. The G -Rho Signaling Axis Is Required for SDF-1-induced Migration through CXCR4 Received for publication, September 25, 2006 Published, JBC Papers in Press, October 20, 2006, DOI 10.1074/jbc.M609062200 Wenfu Tan, Daniel Martin, and J. Silvio Gutkind From the Oral and Pharyngeal Cancer Branch, NIDCR, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland 20892-4330 The CXC chemokine stromal cell-derived factor-1 stromal cell-derived factor-1 (SDF-1), also named CXCL12, (SDF-1) binds to CXCR4, a seven-transmembrane G protein- belongs to the CXC subfamily and was first cloned from bone coupled receptor that plays a critical role in many physiolog- marrow stromal cells and shown to induce proliferation and ical processes that involve cell migration and cell fate deci- differentiation of B cell progenitors (3). SDF-1 is expressed in a sions, ranging from stem cell homing, angiogenesis, and wide range of normal tissues such as bone marrow, lymph neuronal development to immune cell trafficking. CXCR4 is nodes, lung, liver, and brain (4). SDF-1 exerts functions on also implicated in various pathological conditions, including binding to CXCR4, a seven-transmembrane G protein-coupled metastatic spread and human immunodeficiency virus infec- receptor (GPCR) (4–6) that is highly conserved across species tion. Although SDF-1-induced cell migration in CXCR4-ex- and is expressed on a wide variety of cell types, including hema- pressing cells is sensitive to pertussis toxin treatment, hence topoietic cells, vascular endothelial cells, neurons, microglia, involving heterotrimeric G proteins of the G family, whether and astrocytes (7). The SDF-1-CXCR4 signaling system is now other G proteins participate in the chemotactic response to known to be critical for the regulation of the migration, prolif- SDF-1 is still unknown. In this study, we took advantage of the eration, differentiation, and survival of lymphocyte, as reflected potent chemotactic activity of SDF-1 in Jurkat T-cells to by its key role in lymphocyte trafficking and overall immune examine the nature of the heterotrimeric G protein subunits surveillance (8). CXCR4 is also an obligatory co-receptor for the contributing to CXCR4-mediated cell migration. We ob- infection of T-cell tropic human immunodeficiency virus (HIV) served that whereas G and G subunits are involved in SDF- strains (9, 10). 1-induced Rac activation and cell migration, CXCR4 can also The function of SDF-1 and CXCR4 is not restricted to the stimulate Rho potently leading to the phosphorylation of immune system. Indeed, mouse embryos lacking either SDF-1 myosin light chain through the Rho effector, Rho kinase, but or CXCR4 display many lethal defects, including impaired independently of G . Furthermore, we found that G medi- hematopoiesis, malformations of the intestinal vasculature, i 13 ates the activation of Rho by CXCR4 and that the functional cardiac ventricular septal defects, and abnormal migration of activity of both G and Rho is required for directional cell cerebellar neurons (11–13). In addition, SDF-1 and CXCR4 migration in response to SDF-1. Collectively, our data indicate participate in a number of pathologic conditions that involve that signaling by CXCR4 to Rho through G contributes to aberrant cell motility, such as the metastatic spread of cancer- cell migration when stimulated by SDF-1, thus identifying the ous cells (14). For example, CXCR4 is largely overexpressed in G -Rho signaling axis as a potential pharmacological target in many frequently malignant tumors, including breast, lung, and many human diseases that involve the aberrant function of prostate cancer, whereas the expression of SDF-1 is high in the CXCR4. organs in which these tumors metastasize, such as lymph nodes and lung (15). Furthermore, SDF-1 is a potent chemoattractant for breast cancer cells in vitro, and neutralizing CXCR4 anti- bodies inhibit the metastasis of these cells to organs with high Chemokines are a group of chemoattractant cytokines that expression of SDF-1 in vivo (16). are involved in key developmental and homeostatic events, The signaling mechanisms by which CXCR4 promotes cell including leukocyte trafficking, angiogenesis, hematopoiesis, migration are not fully elucidated. It is well known that CXCR4 inflammation, immune response, and organogenesis, as well as is coupled to pertussis toxin (PTX)-sensitive heterotrimeric G in tumor progression and metastasis (1). They are divided into proteins of the G family which promote the activation of phos- four subfamilies, CXC, CC, C, and CX3C, based on their struc- i , phatidylinositol 3-kinase and the accumulation of D-3 phos- tural properties and primary amino acid sequence (1, 2). The phoinositol lipids (17, 18). Phosphatidylinositol 3-kinase sig- naling can in turn promote cell migration in response to SDF-1 * This work was supported by the Intramural Research Program of the by activating ITK, a Tec family kinase (19). However, whether National Institutes of Health, NIDCR. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. The abbreviations used are: SDF, stromal cell-derived factor-1; GPCR, G Section 1734 solely to indicate this fact. protein-coupled receptor; HIV, human immunodeficiency virus; PTX, per- To whom correspondence should be addressed: Oral and Pharyngeal Can- tussis toxin; ERK, extracellular signal-regulated kinase; MLC, myosin light cer Branch, NIDCR, National Institutes of Health, 30 Convent Dr., Bldg. 30, chain; GFP, green fluorescent protein; PMA, phorbol-12-myristate-13-ace- Rm. 211, Bethesda, MD 20892-4340. Tel.: 301-496-6259; Fax: 301-402-0823; tate; shRNA, short hairpin RNA; PAK, p21-activated kinase; GEF, guanine E-mail: [email protected]. nucleotide exchange factor. 39542 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 This is an Open Access article under the CC BY license. CXCR4 Signals to Rho through G other heterotrimeric G proteins are also required for cell migra- Lentivirus Infection—Lentiviral stocks were prepared and tion and, if so, the nature of their downstream targets is not fully titrated as previously reported using 293T cells as the packaging understood. Here, we took advantage of the fact that Jurkat cells (25). Jurkat cells were incubated with viral supernatants for T-cells express CXCR4 receptors endogenously, and thus 12 h. After that, the cells were washed twice with phosphate- migrate readily in response to SDF-1, to begin dissecting the buffered saline and returned to normal growth medium. signaling network by which CXCR4 controls directional cell Flow Cytometric Analysis—Cells were harvested and washed motility. We found that whereas G regulates cell migration by three times with phosphate-buffered saline. Following incuba- activating Rac through G heterotrimeric G protein subunits, tion with biotin-conjugated anti-CXCR-4 antibody or isotype CXCR4 utilizes the  subunit of G to activate Rho and that the control antibody for 60 min at room temperature, the cells were functional activity of G and G , hence the coordinated activa- treated with streptavidin-phycoerythrin-conjugated IgG (Vec- i 13 tion of Rac and Rho, are both required for CXCR4-induced cell tor Laboratories, Burlingame, CA) for 30 min at room temper- migration in response to SDF-1. ature and analyzed with a BD Biosciences flow cytometer. Chemotaxis Assay—Chemotaxis assay was determined with EXPERIMENTAL PROCEDURES a 48-well Boyden chamber (NeuroProbe, Gaithersburg, MD) Materials—Recombinant human stromal cell-derived factor using a polyvinyl pyrrolidone-free polycarbonate filter with a 1 alpha and biotin-conjugated mouse monoclonal anti-CXCR4 5-m pore size (Nuclepore; Corning Costar, Acton, MA). Fil- antibody and mouse IgG isotype antibody were purchased ters were not coated with extracellular matrix molecules to pre- 2B from R&D Systems (Minneapolis, MN). Rabbit monoclonal vent the influence of cell adhesion to the chemotactic response phospho-ERK1/2 (p-ERK1/2) and phospho-myosin light chain to SDF-1. Briefly, 50 l of Jurkat cells transfected by Renilla (p-MLC) and MLC antibodies were purchased from Cell Sig- luciferase with or without other constructs were added to the naling Technology (Beverly, MA). Rabbit polyclonal antiserum upper chamber, and a similar volume of cell suspension was against ERK1/2, Rho, G ,G , and -tubulin were obtained kept as transfection efficiency control. The chemoattractant 12 13 from Santa Cruz Biotechnology (Santa Cruz, CA); mouse was added to the lower chamber. Cells migrated into the lower monoclonal antibody against Rac and rod  transducin were chamber were collected after4hof incubation, and Renilla obtained from BD Transduction Laboratories. Monoclonal luciferase activities present in cellular lysates were assayed antibody against AU-1, AU-5, and GFP epitope were purchased using the dual luciferase reporter system. In each case, migra- form Covance (Berkeley, CA). AMD3100 octahydrochloride tion was calculated as the ratio between the luciferase activity in was purchased from Sigma. PTX and phorbol-12-myristate-13- migrating cells (lower chamber) and the total luciferase activity acetate (PMA) were obtained from Calbiochem. Dual luciferase in the 50-l cell suspension. reporter system was purchased from Promega (Madison, WI). Rho GTPase Pulldown Assay—In vivo Rho and Rac activity Constructs—Expression vectors for G transducin (G ), was assessed by a modified method described elsewhere (21). G ,G , PAK-N, PAK-NL2, RhoN19, GFP fused to the RGS Briefly, after serum starvation overnight, cells were treated as 12 13 domain of PDZ-RhoGEF (GFP-RGS), and C3 toxin have been indicated and lysed at 4 °C in a buffer containing 20 mM Hepes, previously described (20–23). pH 7.4, 0.1 M NaCl, 1% Triton X-100, 10 mM EGTA, 40 mM Cell Lines and Transfection—Jurkat cells were cultured in -glycerophosphate, 20 mM MgCl ,1mM Na VO ,1mM dithi- 2 3 4 RPMI 1640 (Sigma) supplemented with 10% fetal calf serum othreitol, 10 g/ml aprotinin, 10 g/ml leupeptin, and 1 mM (BioWhittaker, Walkersville, MD). Human epithelial kidney phenylmethylsulfonyl fluoride. Lysates were incubated with 293-T cells were grown and maintained in Dulbecco’s modified glutathione S-transferase-rhotekin-Rho binding domain previ- Eagle’s medium (Sigma) containing 10% fetal calf serum. Cells ously bound to glutathione-Sepharose beads for Rho activity were transfected by Lipofectamine-PLUS (Invitrogen) follow- assay or with a purified, bacterially expressed glutathione ing the manufacturer’s directions. S-transferase fusion protein containing the cdc42/Rac-inter- CXCR4 shRNA and G shRNA—To knock down the acting binding (CRIB) domain of PAK1 previously bound to expression of CXCR4 and G , CXCR4 shRNA, GCGCGGC- glutathione-Sepharose beads for Rac activity. Associated GTP- CAAGTTCTTAGTTGCTGTTAGTGAAGCCACAGATGT- bound forms of Rho or Rac were released with protein loading AACAGCAACTAAGAACTTGGCCATGCCTACTGCCTC- buffer and analyzed by Western blot analysis using a mono- TM GGA, which targets CXCR4 mRNA sequence (GenBank clonal antibody against Rho or Rac. accession number AY728138) at nucleotide 5457–5478, and Immunoblot Analysis—Cells were lysed in lysis buffer (50 mM G shRNA, TGCTGTTGACAGTGAGCGCTAAGATGATG- Tris-HCl, 150 mM NaCl, 1% Nonidet P-40) supplemented with TCGTTTGATACTAGTGAAGCCACAGATGTAGTATCAA- protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride, 1 ACGACATCATCTTATTGCCTACTGCCTCGGA, which tar- l/ml aprotinin and leupeptin) for 15 min at 4 °C. Equal TM gets G mRNA sequence (GenBank accession number amounts of protein were subjected to SDS-polyacrylamide gel NM_006572) at nucleotide 412–438, were subcloned into the electrophoresis and transferred