Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Transgenic plants as a source for the bioscavenging enzyme, human butyrylcholinesterase

Transgenic plants as a source for the bioscavenging enzyme, human butyrylcholinesterase Introduction Oragnophosphorous (OP) compounds are highly toxic inhibitors of the acetylcholine‐hydrolyzing enzymes acetylcholinesterase (AChE) and butyrylcholinesterase (BChE). Although first explored as insecticides, the extreme toxicity of OPs towards mammals prompted their development as chemical warfare agents, and the first military grade OP nerve agents, tabun, sarin and soman, were synthesized in Nazi Germany immediately prior to and during World War II. The cold war era saw the unfortunate proliferation of the technology and the development of yet more toxic compounds such as VX, Russian‐VX and cyclosarin ( Greenfield , 2002 ; Lee, 2003 ; Johnson , 2009 ). In fact, nerve agents are relatively easy to produce, store and weaponize, and their use by terrorists and rogue governments (notoriously exemplified by the Tokyo subway sarin attack by Aum Shinrikyo in 1995) pose a major threat to civilians and military personnel ( Johnson , 2009 ). In addition, the widespread and sometimes irresponsible use of OP pesticides increases the chance of environmental and occupational exposure of individuals and communities ( Ray and Richards, 2001 ; Catano , 2008 ; Jintana , 2009 ). Such concerns over exposure from overuse and misuse of OP pesticides and nerve agents have led to detailed studies of how such agents work and how to prevent or ameliorate their effects. However, developing safe and effective prophylactic treatments was met with considerable complications. For over a decade, application of cholinesterases, especially BChE, acting as scavengers of OPs has been explored as a promising medical intervention for prophylaxis and post‐exposure treatment against nerve agents. In the near term, outdated human plasma can be a first generation source of BChE for human clinical trials to validate its safety ( Saxena , 2006 ). In the longer term, a cost‐effective, sustainable supply of cholinesterases from an alternative source must be identified to establish and maintain a strategic reserve of the bioscavengers as they are needed in stoichiometric rather than catalytic quantities. In lieu of other expression systems for cholinesterases (e.g. transgenic goats, see Huang , 2007 ), we initially focused our attention on plant production of human AChE ( Mor , 2001 ; Geyer , 2005, 2007 ; Evron , 2007 ), and in this work, we demonstrate the applicability of plants as a production platform for human BChE, the OP bioscavenger of choice ( Doctor and Saxena, 2005 ; Saxena , 2006 ). We describe and discuss our strategy for codon optimization, which is based on conforming the codon usage of the transgene to that of a selected group of highly expressed plant genes rather than to the general codon usage. Using this strategy, we efficiently produced human BChE in plant and purified it to homogeneity. Our work demonstrates that the plant‐derived enzyme is glycosylated, assembled into tetramers, efficiently binds OP cholinesterase inhibitors and protects mice from OP challenge. Results Re‐engineering the gene encoding human BChE for high‐level expression in plants The human BChE cDNA ( hBCHE) was redesigned in silico for high‐level expression in Nicotiana benthamiana ( Figure 1 ). Extensive optimization included replacing unfavourable codons with more favourable alternatives and introducing silent mutations to disrupt sequences that can function as potential mRNA polyadenylation sites ( Loke , 2005 ), splicing signals ( Hebsgaard , 1996 ) and mRNA‐destabilizing determinants ( Narsai , 2007 ). 