Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Glycosylation Broadens the Substrate Profile of Membrane Type 1 Matrix Metalloproteinase

Glycosylation Broadens the Substrate Profile of Membrane Type 1 Matrix Metalloproteinase THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 9, Issue of February 27, pp. 8278 –8289, 2004 © 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Glycosylation Broadens the Substrate Profile of Membrane Type 1 Matrix Metalloproteinase* Received for publication, October 29, 2003, and in revised form, December 5, 2003 Published, JBC Papers in Press, December 11, 2003, DOI 10.1074/jbc.M311870200 Yi I. Wu‡§, Hidayatullah G. Munshi§ , Ratna Sen‡§, Scott J. Snipas , Guy S. Salvesen , Rafael Fridman**, and M. Sharon Stack‡§‡‡ From the ‡Department of Cell & Molecular Biology and Division of Hematology/Oncology, Department of Medicine, Feinberg School of Medicine, and the §Robert H. Lurie Comprehensive Cancer Center, Northwestern University, Chicago, Illinois 60611, the Program in Apoptosis and Cell Death Research, Burnham Institute, La Jolla, California 92037, and the **Department of Pathology, Wayne State University, Detroit, Michigan 48202 extracellular matrix proteins including collagens, laminins, Membrane type 1 matrix metalloproteinase (MT1- MMP) is a collagenolytic enzyme that has been impli- and fibronectin (4). Recent research has identified a variety of cated in normal development and in pathological pro- non-traditional MMP activities including shedding of growth cesses such as cancer metastasis. The activity of MT1- factors, cytokines and their receptors (5– 8), disruption of cell- MMP is regulated extensively at the post-translational matrix and cell-cell junctional protein complexes (9 –11), and level, and the current data support the hypothesis that initiation of proteinase cascades that impact much broader MT1-MMP activity is modulated by glycosylation. Enzy- substrates (12, 13). As a result, MMPs play a central role in matic deglycosylation, site-directed mutagenesis, and many physiological and pathological processes, including de- lectin precipitation assays were used to demonstrate velopment, wound healing, tissue resorption, angiogenesis, and that MT1-MMP contains O-linked complex carbohy- tumor invasion (3, 14, 15). Most MMPs are secreted proteins 291 299 300 301 drates on the Thr , Thr , Thr , and/or Ser resi- and share a similar modular domain structure including dues in the proline-rich linker region. MT1-MMP glyco- propeptide, catalytic domain, linker region, and hemopexin- forms were detected in human cancer cell lines, like domain (2). However, a subgroup of MMPs, designated suggesting that MT1-MMP activity may be regulated by membrane type (MT)-MMPs, contains either an additional differential glycosylation in vivo. Although the autolytic transmembrane and cytoplasmic domain (16 –19) or a glyco- processing and interstitial collagenase activity of MT1- sylphosphatidylinositol anchor (20, 21), suggesting unique sub- MMP were not impaired in glycosylation-deficient mu- strate specificity and distinct regulatory mechanisms as a con- tants, cell surface MT1-MMP-catalyzed activation of sequence of cell surface localization (22). pro-matrix metalloproteinase-2 (proMMP-2) required Among MT-MMPs, MT1-MMP is the most extensively stud- proper glycosylation of MT1-MMP. The inability of car- bohydrate-free MT1-MMP to activate proMMP-2 was not ied and the best characterized. A primary function of MT1- a result of defective MT1-MMP zymogen activation, ab- MMP is pericelluar collagenolysis (reviewed in Ref. 23). This is errant protein stability, or inability of the mature en- supported by both in vitro experiments in which MT1-MMP zyme to oligomerize. Rather, our data support a mecha- was shown to promote cellular invasion of type I collagen (24, nism whereby glycosylation affects the recruitment of 25), and in vivo studies of mice genetically deficient in MT1- tissue inhibitor of metalloproteinases-2 (TIMP-2) to the MMP expression (MT1-MMP/) (26, 27). These mice devel- cell surface, resulting in defective formation of the MT1- oped craniofacial dysmorphism, arthritis, osteopenia, dwarf- MMP/TIMP-2/proMMP-2 trimeric activation complex. ism, and fibrosis of soft tissues because of the inability to These data provide evidence for an additional mecha- process interstitial collagen (26). In addition to direct cleavage nism for post-translational control of MT1-MMP activity of matrix proteins, MT1-MMP also mediates activation of and suggest that glycosylation of MT1-MMP may regu- proMMP-2, which leads to a broader impact on pericelluar late its substrate targeting. proteolysis (16). ProMMP-2 activation involves formation of a ternary complex consisting of MT1-MMP, TIMP-2, and proMMP-2 (28 –30). In this model, TIMP-2 bridges the catalytic Matrix metalloproteinases (MMPs) are a family of zinc-de- domain of MT1-MMP (31) and the hemopexin-like domain of pendent proteinases (1–3) with activity against a variety of proMMP-2 (32), thereby facilitating the recruitment of proMMP-2 to the cell surface. A catalytically competent MT1- * This work was supported by Grant DAMD170010386 (to Y. I. W.) MMP (TIMP-2 free) then mediates an initial cleavage of from United States Army Medical Research and Materiel Command, proMMP-2 (72 kDa) to generate an intermediate form (68 kDa), and by Grants K08CA94877 (to H. G. M.) and R01CA85870 (to M. S. S.) which undergoes autolysis to generate fully activated MMP-2 from the National Cancer Institute. The costs of publication of this (62 kDa) (33, 34). Recent studies indicate that activation of article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance proMMP-2 is regulated by oligomerization of MT1-MMP via with 18 U.S.C. Section 1734 solely to indicate this fact. hemopexin-like domain interactions (35, 36). ‡‡ To whom correspondence should be addressed: Dept. of Cell and The proteolytic activity of MT1-MMP is tightly regulated Molecular Biology, Northwestern University Medical School, 303 E. under normal physiological conditions (22, 23). In addition to Chicago Ave., Tarry 8-715, Chicago, IL 60611. Tel.: 312-908-8216; Fax: 312-503-7912; E-mail: [email protected]. controls on protein expression, the activity of MT1-MMP is The abbreviations used are: MMP, matrix metalloproteinase; MT, extensively regulated post-translationally by zymogen activa- membrane type; TIMP, tissue inhibitor of metalloproteinases; PC, pro- tion, inhibition by TIMPs, autolytic degradation, shedding, oli- protein convertase; PI, proteinase inhibitor; CHO, Chinese hamster gomerization, and membrane trafficking (34 – 40). MT1-MMP ovary; TUG, transverse urea gradient; BGN, benzyl-2-acetamido- 2-deoxy--D-galactopyranoside. is expressed in a zymogen form (64 kDa) and activated in the 8278 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. Glycosylation Regulates MT1-MMP Activity 8279 were generated in the first step PCR, with an overlapping region carrying secretory pathway by furin or furin-like proprotein convertases tag or mutation(s). In the second step of PCR, both fragments were used (PCs) (41– 43). These proprotein convertases cleave proMT1- as templates to generate the complete cDNA carrying the tag or mutation, 108 111 MMP after the R RKR sequence to generate the active followed by subcloning back into the pCR3.1-Uni vector using HindIII and species (55 kDa). This is supported by studies using an engi- EcoRI sites. The outer primers in this strategy are the sequencing primers neered mutant of 1-proteinase inhibitor (1-PI) with furin/PC provided by Invitrogen. The inner primers are 5-GGCCGGCCGGATTA- inhibitory activity, designated 1-PI (44), to block proMT1- TAAGGATGATGATGATAAGGAGGTGATCATCATTG-3 and 5-CAAT- PDX GATGATCACCTCCTTATCATCATCATCCTTATATTCCGGCCGGCC-3 MMP zymogen activation (43). Active MT1-MMP is inhibited for FLAGtag (stalk); 5-GACTATAAAGATGATGATGATAAATACGCCA- by TIMP-2, but is unaffected by TIMP-1 (34). MT1-MMP also TCCAGGGTCTCAAATG-3 and 5-TTTATCATCATCATCTTTATAATC- 2842 285 undergoes autolytic degradation at Gly Gly in the linker GCGCTTCCTTCGAACATTGGC-3 for FLAG tag (f112); 5-GAACAAAA- region, generating a catalytically inactive species (calculated ACTTATCAGTGAAGAAGATCTGGGCCGGCCGGATGAGfsGGGAC-3 molecular mass of 34 kDa) (39). Finally, as a trans-membrane and 5-CAGATCTTCTTCACTGATAAGTTTTTGTTCTCCCGATGGGCA- protein, MT1-MMP is also regulated by membrane trafficking GCCCATCC-3 for Myc tag (stalk); 5-GTCAGGGTTCCCCGCCAAGAT- GCCCCC-3 and 5GGGGGCATCTTGGCGGGGAACCCTGAC-3 for and cell surface localization (37, 45– 47). CHO-1 (T291A); 5-AGGGCTGCTGCTCGGCCTTCTGTTCCTGAT-3 The current study tested the hypothesis that glycosylation of and 5-GGCCGAGCAGCAGCCCTGGGTTGAGGGGGCAT-3 for CHO-3 MT1-MMP functions as an additional mechanism for post- (T299A/T300A/S301A); 5-GGTGGCTGTGCACGCGCTGGGCCA- translational regulation of enzymatic activity and demon- TGCC-3 and 5-GGCATGGCCCAGCGCGTGCACAGCCACC-3 for strates that MT1-MMP is an O-glycoprotein. Although glyco- E240A; and 5-CGAAGGAAGCGCGGTGAGTCAGGGTTCCCCACC-3 sylation was not required for collagenase activity, formation of and 5-CCCTGACTCACCGCGCTTCCTTCGAACATTGGCC-3 for Cat (112–284). a stable MT1-MMP/TIMP-2/proMMP-2 ternary complex and In addition to the above mutants of MT1-MMP, soluble FLAG-tagged subsequent cell surface activation of MMP-2 was blocked in (f112) MT1-MMP (sMT1-MMP) and CHO-4 mutant (sCHO-4) were also glycosylation-defective mutants. Distinct glycoforms of MT1- generated using TA cloning approach from the corresponding mem- MMP were detected in human cancer cell lines, suggesting that brane-anchored constructs. The primers used to delete the transmem- MT1-MMP activity may be regulated by differential glycosyla- brane and cytoplasmic domain (soluble) are forward primer (5-ACCA- tion in vivo. These data support a model in which glycosylation TGTCTCCCGCCCCAAGAC-3) and reverse primer (5-TCAAGCCGC- GCTCACCGCCCCGCC-3). regulates substrate targeting and suggest a cellular mecha- The DNA constructs of wild type 1-PI and 1-PI in pcDNA3 PDX nism for controlling the initiation of MMP-2 dependent vector (Invitrogen) were generated by the laboratory of Dr. Guy S. proteolysis. Salvesen (Burnham Institute, La Jolla, CA). The PCR reactions were performed using high fidelity Pfu Turbo polymerase (Stratagene, La EXPERIMENTAL PROCEDURES Jolla, CA), and the plasmids were verified by DNA sequencing. Materials—Anti-FLAG monoclonal M1 and M2 antibody, anti-Myc Immunoprecipitation with Anti-FLAG M2 Affinity Gel—COS-7 cells monoclonal antibody (9E10), rabbit polyclonal antibody that recognizes were transfected with plasmid DNA indicated using FuGENE 6 (Roche, the linker region of MT1-MMP, peroxidase-conjugated secondary anti- Switzerland) according to instructions from the manufacturer. After bodies, gelatin, rat tail collagen, O-glycosylation inhibitor, benzyl-2- 24 h, cells were lysed in lysis buffer (50 mM Tris buffer, pH 7.5, 150 mM acetamido-2-deoxy--D-galactopyranoside (GalNAc--O-benzyl (BGN)), NaCl, 1% Triton X-100) supplemented with 5 mM EDTA and protease and N-glycosylation inhibitor tunicamycin were purchased from Sigma. inhibitor mixture (Roche). Immunoprecipitation of FLAG-tagged pro- The broad spectrum metalloproteinase inhibitor GM6001 and rabbit teins was performed using anti-FLAG M2 affinity gel according to polyclonal TIMP-2 antibody (AB801) were purchased from Chemicon instructions from the manufacturer (Sigma) and Handee spin cup col- (Temecula, CA). Anti-transferrin receptor monoclonal antibody was umns (Pierce). The cell lysates were incubated with M2 affinity gel at purchased from Zymed Laboratories Inc. (South San Francisco, CA). 4 °C for 2 h, washed three times with washing buffer containing 50 mM Human TIMP-2 and proMMP-2 were purified as previously described Tris, pH7.5, 150 mM NaCl, and 0.1% Triton X-100, and eluted with 200 (48, 49). g/ml 3 FLAG peptide (Sigma) in washing buffer. In co-immunopre- Sequence Analyses of MT-MMPs—The amino acid sequences of MT1- cipitation experiments, EDTA was omitted from lysis buffer, and both to MT6-MMP were obtained from Swiss-Prot P50281, P51511, P51512, lysis buffer and washing buffer were supplemented with 2 mM CaCl Q9ULZ9, Q9Y5R2, and Q9NPA2, respectively. The prediction of O- and and2mM MgCl . The cell lysates and immunoprecipitates were ana- N-glycosylation sites was performed using full-length sequences on the lyzed by Western blot and gelatin zymography as previously described NetOGlyc 2.0 server (www.cbs.dtu.dk/services/NetOGlyc/) (50) and Net- (24, 40, 52). NGlyc 1.0 server (www.cbs.dtu.dk/services/NetNGlyc/), respectively. Enzymatic Deglycosylation—Enzymatic deglycosylation was per- The alignment of the MT-MMP linker domains was performed on the formed according to instructions from the manufacturer (ProZyme, San server of T-Coffee multiple sequence alignment (www.ch.embnet.org/ Leandro, CA). Briefly, FLAG-tagged MT1-MMP or glycosylation mu- software/TCoffee.html) (51). tants were purified using M2 affinity gel as described above. The Cell Culture—COS-7 cells (generous gift of Dr. Kathleen J. Green, purified protein was heat-denatured in SDS buffer provided, neutral- Northwestern University Medical School, Chicago, IL) and MDA-MB- ized with Triton X-100, and digested with buffer control or different 231 cells (generous gift of Dr. V. Craig Jordan, Northwestern University glycosidases for 24 h. Several glycosidases, including sialidase A, endo- Medical School, Chicago, IL) were maintained in Dulbecco’s modified O-glycosidase, (1– 4)-galactosidase, glucosaminidase, and peptide-N- Eagle’s medium containing 10% fetal bovine serum. The ovarian cancer glycosidase F were used either individually or in combinations as de- cell lines DOV13, OVCA429, and OVCA433 were kindly provided by Dr. scribed under “Results.” The digestion was stopped by boiling in SDS Robert Bast, Jr. (M. D. Anderson Cancer Center, Houston, TX), and sample dilution buffer, and the samples were analyzed by Western blot. were maintained in minimal essential medium containing 10% fetal Lectin Precipitation Assay—Biotinylated lectins, including con- bovine serum. Cell culture media and reagents were purchased from canavalin A, soybean agglutinin, Ulex europaeus agglutinin I, wheat Mediatech (Herndon, VA). germ agglutinin, succinylated wheat germ agglutinin, Maackia amu- DNA Constructs—The human MT1-MMP cDNA was kindly provided rensis lectin II, and Sambucus nigra lectin were purchased from Vector by Dr. Duanqing Pei (University of Minnesota, Minneapolis, MN). The Laboratories (Burlingame, CA). These biotinylated lectins were immo- complete coding sequence of MT1-MMP was amplified by PCR using bilized by incubating with neutravidin-conjugated beads (Pierce) at forward primer, 5-ACCATGTCTCCCGCCCCAAGAC-3 and reverse 4 °C for 1 h, followed by three washes with washing buffer supple- primer, 5-TCAGACCTTGTCCAGCAGGGAAC-3, and subcloned into eu- mented with 2 mM CaCl and MgCl . At the same time, cell lysates were 2 2 karyotic expression vector pCR3.1-Uni (Invitrogen, Carlsbad, CA) to ob- prepared using lysis buffer without EDTA and supplemented with 2 mM tain the untagged wild type construct. The wild type construct was fur- CaCl and MgCl . These immobilized lectins were incubated with the 2 2 ther FLAG (DYKDDDDK)-tagged in the stalk region (stalk) or after the cell lysates overnight, followed by washes with washing buffer contain- furin/PC cleavage site (f112), or Myc (EQKLISEEDL)- tagged in the stalk ing2mM CaCl and MgCl . The precipitated proteins were eluted by 2 2 region (Fig. 1B). Subsequently different deletions (Cat) or point muta- boiling in SDS sample dilution buffer and analyzed by Western blot. tions (E240A, CHO-1, CHO-3, and CHO-4; see below) were generated on Collagen Invasion Assay—Collagen invasion assays were performed the wild type cDNA and on the tagged constructs using a two-step over- and analyzed as previously described (24, 52). Briefly, cell culture lapping PCR strategy. Briefly, two fragments covering the complete cDNA inserts (24 wells, 8.0-m pore, Becton Dickinson, Bedford, MA) were 8280 Glycosylation Regulates MT1-MMP Activity FIG.1. MT1-MMP is O-glycosylated with complex carbohydrates. A, the amino acid sequences from the linker domains of MT-MMPs are aligned in a clustal format, with the conserved residues denoted with asterisks. The predicted O- and N-glycosylation sites within these sequences 24 582 are highlighted with  and ƒ, respectively. B, schematic diagram of MT1-MMP (Ser –Val ) consisting of propeptide (Pro), catalytic, linker, 291 299 300 301 hemopexin-like, and transmembrane/cytoplasmic (TM/CT) domains. The predicted O-glycosylation sites, Thr , Thr , Thr , and Ser , were indicated with E on the linker domain. Different FLAG- and Myc-tagged MT1-MMP plasmid constructs were generated in the following studies. 