onto a polyvinylidene difluo- pENTR-shRNA vector between the XhoI and EcoRI sites. LR ride membrane (Immobilon P; Millipore). The membranes reaction (the Gateway attL  attR reaction) was performed were then incubated with the appropriate antibodies. according to the manufacturer’s instructions to transfer the RESULTS CXCR4 shRNA or G shRNA insert from pENTR-shRNA into PWPI-GW, a Gateway-compatible lentiviral destination SDF-1 Induces Jurkat Cell Migration through CXCR4—To vector (24). investigate the mechanism underlying the ability of SDF-1 to DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39543 CXCR4 Signals to Rho through G FIGURE 1. SDF-1 promotes the migration of Jurkat cells through endoge- nous CXCR4 receptors. A, expression of CXCR4 in Jurkat T-cells. The expres- sion of CXCR4 on Jurkat cells was assessed by fluorescence-activated cell sorter analysis of the fluorescence intensity (arbitrary units) of cells incubated with biotin-conjugated anti-CXCR4 (CXCR4) antibodies or an isotype control FIGURE 2. PTX-sensitive G proteins of the G family are required for SDF- antibody (IgG) followed by streptavidin-phycoerythrin. No specific fluores- 1-induced migration of Jurkat T-cells. A role for G subunits. A, PTX cence was detected in anti-CXCR4-stained SAOS-2 cells when used as nega- inhibits the phosphorylation of ERK stimulated by SDF-1. Jurkat cells pre- tive controls (not shown). B, SDF-1 induces the phosphorylation of ERK in treated overnight with serum-free medium with or without different concen- Jurkat cells. Jurkat cells were serum starved, treated () or not () with trations of PTX were stimulated with SDF-1 (10 ng/ml) for 5 min. Cells were AMD3100, and stimulated with SDF-1 (10 ng/ml) for the indicated time. The lysed and used for Western blot analysis of phosphorylated and total ERK. B, total (ERK) and phosphorylated forms (p-ERK) of ERK1 and ERK2 were detected PTX blocks the migration of Jurkat cells evoked by SDF-1. After incubating in cellular lysates by Western blot analysis with the appropriate antibod- with different concentrations of PTX overnight, Jurkat cells were sus- ies. C, SDF-1 induces the migration of Jurkat cells. Serum-free growth pended in serum-free growth medium and added into the upper wells of medium containing various concentrations of SDF-1 was added into the the Boyden chambers. Serum-free growth medium with or without SDF-1 lower wells of Boyden chambers, and Jurkat cells transfected with Renilla (10 ng/ml) was loaded into the lower wells as chemoattractant. Data are luciferase were loaded into the upper wells. After 4 h, the cells that represented as in Fig. 1C. C, expression of transducin in Jurkat cells. Con- migrated into the lower wells were collected. Migration was measured as trol and transducin (G )-transfected Jurkat cells were analyzed by West- the ratio of the Renilla luciferase activity in migrating cells versus the total ern blotting using antibodies to transducin or -tubulin as a control. D, Renilla luciferase activity in the cells added in the upper chamber of each expression of transducin decreases the phosphorylation of ERK induced by well and expressed as -fold increase with respect to cell migration toward SDF-1. Jurkat cells were transfected with transducin, serum starved over- serum-free growth medium, which was taken as 1. Values are the aver- night, and lysed after stimulating with SDF-1 (10 ng/ml) or PMA (50 nM) for 5 age  S.E. of triplicate samples from a typical experiment. Similar results min. Western blot analysis of ERK phosphorylation was performed as above. E, were obtained in three additional experiments. D, AMD3100 inhibits the transducin inhibits the migration of Jurkat cells induced by SDF-1. Jurkat cells migration induced by SDF-1. Jurkat cells were treated with the indicated transfected with different concentrations of transducin were subjected to concentrations of AMD3100 and their migration toward wells containing migration assays using SDF-1 as the chemoattractant as described above. SDF-1 (10 ng/ml) measured and represented as for panel C. promote cell migration, we took advantage of the Jurkat T cell maximum already at a concentration of 10 ng/ml of this che- line that expresses CXCR4 endogenously (26). We first con- moattractant (Fig. 1C). The treatment with AMD3100 pre- firmed CXCR4 expression on Jurkat cells by fluorescence-acti- vented the SDF-1-induced cell migration in a dose-dependent vated cell sorter analysis. Saos-2 cells, which do not express of manner (Fig. 1D). These data indicated that SDF-1 can induce a CXCR4, were used as a negative control. As shown in Fig. 1A, remarkable migratory response in Jurkat cells through CXCR4. we observed remarkable expression of CXCR4 on Jurkat cells, G and G Are Involved in the Migration of Jurkat Cells whereas no expression of CXCR4 was detected on Saos-2 cells Induced by SDF-1—PTX, which ADP ribosylates G , thereby (not shown). We then determined the functional activity of uncoupling it from receptor activation (28), was used to inves- CXCR4 in Jurkat cells by analyzing the activation of ERK, a tigate the role of G in the process of cell migration stimulated typical response elicited by GPCRs (20) by SDF-1. Exposure of by SDF-1. The effect of PTX on the phosphorylation of ERK was Jurkat cells to SDF-1 resulted in the fast accumulation of the used as positive control. Treatment of Jurkat cells with PTX phosphorylated active form of ERK, which peaked at 5 min resulted in a decrease of phosphorylation of ERK and cell after stimulation and decreased thereafter. Pretreatment of migration in a dose-dependent fashion (Fig. 2, A and B). This cells with AMD3100, a specific CXCR4 inhibitor (27), pre- confirmed that G participates in the migratory response initi- vented the phosphorylation of ERK when provoked by SDF-1 ated by CXCR4. As receptor stimulation of G induces the dis- (Fig. 1B), thus together demonstrating that Jurkat cells express sociation of G subunits from GTP-bound G (29), we next functional CXCR4 receptors. We next evaluated whether evaluated the contribution of G to SDF-1-induced cell SDF-1 could induce the migration of Jurkat cells using a mod- migration by the overexpression of G transducin, which ified Boyden Chamber system in which cell migration can be blocks G function by quenching these G protein subunits easily quantified using a luciferase-based assay. Using this sys- upon their release from G (20). Indeed, expression of G trans- tem, we observed that Jurkat cells migrate efficiently toward ducin in Jurkat cells (Fig. 2C) prevented the phosphorylation of wells containing various concentrations of SDF-1, reaching a ERK induced by SDF-1 (Fig. 2D). In contrast, the phosphoryla- 39544 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 CXCR4 Signals to Rho through G Jurkat cells. Interestingly, as shown in Fig. 3D, expression of PAK-N dramatically reduced the migration of Jurkat cells induced by SDF-1, whereas PAK-NL2 did not exert any demon- strable effect (Fig. 3D). Collectively, our results suggest that G participates in the SDF-1-induced migration of Jurkat cells by stimulating the activity of Rac, likely through G subunits. Rho Is Involved in Cell Migration Induced by SDF-1 through CXCR4—As cell migration often requires the coordinated acti- vation of the small GTPases Rac and Rho, we next sought to explore whether Rho plays a role in the chemotactic response to SDF-1. We first examined whether SDF-1 promotes the activa- tion of Rho. As shown in Fig. 4A, SDF-1 stimulation provoked a profound activation of Rho, as judged by the use of pulldown assays. To address whether Rho is involved in cell migration stimulated by SDF-1, we used both treatment with C3 toxin, by which ADP ribosylates and inhibits Rho (32), and the expres- sion of an AU5-tagged negative dominant mutant of Rho, Rho FIGURE 3. SDF-1 induces cell migration and Rac activation through G . N19. Treatment with C3 toxin from 0.1–5 ng/ml inhibited the A, time course of the activation of Rac stimulated by SDF-1. Serum-starved migration of Jurkat cells toward wells containing SDF-1 (Fig. Jurkat cells were stimulated with SDF-1 (10 ng/ml) for different times, and the GTP-bound form of Rac (GTP-Rac) was assessed in cellular lysates by 4B). Similarly, the expression of the AU5-tagged form of Rho pulldown assays. Western blot analysis of total Rac in each cell lysate was N19 in Jurkat cells (Fig. 4C) dramatically reduced the migration used as a control. B, PTX inhibits the activation of Rac induced by SDF-1. Jurkat cells were cultured overnight in serum-free growth medium with or of these cells when induced by SDF-1 (Fig. 4D), while in control without different concentrations of PTX and stimulated with SDF-1 (10 experiments the dominant negative mutant of Rac, but not of ng/ml) for 5 min. Cell lysates were used for pulldown analysis of GTP- Cdc42, also prevented Jurkat cell migration (not shown). These bound Rac as above. C, expression of the AU1-tagged forms of PAK-N (PAKN) and PAK-NL2 (PAKL2) in Jurkat cells. Jurkat cells transfected with data demonstrate that SDF-1 can activate Rho and that in turn Rho PAK-N and PAK-NL2 expression vectors were lysed for Western blot anal- is involved in cell migration induced by this potent chemokine. To ysis with antibodies to the AU1 epitope or -tubulin as a control. D, inhi- bition of Rac leads to a decrease in Jurkat cell migration induced by SDF-1. further investigate whether Rho activation in response to SDF-1 is Jurkat cells were transfected by PAK-N and the control construct PAK-NL2, indeed mediated through CXCR4, we limited the expression of and migration assays toward SDF-1 were performed as described above. this GPCR by RNA-interfering approaches (Fig. 4E). Our data showed that the knock down of the expression of CXCR4 in Jurkat tion of ERK elicited by PMA through protein kinase C (30) cells resulted in a reduction in the ability of SDF-1 to promote both remained unaffected and served as a negative control (Fig. 2D). Rho activation and migration (Fig. 4, F and G). G transducin expression resulted in a dramatic inhibition of Rho stimulation leads to the activation of Rho kinase, which the migratory response toward SDF-1 (Fig. 2E), thus indicating promotes the accumulation of phospho-MLC by phosphoryl- that G subunits, when released from G , are involved in SDF- ating MLC directly or by inhibiting MLC phosphatase, thereby 1-induced cell migration through CXCR4. contributing to cell migration by regulating acto-myosin con- Signaling through G Promotes the Migration of Jurkat Cells traction (33). To explore whether Rho kinase is an important by Stimulating Rac—Because the small GTP-binding protein downstream effector of Rho activation in response to SDF-1, we Rac plays a central role in the regulation of the actin-based treated Jurkat cells with the Rho kinase inhibitor Y27632 (34) cytoskeleton and cell movement (31), we then investigated and observed that SDF-1 stimulates the phosphorylation of whether this Rho-related GTPase is involved in the G -medi- MLC potently (Fig. 4H), which was abolished by the treatment ated migration of Jurkat cells. As shown in Fig. 3A, by a pull- with Y27632. Furthermore, Y27632 prevented the migration of down assay we observed that stimulation of Jurkat cells with Jurkat cells toward SDF-1 (Fig. 4I). These findings suggest that SDF-1 provoked the rapid accumulation of GTP-bound Rac, the stimulation of Rho by SDF-1 through CXCR4 results in Rho which reached a maximum at 5 min. In parallel experiments, kinase activation and consequent MLC phosphorylation and however, we did not detect the accumulation of the GTP- that these