111 112 The tagging sites are, as indicated in each experiment, either after furin/PC cleavage site (RRKR 2Y A, f112) or in the stalk region between 284 285 hemopexin-like and TM/CT domains. The site of autolysis is also indicated (YG 2G ES). C, FLAG-tagged (stalk) MT1-MMP was purified from transiently transfected COS-7 cells and digested with sialidase A, endo-O-glycosidase, (1– 4)-galactosidase, glucosaminidase, and peptide-N- glycosidase F (PNGase F) as indicated. The reaction mixtures were fractionated on a 10% SDS-PAGE followed by Western blot (WB) with anti-FLAG M2 antibody. D, FLAG-tagged (stalk) glycosylation mutants CHO-1 (T291A), CHO-3 (T299A/T300A/S301A), and CHO-4 (T291A/T299A/ T300A/S301A), as well as wild type MT1-MMP were purified from COS-7 cells, digested with sialidase A, and analyzed by Western blot with anti-FLAG M2 antibody. E, lysates from COS-7 cells expressing FLAG-tagged (stalk) wild type or CHO-4 mutant MT1-MMP were incubated with BSA, biotinylated lectins, including concanavalin A (ConA), soybean agglutinin (SBA), U. europaeus agglutinin I (UEA I), wheat germ agglutinin (WGA), succinylated wheat germ agglutinin (sWGA), M. amurensis lectin II (MAL II), or S. nigra lectin (SNA), followed by neutravidin precipitation as described under “Experimental Procedures.” The carbohydrate group(s) that interacts with each lectin was indicated. Glc, glucose; Man, mannose; Gal, galactose; GalNAc, N-acetylgalactosamine; Fuc, fucose; GlcNAc, N-acetylglucosamine; and Sia, sialic acid. The precipitates along with 10% of corresponding lysate input were analyzed by Western blot with anti-FLAG M2 antibody. The pro- and active forms of MT1-MMP are indicated as  and Š, respectively. coated with rat tail type I collagen (10 g/well) in 100 mM Na CO and of invasion, 25 M GM6001 was added to the inner and outer chambers 2 3 allowed to air-dry overnight. Collagen-coated inserts were then washed as indicated. Cells were allowed to invade for 24 h, non-invading cells with Dulbecco’s modified Eagle’s medium three times to remove salts were removed from inner wells using a cotton swab, and invading cells and used immediately. Transfected COS-7 cells were trypsinized, adherent to the bottom of membrane were fixed and stained using a washed with cultured medium, and 1  10 cells were added to the Diff-Quick staining kit (Dade AG, Miami, FL). Invading cells were inner invasion chamber in 250 l of culture medium. The outer wells enumerated as described previously (24, 40). contained 400 l of culture medium. To evaluate the MMP dependence Transverse Urea Gradient (TUG) PAGE—TUG gel electrophoresis Glycosylation Regulates MT1-MMP Activity 8281 FIG.2. Differential glycosylation of MT1-MMP in cancer cells. A, COS-7 cells were transfected with FLAG-tagged (stalk) wild type (left panel) or CHO-4 mu- tant (right panel) MT1-MMP in the ab- sence or presence of 2 mM O-glycosylation inhibitor BGN. The cell lysates were frac- tionated on a 10% SDS-PAGE followed by Western blot with anti-FLAG M2 anti- body. B, breast cancer MDA-MB-231 cells, and ovarian cancer OVCA-R3, DOV13, and OVCA433 cells were cul- tured in the presence or absence of O- glycosylation inhibitor BGN for 48 h. GM6001 was added 24 h before lysing the cells. The cell surface proteins from these cells were purified as described under “Experimental Procedures” and analyzed by Western blot (WB) with anti-MT1- MMP antibody. The pro- and active forms of MT1-MMP are indicated as  and Š, respectively. was performed as previously described (53). Briefly, 7% polyacrylamide RESULTS gels containing a continuous 0 – 8 M urea gradient were cast in batch MT1-MMP Is Post-translationally Modified by O-Glycosyla- using a multiple gradient caster (Owl Scientific, Woburn, MA). The gels tion—To determine whether MT1-MMP is post-translationally were rotated 90°, and a single sample of purified protein, FLAG-tagged modified by glycosylation, the glycosylation potentials of MT1- (f112) sMT1-MMP or sCHO-4 in a 200-l total volume was loaded evenly across the top of the gel. Electrophoresis was performed in the MMP were examined on the Center for Biological Sequence absence of SDS. The fractionated proteins were transferred to polyvi- Analysis server (NetNGlyc and NetOGlyc programs for nylidene difluoride membranes and analyzed by Western blot analysis N-linked and O-linked glycosylation, respectively). The results using anti-FLAG M1 antibody (1:1000 dilution) and peroxidase-conju- of analysis indicated that MT1-MMP is not likely to be N- gated secondary antibody (1:10,000 dilution) followed by ECL detection glycosylated; however, four potential O-glycosylation sites (Pierce). 291 299 300 301 Labeling and Purification of Cell Surface Proteins—Labeling of cell (Thr , Thr , Thr , and Ser ) were identified (Fig. 1, A surface proteins was performed as described previously (40). Briefly, and B). These sites were all located in the proline-rich linker cells were washed with phosphate-buffered saline and incubated with (also known as hinge) region, proposed to be critical for the Sulfo-NHS-LC-LC-Biotin (Pierce) for 10 min on ice and washed with proteinase activity of MT1-MMP (54). Similar to MT1-MMP, 100 mM glycine to quench remaining NHS groups. The cells were then MT2- to MT6-MMP were all predicted to be glycosylated in the lysed in lysis buffer, incubated with neutravidin-conjugated beads linker region (Fig. 1A), suggesting a conserved post-transla- (Pierce) for 1 h, and eluted by boiling in SDS sample dilution buffer for 15 min followed by Western blot analysis. tional modification indicative of a potential regulatory func- Immunostaining of Endocytosed MT1-MMP—COS-7 cells were tion. Enzymatic deglycosylation was subsequently used to test transfected with FLAG-tagged (stalk) MT1-MMP, CHO-4, and E240A the prediction that MT1-MMP is a glycoprotein. Affinity-puri- mutant in the presence of 25 M GM6001. Cell surface FLAG-tagged fied MT1-MMP from COS-7 cells was digested with specific proteins were labeled with FLAG/M2 antibody (1:1000 dilution) on ice glycosidases and evaluated by SDS-PAGE. Because glycosyla- for 1 h. The unbound antibody was washed off with medium, and 25 M GM6001 alone or 25 M GM6001 and 25 nM TIMP-2 were added back to tion can cause a change in the mass and/or charge of a protein, the chamber slides. Cells were shifted to 37 °C to allow endocytosis to both positive and negative changes in relative electrophoretic take place. After 15 min, the cells were placed on ice, washed with wash mobility were interpreted in support of carbohydrate removal. buffer (500 mM acetic acid and 150 mM NaCl) (47) and phosphate- Without digestion, the purified protein migrated as a 64-kDa buffered saline, fixed with 3.7% formaldehyde, and permeabilized with proMT1-MMP species and a 50-kDa active MT1-MMP species 0.2% Triton X-100. The cells were further stained with rabbit polyclonal (Fig. 1C, lane 1). Treatment of MT1-MMP with peptide-N- antibody (Sigma) that recognizes the linker domain of MT1-MMP (1: 2000 dilution). The bound FLAG/M2 antibody and linker antibody were glycosidase F, which efficiently removes N-linked sugars, did detected with corresponding secondary antibody (1:500 dilution) conju- not result in any detectable mobility shift in either the pro- or gated with Alexa Fluor 488 and 546 (Molecular Probes, Eugene, OR), active MT1-MMP (Fig. 1C, lane 7), supporting the prediction respectively. The nucleus was counterstained with TO-PRO-3 iodide that MT1-MMP is not N-glycosylated. Similarly, treatment (Molecular Probes). The images were taken using a Zeiss LSM510 laser (1– 4)-galac- with several O-glycosidases (endo-O-glycosidase, scanning confocal microscope at the Northwestern University Cell Im- aging Facility, and edited using Adobe PhotoShop 7.0 software. tosidase, and glucosaminidase) did not alter the electrophoretic 8282 Glycosylation Regulates MT1-MMP Activity FIG.4. Glycosylation of MT1-MMP does not affect its autolysis in trans. COS-7 cells were co-transfected with different FLAG-tagged (stalk) and untagged MT1-MMP plasmids in the presence or absence of 25 M GM6001 as indicated. The cell lysates were fractionated on 10% SDS-PAGE and analyzed by Western blot (WB) using anti-FLAG M2 antibody. B, COS-7 cells were co-transfected with FLAG-tagged (stalk) E240A mutant and different Myc-tagged MT1-MMP plasmids in the presence or absence of 25 M GM6001. The cell lysates were fraction- ated on 10% SDS-PAGE and analyzed by Western blot using anti-FLAG M2 antibody. The pro-, active, and autolytic products of MT1-MMP are indicated as , Š, and d, respectively. FIG.3. Glycosylation of MT1-MMP does not affect its zymogen alterations in SDS binding properties of the modified proteins. activation or folding. A, COS-7 cells were co-transfected with differ- Of note, there is no mobility shift detected in the proMT1-MMP ent FLAG-tagged (stalk) MT1-MMP glycosylation variants and wild type 1-PI (WT)or 1-PI mutant in the presence of 25 M GM6001. species following treatment with sialidase A, suggesting that PDX After 24 h, cell lysates were fractionated on 10% SDS-PAGE and ana- the sialylation likely follows activation of proMT1-MMP in the lyzed by Western blot (WB) using anti-FLAG M2 antibody. B, COS-7 trans-Golgi network (58). cells were transfected with vector, FLAG-tagged (f112) wild type MT1- To confirm the prediction that MT1-MMP contains O-linked MMP or CHO-4 mutant in the presence of 25 M GM6001. After 24 h, cell lysates were fractionated on 10% SDS-PAGE and analyzed by carbohydrate, three alanine mutants were generated, in which 291 299 301 Western blot using anti-FLAG M1 (upper panel) and M2 (lower panel) Thr (designated CHO-1), Thr -Thr-Ser (CHO-3), or all antibody. C, soluble FLAG-tagged (f112) MT1-MMP and CHO-4 mutant 291 299 four predicted O-glycosylation sites (Thr and Thr -Thr- were purified from transfected COS-7 cells and analyzed by TUG-PAGE Ser , designated CHO-4) were mutated to alanine(s) (sche- as described under “Experimental Procedures.” The FLAG-tagged pro- teins were detected using anti-FLAG M1 antibody. The pro- and active matic of linker region shown in Fig. 1D, top panel). The CHO-1 forms of MT1-MMP are indicated as  and Š, respectively. mutant, which preserves three predicted glycosylation sites, exhibited a relative electrophoretic mobility shift following de- migration of MT1-MMPs (Fig. 1C, lanes 3–5), potentially be- sialylation similar to the wild type protein (Fig. 1D, lanes 2 and cause of the poor efficiency of these O-glycosidases against 4). Removal of all four potential O-glycosylation site(s) (CHO-4, complex O-linked carbohydrates. However, treatment of MT1- Fig. 1D, lane 7) resulted in a mutant with electrophoretic MMP with sialidase A consistently resulted in an altered rel- mobility similar to desialylated wild type MT1-MMP (Fig. 1D, ative mobility of the active MT1-MMP species (Fig. 1C, lanes 2, lane 2). Further, this mutant was insensitive to sialidase A 6, and 8). A similar decrease in relative mobility after desialy- treatment (Fig. 1D, lane 8), suggesting that sialic acids are lation has been shown in several other glycoproteins including added to MT1-MMP via O-linked carbohydrates and all poten- MUC1, endolyn, and CD44 (55–57) and presumably reflects tial O-glycosylation sites were identified. To further character- Glycosylation Regulates MT1-MMP Activity 8283 shown). To determine whether endogenously expressed MT1- MMP is also glycosylated in cancer cells, breast and ovarian cancer cell lines were cultured in the presence and absence of BGN. Because of low expression levels, the endogenous MT1- MMP was enriched by purification of cell surface proteins. The active species of endogenous MT1-MMP was detected when probed with an antibody that recognizes the linker region in Western blot analysis (Fig. 2B). The treatment with BGN re- sulted in a similar mobility shift of the active MT1-MMP spe- cies in MDA-MB-231, DOV13, and OVCA429 cells, suggesting that endogenous MT1-MMP is also glycosylated. Interestingly, no mobility shift was detected upon BGN treatment of OVCA433 cells, with the active species of MT1-MMP detected at the higher apparent molecular weight corresponding to un- derglycosylated MT1-MMP. These data demonstrate that en- FIG.5. Glycosylation of MT1-MMP does not affect collagen dogenous MT1-MMP is O-glycosylated and indicate the pres- invasion. COS-7 cells were transfected with vector, MT1-MMP, ence of differential MT1-MMP glycoforms in human cancer E240A, and different glycosylation mutants as indicated. After 12 h, these cells were trypsinized, seeded (1  10 /well) onto cell culture cells. inserts (24 well, 8.0 m pore) coated with a type I collagen (10 g/well), Glycosylation Does Not Affect Zymogen Activation and Fold- and allowed to invade for 24 h as described under “Experimental Pro- ing of MT1-MMP—The distinct lectin binding properties of pro- cedures.” Non-invading cells were removed from the upper chamber and active MT1-MMP (Fig. 1E) suggest a temporal relationship with a cotton swab. Filters were then stained, and cells, adherent to the underside of the filter, were enumerated using an ocular micrometer. between MT1-MMP activation and glycosylation. ProMT1- The average values of triplicate experiments were normalized to cells MMP is activated by a specific cleavage following the transfected with vector alone (designated 1) and were presented with 108 111 R RKR sequence by furin or other PCs and zymogen acti- S.D. error bar. GM6001 (25 M) was added in the well indicated. vation can be inhibited by an engineered mutant of l-PI des- ignated 1-PI (43). To evaluate the relationship between PDX ize the glycosylation of MT1-MMP, cells were transfected with proMT1-MMP activation and glycosylation, wild type or glyco- either wild type or CHO-4 mutant MT1-MMP and the lysates sylation-defective MT1-MMP was co-expressed with wild type were precipitated with various immobilized lectins. Negligible 1-PI or 1-PI . In the presence of wild type 1-PI (inactive PDX CHO-4 MT1-MMP was precipitated by any lectin (Fig. 1E, against furin/PC), all proMT1-MMP glycoforms were converted lower panel), suggesting that MT1-MMP has very low carbohy- to the active species in the same relative ratio as the wild type drate-independent interaction with lectins. In contrast wild protein, suggesting glycosylation is not required for MT1-MMP type MT1-MMP was precipitated with both concanavalin A, activation (Fig. 3A, lanes 1, 3, 5, and 7). Co-expression of which binds to glucose and mannose (Fig. 1E, lane 2), and 1-PI inhibited proMT1-MMP activation in all glycoforms PDX soybean agglutinin, which binds to galactose and N-acetyl- (Fig. 3A, lanes 2, 4, 6, and 8), indicating the conversion was galactosamine (Fig. 1E, lane 3). Interestingly, a preferential furin/PC-dependent. The accumulated proMT1-MMP appeared interaction with proMT1-MMP was observed, suggesting that to be glycosylated at the same sites in the linker region, be- partial deglycosylation of the proenzyme may accompany zy- cause the pro-form of the CHO-4 mutant did not exhibit a mogen activation. Wheat germ agglutinin, which binds to N- similar mobility shift (Fig. 3A, lane 8). These data indicate that acetylglucosamine and sialic acid, also precipitated MT1-MMP, glycosylation of MT1-MMP is not required for efficient zymo- with preferential binding to the active MT1-MMP species (Fig. gen activation. 1E, lane 5). Succinylated wheat germ agglutinin, which no Because differential NH -terminal proteolytic processing of longer binds to sialic acid but preserves its interaction with active MT1-MMP has been reported (61, 62), control experi- N-acetylglucosamine, differentially recognizes proMT1-MMP ments were performed to examine whether the altered mobility (Fig. 1E, lane 6), providing additional evidence that active of CHO-4 was the result of unusual NH -terminal processing. MT1-MMP is sialylated. To determine the subtype of sialic acid This was achieved by taking advantage of the anti-FLAG M1 on MT1-MMP, interaction with the (-2,3) linkage-specific lec- antibody, which recognizes the FLAG epitope only when it is at tin M. amurensis lectin II and the (-2,6) linkage-specific lectin the NH terminus. Additional tagged wild type MT1-MMP and S. nigra lectin was evaluated. Only M. amurensis lectin II was 2 CHO-4 constructs were generated in which the FLAG sequence found to interact with MT1-MMP (Fig. 1E, lanes 7 and 8), was inserted immediately after furin/PC cleavage site (desig- indicating the sialic acid was added via (-2,3) linkage. These nated f112), instead of the stalk region (Fig. 1B). The f112- data support the conclusion that MT1-MMP is a glycoprotein tagged constructs were expressed in COS-7 cells and initially with O-linked complex carbohydrates. probed with M2 antibody, which detects the FLAG epitope In addition to mutational analysis and lectin precipitation, irrespective of location in the protein primary structure. Both the O-glycosylation inhibitor benzyl-2-acetamido-2-deoxy--D- the pro- and active species of wild type and CHO-4 MT1-MMP galactopyranoside (GalNAc--O-benzyl, or BGN) (59, 60) and were recognized (Fig. 3B, lower panel). When probed with M1 the N-glycosylation inhibitor tunicamycin were used to evalu- antibody, only the active species were detected, because of ate glycosylation of MT1-MMP. Culture of cells overexpressing exposure of the NH -terminal FLAG epitope following furin/PC wild type MT1-MMP with BGN resulted in expression of an processing (Fig. 3B, upper panel). The CHO-4 mutant as well as MT1-MMP species (Fig. 2A, lane 2) with relative electro- wild type MT1-MMP was recognized, indicating that the amino phoretic migration similar to the carbohydrate-free CHO-4 mu- terminus of the CHO-4 mutant is identical to that of wild type tant (Fig. 2A, lane 3), providing additional evidence that MT1- MMP is O-glycosylated. No change in mobility was observed MT1-MMP. These data confirm that the altered relative elec- trophoretic mobility observed in the CHO-4 mutant reflects upon treatment of CHO-4-expressing cells with BGN (Fig. 2A, lane 4). In control experiments, treatment with the N-glycosy- lack of glycosylation rather than differential proteolysis. Be- cause glycosylation has been shown to be important for protein lation inhibitor tunicamycin did not alter the electrophoretic mobility of either wild type or CHO-4 MT1-MMP (data not folding in many proteins, the stability of the carbohydrate-free 8284 Glycosylation Regulates MT1-MMP Activity FIG.6. Glycosylation of MT1-MMP is required for MMP-2 activation. The transfected COS-7 cells in Fig. 5 were also plated on 6-well plates coated with thin layer of type I collagen at the same time. A, after attachment, cells were incubated with 25 M GM6001 for 12 h. Cell surface proteins were labeled with Sulfo-NHS- LC-LC-Biotin, purified with neutravidin as described under “Experimental Proce- dures,” and analyzed by Western blot (WB) using anti-FLAG M2 antibody and anti-transferrin receptor (TfR) antibody. The active MT1-MMP are indicated as Š. B, cells were also incubated with 1 nM of purified proMMP-2 in serum-free media for 24 h. The conditioned media were col- lected and analyzed by zymography as de- scribed under “Experimental Proce- dures.” The pro-, intermediate, and active form of MMP-2 are indicated as , —, and Š, respectively. CHO-4 mutant relative to wild-type MT1-MMP was evaluated. radation product (Fig. 4A, lanes 7 and 8). These data clearly Soluble MT1-MMP was generated on the background of either indicate that proteolytic processing of MT1-MMP is mediated wild type (sMT1-MMP) or CHO-4 mutant (sCHO-4). Compari- by autolysis in trans. To test whether glycosylation affects son of sMT1-MMP and sCHO-4 by TUG-gel electrophoresis autolytic processing of MT1-MMP, FLAG-tagged inactive showed an identical unfolding transition, indicating similarity E240A MT1-MMP was co-expressed with Myc-tagged wild in stability and folding of the wild type and mutant soluble type, E240A, or CHO-4 MT1-MMP and the cell lysates were proteins (Fig. 3C). probed with anti-FLAG antibody. Consistent with results in Glycosylation Regulates Substrate Targeting of MT1-MMP— Fig. 4A, wild type MT1-MMP cleaved the inactive E240A mu- To evaluate the potential functional consequences of post- tant and this processing was blocked by GM6001 (Fig. 4B, lanes translational glycosylation of MT1-MMP, the proteolytic activ- 1 and 3). Similar results were obtained using CHO-4-MT1- ity of the enzyme was evaluated against several key substrates. MMP (Fig. 4B, lane 4), indicating that glycosylation does not MT1-MMP activity can be down-regulated by autolytic cleav- regulate the catalytic activity of MT1-MMP against other MT1- 284 285 age at the start of the linker region (Gly 2 Gly , Fig. 1B), MMP species. generating a catalytically inactive species (39). Because the Because the linker region of MT1-MMP is important for its predicted glycosylation sites are close to the reported cleavage collagenolytic activity (54) and our results demonstrate that site, the effect of glycosylation on MT1-MMP autolysis was MT1-MMP is glycosylated in this domain, the effect of glycosy- investigated. In initial control experiments, FLAG-tagged lation on collagenolysis was examined using a previously es- MT1-MMP was co-expressed with untagged wild type MT1- tablished three-dimensional collagen gel invasion assay (24). MMP, inactive MT1-MMP (E240A) or control vector. The cell Expression of MT1-MMP resulted in an 8-fold increase in col- lysates were probed with anti-FLAG antibody to monitor proc- lagen invasion (Fig. 5). The proteolytic activity of MT1-MMP is essing of only the FLAG-tagged proteins. The conversion of required for invasion, as base-line levels of invasion are ob- active wild-type MT1-MMP (50 kDa) to a 37-kDa species was served in cells treated with the broad spectrum metalloprotein- blocked by GM6001 (Fig. 4A, lanes 1 and 2). Co-expression of an ase inhibitor GM6001 as well as in cells expressing the cata- untagged MT1-MMP increased the cleavage of the FLAG- lytically inactive E240A mutant. All three glycosylation- defective mutants promoted collagen invasion as efficiently as tagged protein (Fig. 4A, lane 3), whereas co-transfection of the catalytically inactive E240A mutant did not affect conversion wild type MT1-MMP (Fig. 5), demonstrating that collagenolytic activity is not regulated by glycosylation. In control surface- (Fig. 4A, lane 4), supporting a model of autolysis in trans.To further examine the autolysis model, similar experiments were labeling experiments, wild-type MT1-MMP and glycosylation- deficient mutants were presented on the cell surface at equal performed with FLAG-tagged E240A MT1-MMP mutant. Con- sistent with the loss of proteinase activity in the E240A mu- levels (Fig. 6A). In addition to type I collagen, proMMP-2 is a major substrate tant, no autolysis was detected in the presence or absence of GM6001 (Fig. 4A, lanes 5 and 6). Co-expression of the untagged of MT1-MMP. To test whether glycosylation of MT1-MMP af- fects activation of proMMP-2, COS-7 cells were transfected wild type MT1-MMP, but not the untagged E240A mutant, however, substantially converted the active species to the deg- with wild type MT1-MMP or various glycosylation mutants and Glycosylation Regulates MT1-MMP Activity 8285 FIG.7. Oligomerization of MT1- MMP is not affected by its glycosyla- tion. A, schematic diagram of MT1-MMP oligomerization. FLAG- and Myc-tagged (stalk) MT1-MMP and its CHO-4 mutant were generated to test whether glycosyla- tion interferes with oligomerization. B, COS-7 cells were co-transfected with Myc-tagged MT1-MMP and FLAG-tagged different glycosylation variants of MT1- MMP. Cell lysates were immunoprecipi- tated with anti-FLAG M2 antibody and probe back with anti-Myc (9E10) and an- ti-FLAG M2 antibody (upper panel). Cell lysates were also analyzed for equal ex- pression (lower panel). Similar experi- ments were performed in C with Myc- tagged CHO-4 mutant. The pro- and active MT1-MMPs are indicated as  and Š, respectively. WB, Western blot. incubated with purified proMMP-2, followed by analysis of activation of proMMP-2 was blocked by GM6001 (Fig. 6B, lane zymogen activation by gelatin zymography. Cells transfected 3) and transfection of the MT1-MMP E240A mutant failed to with wild type MT1-MMP processed proMMP-2 (72 kDa) to a activate proMMP-2 (Fig. 6B, lane 4). Cells transfected with 68-kDa intermediate and a 62-kDa active species (Fig. 6B, lane glycosylation-deficient mutants demonstrated a distinct activa- 5). The catalytic activity of MT1-MMP is required, because the tion profile. Whereas the CHO-1 mutant activated proMMP-2 8286 Glycosylation Regulates MT1-MMP Activity FIG.8. Glycosylation of MT1-MMP is required for MT1-MMP/TIMP-2/ MMP-2 trimeric complex formation. A, COS-7 cells were transfected with FLAG-tagged MT1-MMP or CHO-4 mu- tant in the presence of 25 M GM6001. After 24 h, cells were incubated with 10 nM TIMP-2 and 10 nM proMMP-2 in the presence of 25 M GM6001 for 1 h. Un- bound TIMP-2 and proMMP-2, as well as GM6001, were then removed to allow ac- tivation of cell surface-bound MMP-2. Cell lysates were obtained at 0, 15, 30, and 60 min and analyzed by gelatin zy- mography as described under “Experi- mental Procedures.” The pro-, intermedi- ate, and active form of MMP-2 are indicated as , —, and Š, respectively. B, COS-7 cells were transfected with vector, Cat, E240A, and different glycosylation variants of MT1-MMP in the presence of 25 M GM6001. After 24 h, cells were incubated with 10 nM TIMP-2 and 10 nM proMMP-2 for 1 h followed by co-immuno- precipitation with anti-FLAG M2 anti- body. The immunoprecipitates were ana- lyzed by Western blot (WB) using anti- FLAG M2 and anti-TIMP-2 antibodies, and analyzed by gelatin zymography. The pro-, active, and autolytic products of MT1-MMP are indicated as , Š, and d, respectively. to the same extent as the wild type protein (Fig. 6B, lane 6), MMP species. This interaction was not affected by the glycosy- 299 301 mutation of the Thr-Thr-Ser sites in CHO-3 and CHO-4 lation status of MT1-MMP, as similar amounts of Myc-tagged significantly blocked proMMP-2 activation (Fig. 6B, lanes 7 and MT1-MMP were co-immunoprecipitated with the FLAG-tagged 8). These data demonstrate a differential effect of glycosylation CHO-1, -3, and -4 glycosylation-defective mutants (Fig. 7B, on the substrate cleavage profile of MT1-MMP. Although wild lanes 5–7). Similar results were obtained using Myc-tagged type MT1-MMP promotes collagenolysis, autolysis, and gelati- CHO-4 MT1-MMP (Fig. 7C), demonstrating that oligomeriza- nolysis (via proMMP-2 activation), the carbohydrate free en- tion is independent of glycosylation. Further, these data indi- zyme does not initiate gelatinolysis. cate that the inability of the CHO-3 and CHO-4 mutants to Oligomerization of MT1-MMP Is Not Regulated by Glycosy- effectively catalyze proMMP-2 activation is not a result of lation—It was recently reported that hemopexin domain-de- inefficient oligomerization. pendent oligomerization of MT1-MMP is required for efficient Glycosylation Affects the Presentation of a Stable MT1-MMP/ proMMP-2 activation (35). To determine whether the defect in TIMP-2/ProMMP-2 Trimeric Complex and Modulates TIMP-2/ proMMP-2 activation described above results from the inability MT1-MMP Interaction—MT1-MMP mediates MMP-2 activa- of the CHO-deficient mutants to oligomerize, differentially tion through the formation of a trimeric complex consisting epitope-tagged MT1-MMP constructs were generated. Wild- MT1-MMP, TIMP-2 and proMMP-2. To examine the effect of type or CHO-4 MT1-MMP expressing the Myc epitope tag was glycosylation on the formation of the trimeric complex, FLAG- generated and co-expressed with FLAG-tagged MT1-MMP or tagged MT1-MMP species were expressed in COS-7 cells in the the individual CHO-1, CHO-3, or CHO-4 mutants. Following presence of GM6001 to prevent autolytic degradation. After expression, cellular extracts were immunoprecipitated with 24 h, the cells were incubated with TIMP-2 and proMMP-2 in immobilized FLAG antibody (M2), electrophoresed, and blots the presence of GM6001 for 1 h. Cells were washed to remove were probed with either the FLAG or Myc epitope tag antibod- unbound protein and inhibitors, and cellular activation of ies. Potential dimer pairings between wild type and CHO- MMP-2 was monitored with time. As indicated in Fig. 8A, proMMP-2 initially associates with MT1-MMP transfected deficient MT1-MMP species are shown schematically in Fig. 7A (only one CHO chain is included for simplicity). Consistent cells, and is processed to the intermediate and active species within 1 h (Fig. 8C, lanes 1– 4). In contrast, interaction of with the observation of Itoh and co-workers (35), immunopre- cipitation through the FLAG epitope tag also precipitated Myc- proMMP-2 with CHO-4 mutant MT1-MMP transfected cells was substantially decreased (Fig. 8A, lanes 5– 8), suggesting tagged MT1-MMP (Fig. 7B, lane 4), supporting the hypothesis that protein-protein interactions occur between adjacent MT1- altered association and/or dissociation kinetics. This was con- Glycosylation Regulates MT1-MMP Activity 8287 FIG.9. Glycosylation of MT1-MMP affects TIMP-2 inhibition of autolysis and TIMP-2-dependent endocytosis of MT1-MMP. COS-7 cells were transfected with FLAG-tagged (stalk) MT1-MMP or CHO-4 mutant in the presence of increasing concentrations of GM6001 (A,0,1,10, and 100 M), or in B, TIMP-1 (100 nM) or increasing concentrations of TIMP-2 (1, 10, and 100 nM). After 24 h, cell lysates were fractionated on 10% SDS-PAGE and analyzed by Western blot using anti-FLAG M2 antibody. The pro-, active, and autolytic products of MT1-MMP are indicated as , Š, andd, respectively. C–H, COS-7 cells were transfected with FLAG-tagged (stalk) MT1-MMP (C and F), CHO-4 (D and G), and E240A (E and H) mutant in the presence of 25 M GM6001. Cell surface FLAG-tagged proteins were labeled with anti-FLAG M2 antibody on ice for 1 h. After washing off unbound antibody, cells were put back to 37 °C to allow endocytosis for 15 min. Cells were then fixed with formaldehyde and permeabilized with saponin, followed by Alexa Fluor 488-conjugated goat anti-mouse secondary antibody (in green). Total expression of MT1-MMP or its mutants were also stained with anti-linker antibody followed by Alexa Fluor 546-conjugated goat anti-rabbit secondary antibody (inset,in red). The nuclei were counterstained using TO-PRO iodide (642/661) (in blue). The images were taken using a Zeiss LSM510 laser scanning confocal microscope. firmed by co-immunoprecipitation experiments in which wild fied soluble MT1-MMP or the CHO-4 mutant (lacking the type or mutant MT1-MMP species were immunoprecipitated transmembrane and cytoplasmic domains) bound to TIMP-2 with anti-FLAG antibody, and analyzed for the presence of with similar efficiency (data not shown). These data suggest an TIMP-2 by Western blot and MMP-2 by gelatin zymography. inability to efficiently recruit TIMP-2 and proMMP-2 to cell Both TIMP-2 and MMP-2 were co-precipitated with wild type surface localized carbohydrate-deficient MT1-MMP, indicating MT1-MMP (Fig. 8B, lanes 4 and 