downstream events initiated by Rho participate in bound form of Cdc42, a Rac-related GTPase (not shown). Pre- cell migration toward SDF-1. treatment of Jurkat cells with PTX attenuated the Rac activity G Is Involved in SDF-1-induced Cell Migration, and 12/13 induced by SDF-1 (Fig. 3B). These data indicate that SDF-1 This Effect Is Mediated by Rho—As both G and Rho activity induces Rac activation through PTX-sensitive G proteins of the were required for SDF-1-induced cell migration, we asked G class. We next set out to explore whether Rac is necessary for whether Rho functions downstream of G . However, as shown i i the migratory response to SDF-1 by expressing in Jurkat cells in Fig. 5A, treatment of Jurkat cells with PTX failed to inhibit the N-terminal region of PAK (p21-activated kinase), PAK-N, Rho activation in response to SDF-1 and instead caused a slight which includes its Cdc42/Rac-interactive binding motif, and enhancement of Rho activity (Fig. 5A). As G and G can 12 13 PAK-NL2, which lacks two residues required for Rac binding promote the activation of Rho elicited by GPCRs through and therefore serves as a specificity control (21). Fig. 3C shows directly binding to the RGS domain of RGS-containing Rho the expression of the AU1-tagged forms of both PAK-N and guanine nucleotide exchange factors (GEFs) (22, 35), we then PAK-NL2 after transfection of their expression vectors into examined whether the G -Rho signaling axis is required 12/13 DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39545 CXCR4 Signals to Rho through G FIGURE 5. G is involved in the migration of Jurkat cells induced by 12/13 SDF-1. A role for G in Rho activation. A, inhibition of the activity of G 12/13 i by PTX fails to prevent Rho activation. Jurkat cells treated with different con- centrations of PTX overnight were stimulated with SDF-1 (10 ng/ml; 5 min), and Rho activity in cell lysates was analyzed as described above. B, expression of the GFP-tagged RGS domain of PDZ-RhoGEF in Jurkat cells. Western blot analysis with antibodies to GFP or -tubulin was performed in lysates from Jurkat cells transfected with the GFP-tagged RGS domain of PDZ-RhoGEF (GFP-RGS) or vector control. C, inhibition of G suppresses the activation 12/13 of Rho by SDF-1. Jurkat cells transfected with GFP-RGS were stimulated with SDF-1 (10 ng/ml) for 5 min and Rho activity measured in cell lysates by pull- down analysis. D, inhibition of G diminishes SDF-1-induced cell migra- 12/13 tion. Jurkat cells transfected with different amounts of GFP-RGS were used for migration assays toward SDF-1 (10 ng/ml) as above. E and F, reconstitution of the CXCR4-G -signaling axis in 293T cells. E, time course of ERK phospho- rylation in response to SDF-1 in 293T cells transfected with expression vectors for GFP or CXCR4. Cells treated with 10 ng/ml SDF-1 were collected at the indicated time for immunoblot analysis. F,G is involved in Rho activation FIGURE 4. Rho is involved in SDF-1-stimulated cell migration. A, time in response to SDF-1 in CXCR4-transfected cells. 293T cells transfected with course of Rho activation induced by SDF-1. Jurkat cells were serum starved GFP or CXCR4 with or without GFP RGS were lysed after treatment with SDF-1 overnight and stimulated with SDF-1 (10 ng/ml) for the indicated times. and used for pulldown assay. Rho activity was assessed in cell lysates by pulldown analysis of GTP- bound Rho. Total Rho in each cell lysate was determined as a control. B, treatment with C3 toxin inhibits the migration of Jurkat cells. Jurkat cells for cell migration when induced by SDF-1. We transfected Jur- were transfected with various concentrations of a C3 toxin expression kat cells with a chimeric molecule encoding GFP fused to the vector, and their migration to wells containing SDF-1 (10 ng/ml) was RGS domain of PDZ-RhoGEF, which binds to the activated assayed as described above. C, expression of RhoN19 in Jurkat cells. Jurkat cells were transfected with AU5-tagged RhoN19, and Western blot analy- forms of G and thus behaves as a dominant negative 12/13 sis was performed in total cell lysates using antibodies to the AU5 epitope mutant for G (25). Expression of this GFP-RGS chimera 12/13 or -tubulin. D, inhibition of Rho prevents Jurkat cell migration induced by in Jurkat cells (Fig. 5B) inhibited the migration elicited by SDF-1. Jurkat cells were transfected with RhoN19 and used for migration assays toward SDF-1 (10 ng/ml) as above. E, knock down of the expression SDF-1 (Fig. 5D), suggesting that G activation is required 12/13 of CXCR4 by RNA-interfering approach. After infection with lentivirus-GFP for the chemotactic response to SDF-1. We then set out to (control shRNA) or lentivirus-CXCR4 shRNA, Jurkat cells were analyzed for CXCR4 expression by fluorescence-activated cell sorter. F, knock down of the explore whether the effect of G on the migration of Jurkat 12/13 expression of CXCR4 diminished ERK phosphorylation and Rho activation in cells is mediated by Rho. As shown in Fig. 5C, Jurkat cells trans- response to SDF-1. Jurkat cells infected with lentivirus-GFP (GFP) or lentivirus- fected by various concentrations of GFP-RGS exhibited CXCR4shRNA were serum starved overnight and used for ERK and Rho acti- vation by Western blot analysis and Rho pulldown assays as above. G, CXCR4 reduced Rho activity after SDF-1 stimulation as compared with knock down decreased Jurkat cell migration induced by SDF-1. Cells infected control-transfected cells. These data provided evidence that with the indicated lentiviruses were used for migration assays in response to G is involved in cell migration when induced by SDF-1 SDF-1 as above. H and I, the Rho effector Rho kinase participates in Jurkat cell 12/13 migration promoted by SDF-1. Pretreatment of Jurkat cells with the indicated and that this effect is likely mediated by Rho. concentrations of the Rho kinase inhibitor Y27632 suppressed the phospho- As 293T cells do not express CXCR4 (not shown), we then set rylation of the MLC (H) and the migration of the Jurkat cells in response to SDF-1 (I). out to reconstitute the CXCR4-G signaling axis by the 39546 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 CXCR4 Signals to Rho through G G and expressed it stably in Jurkat cells by a recently devel- oped lentiviral system (24). As shown in Fig. 6B,G expres- sion was decreased 6 days after infection of Jurkat cells with a lentivirus carrying G shRNA and was almost eliminated 10 days after infection, whereas a control GFP-expressing lentivi- rus had no demonstrable effect. As shown in Fig. 6C, the acti- vation of Rho in Jurkat cells mediated by CXCR4 was signifi- cantly blocked after G knock down. In addition, phosphorylation of ERK elicited by SDF-1 was slightly decreased, suggesting an unexpected role for G in ERK acti- vation by SDF-1. Remarkably, we also found that knock down of the expression of G reduced the migration mediated by CXCR4, in alignment with the result obtained by the G 12/13 dominant negative mutant (Fig. 6D). Taken together, our data suggest that CXCR4 is coupled to G , in addition to G , and 13 i that activation of Rho through the  subunit of G ,G ,is 13 13 required to induce cell migration in response to SDF-1. DISCUSSION In the present study, we used Jurkat T-cells that express CXCR4 endogenously as an experimental model system to examine the contribution of heterotrimeric G proteins and FIGURE 6. Knock down of G prevents the activation of Rho and cell migration in response to SDF-1 in Jurkat cells. A, Jurkat cells express their downstream targets in cell migration induced by SDF-1. G . The expression of G and G in Jurkat cells was analyzed by 13 12 13 Using a simple luciferase-based system to monitor cell migra- Western blot with heterotrimeric G protein  subunit-specific antibodies, using antibodies to -tubulin as a loading control. 293T cells transfected tion, we first observed that SDF-1 elicits a robust chemotactic with empty vector ()orG and G expression vectors were used as 12 13 response through CXCR4 in Jurkat cells. This response was negative and positive controls, respectively. B, knock down of G by abolished by treatment with PTX, confirming the key role for G lentiviruses carrying G shRNA. Jurkat cells infected with lentiviruses carrying GFP or G shRNA were lysed at the indicated times after infec- 13 proteins of the G family in lymphocyte migration toward che- tion and used for Western blot analysis of G expression. Western blot mokine gradients (36). In this regard, we observed that G for -tubulin was used as a loading control. C, knock down of the expres- sion of G partially decreases the phosphorylation of ERK and nearly subunits, when released from G , are strictly required for 13 i abolishes the activation of Rho induced by SDF-1. The accumulation of CXCR4-mediated cell migration and that the chemotactic phosphorylated ERK and GTP-bound Rho in response to SDF-1 (10 ng/ml; response to SDF-1 involves the coordinated activation of the 5 min) was examined as described above in Jurkat cells 10 days after infection with lentiviruses carrying GFP or G shRNA. D, knock down of small GTPases Rac and Rho by CXCR4. Of interest, whereas G inhibits the migration of Jurkat cells stimulated by SDF-1. The migra- the activation of Rac was mediated by G , likely though its tion of Jurkat cells to wells containing SDF-1 (10 ng/ml) was examined as G subunits, the activation of Rho was insensitive to PTX described above 10 days after infection with lentiviruses carrying GFP or G shRNA and normalized by their respective migration to serum-free 13 treatment, thus suggesting that CXCR4 may utilize G pro- growth medium. teins distinct from G to stimulate Rho. Indeed, by a combi- nation of dominant negative and RNA interference ectopic expression of this GPCR upon transfection of its approaches, we now show that G proteins of the G 12/13 expression plasmid in 293T cells. As a control, although SDF-1 family are also required to induce cell migration in response stimulation of 293T cells transfected with a vector control to SDF-1 and that G links CXCR4 to the activation of Rho (GFP) did not cause ERK activation, the phosphorylated form of by SDF-1 in Jurkat T cells. ERK was readily detected in 293T cells transfected with CXCR4 Small GTP-binding proteins of the Rho family, including expression plasmids after SDF-1 treatment (Fig. 5E). Similarly, Rho, Rac, and Cdc42, play a central role in regulating the activation of CXCR4-transfected 293T cells led to a clear dynamic organization of the actin-based cytoskeleton in mam- increase in the level of GTP-bound Rho, which was prevented malian cells (37). During the process of cell migration, each by the co-expression of the RGS domain of PDZ-RhoGEF (Fig. member of this Rho GTPase family plays a distinct role. Rho is 5F), hence supporting the emerging notion that G is important for regulating the formation of contractile actin-my- 12/13 involved in Rho activation downstream from CXCR4. osin filaments, which form stress fibers, and for maintaining Knock Down of G in Jurkat Cells Inhibits Cell Migration focal adhesions at the rear of the migrating cells, whereas Rac is and Rho Activation Induced by SDF-1—To address the direct involved in forming actin-rich membrane ruffles, referred to as role of G in the migration of Jurkat cells mediated by lamellipodia, at the leading edge of the migrating cells and is 12/13 CXCR4, we set out to knock down G by using RNA inter- recognized to be a driving force for cell migration (38). Cdc42 12/13 ference approaches. We first examined the expression of G has been demonstrated to be critical in regulating cell polarity and G in Jurkat