5). In control experiments, no that glycosylation directly affects the presentation of a func- complex was generated with the Cat mutant lacking the ac- tional MT1-MMP/TIMP-2/proMMP-2 ternary complex on the tive site (Fig. 8B, lane 2) and negligible MMP-2 was associated cell surface and thereby inhibits cell surface proMMP -2 with the inactive E240A mutant, presumably through direct activation. interaction with the catalytic domain of MT1-MMP (63) (Fig. To further characterize the effect of glycosylation on the 8B, lane 3). Although similar levels of expression of CHO- MT1-MMP/TIMP-2 interaction, the interaction of MT1-MMP deficient MT1-MMP mutants were obtained, no TIMP-2 was with synthetic metalloproteinase inhibitor GM6001 and the precipitated with the CHO-3 and CHO-4 mutants, and associ- endogenous inhibitor TIMP-2 was examined. GM6001 inhib- ated MMP-2 was substantially decreased to the level of E240A ited the autolysis of both wild type and CHO-4 MT1-MMP in a mutant (Fig. 8B, lanes 7 and 8). In control experiments, puri- dose-dependent manner and with a similar inhibitory profile, 8288 Glycosylation Regulates MT1-MMP Activity with partial inhibition at 1 and 10 M, and complete blockade Regulation of collagenase activity by the MT1-MMP linker at 100 M (Fig. 9A). In contrast, the inhibitory profiles of region has also been demonstrated. MT1-MMP-mediated colla- TIMP-2 against the two glycoforms were quite distinct. Al- gen cleavage was blocked by a recombinant protein containing though TIMP-2 stabilized the 50-kDa active species of wild the linker and hemopexin-like domains of MT1-MMP, whereas type MT1-MMP in a dose-dependent manner (Fig. 9B, lanes the hemopexin-like domain fragment in the absence of the 2– 4), very little of the active species of CHO-4 mutant MT1- linker was ineffective (54). Results of the current study show MMP was preserved even at 100 nM concentration of TIMP-2 effective collagen gel invasion, regardless of the glycosylation (Fig. 9B, lanes 6 – 8). These data suggest that under in vivo status of the MT1-MMP linker region, suggesting that the conditions wherein TIMP-2 is the primary inhibitor of MT1- relative efficiency of pericellular collagenolysis is not altered by MMP, glycosylation of MT1-MMP may protect against autoly- carbohydrate. sis and thus stabilize active MT1-MMP. In addition to interstitial collagen, proMMP-2 is a predomi- As a recent report demonstrated that TIMP-2 undergoes nant MT1-MMP substrate, and results of the current study endocytosis with MT1-MMP (47, 64, 65), the effect of TIMP-2 demonstrate that cell surface activation of proMMP-2 is on wild type and CHO-4 mutant MT1-MMP endocytosis was blocked in glycosylation-defective mutants. The mechanism by evaluated. Cells expressing FLAG epitope-tagged wild type, which glycosylation of MT1-MMP affects MMP-2 activation CHO-4, or E240A-MT1-MMP were incubated at 4 °C to prevent was explored in detail. Experiments using 1-PI to block PDX endocytosis and labeled with anti-FLAG antibody. Cells were furin/PC activity indicated that the zymogen of MT1-MMP was then incubated in the presence or absence of TIMP-2 and activated with equal efficiency in the wild type enzyme or shifted to 37 °C for 15 min to promote endocytosis. To prevent carbohydrate deficient mutants. To determine whether the in- autolysis and shedding of MT1-MMP, GM6001 was kept ability to activate MMP-2 resulted from failure of the carbohy- throughout the experiment (38, 39). After endocytosis, antibody drate-free mutant to oligomerize, differentially epitope-tagged remaining on the cell surface was removed by low pH washing, MT1-MMP species were employed as recently described (35). and endocytosed antibody (indicative of endocytosed MT1- Our results confirm published reports that protein-protein in- MMP) was detected with a secondary antibody probe. Control teractions between neighboring MT1-MMP species accompany experiments using an antibody directed against the MT1-MMP proMMP-2 activation; however, MT1-MMP oligomerization linker domain demonstrated similar levels of expression of the was independent of glycosylation status. The current data sup- various MT1-MMP species (Fig. 9, C–H, index box). Similar port the hypothesis that carbohydrate-free MT1-MMP does not patterns of endocytosis were observed among wild type, carbo- form an effective ternary activation complex owing to an in- hydrate-free, and catalytically inactive MT1-MMP (Fig. 9, ability to recruit TIMP-2 to the cell surface proteinase. Al- C–E). Addition of TIMP-2 to wild-type MT1-MMP significantly though soluble recombinant MT1-MMP lacking the transmem- increased endocytosis (Fig. 9F), whereas TIMP-2 had no effect brane and cytoplasmic domains can bind to TIMP-2 in solution, on endocytosis of either inactive E240A MT1-MMP or carbohy- co-precipitation analyses demonstrate a lack of ternary com- drate-free CHO-4 MT1-MMP (Fig. 9, G and H). These data plex formation with the cell-associated carbohydrate-free mu- suggest that the inability of cell surface CHO-4 MT1-MMP to tant. This result is supported by data showing an inability of bind TIMP-2 may modulate the cell surface retention of the TIMP-2 to block autolysis of cell surface carbohydrate-free protein. MT1-MMP. Although the biochemical basis for the lack of TIMP-2 binding by the cell surface carbohydrate-free MT1- DISCUSSION MMP species is unclear, an unidentified carbohydrate-binding Results of the current study demonstrate that MT1-MMP is protein may be necessary to induce or stabilize the active post-translationally modified by O-glycosylation at Thr , conformation of MT1-MMP prior to TIMP-2 binding. Alterna- 299 300 301 Thr , Thr , and/or Ser residues in the proline-rich linker tively the carbohydrate moiety may participate in the traffick- region. Although the detailed carbohydrate composition was ing of MT1-MMP (55, 68). Indeed, our data demonstrate that, not analyzed, lectin precipitation experiments suggest that the although TIMP-2 promotes endocytosis of wild-type MT1- carbohydrate moiety contains complex sugar structures. Using MMP, internalization of the carbohydrate-defective MT1-MMP glycosylation inhibitors, evidence for glycosylation of endog- mutant is unaltered by TIMP-2, suggesting that glycosylation enously expressed MT1-MMP in human cancer cells was pro- may regulate TIMP-2-driven endocytosis of MT1-MMP. To- vided. Distinct glycoforms of MT1-MMP were detected in hu- gether these data support a model wherein glycosylation reg- man cancer cell lines, suggesting that MT1-MMP activity may ulates substrate targeting and suggest a cellular mechanism by be regulated by differential glycosylation in vivo. Moreover, which post-translational processing may control MT1-MMP putative glycosylation sites are predicted to exist in the linker surface presentation and proMMP-2 activation. regions of all known MT-MMPs, suggesting a conserved post- REFERENCES translational modification indicative of a potential regulatory 1. Brinckerhoff, C. E., and Matrisian, L. M. (2002) Nat. Rev. Mol. Cell. Biol. 3, function. Although the role of glycosylation among MMP family 207–214 members has not been extensively evaluated, the secreted pro- 2. Nagase, H., and Woessner, J. F., Jr. (1999) J. Biol. Chem. 274, 21491–21494 3. Sternlicht, M. D., and Werb, Z. (2001) Annu. Rev. Cell Dev. Biol. 17, 463–516 teinase MMP-9 is known to be both O- and N-glycosylated and 4. Werb, Z. (1997) Cell 91, 439 – 442 terminally sialylated. Interestingly, desialylation of MMP-9 5. Yu, Q., and Stamenkovic, I. (2000) Genes Dev. 14, 163–176 has been shown to increase the hydrolysis of peptide substrate 6. Levi, E., Fridman, R., Miao, H. Q., Ma, Y. S., Yayon, A., and Vlodavsky, I. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7069 –7074 in the presence of TIMP-1 (66), suggesting TIMP-dependent 7. Suzuki, M., Raab, G., Moses, M. A., Fernandez, C. A., and Klagsbrun, M. inhibition of MMP activity could be modulated by glycosylation. (1997) J. Biol. Chem. 272, 31730 –31737 8. English, W. R., Puente, X. S., Freije, J. M., Knauper, V., Amour, A., Merry- To evaluate the potential role of glycosylation in modifying weather, A., Lopez-Otin, C., and Murphy, G. (2000) J. Biol. Chem. 275, MT1-MMP function, initial studies focused on analysis of col- 14046 –14055 lagenase activity, as recent studies have proposed that the 9. Noe, V., Fingleton, B., Jacobs, K., Crawford, H. C., Vermeulen, S., Steelant, W., Bruyneel, E., Matrisian, L. M., and Mareel, M. (2001) J. Cell Sci. 114, linker domains of MMPs may play a crucial role in collagenoly- 111–118 sis. For example, introduction of a single amino acid mutation 10. Deryugina, E. I., Ratnikov, B., Monosov, E., Postnova, T. I., DiScipio, R., Smith, J. W., and Strongin, A. Y. (2001) Exp. Cell Res. 263, 209 –223 in the linker region of MMP-1 (collagenase-1) dramatically 11. Preece, G., Murphy, G., and Ager, A. (1996) J. Biol. Chem. 271, 11634 –11640 decreased collagenase activity without affecting gelatinolysis, 12. Knauper, V., Will, H., Lopez-Otin, C., Smith, B., Atkinson, S. J., Stanton, H., suggesting a direct role of this domain in collagen cleavage (67). Hembry, R. M., and Murphy, G. (1996) J. Biol. Chem. 271, 17124 –17131 Glycosylation Regulates MT1-MMP Activity 8289 13. Murphy, G., Stanton, H., Cowell, S., Butler, G., Knauper, V., Atkinson, S., and 40. Munshi, H. G., Wu, Y. I., Ariztia, E. V., and Stack, M. S. (2002) J. Biol. Chem. Gavrilovic, J. (1999) APMIS 107, 38 – 44 277, 41480 – 41488 14. Overall, C. M., and Lopez-Otin, C. (2002) Nat. Rev. Cancer 2, 657– 672 41. Pei, D., and Weiss, S. J. (1995) Nature 375, 244 –247 15. Nelson, A. R., Fingleton, B., Rothenberg, M. L., and Matrisian, L. M. (2000) 42. Maquoi, E., Noel, A., Frankenne, F., Angliker, H., Murphy, G., and Foidart, J. Clin. Oncol. 18, 1135–1149 J. M. (1998) FEBS Lett. 424, 262–266 16. Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., and 43. Yana, I., and Weiss, S. J. (2000) Mol. Biol. Cell 11, 2387–2401 Seiki, M. (1994) Nature 370, 61– 65 44. Anderson, E. D., Thomas, L., Hayflick, J. S., and Thomas, G. (1993) J. Biol. 17. Takino, T., Sato, H., Shinagawa, A., and Seiki, M. (1995) J. Biol. Chem. 270, Chem. 268, 24887–24891 23013–23020 45. Mori, H., Tomari, T., Koshikawa, N., Kajita, M., Itoh, Y., Sato, H., Tojo, H., 18. Will, H., and Hinzmann, B. (1995) Eur. J. Biochem. 231, 602– 608 Yana, I., and Seiki, M. (2002) EMBO J. 21, 3949 –3959 19. Pei, D. (1999) J. Biol. Chem. 274, 8925– 8932 46. Galvez, B. G., Matias-Roman, S., Yanez-Mo, M., Sanchez-Madrid, F., and 20. Itoh, Y., Kajita, M., Kinoh, H., Mori, H., Okada, A., and Seiki, M. (1999) J. Biol. Arroyo, A. G. (2002) J. Cell Biol. 159, 509 –521 Chem. 274, 34260 –34266 47. Uekita, T., Itoh, Y., Yana, I., Ohno, H., and Seiki, M. (2001) J. Cell Biol. 155, 21. Kojima, S., Itoh, Y., Matsumoto, S., Masuho, Y., and Seiki, M. (2000) FEBS 1345–1356 Lett. 480, 142–146 48. Toth, M., Bernardo, M. M., Gervasi, D. C., Soloway, P. D., Wang, Z., Bigg, 22. Seiki, M. (2002) Curr. Opin. Cell Biol. 14, 624 – 632 H. F., Overall, C. M., DeClerck, Y. A., Tschesche, H., Cher, M. L., Brown, S., 23. Seiki, M. (2003) Cancer Lett. 194, 1–11 Mobashery, S., and Fridman, R. (2000) J. Biol. Chem. 275, 41415– 41423 24. Ellerbroek, S. M., Wu, Y. I., Overall, C. M., and Stack, M. S. (2001) J. Biol. 49. Olson, M. W., Gervasi, D. C., Mobashery, S., and Fridman, R. (1997) J. Biol. Chem. 276, 24833–24842 Chem. 272, 29975–29983 25. Hotary, K., Allen, E., Punturieri, A., Yana, I., and Weiss, S. J. (2000) J. Cell 50. Hansen, J. E., Lund, O., Rapacki, K., and Brunak, S. (1997) Nucleic Acids Res. Biol. 149, 1309 –1323 25, 278 –282 26. Holmbeck, K., Bianco, P., Caterina, J., Yamada, S., Kromer, M., Kuznetsov, 51. Notredame, C., Higgins, D. G., and Heringa, J. (2000) J. Mol. Biol. 302, S. A., Mankani, M., Robey, P. G., Poole, A. R., Pidoux, I., Ward, J. M., and 205–217 Birkedal-Hansen, H. (1999) Cell 99, 81–92 52. Munshi, H. G., and Stack, M. S. (2002) Methods Cell Biol. 69, 195–205 27. Zhou, Z., Apte, S. S., Soininen, R., Cao, R., Baaklini, G. Y., Rauser, R. W., 53. Mast, A. E., Enghild, J. J., Pizzo, S. V., and Salvesen, G. (1991) Biochemistry Wang, J., Cao, Y., and Tryggvason, K. (2000) Proc. Natl. Acad. Sci. U. S. A. 30, 1723–1730 97, 4052– 4057 54. Tam, E. M., Wu, Y. I., Butler, G. S., Stack, M. S., and Overall, C. M. (2002) 28. Strongin, A. Y., Collier, I., Bannikov, G., Marmer, B. L., Grant, G. A., and J. Biol. Chem. 277, 39005–39014 Goldberg, G. I. (1995) J. Biol. Chem. 270, 5331–5338 55. Altschuler, Y., Kinlough, C. L., Poland, P. A., Bruns, J. B., Apodaca, G., Weisz, 29. Butler, G. S., Butler, M. J., Atkinson, S. J., Will, H., Tamura, T., van Westrum, O. A., and Hughey, R. P. (2000) Mol. Biol. Cell 11, 819 – 831 S. S., Crabbe, T., Clements, J., d’Ortho, M. P., and Murphy, G. (1998) 56. Huet, G., Hennebicq-Reig, S., de Bolos, C., Ulloa, F., Lesuffleur, T., Barbat, A., J. Biol. Chem. 273, 871– 880 Carriere, V., Kim, I., Real, F. X., Delannoy, P., and Zweibaum, A. (1998) 30. Kinoshita, T., Sato, H., Okada, A., Ohuchi, E., Imai, K., Okada, Y., and Seiki, J. Cell Biol. 141, 1311–1322 M. (1998) J. Biol. Chem. 273, 16098 –16103 57. Ihrke, G., Bruns, J. R., Luzio, J. P., and Weisz, O. A. (2001) EMBO J. 20, 31. Zucker, S., Drews, M., Conner, C., Foda, H. D., DeClerck, Y. A., Langley, K. E., 6256 – 6264 Bahou, W. F., Docherty, A. J., and Cao, J. (1998) J. Biol. Chem. 273, 58. Molloy, S. S., Anderson, E. D., Jean, F., and Thomas, G. (1999) Trends Cell 1216 –1222 Biol. 9, 28 –35 32. Overall, C. M., King, A. E., Sam, D. K., Ong, A. D., Lau, T. T., Wallon, U. M., 59. Kuan, S. F., Byrd, J. C., Basbaum, C., and Kim, Y. S. (1989) J. Biol. Chem. 264, DeClerck, Y. A., and Atherstone, J. (1999) J. Biol. Chem. 274, 4421– 4429 19271–19277 33. Atkinson, S. J., Crabbe, T., Cowell, S., Ward, R. V., Butler, M. J., Sato, H., 60. Huet, G., Kim, I., de Bolos, C., Lo-Guidice, J. M., Moreau, O., Hemon, B., Seiki, M., Reynolds, J. J., and Murphy, G. (1995) J. Biol. Chem. 270, Richet, C., Delannoy, P., Real, F. X., and Degand, P. (1995) J. Cell Sci. 108, 30479 –30485 1275–1285 34. Will, H., Atkinson, S. J., Butler, G. S., Smith, B., and Murphy, G. (1996) 61. Rozanov, D. V., and Strongin, A. Y. (2003) J. Biol. Chem. 278, 8257– 8260 J. Biol. Chem. 271, 17119 –17123 62. Koo, H. M., Kim, J. H., Hwang, I. K., Lee, S. J., Kim, T. H., Rhee, K. H., and 35. Itoh, Y., Takamura, A., Ito, N., Maru, Y., Sato, H., Suenaga, N., Aoki, T., and Lee, S. T. (2002) Mol. Cell 13, 118 –124 Seiki, M. (2001) EMBO J. 20, 4782– 4793 63. English, W. R., Holtz, B., Vogt, G., Knauper, V., and Murphy, G. (2001) J. Biol. 36. Lehti, K., Lohi, J., Juntunen, M. M., Pei, D., and Keski-Oja, J. (2002) J. Biol. Chem. 276, 42018 – 42026 Chem. 277, 8440 – 8448 64. Remacle, A., Murphy, G., and Roghi, C. (2003) J. Cell Sci. 116, 3905–3916 37. Jiang, A., Lehti, K., Wang, X., Weiss, S. J., Keski-Oja, J., and Pei, D. (2001) 65. Maquoi, E., Frankenne, F., Baramova, E., Munaut, C., Sounni, N. E., Remacle, Proc. Natl. Acad. Sci. U. S. A. 98, 13693–13698 A., Noel, A., Murphy, G., and Foidart, J. M. (2000) J. Biol. Chem. 275, 38. Toth, M., Hernandez-Barrantes, S., Osenkowski, P., Bernardo, M. M., Gervasi, 11368 –11378 D. C., Shimura, Y., Meroueh, O., Kotra, L. P., Galvez, B. G., Arroyo, A. G., 66. Van den Steen, P. E., Opdenakker, G., Wormald, M. R., Dwek, R. A., and Rudd, Mobashery, S., and Fridman, R. (2002) J. Biol. Chem. 277, 26340 –26350 P. M. (2001) Biochim. Biophys. Acta 1528, 61–73 39. Hernandez-Barrantes, S., Toth, M., Bernardo, M. M., Yurkova, M., Gervasi, 67. Tsukada, H., and Pourmotabbed, T. (2002) J. Biol. Chem. 277, 27378 –27384 D. C., Raz, Y., Sang, Q. A., and Fridman, R. (2000) J. Biol. Chem. 275, 68. Yeaman, C., Le Gall, A. H., Baldwin, A. N., Monlauzeur, L., Le Bivic, A., and 12080 –12089 Rodriguez-Boulan, E. (1997) J. Cell Biol. 139, 929 –940 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Glycosylation Broadens the Substrate Profile of Membrane Type 1 Matrix Metalloproteinase

Download PDF
12 pages

Loading next page...