cells using 293T cells transfected with G and filopodia formation, thereby controlling the direction of 13 12 or G , respectively, as positive controls. As shown in Fig. 6A, the cell migration (39). Hence, the coordinated activation of Jurkat cells only express G , while expression of G is Rho GTPases represents a key regulatory event during the 13 12 undetectable. We then designed a shRNA sequence targeting migration of cells toward a chemoattractant gradient. How this DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39547 CXCR4 Signals to Rho through G coordination is achieved is under current intense investigation The finding that CXCR4 utilizes a G -Rho signaling axis 12/13 (37, 40, 41). to promote cell migration may have broad implications as the In Jurkat T cells, we observed that SDF-1 induces the rapid SDF-1/CXCR4 signaling system plays a critical role in many activation of both Rac and Rho, but not Cdc42, in line with prior physiological processes, such as axon guidance, stem cell hom- studies using human peripheral blood lymphocytes (42, 43). Of ing, tissue damage repair, and hematopoietic cell trafficking (8, interest, PTX treatment suppressed the activation of Rac while 13, 14, 17), in which the contribution of G and Rho can 12/13 slightly enhancing Rho activity. This observation is consistent now be investigated. Similarly, although signaling through G with a role for G in signaling from chemokine receptors to Rac by CXCR4 appears not to be necessary for the infection of lym- (42) and prior studies that demonstrated that the activity of Rho phocytes by T-cell tropic (R4) HIV (10), the ability of this che- can be negatively regulated by Rac (44, 45). However, the nature mokine receptor to couple to G , thereby stimulating Rho-de- of the molecular mechanism by which G regulates Rac is at the pendent pathways that affect cell motility and nuclear events, present not fully understood. A recent study suggests that Vav1, may now help explain the still unknown post-entry mechanism a Rac GEF that is activated upon tyrosine phosphorylation (46), by which signaling through CXCR4 contributes to HIV replica- changes its localization and activity upon SDF-1 stimulation of tion and viral transmission (reviewed in Refs. 2, 54). Further- lymphocytes (47). Furthermore, given the fact that CXCR4 acti- more, SDF-1 is produced by stromal cells in the lymph nodes vates phosphatidylinositol 3-kinase (18) and the Tec family and acts as a potent chemoattractant for many cancer cells that tyrosine kinase ITK through Src (19), it is quite likely that express CXCR4, including those from the breast, prostate, and CXCR4 may promote the activation of Rac through the sequen- lung, thereby promoting lymph node invasion and the subse- tial stimulation of Src, phosphatidylinositol 3-kinase, and ITK quent metastatic spread of these highly prevalent cancers (14, and the consequent tyrosine phosphorylation and phosphati- 16, 36). Thus, the finding that CXCR4 signals through G to dylinositol 3-kinase-dependent activation of Vav1. However, it Rho in response to SDF-1 may provide novel therapeutic tar- is still possible that, upon SDF-1 binding to CXCR4, G or free gets for pharmacological intervention in many pathological G may also promote the direct activation of G protein-cou- conditions, ranging from increasing the efficiency on bone pled Rac GEFs such as Tiam1 (48) and P-REX2 (49), both of marrow transplantation to treating cancer metastasis and HIV which are expressed in Jurkat cells (not shown). Thus, the rel- infection. ative contribution of each of these Rac GEFs to the activation of Rac by CXCR4 and lymphocyte migration warrants further REFERENCES investigation. 1. Locati, M., and Murphy, P. M. (1999) Annu. Rev. Med. 50, 425–440 2. Sodhi, A., Montaner, S., and Gutkind, J. S. (2004) Nat. Rev. Mol. Cell Biol. On the other hand, the migratory response of Jurkat T cells 5, 998–1012 toward SDF-1 required the functional activity of Rho, but the 3. Nagasawa, T., Kaisho, T., Kishimoto, T., and Kikutani, H. (1994) J. Immu- activation of this GTPase by CXCR4 was not mediated by G . nol. 152, 2788–2797 This prompted us to explore whether additional G protein 4. Bleul, C. C., Fuhlbrigge, R. C., Casasnovas, J. M., Aiuti, A., and Springer, subunits may link CXCR4 to Rho. In this regard, G and 12 T. A. (1996) J. Exp. Med. 184, 1101–1109 G , members of the G family of G proteins, are known to 5. Ganju, R. K., Brubaker, S. A., Meyer, J., Dutt, P., Yang, Y., Qin, S., Newman, 13 12 W., and Groopman, J. E. (1998) J. Biol. Chem. 273, 23169–23175 stimulate signaling pathways involved in cell growth and neo- 6. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana- plastic transformation (50, 51), but accumulating evidence also Seisdedos, F., Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., supports a role for these G protein  subunits in the regulation Loetscher, M., Baggiolini, M., and Moser, B. (1996) Nature 382, 833–835 of cell migration. For example, concertina, an ortholog of 7. Horuk, R. (2001) Cytokine Growth Factor Rev. 12, 313–335 G , is critically required for cell movement during Dro- 12/13 8. Klein, R. S., and Rubin, J. B. (2004) Trends Immunol. 25, 306–314 sophila embryogenesis (52), and G knockout embryonic 9. Juarez, J., and Bendall, L. (2004) Histol. Histopathol. 19, 299–309 10. Berger, E. A., Murphy, P. M., and Farber, J. M. (1999) Annu. Rev. Immunol. fibroblasts exhibit reduced migratory response to thrombin 17, 657–700 and lysophosphatidic acid (53). Hence, in the present work, we 11. Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa, T., Kishimoto, found that G plays a key role in the chemotactic response 12/13 T., Bronson, R. T., and Springer, T. A. (1998) Proc. Natl. Acad. Sci. U. S. A. initiated by SDF-1 through CXCR4. Furthermore, the results 95, 9448–9453 obtained by reconstituting the CXCR4-G signaling axis in 13 12. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., 293T cells and the knock down of G by the infection of Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998) Nature 393, 591–594 Jurkat cells with lentiviruses carrying G shRNA revealed 13. Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. that CXCR4 stimulates Rho activation through G . Thus, the (1998) Nature 393, 595–599 remarkable biological responses elicited by CXCR4 may 14. Juarez, J., Bendall, L., and Bradstock, K. (2004) Curr. Pharm. Des. 10, require the coordinated activation of Rac-dependent pathways 1245–1259 through G and biochemical routes regulated by Rho through 15. Zlotnik, A. (2004) Semin. Cancer Biol. 14, 181–185 the activation of G . As GTP-bound G can activate Rho 16. Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., 13 13 McClanahan, T., Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., through RGS-containing Rho GEFs, p115 RhoGEF, PDZ-Rho- Mohar, A., Verastegui, E., and Zlotnik, A. (2001) Nature 410, 50–56 GEF, or LARG (22, 35), these findings may also provide a 17. Dutt, P., Wang, J. F., and Groopman, J. E. (1998) J. Immunol. 161, molecular framework to help define the precise GEF utilized by 3652–3658 CXCR4 to stimulate Rho in Jurkat T-cells and in many other 18. Curnock, A. P., Sotsios, Y., Wright, K. L., and Ward, S. G. (2003) J. Immu- cell types in which SDF-1 and CXCR4 regulate normal and nol. 170, 4021–4030 aberrant cell migration. 19. Fischer, A. M., Mercer, J. C., Iyer, A., Ragin, M. J., and August, A. (2004) 39548 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 CXCR4 Signals to Rho through G J. Biol. Chem. 279, 29816–29820 1704–1709 20. Crespo, P., Xu, N., Simonds, W. F., and Gutkind, J. S. (1994) Nature 369, 39. Nobes, C. D., and Hall, A. (1995) Biochem. Soc. Trans. 23, 456–459 418–420 40. Xu, J., Wang, F., Van Keymeulen, A., Herzmark, P., Straight, A., Kelly, K., 21. Montaner, S., Sodhi, A., Servitja, J. M., Ramsdell, A. K., Barac, A., Sawai, Takuwa, Y., Sugimoto, N., Mitchison, T., and Bourne, H. R. (2003) Cell E. T., and Gutkind, J. S. (2004) Blood 104, 2903–2911 114, 201–214 22. Fukuhara, S., Chikumi, H., and Gutkind, J. S. (2000) FEBS Lett. 485, 41. Barac, A., Basile, J., Vazquez-Prado, J., Gao, Y., Zheng, Y., and Gutkind, J. S. 183–188 (2004) J. Biol. Chem. 279, 6182–6189 23. Marinissen, M. J., Chiariello, M., Tanos, T., Bernard, O., Narumiya, S., and 42. Nishita, M., Aizawa, H., and Mizuno, K. (2002) Mol. Cell Biol. 22, 774–783 Gutkind, J. S. (2004) Mol. Cell 14, 29–41 43. Vicente-Manzanares, M., Cabrero, J. R., Rey, M., Perez-Martinez, M., 24. Wiznerowicz, M., and Trono, D. (2003) J. Virol. 77, 8957–8961 Ursa, A., Itoh, K., and Sanchez-Madrid, F. (2002) J. Immunol. 168, 25. Basile, J. R., Barac, A., Zhu, T., Guan, K. L., and Gutkind, J. S. (2004) Cancer 400–410 Res. 64, 5212–5224 44. Sander, E. E., ten Klooster, J. P., van Delft, S., van der Kammen, R. A., and 26. Peacock, J. W., and Jirik, F. R. (1999) J. Immunol. 162, 215–223 Collard, J. G. (1999) J. Cell Biol. 147, 1009–1022 27. Donzella, G. A., Schols, D., Lin, S. W., Este, J. A., Nagashima, K. A., Mad- 45. Zondag, G. C., Evers, E. E., ten Klooster, J. P., Janssen, L., van der Kammen, don, P. J., Allaway, G. P., Sakmar, T. P., Henson, G., De Clercq, E., and R. A., and Collard, J. G. (2000) J. Cell Biol. 149, 775–782 Moore, J. P. (1998) Nat. Med. 4, 72–77 46. Crespo, P., Schuebel, K. E., Ostrom, A. A., Gutkind, J. S., and Bustelo, X. R. 28. Ui, M., and Katada, T. (1990) Adv. Second Messenger Phosphoprotein Res. (1997) Nature 385, 169–172 24, 63–69 47. Vicente-Manzanares, M., Cruz-Adalia, A., Martin-Cofreces, N. B., Ca- 29. Hamm, H. E. (1998) J. Biol. Chem. 273, 669–672 brero, J. R., Dosil, M., Alvarado-Sanchez, B., Bustelo, X. R., and Sanchez- 30. Ueda, Y., Hirai, S., Osada, S., Suzuki, A., Mizuno, K., and Ohno, S. (1996) Madrid, F. (2005) Blood 105, 3026–3034 J. Biol. Chem. 271, 23512–23519 48. Van Leeuwen, F. N., Olivo, C., Grivell, S., Giepmans, B. N., Collard, J. G., 31. Bar-Sagi, D., and Hall, A. (2000) Cell 103, 227–238 and Moolenaar, W. H. (2003) J. Biol. Chem. 278, 400–406 32. Kikuchi, A., Yamamoto, K., Fujita, T., and Takai, Y. (1988) J. Biol. Chem. 49. Rosenfeldt, H., Vazquez-Prado, J., and Gutkind, J. S. (2004) FEBS Lett. 572, 263, 16303–16308 167–171 33. Burridge, K., and Wennerberg, K. (2004) Cell 116, 167–179 50. Radhika, V., and Dhanasekaran, N. (2001) Oncogene 20, 1607–1614 34. Narumiya, S., Ishizaki, T., and Uehata, M. (2000) Methods Enzymol. 325, 51. Xu, N., Voyno-Yasenetskaya, T., and Gutkind, J. S. (1994) Biochem. Bio- 273–284 phys. Res. Commun. 201, 603–609 35. Fukuhara, S., Murga, C., Zohar, M., Igishi, T., and Gutkind, J. S. (1999) 52. Parks, S., and Wieschaus, E. (1991) Cell 64, 447–458 J. Biol. Chem. 274, 5868–5879 53. Offermanns, S., Mancino, V., Revel, J. P., and Simon, M. I. (1997) Science 36. Murphy, P. M. (2001) N. Engl. J. Med. 345, 833–835 275, 533–536 37. Etienne-Manneville, S., and Hall, A. (2002) Nature 420, 629–635 54. Stantchev, T. S., and Broder, C. C. (2001) Cytokine Growth Factor Rev. 12, 38. Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T., and Horwitz, A. R. (2003) Science 302, 219–243 DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39549 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry American Society for Biochemistry and Molecular Biology

The Gα13-Rho Signaling Axis Is Required for SDF-1-induced Migration through CXCR4 *

Download PDF
8 pages

Loading next page...
 
/lp/american-society-for-biochemistry-and-molecular-biology/the-g-13-rho-signaling-axis-is-required-for-sdf-1-induced-migration-zNwqNfv2qa

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
American Society for Biochemistry and Molecular Biology
Copyright
Copyright © 2006 Elsevier Inc.
ISSN
0021-9258
eISSN
1083-351X
DOI
10.1074/jbc.m609062200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 51, pp. 39542–39549, December 22, 2006 Printed in the U.S.A. The G -Rho Signaling Axis Is Required for SDF-1-induced Migration through CXCR4 Received for publication, September 25, 2006 Published, JBC Papers in Press, October 20, 2006, DOI 10.1074/jbc.M609062200 Wenfu Tan, Daniel Martin, and J. Silvio Gutkind From the Oral and Pharyngeal Cancer Branch, NIDCR, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland 20892-4330 The CXC chemokine stromal cell-derived factor-1 stromal cell-derived factor-1 (SDF-1), also named CXCL12, (SDF-1) binds to CXCR4, a seven-transmembrane G protein- belongs to the CXC subfamily and was first cloned from bone coupled receptor that plays a critical role in many physiolog- marrow stromal cells and shown to induce proliferation and ical processes that involve cell migration and cell fate deci- differentiation of B cell progenitors (3). SDF-1 is expressed in a sions, ranging from stem cell homing, angiogenesis, and wide range of normal tissues such as bone marrow, lymph neuronal development to immune cell trafficking. CXCR4 is nodes, lung, liver, and brain (4). SDF-1 exerts functions on also implicated in various pathological conditions, including binding to CXCR4, a seven-transmembrane G protein-coupled metastatic spread and human immunodeficiency virus infec- receptor (GPCR) (4–6) that is highly conserved across species tion. Although SDF-1-induced cell migration in CXCR4-ex- and is expressed on a wide variety of cell types, including hema- pressing cells is sensitive to pertussis toxin treatment, hence topoietic cells, vascular endothelial cells, neurons, microglia, involving heterotrimeric G proteins of the G family, whether and astrocytes (7). The SDF-1-CXCR4 signaling system is now other G proteins participate in the chemotactic response to known to be critical for the regulation of the migration, prolif- SDF-1 is still unknown. In this study, we took advantage of the eration, differentiation, and survival of lymphocyte, as reflected potent chemotactic activity of SDF-1 in Jurkat T-cells to by its key role in lymphocyte trafficking and overall immune examine the nature of the heterotrimeric G protein subunits surveillance (8). CXCR4 is also an obligatory co-receptor for the contributing to CXCR4-mediated cell migration. We ob- infection of T-cell tropic human immunodeficiency virus (HIV) served that whereas G and G subunits are involved in SDF- strains (9, 10). 1-induced Rac activation and cell migration, CXCR4 can also The function of SDF-1 and CXCR4 is not restricted to the stimulate Rho potently leading to the phosphorylation of immune system. Indeed, mouse embryos lacking either SDF-1 myosin light chain through the Rho effector, Rho kinase, but or CXCR4 display many lethal defects, including impaired independently of G . Furthermore, we found that G medi- hematopoiesis, malformations of the intestinal vasculature, i 13 ates the activation of Rho by CXCR4 and that the functional cardiac ventricular septal defects, and abnormal migration of activity of both G and Rho is required for directional cell cerebellar neurons (11–13). In addition, SDF-1 and CXCR4 migration in response to SDF-1. Collectively, our data indicate participate in a number of pathologic conditions that involve that signaling by CXCR4 to Rho through G contributes to aberrant cell motility, such as the metastatic spread of cancer- cell migration when stimulated by SDF-1, thus identifying the ous cells (14). For example, CXCR4 is largely overexpressed in G -Rho signaling axis as a potential pharmacological target in many frequently malignant tumors, including breast, lung, and many human diseases that involve the aberrant function of prostate cancer, whereas the expression of SDF-1 is high in the CXCR4. organs in which these tumors metastasize, such as lymph nodes and lung (15). Furthermore, SDF-1 is a potent chemoattractant for breast cancer cells in vitro, and neutralizing CXCR4 anti- bodies inhibit the metastasis of these cells to organs with high Chemokines are a group of chemoattractant cytokines that expression of SDF-1 in vivo (16). are involved in key developmental and homeostatic events, The signaling mechanisms by which CXCR4 promotes cell including leukocyte trafficking, angiogenesis, hematopoiesis, migration are not fully elucidated. It is well known that CXCR4 inflammation, immune response, and organogenesis, as well as is coupled to pertussis toxin (PTX)-sensitive heterotrimeric G in tumor progression and metastasis (1). They are divided into proteins of the G family which promote the activation of phos- four subfamilies, CXC, CC, C, and CX3C, based on their struc- i , phatidylinositol 3-kinase and the accumulation of D-3 phos- tural properties and primary amino acid sequence (1, 2). The phoinositol lipids (17, 18). Phosphatidylinositol 3-kinase sig- naling can in turn promote cell migration in response to SDF-1 * This work was supported by the Intramural Research Program of the by activating ITK, a Tec family kinase (19). However, whether National Institutes of Health, NIDCR. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. The abbreviations used are: SDF, stromal cell-derived factor-1; GPCR, G Section 1734 solely to indicate this fact. protein-coupled receptor; HIV, human immunodeficiency virus; PTX, per- To whom correspondence should be addressed: Oral and Pharyngeal Can- tussis toxin; ERK, extracellular signal-regulated kinase; MLC, myosin light cer Branch, NIDCR, National Institutes of Health, 30 Convent Dr., Bldg. 30, chain; GFP, green fluorescent protein; PMA, phorbol-12-myristate-13-ace- Rm. 211, Bethesda, MD 20892-4340. Tel.: 301-496-6259; Fax: 301-402-0823; tate; shRNA, short hairpin RNA; PAK, p21-activated kinase; GEF, guanine E-mail: [email protected]. nucleotide exchange factor. 39542 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 This is an Open Access article under the CC BY license. CXCR4 Signals to Rho through G other heterotrimeric G proteins are also required for cell migra- Lentivirus Infection—Lentiviral stocks were prepared and tion and, if so, the nature of their downstream targets is not fully titrated as previously reported using 293T cells as the packaging understood. Here, we took advantage of the fact that Jurkat cells (25). Jurkat cells were incubated with viral supernatants for T-cells express CXCR4 receptors endogenously, and thus 12 h. After that, the cells were washed twice with phosphate- migrate readily in response to SDF-1, to begin dissecting the buffered saline and returned to normal growth medium. signaling network by which CXCR4 controls directional cell Flow Cytometric Analysis—Cells were harvested and washed motility. We found that whereas G regulates cell migration by three times with phosphate-buffered saline. Following incuba- activating Rac through G heterotrimeric G protein subunits, tion with biotin-conjugated anti-CXCR-4 antibody or isotype CXCR4 utilizes the  subunit of G to activate Rho and that the control antibody for 60 min at room temperature, the cells were functional activity of G and G , hence the coordinated activa- treated with streptavidin-phycoerythrin-conjugated IgG (Vec- i 13 tion of Rac and Rho, are both required for CXCR4-induced cell tor Laboratories, Burlingame, CA) for 30 min at room temper- migration in response to SDF-1. ature and analyzed with a BD Biosciences flow cytometer. Chemotaxis Assay—Chemotaxis assay was determined with EXPERIMENTAL PROCEDURES a 48-well Boyden chamber (NeuroProbe, Gaithersburg, MD) Materials—Recombinant human stromal cell-derived factor using a polyvinyl pyrrolidone-free polycarbonate filter with a 1 alpha and biotin-conjugated mouse monoclonal anti-CXCR4 5-m pore size (Nuclepore; Corning Costar, Acton, MA). Fil- antibody and mouse IgG isotype antibody were purchased ters were not coated with extracellular matrix molecules to pre- 2B from R&D Systems (Minneapolis, MN). Rabbit monoclonal vent the influence of cell adhesion to the chemotactic response phospho-ERK1/2 (p-ERK1/2) and phospho-myosin light chain to SDF-1. Briefly, 50 l of Jurkat cells transfected by Renilla (p-MLC) and MLC antibodies were purchased from Cell Sig- luciferase with or without other constructs were added to the naling Technology (Beverly, MA). Rabbit polyclonal antiserum upper chamber, and a similar volume of cell suspension was against ERK1/2, Rho, G ,G , and -tubulin were obtained kept as transfection efficiency control. The chemoattractant 12 13 from Santa Cruz Biotechnology (Santa Cruz, CA); mouse was added to the lower chamber. Cells migrated into the lower monoclonal antibody against Rac and rod  transducin were chamber were collected after4hof incubation, and Renilla obtained from BD Transduction Laboratories. Monoclonal luciferase activities present in cellular lysates were assayed antibody against AU-1, AU-5, and GFP epitope were purchased using the dual luciferase reporter system. In each case, migra- form Covance (Berkeley, CA). AMD3100 octahydrochloride tion was calculated as the ratio between the luciferase activity in was purchased from Sigma. PTX and phorbol-12-myristate-13- migrating cells (lower chamber) and the total luciferase activity acetate (PMA) were obtained from Calbiochem. Dual luciferase in the 50-l cell suspension. reporter system was purchased from Promega (Madison, WI). Rho GTPase Pulldown Assay—In vivo Rho and Rac activity Constructs—Expression vectors for G transducin (G ), was assessed by a modified method described elsewhere (21). G ,G , PAK-N, PAK-NL2, RhoN19, GFP fused to the RGS Briefly, after serum starvation overnight, cells were treated as 12 13 domain of PDZ-RhoGEF (GFP-RGS), and C3 toxin have been indicated and lysed at 4 °C in a buffer containing 20 mM Hepes, previously described (20–23). pH 7.4, 0.1 M NaCl, 1% Triton X-100, 10 mM EGTA, 40 mM Cell Lines and Transfection—Jurkat cells were cultured in -glycerophosphate, 20 mM MgCl ,1mM Na VO ,1mM dithi- 2 3 4 RPMI 1640 (Sigma) supplemented with 10% fetal calf serum othreitol, 10 g/ml aprotinin, 10 g/ml leupeptin, and 1 mM (BioWhittaker, Walkersville, MD). Human epithelial kidney phenylmethylsulfonyl fluoride. Lysates were incubated with 293-T cells were grown and maintained in Dulbecco’s modified glutathione S-transferase-rhotekin-Rho binding domain previ- Eagle’s medium (Sigma) containing 10% fetal calf serum. Cells ously bound to glutathione-Sepharose beads for Rho activity were transfected by Lipofectamine-PLUS (Invitrogen) follow- assay or with a purified, bacterially expressed glutathione ing the manufacturer’s directions. S-transferase fusion protein containing the cdc42/Rac-inter- CXCR4 shRNA and G shRNA—To knock down the acting binding (CRIB) domain of PAK1 previously bound to expression of CXCR4 and G , CXCR4 shRNA, GCGCGGC- glutathione-Sepharose beads for Rac activity. Associated GTP- CAAGTTCTTAGTTGCTGTTAGTGAAGCCACAGATGT- bound forms of Rho or Rac were released with protein loading AACAGCAACTAAGAACTTGGCCATGCCTACTGCCTC- buffer and analyzed by Western blot analysis using a mono- TM GGA, which targets CXCR4 mRNA sequence (GenBank clonal antibody against Rho or Rac. accession number AY728138) at nucleotide 5457–5478, and Immunoblot Analysis—Cells were lysed in lysis buffer (50 mM G shRNA, TGCTGTTGACAGTGAGCGCTAAGATGATG- Tris-HCl, 150 mM NaCl, 1% Nonidet P-40) supplemented with TCGTTTGATACTAGTGAAGCCACAGATGTAGTATCAA- protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride, 1 ACGACATCATCTTATTGCCTACTGCCTCGGA, which tar- l/ml aprotinin and leupeptin) for 15 