 
/lp/unpaywall/glycosylation-broadens-the-substrate-profile-of-membrane-type-1-matrix-UbDkIa2XC0

References (71)

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m311870200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 9, Issue of February 27, pp. 8278 –8289, 2004 © 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Glycosylation Broadens the Substrate Profile of Membrane Type 1 Matrix Metalloproteinase* Received for publication, October 29, 2003, and in revised form, December 5, 2003 Published, JBC Papers in Press, December 11, 2003, DOI 10.1074/jbc.M311870200 Yi I. Wu‡§, Hidayatullah G. Munshi§ , Ratna Sen‡§, Scott J. Snipas , Guy S. Salvesen , Rafael Fridman**, and M. Sharon Stack‡§‡‡ From the ‡Department of Cell & Molecular Biology and Division of Hematology/Oncology, Department of Medicine, Feinberg School of Medicine, and the §Robert H. Lurie Comprehensive Cancer Center, Northwestern University, Chicago, Illinois 60611, the Program in Apoptosis and Cell Death Research, Burnham Institute, La Jolla, California 92037, and the **Department of Pathology, Wayne State University, Detroit, Michigan 48202 extracellular matrix proteins including collagens, laminins, Membrane type 1 matrix metalloproteinase (MT1- MMP) is a collagenolytic enzyme that has been impli- and fibronectin (4). Recent research has identified a variety of cated in normal development and in pathological pro- non-traditional MMP activities including shedding of growth cesses such as cancer metastasis. The activity of MT1- factors, cytokines and their receptors (5– 8), disruption of cell- MMP is regulated extensively at the post-translational matrix and cell-cell junctional protein complexes (9 –11), and level, and the current data support the hypothesis that initiation of proteinase cascades that impact much broader MT1-MMP activity is modulated by glycosylation. Enzy- substrates (12, 13). As a result, MMPs play a central role in matic deglycosylation, site-directed mutagenesis, and many physiological and pathological processes, including de- lectin precipitation assays were used to demonstrate velopment, wound healing, tissue resorption, angiogenesis, and that MT1-MMP contains O-linked complex carbohy- tumor invasion (3, 14, 15). Most MMPs are secreted proteins 291 299 300 301 drates on the Thr , Thr , Thr , and/or Ser resi- and share a similar modular domain structure including dues in the proline-rich linker region. MT1-MMP glyco- propeptide, catalytic domain, linker region, and hemopexin- forms were detected in human cancer cell lines, like domain (2). However, a subgroup of MMPs, designated suggesting that MT1-MMP activity may be regulated by membrane type (MT)-MMPs, contains either an additional differential glycosylation in vivo. Although the autolytic transmembrane and cytoplasmic domain (16 –19) or a glyco- processing and interstitial collagenase activity of MT1- sylphosphatidylinositol anchor (20, 21), suggesting unique sub- MMP were not impaired in glycosylation-deficient mu- strate specificity and distinct regulatory mechanisms as a con- tants, cell surface MT1-MMP-catalyzed activation of sequence of cell surface localization (22). pro-matrix metalloproteinase-2 (proMMP-2) required Among MT-MMPs, MT1-MMP is the most extensively stud- proper glycosylation of MT1-MMP. The inability of car- bohydrate-free MT1-MMP to activate proMMP-2 was not ied and the best characterized. A primary function of MT1- a result of defective MT1-MMP zymogen activation, ab- MMP is pericelluar collagenolysis (reviewed in Ref. 23). This is errant protein stability, or inability of the mature en- supported by both in vitro experiments in which MT1-MMP zyme to oligomerize. Rather, our data support a mecha- was shown to promote cellular invasion of type I collagen (24, nism whereby glycosylation affects the recruitment of 25), and in vivo studies of mice genetically deficient in MT1- tissue inhibitor of metalloproteinases-2 (TIMP-2) to the MMP expression (MT1-MMP/) (26, 27). These mice devel- cell surface, resulting in defective formation of the MT1- oped craniofacial dysmorphism, arthritis, osteopenia, dwarf- MMP/TIMP-2/proMMP-2 trimeric activation complex. ism, and fibrosis of soft tissues because of the inability to These data provide evidence for an additional mecha- process interstitial collagen (26). In addition to direct cleavage nism for post-translational control of MT1-MMP activity of matrix proteins, MT1-MMP also mediates activation of and suggest that glycosylation of MT1-MMP may regu- proMMP-2, which leads to a broader impact on pericelluar late its substrate targeting. proteolysis (16). ProMMP-2 activation involves formation of a ternary complex consisting of MT1-MMP, TIMP-2, and proMMP-2 (28 –30). In this model, TIMP-2 bridges the catalytic Matrix metalloproteinases (MMPs) are a family of zinc-de- domain of MT1-MMP (31) and the hemopexin-like domain of pendent proteinases (1–3) with activity against a variety of proMMP-2 (32), thereby facilitating the recruitment of proMMP-2 to the cell surface. A catalytically competent MT1- * This work was supported by Grant DAMD170010386 (to Y. I. W.) MMP (TIMP-2 free) then mediates an initial cleavage of from United States Army Medical Research and Materiel Command, proMMP-2 (72 kDa) to generate an intermediate form (68 kDa), and by Grants K08CA94877 (to H. G. M.) and R01CA85870 (to M. S. S.) which undergoes autolysis to generate fully activated MMP-2 from the National Cancer Institute. The costs of publication of this (62 kDa) (33, 34). Recent studies indicate that activation of article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance proMMP-2 is regulated by oligomerization of MT1-MMP via with 18 U.S.C. Section 1734 solely to indicate this fact. hemopexin-like domain interactions (35, 36). ‡‡ To whom correspondence should be addressed: Dept. of Cell and The proteolytic activity of MT1-MMP is tightly regulated Molecular Biology, Northwestern University Medical School, 303 E. under normal physiological conditions (22, 23). In addition to Chicago Ave., Tarry 8-715, Chicago, IL 60611. Tel.: 312-908-8216; Fax: 312-503-7912; E-mail: [email protected]. controls on protein expression, the activity of MT1-MMP is The abbreviations used are: MMP, matrix metalloproteinase; MT, extensively regulated post-translationally by zymogen activa- membrane type; TIMP, tissue inhibitor of metalloproteinases; PC, pro- tion, inhibition by TIMPs, autolytic degradation, shedding, oli- protein convertase; PI, proteinase inhibitor; CHO, Chinese hamster gomerization, and membrane trafficking (34 – 40). MT1-MMP ovary; TUG, transverse urea gradient; BGN, benzyl-2-acetamido- 2-deoxy--D-galactopyranoside. is expressed in a zymogen form (64 kDa) and activated in the 8278 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. Glycosylation Regulates MT1-MMP Activity 8279 were generated in the first step PCR, with an overlapping region carrying secretory pathway by furin or furin-like proprotein convertases tag or mutation(s). In the second step of PCR, both fragments were used (PCs) (41– 43). These proprotein convertases cleave proMT1- as templates to generate the complete cDNA carrying the tag or mutation, 108 111 MMP after the R RKR sequence to generate the active followed by subcloning back into the pCR3.1-Uni vector using HindIII and species (55 kDa). This is supported by studies using an engi- EcoRI sites. The outer primers in this strategy are the sequencing primers neered mutant of 1-proteinase inhibitor (1-PI) with furin/PC provided by Invitrogen. The inner primers are 5-GGCCGGCCGGATTA- inhibitory activity, designated 1-PI (44), to block proMT1- TAAGGATGATGATGATAAGGAGGTGATCATCATTG-3 and 5-CAAT- PDX GATGATCACCTCCTTATCATCATCATCCTTATATTCCGGCCGGCC-3 MMP zymogen activation (43). Active MT1-MMP is inhibited for FLAGtag (stalk); 5-GACTATAAAGATGATGATGATAAATACGCCA- by TIMP-2, but is unaffected by TIMP-1 (34). MT1-MMP also TCCAGGGTCTCAAATG-3 and 5-TTTATCATCATCATCTTTATAATC- 2842 285 undergoes autolytic degradation at Gly Gly in the linker GCGCTTCCTTCGAACATTGGC-3 for FLAG tag (f112); 5-GAACAAAA- region, generating a catalytically inactive species (calculated ACTTATCAGTGAAGAAGATCTGGGCCGGCCGGATGAGfsGGGAC-3 molecular mass of 34 kDa) (39). Finally, as a trans-membrane and 5-CAGATCTTCTTCACTGATAAGTTTTTGTTCTCCCGATGGGCA- protein, MT1-MMP is also regulated by membrane trafficking GCCCATCC-3 for Myc tag (stalk); 5-GTCAGGGTTCCCCGCCAAGAT- GCCCCC-3 and 5GGGGGCATCTTGGCGGGGAACCCTGAC-3 for and cell surface localization (37, 45– 47). CHO-1 (T291A); 5-AGGGCTGCTGCTCGGCCTTCTGTTCCTGAT-3 The current study tested the hypothesis that glycosylation of and 5-GGCCGAGCAGCAGCCCTGGGTTGAGGGGGCAT-3 for CHO-3 MT1-MMP functions as an additional mechanism for post- (T299A/T300A/S301A); 5-GGTGGCTGTGCACGCGCTGGGCCA- translational regulation of enzymatic activity and demon- TGCC-3 and 5-GGCATGGCCCAGCGCGTGCACAGCCACC-3 for strates that MT1-MMP is an O-glycoprotein. Although glyco- E240A; and 5-CGAAGGAAGCGCGGTGAGTCAGGGTTCCCCACC-3 sylation was not required for collagenase activity, formation of and 5-CCCTGACTCACCGCGCTTCCTTCGAACATTGGCC-3 for Cat (112–284). a stable MT1-MMP/TIMP-2/proMMP-2 ternary complex and In addition to the above mutants of MT1-MMP, soluble FLAG-tagged subsequent cell surface activation of MMP-2 was blocked in (f112) MT1-MMP (sMT1-MMP) and CHO-4 mutant (sCHO-4) were also glycosylation-defective mutants. Distinct glycoforms of MT1- generated using TA cloning approach from the corresponding mem- MMP were detected in human cancer cell lines, suggesting that brane-anchored constructs. The primers used to delete the transmem- MT1-MMP activity may be regulated by differential glycosyla- brane and cytoplasmic domain (soluble) are forward primer (5-ACCA- tion in vivo. These data support a model in which glycosylation TGTCTCCCGCCCCAAGAC-3) and reverse primer (5-TCAAGCCGC- GCTCACCGCCCCGCC-3). regulates substrate targeting and suggest a cellular mecha- The DNA constructs of wild type 1-PI and 1-PI in pcDNA3 PDX nism for controlling the initiation of MMP-2 dependent vector (Invitrogen) were generated by the laboratory of Dr. Guy S. proteolysis. Salvesen (Burnham Institute, La Jolla, CA). The PCR reactions were performed using high fidelity Pfu Turbo polymerase (Stratagene, La EXPERIMENTAL PROCEDURES Jolla, CA), and the plasmids were verified by DNA sequencing. Materials—Anti-FLAG monoclonal M1 and M2 antibody, anti-Myc Immunoprecipitation with Anti-FLAG M2 Affinity Gel—COS-7 cells monoclonal antibody (9E10), rabbit polyclonal antibody that recognizes were transfected with plasmid DNA indicated using FuGENE 6 (Roche, the linker region of MT1-MMP, peroxidase-conjugated secondary anti- Switzerland) according to instructions from the manufacturer. After bodies, gelatin, rat tail collagen, O-glycosylation inhibitor, benzyl-2- 24 h, cells were lysed in lysis buffer (50 mM Tris buffer, pH 7.5, 150 mM acetamido-2-deoxy--D-galactopyranoside (GalNAc--O-benzyl (BGN)), NaCl, 1% Triton X-100) supplemented with 5 mM EDTA and protease and N-glycosylation inhibitor tunicamycin were purchased from Sigma. inhibitor mixture (Roche). Immunoprecipitation of FLAG-tagged pro- The broad spectrum metalloproteinase inhibitor GM6001 and rabbit teins was performed using anti-FLAG M2 affinity gel according to polyclonal TIMP-2 antibody (AB801) were purchased from Chemicon instructions from the manufacturer (Sigma) and Handee spin cup col- (Temecula, CA). Anti-transferrin receptor monoclonal antibody was umns (Pierce). The cell lysates were incubated with M2 affinity gel at purchased from Zymed Laboratories Inc. (South San Francisco, CA). 4 °C for 2 h, washed three times with washing buffer containing 50 mM Human TIMP-2 and proMMP-2 were purified as previously described Tris, pH7.5, 150 mM NaCl, and 0.1% Triton X-100, and eluted with 200 (48, 49). g/ml 3 FLAG peptide (Sigma) in washing buffer. In co-immunopre- Sequence Analyses of MT-MMPs—The amino acid sequences of MT1- cipitation experiments, EDTA was omitted from lysis buffer, and both to MT6-MMP were obtained from Swiss-Prot P50281, P51511, P51512, lysis buffer and washing buffer were supplemented with 2 mM CaCl Q9ULZ9, Q9Y5R2, and Q9NPA2, respectively. The prediction of O- and and2mM MgCl . The cell lysates and immunoprecipitates were ana- N-glycosylation sites was performed using full-length sequences on the lyzed by Western blot and gelatin zymography as previously described NetOGlyc 2.0 server (www.cbs.dtu.dk/services/NetOGlyc/) (50) and Net- (24, 40, 52). NGlyc 1.0 server (www.cbs.dtu.dk/services/NetNGlyc/), respectively. Enzymatic Deglycosylation—Enzymatic deglycosylation was per- The alignment of the MT-MMP linker domains was performed on the formed according to instructions from the manufacturer (ProZyme, San server of T-Coffee multiple sequence alignment (www.ch.embnet.org/ Leandro, CA). Briefly, FLAG-tagged MT1-MMP or glycosylation mu- software/TCoffee.html) (51). tants were purified using M2 affinity gel as described above. The Cell Culture—COS-7 cells (generous gift of Dr. Kathleen J. Green, purified protein was heat-denatured in SDS buffer provided, neutral- Northwestern University Medical School, Chicago, IL) and MDA-MB- ized with Triton X-100, and digested with buffer control or different 231 cells (generous gift of Dr. V. Craig Jordan, Northwestern University glycosidases for 24 h. Several glycosidases, including sialidase A, endo- Medical School, Chicago, IL) were maintained in Dulbecco’s modified O-glycosidase, (1– 4)-galactosidase, glucosaminidase, and peptide-N- Eagle’s medium containing 10% fetal bovine serum. The ovarian cancer glycosidase F were used either individually or in combinations as de- cell lines DOV13, OVCA429, and OVCA433 were kindly provided by Dr. scribed under “Results.” The digestion was stopped by boiling in SDS Robert Bast, Jr. (M. D. Anderson Cancer Center, Houston, TX), and sample dilution buffer, and the samples were analyzed by Western blot. were maintained in minimal essential medium containing 10% fetal Lectin Precipitation Assay—Biotinylated lectins, including con- bovine serum. Cell culture media and reagents were purchased from canavalin A, soybean agglutinin, Ulex europaeus agglutinin I, wheat Mediatech (Herndon, VA). germ agglutinin, succinylated wheat germ agglutinin, Maackia amu- DNA Constructs—The human MT1-MMP cDNA was kindly provided rensis lectin II, and Sambucus nigra lectin were purchased from Vector by Dr. Duanqing Pei (University of Minnesota, Minneapolis, MN). The Laboratories (Burlingame, CA). These biotinylated lectins were immo- complete coding sequence of MT1-MMP was amplified by PCR using bilized by incubating with neutravidin-conjugated beads (Pierce) at forward primer, 5-ACCATGTCTCCCGCCCCAAGAC-3 and reverse 4 °C for 1 h, followed by three washes with washing buffer supple- primer, 5-TCAGACCTTGTCCAGCAGGGAAC-3, and subcloned into eu- mented with 2 mM CaCl and MgCl . At the same time, cell lysates were 2 2 karyotic expression vector pCR3.1-Uni (Invitrogen, Carlsbad, CA) to ob- prepared using lysis buffer without EDTA and supplemented with 2 mM tain the untagged wild type construct. The wild type construct was fur- CaCl and MgCl . These immobilized lectins were incubated with the 2 2 ther FLAG (DYKDDDDK)-tagged in the stalk region (stalk) or after the cell lysates overnight, followed by washes with washing buffer contain- furin/PC cleavage site (f112), or Myc (EQKLISEEDL)- tagged in the stalk ing2mM CaCl and MgCl . The precipitated proteins were eluted by 2 2 region (Fig. 1B). Subsequently different deletions (Cat) or point muta- boiling in SDS sample dilution buffer and analyzed by Western blot. tions (E240A, CHO-1, CHO-3, and CHO-4; see below) were generated on Collagen Invasion Assay—Collagen invasion assays were performed the wild type cDNA and on the tagged constructs using a two-step over- and analyzed as previously described (24, 52). Briefly, cell culture lapping PCR strategy. Briefly, two fragments covering the complete cDNA inserts (24 wells, 8.0-m pore, Becton Dickinson, Bedford, MA) were 8280 Glycosylation Regulates MT1-MMP Activity FIG.1. MT1-MMP is O-glycosylated with complex carbohydrates. A, the amino acid sequences from the linker domains of MT-MMPs are aligned in a clustal format, with the conserved residues denoted with asterisks. The predicted O- and N-glycosylation sites within these sequences 24 582 are highlighted with  and ƒ, respectively. B, schematic diagram of MT1-MMP (Ser –Val ) consisting of propeptide (Pro), catalytic, linker, 291 299 300 301 hemopexin-like, and transmembrane/cytoplasmic (TM/CT) domains. The predicted O-glycosylation sites, Thr , Thr , Thr , and Ser , were indicated with E on the linker domain. Different FLAG- and Myc-tagged MT1-MMP plasmid constructs were generated in the following studies. 