min at 4 °C. Equal TM gets G mRNA sequence (GenBank accession number amounts of protein were subjected to SDS-polyacrylamide gel NM_006572) at nucleotide 412–438, were subcloned into the electrophoresis and transferred onto a polyvinylidene difluo- pENTR-shRNA vector between the XhoI and EcoRI sites. LR ride membrane (Immobilon P; Millipore). The membranes reaction (the Gateway attL  attR reaction) was performed were then incubated with the appropriate antibodies. according to the manufacturer’s instructions to transfer the RESULTS CXCR4 shRNA or G shRNA insert from pENTR-shRNA into PWPI-GW, a Gateway-compatible lentiviral destination SDF-1 Induces Jurkat Cell Migration through CXCR4—To vector (24). investigate the mechanism underlying the ability of SDF-1 to DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39543 CXCR4 Signals to Rho through G FIGURE 1. SDF-1 promotes the migration of Jurkat cells through endoge- nous CXCR4 receptors. A, expression of CXCR4 in Jurkat T-cells. The expres- sion of CXCR4 on Jurkat cells was assessed by fluorescence-activated cell sorter analysis of the fluorescence intensity (arbitrary units) of cells incubated with biotin-conjugated anti-CXCR4 (CXCR4) antibodies or an isotype control FIGURE 2. PTX-sensitive G proteins of the G family are required for SDF- antibody (IgG) followed by streptavidin-phycoerythrin. No specific fluores- 1-induced migration of Jurkat T-cells. A role for G subunits. A, PTX cence was detected in anti-CXCR4-stained SAOS-2 cells when used as nega- inhibits the phosphorylation of ERK stimulated by SDF-1. Jurkat cells pre- tive controls (not shown). B, SDF-1 induces the phosphorylation of ERK in treated overnight with serum-free medium with or without different concen- Jurkat cells. Jurkat cells were serum starved, treated () or not () with trations of PTX were stimulated with SDF-1 (10 ng/ml) for 5 min. Cells were AMD3100, and stimulated with SDF-1 (10 ng/ml) for the indicated time. The lysed and used for Western blot analysis of phosphorylated and total ERK. B, total (ERK) and phosphorylated forms (p-ERK) of ERK1 and ERK2 were detected PTX blocks the migration of Jurkat cells evoked by SDF-1. After incubating in cellular lysates by Western blot analysis with the appropriate antibod- with different concentrations of PTX overnight, Jurkat cells were sus- ies. C, SDF-1 induces the migration of Jurkat cells. Serum-free growth pended in serum-free growth medium and added into the upper wells of medium containing various concentrations of SDF-1 was added into the the Boyden chambers. Serum-free growth medium with or without SDF-1 lower wells of Boyden chambers, and Jurkat cells transfected with Renilla (10 ng/ml) was loaded into the lower wells as chemoattractant. Data are luciferase were loaded into the upper wells. After 4 h, the cells that represented as in Fig. 1C. C, expression of transducin in Jurkat cells. Con- migrated into the lower wells were collected. Migration was measured as trol and transducin (G )-transfected Jurkat cells were analyzed by West- the ratio of the Renilla luciferase activity in migrating cells versus the total ern blotting using antibodies to transducin or -tubulin as a control. D, Renilla luciferase activity in the cells added in the upper chamber of each expression of transducin decreases the phosphorylation of ERK induced by well and expressed as -fold increase with respect to cell migration toward SDF-1. Jurkat cells were transfected with transducin, serum starved over- serum-free growth medium, which was taken as 1. Values are the aver- night, and lysed after stimulating with SDF-1 (10 ng/ml) or PMA (50 nM) for 5 age  S.E. of triplicate samples from a typical experiment. Similar results min. Western blot analysis of ERK phosphorylation was performed as above. E, were obtained in three additional experiments. D, AMD3100 inhibits the transducin inhibits the migration of Jurkat cells induced by SDF-1. Jurkat cells migration induced by SDF-1. Jurkat cells were treated with the indicated transfected with different concentrations of transducin were subjected to concentrations of AMD3100 and their migration toward wells containing migration assays using SDF-1 as the chemoattractant as described above. SDF-1 (10 ng/ml) measured and represented as for panel C. promote cell migration, we took advantage of the Jurkat T cell maximum already at a concentration of 10 ng/ml of this che- line that expresses CXCR4 endogenously (26). We first con- moattractant (Fig. 1C). The treatment with AMD3100 pre- firmed CXCR4 expression on Jurkat cells by fluorescence-acti- vented the SDF-1-induced cell migration in a dose-dependent vated cell sorter analysis. Saos-2 cells, which do not express of manner (Fig. 1D). These data indicated that SDF-1 can induce a CXCR4, were used as a negative control. As shown in Fig. 1A, remarkable migratory response in Jurkat cells through CXCR4. we observed remarkable expression of CXCR4 on Jurkat cells, G and G Are Involved in the Migration of Jurkat Cells whereas no expression of CXCR4 was detected on Saos-2 cells Induced by SDF-1—PTX, which ADP ribosylates G , thereby (not shown). We then determined the functional activity of uncoupling it from receptor activation (28), was used to inves- CXCR4 in Jurkat cells by analyzing the activation of ERK, a tigate the role of G in the process of cell migration stimulated typical response elicited by GPCRs (20) by SDF-1. Exposure of by SDF-1. The effect of PTX on the phosphorylation of ERK was Jurkat cells to SDF-1 resulted in the fast accumulation of the used as positive control. Treatment of Jurkat cells with PTX phosphorylated active form of ERK, which peaked at 5 min resulted in a decrease of phosphorylation of ERK and cell after stimulation and decreased thereafter. Pretreatment of migration in a dose-dependent fashion (Fig. 2, A and B). This cells with AMD3100, a specific CXCR4 inhibitor (27), pre- confirmed that G participates in the migratory response initi- vented the phosphorylation of ERK when provoked by SDF-1 ated by CXCR4. As receptor stimulation of G induces the dis- (Fig. 1B), thus together demonstrating that Jurkat cells express sociation of G subunits from GTP-bound G (29), we next functional CXCR4 receptors. We next evaluated whether evaluated the contribution of G to SDF-1-induced cell SDF-1 could induce the migration of Jurkat cells using a mod- migration by the overexpression of G transducin, which ified Boyden Chamber system in which cell migration can be blocks G function by quenching these G protein subunits easily quantified using a luciferase-based assay. Using this sys- upon their release from G (20). Indeed, expression of G trans- tem, we observed that Jurkat cells migrate efficiently toward ducin in Jurkat cells (Fig. 2C) prevented the phosphorylation of wells containing various concentrations of SDF-1, reaching a ERK induced by SDF-1 (Fig. 2D). In contrast, the phosphoryla- 39544 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 CXCR4 Signals to Rho through G Jurkat cells. Interestingly, as shown in Fig. 3D, expression of PAK-N dramatically reduced the migration of Jurkat cells induced by SDF-1, whereas PAK-NL2 did not exert any demon- strable effect (Fig. 3D). Collectively, our results suggest that G participates in the SDF-1-induced migration of Jurkat cells by stimulating the activity of Rac, likely through G subunits. Rho Is Involved in Cell Migration Induced by SDF-1 through CXCR4—As cell migration often requires the coordinated acti- vation of the small GTPases Rac and Rho, we next sought to explore whether Rho plays a role in the chemotactic response to SDF-1. We first examined whether SDF-1 promotes the activa- tion of Rho. As shown in Fig. 4A, SDF-1 stimulation provoked a profound activation of Rho, as judged by the use of pulldown assays. To address whether Rho is involved in cell migration stimulated by SDF-1, we used both treatment with C3 toxin, by which ADP ribosylates and inhibits Rho (32), and the expres- sion of an AU5-tagged negative dominant mutant of Rho, Rho FIGURE 3. SDF-1 induces cell migration and Rac activation through G . N19. Treatment with C3 toxin from 0.1–5 ng/ml inhibited the A, time course of the activation of Rac stimulated by SDF-1. Serum-starved migration of Jurkat cells toward wells containing SDF-1 (Fig. Jurkat cells were stimulated with SDF-1 (10 ng/ml) for different times, and the GTP-bound form of Rac (GTP-Rac) was assessed in cellular lysates by 4B). Similarly, the expression of the AU5-tagged form of Rho pulldown assays. Western blot analysis of total Rac in each cell lysate was N19 in Jurkat cells (Fig. 4C) dramatically reduced the migration used as a control. B, PTX inhibits the activation of Rac induced by SDF-1. Jurkat cells were cultured overnight in serum-free growth medium with or of these cells when induced by SDF-1 (Fig. 4D), while in control without different concentrations of PTX and stimulated with SDF-1 (10 experiments the dominant negative mutant of Rac, but not of ng/ml) for 5 min. Cell lysates were used for pulldown analysis of GTP- Cdc42, also prevented Jurkat cell migration (not shown). These bound Rac as above. C, expression of the AU1-tagged forms of PAK-N (PAKN) and PAK-NL2 (PAKL2) in Jurkat cells. Jurkat cells transfected with data demonstrate that SDF-1 can activate Rho and that in turn Rho PAK-N and PAK-NL2 expression vectors were lysed for Western blot anal- is involved in cell migration induced by this potent chemokine. To ysis with antibodies to the AU1 epitope or -tubulin as a control. D, inhi- bition of Rac leads to a decrease in Jurkat cell migration induced by SDF-1. further investigate whether Rho activation in response to SDF-1 is Jurkat cells were transfected by PAK-N and the control construct PAK-NL2, indeed mediated through CXCR4, we limited the expression of and migration assays toward SDF-1 were performed as described above. this GPCR by RNA-interfering approaches (Fig. 4E). Our data showed that the knock down of the expression of CXCR4 in Jurkat tion of ERK elicited by PMA through protein kinase C (30) cells resulted in a reduction in the ability of SDF-1 to promote both remained unaffected and served as a negative control (Fig. 2D). Rho activation and migration (Fig. 4, F and G). G transducin expression resulted in a dramatic inhibition of Rho stimulation leads to the activation of Rho kinase, which the migratory response toward SDF-1 (Fig. 2E), thus indicating promotes the accumulation of phospho-MLC by phosphoryl- that G subunits, when released from G , are involved in SDF- ating MLC directly or by inhibiting MLC phosphatase, thereby 1-induced cell migration through CXCR4. contributing to cell migration by regulating acto-myosin con- Signaling through G Promotes the Migration of Jurkat Cells traction (33). To explore whether Rho kinase is an important by Stimulating Rac—Because the small GTP-binding protein downstream effector of Rho activation in response to SDF-1, we Rac plays a central role in the regulation of the actin-based treated Jurkat cells with the Rho kinase inhibitor Y27632 (34) cytoskeleton and cell movement (31), we then investigated and observed that SDF-1 stimulates the phosphorylation of whether this Rho-related GTPase is involved in the G -medi- MLC potently (Fig. 4H), which was abolished by the treatment ated migration of Jurkat cells. As shown in Fig. 3A, by a pull- with Y27632. Furthermore, Y27632 prevented the migration of down assay we observed that stimulation of Jurkat cells with Jurkat cells toward SDF-1 (Fig. 4I). These findings suggest that SDF-1 provoked the rapid accumulation of