111 112 The tagging sites are, as indicated in each experiment, either after furin/PC cleavage site (RRKR 2Y A, f112) or in the stalk region between 284 285 hemopexin-like and TM/CT domains. The site of autolysis is also indicated (YG 2G ES). C, FLAG-tagged (stalk) MT1-MMP was purified from transiently transfected COS-7 cells and digested with sialidase A, endo-O-glycosidase, (1– 4)-galactosidase, glucosaminidase, and peptide-N- glycosidase F (PNGase F) as indicated. The reaction mixtures were fractionated on a 10% SDS-PAGE followed by Western blot (WB) with anti-FLAG M2 antibody. D, FLAG-tagged (stalk) glycosylation mutants CHO-1 (T291A), CHO-3 (T299A/T300A/S301A), and CHO-4 (T291A/T299A/ T300A/S301A), as well as wild type MT1-MMP were purified from COS-7 cells, digested with sialidase A, and analyzed by Western blot with anti-FLAG M2 antibody. E, lysates from COS-7 cells expressing FLAG-tagged (stalk) wild type or CHO-4 mutant MT1-MMP were incubated with BSA, biotinylated lectins, including concanavalin A (ConA), soybean agglutinin (SBA), U. europaeus agglutinin I (UEA I), wheat germ agglutinin (WGA), succinylated wheat germ agglutinin (sWGA), M. amurensis lectin II (MAL II), or S. nigra lectin (SNA), followed by neutravidin precipitation as described under “Experimental Procedures.” The carbohydrate group(s) that interacts with each lectin was indicated. Glc, glucose; Man, mannose; Gal, galactose; GalNAc, N-acetylgalactosamine; Fuc, fucose; GlcNAc, N-acetylglucosamine; and Sia, sialic acid. The precipitates along with 10% of corresponding lysate input were analyzed by Western blot with anti-FLAG M2 antibody. The pro- and active forms of MT1-MMP are indicated as  and Š, respectively. coated with rat tail type I collagen (10 g/well) in 100 mM Na CO and of invasion, 25 M GM6001 was added to the inner and outer chambers 2 3 allowed to air-dry overnight. Collagen-coated inserts were then washed as indicated. Cells were allowed to invade for 24 h, non-invading cells with Dulbecco’s modified Eagle’s medium three times to remove salts were removed from inner wells using a cotton swab, and invading cells and used immediately. Transfected COS-7 cells were trypsinized, adherent to the bottom of membrane were fixed and stained using a washed with cultured medium, and 1  10 cells were added to the Diff-Quick staining kit (Dade AG, Miami, FL). Invading cells were inner invasion chamber in 250 l of culture medium. The outer wells enumerated as described previously (24, 40). contained 400 l of culture medium. To evaluate the MMP dependence Transverse Urea Gradient (TUG) PAGE—TUG gel electrophoresis Glycosylation Regulates MT1-MMP Activity 8281 FIG.2. Differential glycosylation of MT1-MMP in cancer cells. A, COS-7 cells were transfected with FLAG-tagged (stalk) wild type (left panel) or CHO-4 mu- tant (right panel) MT1-MMP in the ab- sence or presence of 2 mM O-glycosylation inhibitor BGN. The cell lysates were frac- tionated on a 10% SDS-PAGE followed by Western blot with anti-FLAG M2 anti- body. B, breast cancer MDA-MB-231 cells, and ovarian cancer OVCA-R3, DOV13, and OVCA433 cells were cul- tured in the presence or absence of O- glycosylation inhibitor BGN for 48 h. GM6001 was added 24 h before lysing the cells. The cell surface proteins from these cells were purified as described under “Experimental Procedures” and analyzed by Western blot (WB) with anti-MT1- MMP antibody. The pro- and active forms of MT1-MMP are indicated as  and Š, respectively. was performed as previously described (53). Briefly, 7% polyacrylamide RESULTS gels containing a continuous 0 – 8 M urea gradient were cast in batch MT1-MMP Is Post-translationally Modified by O-Glycosyla- using a multiple gradient caster (Owl Scientific, Woburn, MA). The gels tion—To determine whether MT1-MMP is post-translationally were rotated 90°, and a single sample of purified protein, FLAG-tagged modified by glycosylation, the glycosylation potentials of MT1- (f112) sMT1-MMP or sCHO-4 in a 200-l total volume was loaded evenly across the top of the gel. Electrophoresis was performed in the MMP were examined on the Center for Biological Sequence absence of SDS. The fractionated proteins were transferred to polyvi- Analysis server (NetNGlyc and NetOGlyc programs for nylidene difluoride membranes and analyzed by Western blot analysis N-linked and O-linked glycosylation, respectively). The results using anti-FLAG M1 antibody (1:1000 dilution) and peroxidase-conju- of analysis indicated that MT1-MMP is not likely to be N- gated secondary antibody (1:10,000 dilution) followed by ECL detection glycosylated; however, four potential O-glycosylation sites (Pierce). 291 299 300 301 Labeling and Purification of Cell Surface Proteins—Labeling of cell (Thr , Thr , Thr , and Ser ) were identified (Fig. 1, A surface proteins was performed as described previously (40). Briefly, and B). These sites were all located in the proline-rich linker cells were washed with phosphate-buffered saline and incubated with (also known as hinge) region, proposed to be critical for the Sulfo-NHS-LC-LC-Biotin (Pierce) for 10 min on ice and washed with proteinase activity of MT1-MMP (54). Similar to MT1-MMP, 100 mM glycine to quench remaining NHS groups. The cells were then MT2- to MT6-MMP were all predicted to be glycosylated in the lysed in lysis buffer, incubated with neutravidin-conjugated beads linker region (Fig. 1A), suggesting a conserved post-transla- (Pierce) for 1 h, and eluted by boiling in SDS sample dilution buffer for 15 min followed by Western blot analysis. tional modification indicative of a potential regulatory func- Immunostaining of Endocytosed MT1-MMP—COS-7 cells were tion. Enzymatic deglycosylation was subsequently used to test transfected with FLAG-tagged (stalk) MT1-MMP, CHO-4, and E240A the prediction that MT1-MMP is a glycoprotein. Affinity-puri- mutant in the presence of 25 M GM6001. Cell surface FLAG-tagged fied MT1-MMP from COS-7 cells was digested with specific proteins were labeled with FLAG/M2 antibody (1:1000 dilution) on ice glycosidases and evaluated by SDS-PAGE. Because glycosyla- for 1 h. The unbound antibody was washed off with medium, and 25 M GM6001 alone or 25 M GM6001 and 25 nM TIMP-2 were added back to tion can cause a change in the mass and/or charge of a protein, the chamber slides. Cells were shifted to 37 °C to allow endocytosis to both positive and negative changes in relative electrophoretic take place. After 15 min, the cells were placed on ice, washed with wash mobility were interpreted in support of carbohydrate removal. buffer (500 mM acetic acid and 150 mM NaCl) (47) and phosphate- Without digestion, the purified protein migrated as a 64-kDa buffered saline, fixed with 3.7% formaldehyde, and permeabilized with proMT1-MMP species and a 50-kDa active MT1-MMP species 0.2% Triton X-100. The cells were further stained with rabbit polyclonal (Fig. 1C, lane 1). Treatment of MT1-MMP with peptide-N- antibody (Sigma) that recognizes the linker domain of MT1-MMP (1: 2000 dilution). The bound FLAG/M2 antibody and linker antibody were glycosidase F, which efficiently removes N-linked sugars, did detected with corresponding secondary antibody (1:500 dilution) conju- not result in any detectable mobility shift in either the pro- or gated with Alexa Fluor 488 and 546 (Molecular Probes, Eugene, OR), active MT1-MMP (Fig. 1C, lane 7), supporting the prediction respectively. The nucleus was counterstained with TO-PRO-3 iodide that MT1-MMP is not N-glycosylated. Similarly, treatment (Molecular Probes). The images were taken using a Zeiss LSM510 laser (1– 4)-galac- with several O-glycosidases (endo-O-glycosidase, scanning confocal microscope at the Northwestern University Cell Im- aging Facility, and edited using Adobe PhotoShop 7.0 software. tosidase, and glucosaminidase) did not alter the electrophoretic 8282 Glycosylation Regulates MT1-MMP Activity FIG.4. Glycosylation of MT1-MMP does not affect its autolysis in trans. COS-7 cells were co-transfected with different FLAG-tagged (stalk) and untagged MT1-MMP plasmids in the presence or absence of 25 M GM6001 as indicated. The cell lysates were fractionated on 10% SDS-PAGE and analyzed by Western blot (WB) using anti-FLAG M2 antibody. B, COS-7 cells were co-transfected with FLAG-tagged (stalk) E240A mutant and different Myc-tagged MT1-MMP plasmids in the presence or absence of 25 M GM6001. The cell lysates were fraction- ated on 10% SDS-PAGE and analyzed by Western blot using anti-FLAG M2 antibody. The pro-, active, and autolytic products of MT1-MMP are indicated as , Š, and d, respectively. FIG.3. Glycosylation of MT1-MMP does not affect its zymogen alterations in SDS binding properties of the modified proteins. activation or folding. A, COS-7 cells were co-transfected with differ- Of note, there is no mobility shift detected in the proMT1-MMP ent FLAG-tagged (stalk) MT1-MMP glycosylation variants and wild type 1-PI (WT)or 1-PI mutant in the presence of 25 M GM6001. species following treatment with sialidase A, suggesting that PDX After 24 h, cell lysates were fractionated on 10% SDS-PAGE and ana- the sialylation likely follows activation of proMT1-MMP in the lyzed by Western blot (WB) using anti-FLAG M2 antibody. B, COS-7 trans-Golgi network (58). cells were transfected with vector, FLAG-tagged (f112) wild type MT1- To confirm the prediction that MT1-MMP contains O-linked MMP or CHO-4 mutant in the presence of 25 M GM6001. After 24 h, cell lysates were fractionated on 10% SDS-PAGE and analyzed by carbohydrate, three alanine mutants were generated, in which 291 299 301 Western blot using anti-FLAG M1 (upper panel) and M2 (lower panel) Thr (designated CHO-1), Thr -Thr-Ser (CHO-3), or all antibody. C, soluble FLAG-tagged (f112) MT1-MMP and CHO-4 mutant 291 299 four predicted O-glycosylation sites (Thr and Thr -Thr- were purified from transfected COS-7 cells and analyzed by TUG-PAGE Ser , designated CHO-4) were mutated to alanine(s) (sche- as described under “Experimental Procedures.” The FLAG-tagged pro- teins were detected using anti-FLAG M1 antibody. The pro- and active matic of linker region shown in Fig. 1D, top panel). The CHO-1 forms of MT1-MMP are indicated as  and Š, respectively. mutant, which preserves three predicted glycosylation sites, exhibited a relative electrophoretic mobility shift following de- migration of MT1-MMPs (Fig. 1C, lanes 3–5), potentially be- sialylation similar to the wild type protein (Fig. 1D, lanes 2 and cause of the poor efficiency of these O-glycosidases against 4). Removal of all four potential O-glycosylation site(s) (CHO-4, complex O-linked carbohydrates. However, treatment of MT1- Fig. 1D, lane 7) resulted in a mutant with electrophoretic MMP with sialidase A consistently resulted in an altered rel- mobility similar to desialylated wild type MT1-MMP (Fig. 1D, ative mobility of the active MT1-MMP species (Fig. 1C, lanes 2, lane 2). Further, this mutant was insensitive to sialidase A 6, and 8). A similar decrease in relative mobility after desialy- treatment (Fig. 1D, lane 8), suggesting that sialic acids are lation has been shown in several other glycoproteins including added to MT1-MMP via O-linked carbohydrates and all poten- MUC1, endolyn, and CD44 (55–57) and presumably reflects tial O-glycosylation sites were identified. To further character- Glycosylation Regulates MT1-MMP Activity 8283 shown). To determine whether endogenously expressed MT1- MMP is also glycosylated in cancer cells, breast and ovarian cancer cell lines were cultured in the presence and absence of BGN. Because of low expression levels, the endogenous MT1- MMP was enriched by purification of cell surface proteins. The active species of endogenous MT1-MMP was detected when probed with an antibody that recognizes the linker region in Western blot analysis (Fig. 2B). The treatment with BGN re- sulted in a similar mobility shift of the active MT1-MMP spe- cies in MDA-MB-231, DOV13, and OVCA429 cells, suggesting that endogenous MT1-MMP is also glycosylated. Interestingly, no mobility shift was detected upon BGN treatment of OVCA433 cells, with the active species of MT1-MMP detected at the higher apparent molecular weight corresponding to un- derglycosylated MT1-MMP. These data demonstrate that en- FIG.5. Glycosylation of MT1-MMP does not affect collagen dogenous MT1-MMP is O-glycosylated and indicate the pres- invasion. COS-7 cells were transfected with vector, MT1-MMP, ence of differential MT1-MMP glycoforms in human cancer E240A, and different glycosylation mutants as indicated. After 12 h, these cells were trypsinized, seeded (1  10 /well) onto cell culture cells. inserts (24 well, 8.0 m pore) coated with a type I collagen (10 g/well), Glycosylation Does Not Affect Zymogen Activation and Fold- and allowed to invade for 24 h as described under “Experimental Pro- ing of MT1-MMP—The distinct lectin binding properties of pro- cedures.” Non-invading cells were removed from the upper chamber and active MT1-MMP (Fig. 1E) suggest a temporal relationship with a cotton swab. Filters were then stained, and cells, adherent to the underside of the filter, were enumerated using an ocular micrometer. between MT1-MMP activation and glycosylation. ProMT1- The average values of triplicate experiments were normalized to cells MMP is activated by a specific cleavage following the transfected with vector alone (designated 1) and were presented with 108 111 R RKR sequence by furin or other PCs and zymogen acti- S.D. error bar. GM6001 (25 M) was added in the well indicated. vation can be inhibited by an engineered mutant of l-PI des- ignated 1-PI (43). To evaluate the relationship between PDX ize the glycosylation of MT1-MMP, cells were transfected with proMT1-MMP activation and glycosylation, wild type or glyco- either wild type or CHO-4 mutant MT1-MMP and the lysates sylation-defective MT1-MMP was co-expressed with wild type were precipitated with various immobilized lectins. Negligible 1-PI or 1-PI . In the presence of wild type 1-PI (inactive PDX CHO-4 MT1-MMP was precipitated by any lectin (Fig. 1E, against furin/PC), all proMT1-MMP glycoforms were converted lower panel), suggesting that MT1-MMP has very low carbohy- to the active species in the same relative ratio as the wild type drate-independent interaction with lectins. In contrast wild protein, suggesting glycosylation is not required for MT1-MMP type MT1-MMP was precipitated with both concanavalin A, activation (Fig. 3A, lanes 1, 3, 5, and 7). Co-expression of which binds to glucose and mannose (Fig. 1E, lane 2), and 1-PI inhibited proMT1-MMP activation in all glycoforms PDX soybean agglutinin, which binds to galactose and N-acetyl- (Fig. 3A, lanes 2, 4, 6, and 8), indicating the conversion was galactosamine (Fig. 1E, lane 3). Interestingly, a preferential furin/PC-dependent. The accumulated proMT1-MMP appeared interaction with proMT1-MMP was observed, suggesting that to be glycosylated at the same sites in the linker region, be- partial deglycosylation of the proenzyme may accompany zy- cause the pro-form of the CHO-4 mutant did not exhibit a mogen activation. Wheat germ agglutinin, which binds to N- similar mobility shift (Fig. 3A, lane 8). These data indicate that acetylglucosamine and sialic acid, also precipitated MT1-MMP, glycosylation of MT1-MMP is not required for efficient zymo- with preferential binding to the active MT1-MMP species (Fig. gen activation. 