GTP-bound Rac, the stimulation of Rho by SDF-1 through CXCR4 results in Rho which reached a maximum at 5 min. In parallel experiments, kinase activation and consequent MLC phosphorylation and however, we did not detect the accumulation of the GTP- that these downstream events initiated by Rho participate in bound form of Cdc42, a Rac-related GTPase (not shown). Pre- cell migration toward SDF-1. treatment of Jurkat cells with PTX attenuated the Rac activity G Is Involved in SDF-1-induced Cell Migration, and 12/13 induced by SDF-1 (Fig. 3B). These data indicate that SDF-1 This Effect Is Mediated by Rho—As both G and Rho activity induces Rac activation through PTX-sensitive G proteins of the were required for SDF-1-induced cell migration, we asked G class. We next set out to explore whether Rac is necessary for whether Rho functions downstream of G . However, as shown i i the migratory response to SDF-1 by expressing in Jurkat cells in Fig. 5A, treatment of Jurkat cells with PTX failed to inhibit the N-terminal region of PAK (p21-activated kinase), PAK-N, Rho activation in response to SDF-1 and instead caused a slight which includes its Cdc42/Rac-interactive binding motif, and enhancement of Rho activity (Fig. 5A). As G and G can 12 13 PAK-NL2, which lacks two residues required for Rac binding promote the activation of Rho elicited by GPCRs through and therefore serves as a specificity control (21). Fig. 3C shows directly binding to the RGS domain of RGS-containing Rho the expression of the AU1-tagged forms of both PAK-N and guanine nucleotide exchange factors (GEFs) (22, 35), we then PAK-NL2 after transfection of their expression vectors into examined whether the G -Rho signaling axis is required 12/13 DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39545 CXCR4 Signals to Rho through G FIGURE 5. G is involved in the migration of Jurkat cells induced by 12/13 SDF-1. A role for G in Rho activation. A, inhibition of the activity of G 12/13 i by PTX fails to prevent Rho activation. Jurkat cells treated with different con- centrations of PTX overnight were stimulated with SDF-1 (10 ng/ml; 5 min), and Rho activity in cell lysates was analyzed as described above. B, expression of the GFP-tagged RGS domain of PDZ-RhoGEF in Jurkat cells. Western blot analysis with antibodies to GFP or -tubulin was performed in lysates from Jurkat cells transfected with the GFP-tagged RGS domain of PDZ-RhoGEF (GFP-RGS) or vector control. C, inhibition of G suppresses the activation 12/13 of Rho by SDF-1. Jurkat cells transfected with GFP-RGS were stimulated with SDF-1 (10 ng/ml) for 5 min and Rho activity measured in cell lysates by pull- down analysis. D, inhibition of G diminishes SDF-1-induced cell migra- 12/13 tion. Jurkat cells transfected with different amounts of GFP-RGS were used for migration assays toward SDF-1 (10 ng/ml) as above. E and F, reconstitution of the CXCR4-G -signaling axis in 293T cells. E, time course of ERK phospho- rylation in response to SDF-1 in 293T cells transfected with expression vectors for GFP or CXCR4. Cells treated with 10 ng/ml SDF-1 were collected at the indicated time for immunoblot analysis. F,G is involved in Rho activation FIGURE 4. Rho is involved in SDF-1-stimulated cell migration. A, time in response to SDF-1 in CXCR4-transfected cells. 293T cells transfected with course of Rho activation induced by SDF-1. Jurkat cells were serum starved GFP or CXCR4 with or without GFP RGS were lysed after treatment with SDF-1 overnight and stimulated with SDF-1 (10 ng/ml) for the indicated times. and used for pulldown assay. Rho activity was assessed in cell lysates by pulldown analysis of GTP- bound Rho. Total Rho in each cell lysate was determined as a control. B, treatment with C3 toxin inhibits the migration of Jurkat cells. Jurkat cells for cell migration when induced by SDF-1. We transfected Jur- were transfected with various concentrations of a C3 toxin expression kat cells with a chimeric molecule encoding GFP fused to the vector, and their migration to wells containing SDF-1 (10 ng/ml) was RGS domain of PDZ-RhoGEF, which binds to the activated assayed as described above. C, expression of RhoN19 in Jurkat cells. Jurkat cells were transfected with AU5-tagged RhoN19, and Western blot analy- forms of G and thus behaves as a dominant negative 12/13 sis was performed in total cell lysates using antibodies to the AU5 epitope mutant for G (25). Expression of this GFP-RGS chimera 12/13 or -tubulin. D, inhibition of Rho prevents Jurkat cell migration induced by in Jurkat cells (Fig. 5B) inhibited the migration elicited by SDF-1. Jurkat cells were transfected with RhoN19 and used for migration assays toward SDF-1 (10 ng/ml) as above. E, knock down of the expression SDF-1 (Fig. 5D), suggesting that G activation is required 12/13 of CXCR4 by RNA-interfering approach. After infection with lentivirus-GFP for the chemotactic response to SDF-1. We then set out to (control shRNA) or lentivirus-CXCR4 shRNA, Jurkat cells were analyzed for CXCR4 expression by fluorescence-activated cell sorter. F, knock down of the explore whether the effect of G on the migration of Jurkat 12/13 expression of CXCR4 diminished ERK phosphorylation and Rho activation in cells is mediated by Rho. As shown in Fig. 5C, Jurkat cells trans- response to SDF-1. Jurkat cells infected with lentivirus-GFP (GFP) or lentivirus- fected by various concentrations of GFP-RGS exhibited CXCR4shRNA were serum starved overnight and used for ERK and Rho acti- vation by Western blot analysis and Rho pulldown assays as above. G, CXCR4 reduced Rho activity after SDF-1 stimulation as compared with knock down decreased Jurkat cell migration induced by SDF-1. Cells infected control-transfected cells. These data provided evidence that with the indicated lentiviruses were used for migration assays in response to G is involved in cell migration when induced by SDF-1 SDF-1 as above. H and I, the Rho effector Rho kinase participates in Jurkat cell 12/13 migration promoted by SDF-1. Pretreatment of Jurkat cells with the indicated and that this effect is likely mediated by Rho. concentrations of the Rho kinase inhibitor Y27632 suppressed the phospho- As 293T cells do not express CXCR4 (not shown), we then set rylation of the MLC (H) and the migration of the Jurkat cells in response to SDF-1 (I). out to reconstitute the CXCR4-G signaling axis by the 39546 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 CXCR4 Signals to Rho through G G and expressed it stably in Jurkat cells by a recently devel- oped lentiviral system (24). As shown in Fig. 6B,G expres- sion was decreased 6 days after infection of Jurkat cells with a lentivirus carrying G shRNA and was almost eliminated 10 days after infection, whereas a control GFP-expressing lentivi- rus had no demonstrable effect. As shown in Fig. 6C, the acti- vation of Rho in Jurkat cells mediated by CXCR4 was signifi- cantly blocked after G knock down. In addition, phosphorylation of ERK elicited by SDF-1 was slightly decreased, suggesting an unexpected role for G in ERK acti- vation by SDF-1. Remarkably, we also found that knock down of the expression of G reduced the migration mediated by CXCR4, in alignment with the result obtained by the G 12/13 dominant negative mutant (Fig. 6D). Taken together, our data suggest that CXCR4 is coupled to G , in addition to G , and 13 i that activation of Rho through the  subunit of G ,G ,is 13 13 required to induce cell migration in response to SDF-1. DISCUSSION In the present study, we used Jurkat T-cells that express CXCR4 endogenously as an experimental model system to examine the contribution of heterotrimeric G proteins and FIGURE 6. Knock down of G prevents the activation of Rho and cell migration in response to SDF-1 in Jurkat cells. A, Jurkat cells express their downstream targets in cell migration induced by SDF-1. G . The expression of G and G in Jurkat cells was analyzed by 13 12 13 Using a simple luciferase-based system to monitor cell migra- Western blot with heterotrimeric G protein  subunit-specific antibodies, using antibodies to -tubulin as a loading control. 293T cells transfected tion, we first observed that SDF-1 elicits a robust chemotactic with empty vector ()orG and G expression vectors were used as 12 13 response through CXCR4 in Jurkat cells. This response was negative and positive controls, respectively. B, knock down of G by abolished by treatment with PTX, confirming the key role for G lentiviruses carrying G shRNA. Jurkat cells infected with lentiviruses carrying GFP or G shRNA were lysed at the indicated times after infec- 13 proteins of the G family in lymphocyte migration toward che- tion and used for Western blot analysis of G expression. Western blot mokine gradients (36). In this regard, we observed that G for -tubulin was used as a loading control. C, knock down of the expres- sion of G partially decreases the phosphorylation of ERK and nearly subunits, when released from G , are strictly required for 13 i abolishes the activation of Rho induced by SDF-1. The accumulation of CXCR4-mediated cell migration and that the chemotactic phosphorylated ERK and GTP-bound Rho in response to SDF-1 (10 ng/ml; response to SDF-1 involves the coordinated activation of the 5 min) was examined as described above in Jurkat cells 10 days after infection with lentiviruses carrying GFP or G shRNA. D, knock down of small GTPases Rac and Rho by CXCR4. Of interest, whereas G inhibits the migration of Jurkat cells stimulated by SDF-1. The migra- the activation of Rac was mediated by G , likely though its tion of Jurkat cells to wells containing SDF-1 (10 ng/ml) was examined as G subunits, the activation of Rho was insensitive to PTX described above 10 days after infection with lentiviruses carrying GFP or G shRNA and normalized by their respective migration to serum-free 13 treatment, thus suggesting that CXCR4 may utilize G pro- growth medium. teins distinct from G to stimulate Rho. Indeed, by a combi- nation of dominant negative and RNA interference ectopic expression of this GPCR upon transfection of its approaches, we now show that G proteins of the G 12/13 expression plasmid in 293T cells. As a control, although SDF-1 family are also required to induce cell migration in response stimulation of 293T cells transfected with a vector control to SDF-1 and that G links CXCR4 to the activation of Rho (GFP) did not cause ERK activation, the phosphorylated form of by SDF-1 in Jurkat T cells. ERK was readily detected in 293T cells transfected with CXCR4 Small GTP-binding proteins of the Rho family, including expression plasmids after SDF-1 treatment (Fig. 5E). Similarly, Rho, Rac, and Cdc42, play a central role in regulating the activation of CXCR4-transfected 293T cells led to a clear dynamic organization of the actin-based cytoskeleton in mam- increase in the level of GTP-bound Rho, which was prevented malian cells (37). During the process of cell migration, each by the co-expression of the RGS domain of PDZ-RhoGEF (Fig. member of this Rho GTPase family plays a distinct role. Rho is 5F), hence supporting the emerging notion that G is important for regulating the formation of contractile actin-my- 12/13 involved in Rho activation downstream from CXCR4. osin filaments, which form stress fibers, and for maintaining Knock Down of G in Jurkat Cells Inhibits Cell Migration focal adhesions at the rear of the migrating cells, whereas Rac is and Rho Activation Induced by SDF-1—To address the direct involved in forming actin-rich membrane ruffles, referred to as role of G in the migration of Jurkat cells mediated by lamellipodia, at the leading