1E, lane 5). Succinylated wheat germ agglutinin, which no Because differential NH -terminal proteolytic processing of longer binds to sialic acid but preserves its interaction with active MT1-MMP has been reported (61, 62), control experi- N-acetylglucosamine, differentially recognizes proMT1-MMP ments were performed to examine whether the altered mobility (Fig. 1E, lane 6), providing additional evidence that active of CHO-4 was the result of unusual NH -terminal processing. MT1-MMP is sialylated. To determine the subtype of sialic acid This was achieved by taking advantage of the anti-FLAG M1 on MT1-MMP, interaction with the (-2,3) linkage-specific lec- antibody, which recognizes the FLAG epitope only when it is at tin M. amurensis lectin II and the (-2,6) linkage-specific lectin the NH terminus. Additional tagged wild type MT1-MMP and S. nigra lectin was evaluated. Only M. amurensis lectin II was 2 CHO-4 constructs were generated in which the FLAG sequence found to interact with MT1-MMP (Fig. 1E, lanes 7 and 8), was inserted immediately after furin/PC cleavage site (desig- indicating the sialic acid was added via (-2,3) linkage. These nated f112), instead of the stalk region (Fig. 1B). The f112- data support the conclusion that MT1-MMP is a glycoprotein tagged constructs were expressed in COS-7 cells and initially with O-linked complex carbohydrates. probed with M2 antibody, which detects the FLAG epitope In addition to mutational analysis and lectin precipitation, irrespective of location in the protein primary structure. Both the O-glycosylation inhibitor benzyl-2-acetamido-2-deoxy--D- the pro- and active species of wild type and CHO-4 MT1-MMP galactopyranoside (GalNAc--O-benzyl, or BGN) (59, 60) and were recognized (Fig. 3B, lower panel). When probed with M1 the N-glycosylation inhibitor tunicamycin were used to evalu- antibody, only the active species were detected, because of ate glycosylation of MT1-MMP. Culture of cells overexpressing exposure of the NH -terminal FLAG epitope following furin/PC wild type MT1-MMP with BGN resulted in expression of an processing (Fig. 3B, upper panel). The CHO-4 mutant as well as MT1-MMP species (Fig. 2A, lane 2) with relative electro- wild type MT1-MMP was recognized, indicating that the amino phoretic migration similar to the carbohydrate-free CHO-4 mu- terminus of the CHO-4 mutant is identical to that of wild type tant (Fig. 2A, lane 3), providing additional evidence that MT1- MMP is O-glycosylated. No change in mobility was observed MT1-MMP. These data confirm that the altered relative elec- trophoretic mobility observed in the CHO-4 mutant reflects upon treatment of CHO-4-expressing cells with BGN (Fig. 2A, lane 4). In control experiments, treatment with the N-glycosy- lack of glycosylation rather than differential proteolysis. Be- cause glycosylation has been shown to be important for protein lation inhibitor tunicamycin did not alter the electrophoretic mobility of either wild type or CHO-4 MT1-MMP (data not folding in many proteins, the stability of the carbohydrate-free 8284 Glycosylation Regulates MT1-MMP Activity FIG.6. Glycosylation of MT1-MMP is required for MMP-2 activation. The transfected COS-7 cells in Fig. 5 were also plated on 6-well plates coated with thin layer of type I collagen at the same time. A, after attachment, cells were incubated with 25 M GM6001 for 12 h. Cell surface proteins were labeled with Sulfo-NHS- LC-LC-Biotin, purified with neutravidin as described under “Experimental Proce- dures,” and analyzed by Western blot (WB) using anti-FLAG M2 antibody and anti-transferrin receptor (TfR) antibody. The active MT1-MMP are indicated as Š. B, cells were also incubated with 1 nM of purified proMMP-2 in serum-free media for 24 h. The conditioned media were col- lected and analyzed by zymography as de- scribed under “Experimental Proce- dures.” The pro-, intermediate, and active form of MMP-2 are indicated as , —, and Š, respectively. CHO-4 mutant relative to wild-type MT1-MMP was evaluated. radation product (Fig. 4A, lanes 7 and 8). These data clearly Soluble MT1-MMP was generated on the background of either indicate that proteolytic processing of MT1-MMP is mediated wild type (sMT1-MMP) or CHO-4 mutant (sCHO-4). Compari- by autolysis in trans. To test whether glycosylation affects son of sMT1-MMP and sCHO-4 by TUG-gel electrophoresis autolytic processing of MT1-MMP, FLAG-tagged inactive showed an identical unfolding transition, indicating similarity E240A MT1-MMP was co-expressed with Myc-tagged wild in stability and folding of the wild type and mutant soluble type, E240A, or CHO-4 MT1-MMP and the cell lysates were proteins (Fig. 3C). probed with anti-FLAG antibody. Consistent with results in Glycosylation Regulates Substrate Targeting of MT1-MMP— Fig. 4A, wild type MT1-MMP cleaved the inactive E240A mu- To evaluate the potential functional consequences of post- tant and this processing was blocked by GM6001 (Fig. 4B, lanes translational glycosylation of MT1-MMP, the proteolytic activ- 1 and 3). Similar results were obtained using CHO-4-MT1- ity of the enzyme was evaluated against several key substrates. MMP (Fig. 4B, lane 4), indicating that glycosylation does not MT1-MMP activity can be down-regulated by autolytic cleav- regulate the catalytic activity of MT1-MMP against other MT1- 284 285 age at the start of the linker region (Gly 2 Gly , Fig. 1B), MMP species. generating a catalytically inactive species (39). Because the Because the linker region of MT1-MMP is important for its predicted glycosylation sites are close to the reported cleavage collagenolytic activity (54) and our results demonstrate that site, the effect of glycosylation on MT1-MMP autolysis was MT1-MMP is glycosylated in this domain, the effect of glycosy- investigated. In initial control experiments, FLAG-tagged lation on collagenolysis was examined using a previously es- MT1-MMP was co-expressed with untagged wild type MT1- tablished three-dimensional collagen gel invasion assay (24). MMP, inactive MT1-MMP (E240A) or control vector. The cell Expression of MT1-MMP resulted in an 8-fold increase in col- lysates were probed with anti-FLAG antibody to monitor proc- lagen invasion (Fig. 5). The proteolytic activity of MT1-MMP is essing of only the FLAG-tagged proteins. The conversion of required for invasion, as base-line levels of invasion are ob- active wild-type MT1-MMP (50 kDa) to a 37-kDa species was served in cells treated with the broad spectrum metalloprotein- blocked by GM6001 (Fig. 4A, lanes 1 and 2). Co-expression of an ase inhibitor GM6001 as well as in cells expressing the cata- untagged MT1-MMP increased the cleavage of the FLAG- lytically inactive E240A mutant. All three glycosylation- defective mutants promoted collagen invasion as efficiently as tagged protein (Fig. 4A, lane 3), whereas co-transfection of the catalytically inactive E240A mutant did not affect conversion wild type MT1-MMP (Fig. 5), demonstrating that collagenolytic activity is not regulated by glycosylation. In control surface- (Fig. 4A, lane 4), supporting a model of autolysis in trans.To further examine the autolysis model, similar experiments were labeling experiments, wild-type MT1-MMP and glycosylation- deficient mutants were presented on the cell surface at equal performed with FLAG-tagged E240A MT1-MMP mutant. Con- sistent with the loss of proteinase activity in the E240A mu- levels (Fig. 6A). In addition to type I collagen, proMMP-2 is a major substrate tant, no autolysis was detected in the presence or absence of GM6001 (Fig. 4A, lanes 5 and 6). Co-expression of the untagged of MT1-MMP. To test whether glycosylation of MT1-MMP af- fects activation of proMMP-2, COS-7 cells were transfected wild type MT1-MMP, but not the untagged E240A mutant, however, substantially converted the active species to the deg- with wild type MT1-MMP or various glycosylation mutants and Glycosylation Regulates MT1-MMP Activity 8285 FIG.7. Oligomerization of MT1- MMP is not affected by its glycosyla- tion. A, schematic diagram of MT1-MMP oligomerization. FLAG- and Myc-tagged (stalk) MT1-MMP and its CHO-4 mutant were generated to test whether glycosyla- tion interferes with oligomerization. B, COS-7 cells were co-transfected with Myc-tagged MT1-MMP and FLAG-tagged different glycosylation variants of MT1- MMP. Cell lysates were immunoprecipi- tated with anti-FLAG M2 antibody and probe back with anti-Myc (9E10) and an- ti-FLAG M2 antibody (upper panel). Cell lysates were also analyzed for equal ex- pression (lower panel). Similar experi- ments were performed in C with Myc- tagged CHO-4 mutant. The pro- and active MT1-MMPs are indicated as  and Š, respectively. WB, Western blot. incubated with purified proMMP-2, followed by analysis of activation of proMMP-2 was blocked by GM6001 (Fig. 6B, lane zymogen activation by gelatin zymography. Cells transfected 3) and transfection of the MT1-MMP E240A mutant failed to with wild type MT1-MMP processed proMMP-2 (72 kDa) to a activate proMMP-2 (Fig. 6B, lane 4). Cells transfected with 68-kDa intermediate and a 62-kDa active species (Fig. 6B, lane glycosylation-deficient mutants demonstrated a distinct activa- 5). The catalytic activity of MT1-MMP is required, because the tion profile. Whereas the CHO-1 mutant activated proMMP-2 8286 Glycosylation Regulates MT1-MMP Activity FIG.8. Glycosylation of MT1-MMP is required for MT1-MMP/TIMP-2/ MMP-2 trimeric complex formation. A, COS-7 cells were transfected with FLAG-tagged MT1-MMP or CHO-4 mu- tant in the presence of 25 M GM6001. After 24 h, cells were incubated with 10 nM TIMP-2 and 10 nM proMMP-2 in the presence of 25 M GM6001 for 1 h. Un- bound TIMP-2 and proMMP-2, as well as GM6001, were then removed to allow ac- tivation of cell surface-bound MMP-2. Cell lysates were obtained at 0, 15, 30, and 60 min and analyzed by gelatin zy- mography as described under “Experi- mental Procedures.” The pro-, intermedi- ate, and active form of MMP-2 are indicated as , —, and Š, respectively. B, COS-7 cells were transfected with vector, Cat, E240A, and different glycosylation variants of MT1-MMP in the presence of 25 M GM6001. After 24 h, cells were incubated with 10 nM TIMP-2 and 10 nM proMMP-2 for 1 h followed by co-immuno- precipitation with anti-FLAG M2 anti- body. The immunoprecipitates were ana- lyzed by Western blot (WB) using anti- FLAG M2 and anti-TIMP-2 antibodies, and analyzed by gelatin zymography. The pro-, active, and autolytic products of MT1-MMP are indicated as , Š, and d, respectively. to the same extent as the wild type protein (Fig. 6B, lane 6), MMP species. This interaction was not affected by the glycosy- 299 301 mutation of the Thr-Thr-Ser sites in CHO-3 and CHO-4 lation status of MT1-MMP, as similar amounts of Myc-tagged significantly blocked proMMP-2 activation (Fig. 6B, lanes 7 and MT1-MMP were co-immunoprecipitated with the FLAG-tagged 8). These data demonstrate a differential effect of glycosylation CHO-1, -3, and -4 glycosylation-defective mutants (Fig. 7B, on the substrate cleavage profile of MT1-MMP. Although wild lanes 5–7). Similar results were obtained using Myc-tagged type MT1-MMP promotes collagenolysis, autolysis, and gelati- CHO-4 MT1-MMP (Fig. 7C), demonstrating that oligomeriza- nolysis (via proMMP-2 activation), the carbohydrate free en- tion is independent of glycosylation. Further, these data indi- zyme does not initiate gelatinolysis. cate that the inability of the CHO-3 and CHO-4 mutants to Oligomerization of MT1-MMP Is Not Regulated by Glycosy- effectively catalyze proMMP-2 activation is not a result of lation—It was recently reported that hemopexin domain-de- inefficient oligomerization. pendent oligomerization of MT1-MMP is required for efficient Glycosylation Affects the Presentation of a Stable MT1-MMP/ proMMP-2 activation (35). To determine whether the defect in TIMP-2/ProMMP-2 Trimeric Complex and Modulates TIMP-2/ proMMP-2 activation described above results from the inability MT1-MMP Interaction—MT1-MMP mediates MMP-2 activa- of the CHO-deficient mutants to oligomerize, differentially tion through the formation of a trimeric complex consisting epitope-tagged MT1-MMP constructs were generated. Wild- MT1-MMP, TIMP-2 and proMMP-2. To examine the effect of type or CHO-4 MT1-MMP expressing the Myc epitope tag was glycosylation on the formation of the trimeric complex, FLAG- generated and co-expressed with FLAG-tagged MT1-MMP or tagged MT1-MMP species were expressed in COS-7 cells in the the individual CHO-1, CHO-3, or CHO-4 mutants. Following presence of GM6001 to prevent autolytic degradation. After expression, cellular extracts were immunoprecipitated with 24 h, the cells were incubated with TIMP-2 and proMMP-2 in immobilized FLAG antibody (M2), electrophoresed, and blots the presence of GM6001 for 1 h. Cells were washed to remove were probed with either the FLAG or Myc epitope tag antibod- unbound protein and inhibitors, and cellular activation of ies. Potential dimer pairings between wild type and CHO- MMP-2 was monitored with time. As indicated in Fig. 8A, proMMP-2 initially associates with MT1-MMP transfected deficient MT1-MMP species are shown schematically in Fig. 7A (only one CHO chain is included for simplicity). Consistent cells, and is processed to the intermediate and active species within 1 h (Fig. 8C, lanes 1– 4). In contrast, interaction of with the observation of Itoh and co-workers (35), immunopre- cipitation through the FLAG epitope tag also precipitated Myc- proMMP-2 with CHO-4 mutant MT1-MMP transfected cells was substantially decreased (Fig. 8A, lanes 5– 8), suggesting tagged MT1-MMP (Fig. 7B, lane 4), supporting the hypothesis that protein-protein interactions occur between adjacent MT1- altered association and/or dissociation kinetics. This was con- Glycosylation Regulates MT1-MMP Activity 8287 FIG.9. Glycosylation of MT1-MMP affects TIMP-2 inhibition of autolysis and TIMP-2-dependent endocytosis of MT1-MMP. COS-7 cells were transfected with FLAG-tagged (stalk) MT1-MMP or CHO-4 mutant in the presence of increasing concentrations of GM6001 (A,0,1,10, and 100 M), or in B, TIMP-1 (100 nM) or increasing concentrations of TIMP-2 (1, 10, and 100 nM). After 24 h, cell lysates were fractionated on 10% SDS-PAGE and analyzed by Western blot using anti-FLAG M2 antibody. The pro-, active, and autolytic products of MT1-MMP are indicated as , Š, andd, respectively. C–H, COS-7 cells were transfected with FLAG-tagged (stalk) MT1-MMP (C and F), CHO-4 (D and G), and E240A (E and H) mutant in the presence of 25 M GM6001. Cell surface FLAG-tagged proteins were labeled with anti-FLAG M2 antibody on ice for 1 h. After washing off unbound antibody, cells were put back to 37 °C to allow endocytosis for 15 min. Cells were then fixed with formaldehyde and permeabilized with saponin, followed by Alexa Fluor 488-conjugated goat anti-mouse secondary antibody (in green). Total expression of MT1-MMP or its mutants were also stained with anti-linker antibody followed by Alexa Fluor 546-conjugated goat anti-rabbit secondary antibody (inset,in red). The nuclei were counterstained using TO-PRO iodide (642/661) (in blue). The images were taken using a Zeiss LSM510 laser scanning confocal microscope. firmed by co-immunoprecipitation experiments in which wild fied soluble MT1-MMP or the CHO-4 mutant (lacking the type or mutant MT1-MMP species were immunoprecipitated transmembrane and cytoplasmic domains) bound to TIMP-2 with anti-FLAG antibody, and analyzed for the presence of with similar efficiency (data not shown). These data suggest an TIMP-2 by Western blot and MMP-2 by gelatin zymography. inability to efficiently recruit TIMP-2 and proMMP-2 to cell Both TIMP-2 and MMP-2 were co-precipitated with wild type surface localized carbohydrate-deficient MT1-MMP, indicating MT1-MMP (Fig. 8B, lanes 4 and 5). In control experiments, no that glycosylation directly affects the presentation of a func- complex was generated with the Cat mutant lacking the ac- tional MT1-MMP/TIMP-2/proMMP-2 ternary complex on the tive site (Fig. 8B, lane 2) and negligible MMP-2 was associated cell surface and thereby inhibits cell surface proMMP -2 with the inactive E240A mutant, presumably through direct activation. interaction with the catalytic domain of MT1-MMP (63) (Fig. To further characterize the effect of glycosylation on the 8B, lane 3). Although similar levels of expression of CHO- MT1-MMP/TIMP-2 interaction, the interaction of MT1-MMP deficient MT1-MMP mutants were obtained, no TIMP-2 was with synthetic metalloproteinase inhibitor GM6001 and the precipitated with the CHO-3 and CHO-4 mutants, and associ- endogenous inhibitor TIMP-2 was examined. GM6001 inhib- ated MMP-2 was substantially decreased to the level of E240A ited the autolysis of both wild type and CHO-4 MT1-MMP in a mutant (Fig. 8B, lanes 7 and 8). In control experiments, puri- dose-dependent manner and with a similar inhibitory profile, 8288 Glycosylation Regulates MT1-MMP Activity with partial inhibition at 1 and 10 M, and complete blockade Regulation of collagenase activity by the MT1-MMP linker at 100 M (Fig. 9A). In contrast, the inhibitory profiles of region has also been demonstrated. MT1-MMP-mediated colla- TIMP-2 against the two glycoforms were quite distinct. Al- gen cleavage was blocked by a recombinant protein containing though TIMP-2 stabilized the 50-kDa active species of wild the linker and hemopexin-like domains of MT1-MMP, whereas type MT1-MMP in a dose-dependent manner (Fig. 9B, lanes the hemopexin-like domain fragment in the absence of the 2– 4), very little of the active species of CHO-4 mutant MT1- linker was ineffective (54). Results of the current study show MMP was preserved even at 100 nM concentration of TIMP-2 effective collagen gel invasion, regardless of the glycosylation (Fig. 9B, lanes 6 – 8). These data suggest that under in vivo status of the MT1-MMP linker region, suggesting that the conditions wherein TIMP-2 is the primary inhibitor of MT1- relative efficiency of pericellular collagenolysis is not altered by MMP, glycosylation of MT1-MMP may protect against autoly- carbohydrate. sis and thus stabilize active MT1-MMP. In addition to interstitial collagen, proMMP-2 is a predomi- As a recent report demonstrated that TIMP-2 undergoes nant MT1-MMP substrate, and results of the current study endocytosis with MT1-MMP (47, 64, 65), the effect of TIMP-2 demonstrate that cell surface activation of proMMP-2 is on wild type and CHO-4 mutant MT1-MMP endocytosis was blocked in glycosylation-defective mutants. The mechanism by evaluated. Cells expressing FLAG epitope-tagged wild type, which glycosylation of MT1-MMP affects MMP-2 activation CHO-4, or E240A-MT1-MMP were incubated at 4 °C to prevent was explored in detail. Experiments using 1-PI to block PDX endocytosis and labeled with anti-FLAG antibody. Cells were furin/PC activity indicated that the zymogen of MT1-MMP was then incubated in the presence or absence of TIMP-2 and activated with equal efficiency in the wild type enzyme or shifted to 37 °C for 15 min to promote endocytosis. To prevent carbohydrate deficient mutants. To determine whether the in- autolysis and shedding of MT1-MMP, GM6001 was kept ability to activate MMP-2 resulted from failure of the carbohy- throughout the experiment (38, 39). After endocytosis, antibody drate-free mutant to oligomerize, differentially epitope-tagged remaining on the cell surface was removed by low pH washing, MT1-MMP species were employed as recently described (35). and endocytosed antibody (indicative of endocytosed MT1- Our results confirm published reports that protein-protein in- MMP) was detected with a secondary antibody probe. Control teractions between neighboring MT1-MMP species accompany experiments using an antibody directed against the MT1-MMP proMMP-2 activation; however, MT1-MMP oligomerization linker domain demonstrated similar levels of expression of the was independent of glycosylation status. The current data sup- various MT1-MMP species (Fig. 9, C–H, index box). Similar port the hypothesis that carbohydrate-free MT1-MMP does not patterns of endocytosis were observed among wild type, carbo- form an effective ternary activation complex owing to an in- hydrate-free, and catalytically inactive MT1-MMP (Fig. 9, ability to recruit TIMP-2 to the cell surface proteinase. Al- C–E). Addition of TIMP-2 to wild-type MT1-MMP significantly though soluble recombinant MT1-MMP lacking the transmem- increased endocytosis (Fig. 9F), whereas TIMP-2 had no effect brane and cytoplasmic domains can bind to TIMP-2 in solution, on endocytosis of either inactive E240A MT1-MMP or carbohy- co-precipitation analyses demonstrate a lack of ternary com- drate-free CHO-4 MT1-MMP (Fig. 9, G and H). These data plex formation with the cell-associated carbohydrate-free mu- suggest that the inability of cell surface CHO-4 MT1-MMP to tant. This result is supported by data showing an inability of bind TIMP-2 may modulate the cell surface retention of the TIMP-2 to block autolysis of cell surface carbohydrate-free protein. MT1-MMP. Although the biochemical basis for the lack of TIMP-2 binding by the cell surface carbohydrate-free MT1- DISCUSSION MMP species is unclear, an unidentified carbohydrate-binding Results of the current study demonstrate that MT1-MMP is protein may be necessary to induce or stabilize the active post-translationally modified by O-glycosylation at Thr , conformation of MT1-MMP prior to TIMP-2 binding. Alterna- 299 300 301 Thr , Thr , and/or Ser residues in the proline-rich linker tively the carbohydrate moiety may participate in the traffick- region. Although the detailed carbohydrate composition was ing of MT1-MMP (55, 68). Indeed, our data demonstrate that, not analyzed, lectin precipitation experiments suggest that the although TIMP-2 promotes endocytosis of wild-type MT1- carbohydrate moiety contains complex sugar structures. Using MMP, internalization of the carbohydrate-defective MT1-MMP glycosylation inhibitors, evidence for glycosylation of endog- mutant is unaltered by TIMP-2, suggesting that glycosylation enously expressed MT1-MMP in human cancer cells was pro- may regulate TIMP-2-driven endocytosis of MT1-MMP. To- vided. Distinct glycoforms of MT1-MMP were detected in hu- gether these data support a model wherein glycosylation reg- man cancer cell lines, suggesting that MT1-MMP activity may ulates substrate targeting and suggest a cellular mechanism by be regulated by differential glycosylation in vivo. Moreover, which post-translational processing may control MT1-MMP putative glycosylation sites are predicted to exist in the linker surface presentation and proMMP-2 activation. regions of all known MT-MMPs, suggesting a conserved post- REFERENCES translational modification indicative of a potential regulatory 1. Brinckerhoff, C. E., and Matrisian, L. M. (2002) Nat. Rev. Mol. Cell. Biol. 3, function. Although the role of glycosylation among MMP family 207–214 members has not been extensively evaluated, the secreted pro- 2. Nagase, H., and Woessner, J. F., Jr. (1999) J. Biol. Chem. 274, 21491–21494 3. Sternlicht, M. D., and Werb, Z. (2001) Annu. Rev. Cell Dev. Biol. 17, 463–516 teinase MMP-9 is known to be both O- and N-glycosylated and 4. Werb, Z. (1997) Cell 91, 439 – 442 terminally sialylated. Interestingly, desialylation of MMP-9 5. Yu, Q., and Stamenkovic, I. (2000) Genes Dev. 14, 163–176 has been shown to increase the hydrolysis of peptide substrate 6. Levi, E., Fridman, R., Miao, H. Q., Ma, Y. S., Yayon, A., and Vlodavsky, I. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7069 –7074 in the presence of TIMP-1 (66), suggesting TIMP-dependent 7. Suzuki, M., Raab, G., Moses, M. A., Fernandez, C. A., and Klagsbrun, M. inhibition of MMP activity could be modulated by glycosylation. (1997) J. Biol. Chem. 272, 31730 –31737 8. English, W. R., Puente, X. S., Freije, J. M., Knauper, V., Amour, A., Merry- To evaluate the potential role of glycosylation in modifying weather, A., Lopez-Otin, C., and Murphy, G. (2000) J. Biol. Chem. 275, MT1-MMP function, initial studies focused on analysis of col- 14046 –14055 lagenase activity, as recent studies have proposed that the 9. Noe, V., Fingleton, B., Jacobs, K., Crawford, H. C., Vermeulen, S., Steelant, W., Bruyneel, E., Matrisian, L. M., and Mareel, M. (2001) J. Cell Sci. 114, linker domains of MMPs may play a crucial role in collagenoly- 111–118 sis. For example, introduction of a single amino acid mutation 10. Deryugina, E. I., Ratnikov, B., Monosov, E., Postnova, T. I., DiScipio, R., Smith, J. W., and Strongin, A. Y. (2001) Exp. Cell Res. 263, 209 –223 in the linker region of MMP-1 (collagenase-1) dramatically 11. Preece, G., Murphy, G., and Ager, A. (1996) J. Biol. Chem. 271, 11634 –11640 decreased collagenase activity without affecting gelatinolysis, 12. Knauper, V., Will, H., Lopez-Otin, C., Smith, B., Atkinson, S. J., Stanton, H., suggesting a direct role of this domain in collagen cleavage (67). Hembry, R. M., and Murphy, G. (1996) J. Biol. Chem. 271, 17124 –17131 Glycosylation Regulates MT1-MMP Activity 8289 13. Murphy, G., Stanton, H., Cowell, S., Butler, G., Knauper, V., Atkinson, S., and 40. Munshi, H. G., Wu, Y. I., Ariztia, E. V., and Stack, M. S. (2002) J. Biol. Chem. Gavrilovic, J. (1999) APMIS 107, 38 – 44 277, 41480 – 41488 14. Overall, C. M., and Lopez-Otin, C. (2002) Nat. Rev. Cancer 2, 657– 672 41. Pei, D., and Weiss, S. J. (1995) Nature 375, 244 –247 15. Nelson, A. R., Fingleton, B., Rothenberg, M. L., and Matrisian, L. M. (2000) 42. Maquoi, E., Noel, A., Frankenne, F., Angliker, H., Murphy, G., and Foidart, J. Clin. Oncol. 18, 1135–1149 J. M. (1998) FEBS Lett. 424, 262–266 16. Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., and 43. Yana, I., and Weiss, S. J. (2000) Mol. Biol. Cell 11, 2387–2401 Seiki, M. (1994) Nature 370, 61– 65 44. Anderson, E. D., Thomas, L., Hayflick, J. S., and Thomas, G. (1993) J. Biol. 17. Takino, T., Sato, H., Shinagawa, A., and Seiki, M. (1995) J. Biol. Chem. 270, Chem. 268, 24887–24891 23013–23020 45. Mori, H., Tomari, T., Koshikawa, N., Kajita, M., Itoh, Y., Sato, H., Tojo, H., 18. Will, H., and Hinzmann, B. (1995) Eur. J. Biochem. 231, 602– 608 Yana, I., and Seiki, M. (2002) EMBO J. 21, 3949 –3959 19. Pei, D. (1999) J. Biol. Chem. 274, 8925– 8932 46. Galvez, B. G., Matias-Roman, S., Yanez-Mo, M., Sanchez-Madrid, F., and 20. Itoh, Y., Kajita, M., Kinoh, H., Mori, H., Okada, A., and Seiki, M. (1999) J. Biol. Arroyo, A. G. (2002) J. Cell Biol. 159, 509 –521 Chem. 274, 34260 –34266 47. Uekita, T., Itoh, Y., Yana, I., Ohno, H., and Seiki, M. (2001) J. Cell Biol. 155, 21. Kojima, S., Itoh, Y., Matsumoto, S., Masuho, Y., and Seiki, M. (2000) FEBS 1345–1356 Lett. 480, 142–146 48. Toth, M., Bernardo, M. M., Gervasi, D. C., Soloway, P. D., Wang, Z., Bigg, 22. Seiki, M. (2002) Curr. Opin. Cell Biol. 14, 624 – 632 H. F., Overall, C. M., DeClerck, Y. A., Tschesche, H., Cher, M. L., Brown, S., 23. Seiki, M. (2003) Cancer Lett. 194, 1–11 Mobashery, S., and Fridman, R. (2000) J. Biol. Chem. 275, 41415– 41423 24. Ellerbroek, S. M., Wu, Y. I., Overall, C. M., and Stack, M. S. (2001) J. Biol. 49. Olson, M. W., Gervasi, D. C., Mobashery, S., and Fridman, R. (1997) J. Biol. Chem. 276, 24833–24842 Chem. 272, 29975–29983 25. Hotary, K., Allen, E., Punturieri, A., Yana, I., and Weiss, S. J. (2000) J. Cell 50. Hansen, J. E., Lund, O., Rapacki, K., and Brunak, S. (1997) Nucleic Acids Res. Biol. 149, 1309 –1323 25, 278 –282 26. Holmbeck, K., Bianco, P., Caterina, J., Yamada, S., Kromer, M., Kuznetsov, 51. Notredame, C., Higgins, D. G., and Heringa, J. (2000) J. Mol. Biol. 302, S. A., Mankani, M., Robey, P. G., Poole, A. R., Pidoux, I., Ward, J. M., and 205–217 Birkedal-Hansen, H. (1999) Cell 99, 81–92 52. Munshi, H. G., and Stack, M. S. (2002) Methods Cell Biol. 69, 195–205 27. Zhou, Z., Apte, S. S., Soininen, R., Cao, R., Baaklini, G. Y., Rauser, R. W., 53. Mast, A. E., Enghild, J. J., Pizzo, S. V., and Salvesen, G. (1991) Biochemistry Wang, J., Cao, Y., and Tryggvason, K. (2000) Proc. Natl. Acad. Sci. U. S. A. 30, 1723–1730 97, 4052– 4057 54. Tam, E. M., Wu, Y. I., Butler, G. S., Stack, M. S., and Overall, C. M. (2002) 28. Strongin, A. Y., Collier, I., Bannikov, G., Marmer, B. L., Grant, G. A., and J. Biol. Chem. 277, 39005–39014 Goldberg, G. I. (1995) J. Biol. Chem. 270, 5331–5338 55. Altschuler, Y., Kinlough, C. L., Poland, P. A., Bruns, J. B., Apodaca, G., Weisz, 29. Butler, G. S., Butler, M. J., Atkinson, S. J., Will, H., Tamura, T., van Westrum, O. A., and Hughey, R. P. (2000) Mol. Biol. Cell 11, 819 – 831 S. S., Crabbe, T., Clements, J., d’Ortho, M. P., and Murphy, G. (1998) 56. Huet, G., Hennebicq-Reig, S., de Bolos, C., Ulloa, F., Lesuffleur, T., Barbat, A., J. Biol. Chem. 273, 871– 880 Carriere, V., Kim, I., Real, F. X., Delannoy, P., and Zweibaum, A. (1998) 30. Kinoshita, T., Sato, H., Okada, A., Ohuchi, E., Imai, K., Okada, Y., and Seiki, J. Cell Biol. 141, 1311–1322 M. (1998) J. Biol. Chem. 273, 16098 –16103 57. Ihrke, G., Bruns, J. R., Luzio, J. P., and Weisz, O. A. (2001) EMBO J. 20, 31. Zucker, S., Drews, M., Conner, C., Foda, H. D., DeClerck, Y. A., Langley, K. E., 6256 – 6264 Bahou, W. F., Docherty, A. J., and Cao, J. (1998) J. Biol. Chem. 273, 58. Molloy, S. S., Anderson, E. D., Jean, F., and Thomas, G. (1999) Trends Cell 1216 –1222 Biol. 9, 28 –35 32. Overall, C. M., King, A. E., Sam, D. K., Ong, A. D., Lau, T. T., Wallon, U. M., 59. Kuan, S. F., Byrd, J. C., Basbaum, C., and Kim, Y. S. (1989) J. Biol. Chem. 264, DeClerck, Y. A., and Atherstone, J. (1999) J. Biol. Chem. 274, 4421– 4429 19271–19277 33. Atkinson, S. J., Crabbe, T., Cowell, S., Ward, R. V., Butler, M. J., Sato, H., 60. Huet, G., Kim, I., de Bolos, C., Lo-Guidice, J. M., Moreau, O., Hemon, B., Seiki, M., Reynolds, J. J., and Murphy, G. (1995) J. Biol. Chem. 270, Richet, C., Delannoy, P., Real, F. X., and Degand, P. (1995) J. Cell Sci. 108, 30479 –30485 1275–1285 34. Will, H., Atkinson, S. J., Butler, G. S., Smith, B., and Murphy, G. (1996) 61. Rozanov, D. V., and Strongin, A. Y. (2003) J. Biol. Chem. 278, 8257– 8260 J. Biol. Chem. 271, 17119 –17123 62. Koo, H. M., Kim, J. H., Hwang, I. K., Lee, S. J., Kim, T. H., Rhee, K. H., and 35. Itoh, Y., Takamura, A., Ito, N., Maru, Y., Sato, H., Suenaga, N., Aoki, T., and Lee, S. T. (2002) Mol. Cell 13, 118 –124 Seiki, M. (2001) EMBO J. 20, 4782– 4793 63. English, W. R., Holtz, B., Vogt, G., Knauper, V., and Murphy, G. (2001) J. Biol. 36. Lehti, K., Lohi, J., Juntunen, M. M., Pei, D., and Keski-Oja, J. (2002) J. Biol. Chem. 276, 42018 – 42026 Chem. 277, 8440 – 8448 64. Remacle, A., Murphy, G., and Roghi, C. (2003) J. Cell Sci. 116, 3905–3916 37. Jiang, A., Lehti, K., Wang, X., Weiss, S. J., Keski-Oja, J., and Pei, D. (2001) 65. Maquoi, E., Frankenne, F., Baramova, E., Munaut, C., Sounni, N. E., Remacle, Proc. Natl. Acad. Sci. U. S. A. 98, 13693–13698 A., Noel, A., Murphy, G., and Foidart, J. M. (2000) J. Biol. Chem. 275, 38. Toth, M., Hernandez-Barrantes, S., Osenkowski, P., Bernardo, M. M., Gervasi, 11368 –11378 D. C., Shimura, Y., Meroueh, O., Kotra, L. P., Galvez, B. G., Arroyo, A. G., 66. Van den Steen, P. E., Opdenakker, G., Wormald, M. R., Dwek, R. A., and Rudd, Mobashery, S., and Fridman, R. (2002) J. Biol. Chem. 277, 26340 –26350 P. M. (2001) Biochim. Biophys. Acta 1528, 61–73 39. Hernandez-Barrantes, S., Toth, M., Bernardo, M. M., Yurkova, M., Gervasi, 67. Tsukada, H., and Pourmotabbed, T. (2002) J. Biol. Chem. 277, 27378 –27384 D. C., Raz, Y., Sang, Q. A., and Fridman, R. (2000) J. Biol. Chem. 275, 68. Yeaman, C., Le Gall, A. H., Baldwin, A. N., Monlauzeur, L., Le Bivic, A., and 12080 –12089 Rodriguez-Boulan, E. (1997) J. Cell Biol. 139, 929 –940

Journal

Journal of Biological Chemistry – Unpaywall

Published: Feb 1, 2004

There are no references for this article.