edge of the migrating cells and is 12/13 CXCR4, we set out to knock down G by using RNA inter- recognized to be a driving force for cell migration (38). Cdc42 12/13 ference approaches. We first examined the expression of G has been demonstrated to be critical in regulating cell polarity and G in Jurkat cells using 293T cells transfected with G and filopodia formation, thereby controlling the direction of 13 12 or G , respectively, as positive controls. As shown in Fig. 6A, the cell migration (39). Hence, the coordinated activation of Jurkat cells only express G , while expression of G is Rho GTPases represents a key regulatory event during the 13 12 undetectable. We then designed a shRNA sequence targeting migration of cells toward a chemoattractant gradient. How this DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39547 CXCR4 Signals to Rho through G coordination is achieved is under current intense investigation The finding that CXCR4 utilizes a G -Rho signaling axis 12/13 (37, 40, 41). to promote cell migration may have broad implications as the In Jurkat T cells, we observed that SDF-1 induces the rapid SDF-1/CXCR4 signaling system plays a critical role in many activation of both Rac and Rho, but not Cdc42, in line with prior physiological processes, such as axon guidance, stem cell hom- studies using human peripheral blood lymphocytes (42, 43). Of ing, tissue damage repair, and hematopoietic cell trafficking (8, interest, PTX treatment suppressed the activation of Rac while 13, 14, 17), in which the contribution of G and Rho can 12/13 slightly enhancing Rho activity. This observation is consistent now be investigated. Similarly, although signaling through G with a role for G in signaling from chemokine receptors to Rac by CXCR4 appears not to be necessary for the infection of lym- (42) and prior studies that demonstrated that the activity of Rho phocytes by T-cell tropic (R4) HIV (10), the ability of this che- can be negatively regulated by Rac (44, 45). However, the nature mokine receptor to couple to G , thereby stimulating Rho-de- of the molecular mechanism by which G regulates Rac is at the pendent pathways that affect cell motility and nuclear events, present not fully understood. A recent study suggests that Vav1, may now help explain the still unknown post-entry mechanism a Rac GEF that is activated upon tyrosine phosphorylation (46), by which signaling through CXCR4 contributes to HIV replica- changes its localization and activity upon SDF-1 stimulation of tion and viral transmission (reviewed in Refs. 2, 54). Further- lymphocytes (47). Furthermore, given the fact that CXCR4 acti- more, SDF-1 is produced by stromal cells in the lymph nodes vates phosphatidylinositol 3-kinase (18) and the Tec family and acts as a potent chemoattractant for many cancer cells that tyrosine kinase ITK through Src (19), it is quite likely that express CXCR4, including those from the breast, prostate, and CXCR4 may promote the activation of Rac through the sequen- lung, thereby promoting lymph node invasion and the subse- tial stimulation of Src, phosphatidylinositol 3-kinase, and ITK quent metastatic spread of these highly prevalent cancers (14, and the consequent tyrosine phosphorylation and phosphati- 16, 36). Thus, the finding that CXCR4 signals through G to dylinositol 3-kinase-dependent activation of Vav1. However, it Rho in response to SDF-1 may provide novel therapeutic tar- is still possible that, upon SDF-1 binding to CXCR4, G or free gets for pharmacological intervention in many pathological G may also promote the direct activation of G protein-cou- conditions, ranging from increasing the efficiency on bone pled Rac GEFs such as Tiam1 (48) and P-REX2 (49), both of marrow transplantation to treating cancer metastasis and HIV which are expressed in Jurkat cells (not shown). Thus, the rel- infection. ative contribution of each of these Rac GEFs to the activation of Rac by CXCR4 and lymphocyte migration warrants further REFERENCES investigation. 1. Locati, M., and Murphy, P. M. (1999) Annu. Rev. Med. 50, 425–440 2. Sodhi, A., Montaner, S., and Gutkind, J. S. (2004) Nat. Rev. Mol. Cell Biol. On the other hand, the migratory response of Jurkat T cells 5, 998–1012 toward SDF-1 required the functional activity of Rho, but the 3. Nagasawa, T., Kaisho, T., Kishimoto, T., and Kikutani, H. (1994) J. Immu- activation of this GTPase by CXCR4 was not mediated by G . nol. 152, 2788–2797 This prompted us to explore whether additional G protein 4. Bleul, C. C., Fuhlbrigge, R. C., Casasnovas, J. M., Aiuti, A., and Springer, subunits may link CXCR4 to Rho. In this regard, G and 12 T. A. (1996) J. Exp. Med. 184, 1101–1109 G , members of the G family of G proteins, are known to 5. Ganju, R. K., Brubaker, S. A., Meyer, J., Dutt, P., Yang, Y., Qin, S., Newman, 13 12 W., and Groopman, J. E. (1998) J. Biol. Chem. 273, 23169–23175 stimulate signaling pathways involved in cell growth and neo- 6. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana- plastic transformation (50, 51), but accumulating evidence also Seisdedos, F., Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., supports a role for these G protein  subunits in the regulation Loetscher, M., Baggiolini, M., and Moser, B. (1996) Nature 382, 833–835 of cell migration. For example, concertina, an ortholog of 7. Horuk, R. (2001) Cytokine Growth Factor Rev. 12, 313–335 G , is critically required for cell movement during Dro- 12/13 8. Klein, R. S., and Rubin, J. B. (2004) Trends Immunol. 25, 306–314 sophila embryogenesis (52), and G knockout embryonic 9. Juarez, J., and Bendall, L. (2004) Histol. Histopathol. 19, 299–309 10. Berger, E. A., Murphy, P. M., and Farber, J. M. (1999) Annu. Rev. Immunol. fibroblasts exhibit reduced migratory response to thrombin 17, 657–700 and lysophosphatidic acid (53). Hence, in the present work, we 11. Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa, T., Kishimoto, found that G plays a key role in the chemotactic response 12/13 T., Bronson, R. T., and Springer, T. A. (1998) Proc. Natl. Acad. Sci. U. S. A. initiated by SDF-1 through CXCR4. Furthermore, the results 95, 9448–9453 obtained by reconstituting the CXCR4-G signaling axis in 13 12. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., 293T cells and the knock down of G by the infection of Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998) Nature 393, 591–594 Jurkat cells with lentiviruses carrying G shRNA revealed 13. Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. that CXCR4 stimulates Rho activation through G . Thus, the (1998) Nature 393, 595–599 remarkable biological responses elicited by CXCR4 may 14. Juarez, J., Bendall, L., and Bradstock, K. (2004) Curr. Pharm. Des. 10, require the coordinated activation of Rac-dependent pathways 1245–1259 through G and biochemical routes regulated by Rho through 15. Zlotnik, A. (2004) Semin. Cancer Biol. 14, 181–185 the activation of G . As GTP-bound G can activate Rho 16. Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., 13 13 McClanahan, T., Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., through RGS-containing Rho GEFs, p115 RhoGEF, PDZ-Rho- Mohar, A., Verastegui, E., and Zlotnik, A. (2001) Nature 410, 50–56 GEF, or LARG (22, 35), these findings may also provide a 17. Dutt, P., Wang, J. F., and Groopman, J. E. (1998) J. Immunol. 161, molecular framework to help define the precise GEF utilized by 3652–3658 CXCR4 to stimulate Rho in Jurkat T-cells and in many other 18. Curnock, A. P., Sotsios, Y., Wright, K. L., and Ward, S. G. (2003) J. Immu- cell types in which SDF-1 and CXCR4 regulate normal and nol. 170, 4021–4030 aberrant cell migration. 19. Fischer, A. M., Mercer, J. C., Iyer, A., Ragin, M. J., and August, A. (2004) 39548 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 51 •DECEMBER 22, 2006 CXCR4 Signals to Rho through G J. Biol. Chem. 279, 29816–29820 1704–1709 20. Crespo, P., Xu, N., Simonds, W. F., and Gutkind, J. S. (1994) Nature 369, 39. Nobes, C. D., and Hall, A. (1995) Biochem. Soc. Trans. 23, 456–459 418–420 40. Xu, J., Wang, F., Van Keymeulen, A., Herzmark, P., Straight, A., Kelly, K., 21. Montaner, S., Sodhi, A., Servitja, J. M., Ramsdell, A. K., Barac, A., Sawai, Takuwa, Y., Sugimoto, N., Mitchison, T., and Bourne, H. R. (2003) Cell E. T., and Gutkind, J. S. (2004) Blood 104, 2903–2911 114, 201–214 22. Fukuhara, S., Chikumi, H., and Gutkind, J. S. (2000) FEBS Lett. 485, 41. Barac, A., Basile, J., Vazquez-Prado, J., Gao, Y., Zheng, Y., and Gutkind, J. S. 183–188 (2004) J. Biol. Chem. 279, 6182–6189 23. Marinissen, M. J., Chiariello, M., Tanos, T., Bernard, O., Narumiya, S., and 42. Nishita, M., Aizawa, H., and Mizuno, K. (2002) Mol. Cell Biol. 22, 774–783 Gutkind, J. S. (2004) Mol. Cell 14, 29–41 43. Vicente-Manzanares, M., Cabrero, J. R., Rey, M., Perez-Martinez, M., 24. Wiznerowicz, M., and Trono, D. (2003) J. Virol. 77, 8957–8961 Ursa, A., Itoh, K., and Sanchez-Madrid, F. (2002) J. Immunol. 168, 25. Basile, J. R., Barac, A., Zhu, T., Guan, K. L., and Gutkind, J. S. (2004) Cancer 400–410 Res. 64, 5212–5224 44. Sander, E. E., ten Klooster, J. P., van Delft, S., van der Kammen, R. A., and 26. Peacock, J. W., and Jirik, F. R. (1999) J. Immunol. 162, 215–223 Collard, J. G. (1999) J. Cell Biol. 147, 1009–1022 27. Donzella, G. A., Schols, D., Lin, S. W., Este, J. A., Nagashima, K. A., Mad- 45. Zondag, G. C., Evers, E. E., ten Klooster, J. P., Janssen, L., van der Kammen, don, P. J., Allaway, G. P., Sakmar, T. P., Henson, G., De Clercq, E., and R. A., and Collard, J. G. (2000) J. Cell Biol. 149, 775–782 Moore, J. P. (1998) Nat. Med. 4, 72–77 46. Crespo, P., Schuebel, K. E., Ostrom, A. A., Gutkind, J. S., and Bustelo, X. R. 28. Ui, M., and Katada, T. (1990) Adv. Second Messenger Phosphoprotein Res. (1997) Nature 385, 169–172 24, 63–69 47. Vicente-Manzanares, M., Cruz-Adalia, A., Martin-Cofreces, N. B., Ca- 29. Hamm, H. E. (1998) J. Biol. Chem. 273, 669–672 brero, J. R., Dosil, M., Alvarado-Sanchez, B., Bustelo, X. R., and Sanchez- 30. Ueda, Y., Hirai, S., Osada, S., Suzuki, A., Mizuno, K., and Ohno, S. (1996) Madrid, F. (2005) Blood 105, 3026–3034 J. Biol. Chem. 271, 23512–23519 48. Van Leeuwen, F. N., Olivo, C., Grivell, S., Giepmans, B. N., Collard, J. G., 31. Bar-Sagi, D., and Hall, A. (2000) Cell 103, 227–238 and Moolenaar, W. H. (2003) J. Biol. Chem. 278, 400–406 32. Kikuchi, A., Yamamoto, K., Fujita, T., and Takai, Y. (1988) J. Biol. Chem. 49. Rosenfeldt, H., Vazquez-Prado, J., and Gutkind, J. S. (2004) FEBS Lett. 572, 263, 16303–16308 167–171 33. Burridge, K., and Wennerberg, K. (2004) Cell 116, 167–179 50. Radhika, V., and Dhanasekaran, N. (2001) Oncogene 20, 1607–1614 34. Narumiya, S., Ishizaki, T., and Uehata, M. (2000) Methods Enzymol. 325, 51. Xu, N., Voyno-Yasenetskaya, T., and Gutkind, J. S. (1994) Biochem. Bio- 273–284 phys. Res. Commun. 201, 603–609 35. Fukuhara, S., Murga, C., Zohar, M., Igishi, T., and Gutkind, J. S. (1999) 52. Parks, S., and Wieschaus, E. (1991) Cell 64, 447–458 J. Biol. Chem. 274, 5868–5879 53. Offermanns, S., Mancino, V., Revel, J. P., and Simon, M. I. (1997) Science 36. Murphy, P. M. (2001) N. Engl. J. Med. 345, 833–835 275, 533–536 37. Etienne-Manneville, S., and Hall, A. (2002) Nature 420, 629–635 54. Stantchev, T. S., and Broder, C. C. (2001) Cytokine Growth Factor Rev. 12, 38. Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T., and Horwitz, A. R. (2003) Science 302, 219–243 DECEMBER 22, 2006• VOLUME 281 • NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 39549

Journal

Journal of Biological Chemistry – American Society for Biochemistry and Molecular Biology

Published: Dec 22, 2006

References