1 Sequence alignment of hBCHE and pBCHE genes and their expected translation product. Both genes encode for an identical protein (top line), but the nucleotide sequence of hBCHE (middle line) was adapted to allow higher level of expression in designing pBCHE (bottom line). Various molecular features that were targeted in optimizing the gene are labelled as shown on the figure. Both genes include two insertions (highlighted grey): a single residue near the N‐terminus (Gly2) and the C‐terminal ER retention signal (SEKDEL). In addition, two silent mutations (A174T and C312T, underlined) were introduced into the hBCHE to disrupt an EcoRI and an NcoI sites. Ribosome pausing as a result of long stretches of rare codons was implicated in correct co‐translational folding of certain protein domains ( Komar, 2009 ; Rosano and Ceccarelli, 2009 ). When considered within the context of the Homo sapiens codon usage, the BCHE gene has a value of 0.67 with only 16% unpreferred codons (i.e. with adaptiveness value w < 0.5, Table 1, see Experimental Procedures for explanation of w and CAI). These are generally spread throughout the gene’s sequence without clusters of more than three consecutive unpreferred codons (data not shown). Thus, in the case of the BCHE gene, translation elongation rates may play only a minor role, if any, in ensuring proper folding of the BChE protein. We therefore concluded that no specific rare codons in specific locations should be maintained when optimizing the gene’s sequence for expression in plants. In the context of the plant codon usage, more than 30% of the BCHE gene’s codons are unpreferred ( Tables 1 and 2 ). The overall CAI value of 0.60 is moderately low, but in three extensive regions of the genes, the localized CAI values are considerably lower ( Figure 2 ). In fact, there are seven different regions with four or more consecutive unpreferred codons (including one with eight codons). In adapting the sequence of BCHE for expression in plants, we eliminated the majority of rarely used codons (down to 7%), completely abolished the long clusters of such codons, and increased the CAI value to 0.83 ( Figures 1 and 2 , Table 2 ). These features conform to those of a gene encoding a highly abundant plant protein, the small subunit of ribulose bisphosphate carboxylase (RuBisCO) (CAI = 0.81, Figure 2 ). 1 Codon usage (frequency) of h BCHE and the plant‐expression‐optimized pBCHE genes 2 Codon usage of pBCHE is comparable to that of a highly expressed plant gene. Plotted values of the relative adaptiveness, w, of each codon represent a moving average (geometric mean, window size 51) centring on each codon for the coding regions of hBCHE, pBCHE and rbcS1B (encoding the small subunit of the enzyme RuBisCO). The codon adaptation index (CAI, relative adaptiveness averaged over the entire length of a sequence) for each gene is shown as a broken line. 2 Molecular features of h BCHE and the plant‐expression‐optimized pBCHE genes hBCHE pBCHE Codon usage Total 609 609 Unfavourable 189 45 % 31 7 Clusters of 2–3 31 2 4≤ 7 0 CAI 0.60 0.83 RNA‐destabilizing sequences AUUUA* 3 0 AUAGAU* 1 0 UUUUUU* 3 0 1–10 seqs of Narsai et al. 19 9 Polyadenylation signals 1–10 seqs of Loke et al. 9 1 1–100 seqs of Loke et al. 61 5 Donor splice sites Highly likely 1 0 Potential 1 1 Acceptor splice sites Potential 3 1 Branch point splice sites Potential 3 1 Potential DNA methylation sites CG 10 3 CNG 76 55 % GC 40 46 *Sequences previously demonstrated to affect stability. In addition to codon‐usage adaptation, we replaced sequences that were demonstrated to reduce transcript stability and reduced the number of putative RNA‐destabilizing sequences ( Table 2 , Narsai , 2007 ; and references therein). We further drastically reduced the number of putative plant near‐up‐stream polyadenylation sequences, predicted plant splicing signals and potential methylation sites ( Table 2 , Hebsgaard , 1996 ; Loke , 2005 ). Finally, the newly designed gene G+C content was higher than that of the native human gene and closer to that of a typical dicotyledonous plant gene (44.9% and 39.7%, respectively). Expression of human BChE in plants The de novo ‐synthesized pBCHE gene was cloned into a plant expression vector that was then used to create transgenic N. benthamiana plants via Agrobacterium ‐mediated transformation. In parallel, we created transgenic plants expressing the native (i.e. non‐plant expression‐optimized) hBCHE gene. Both genes were equipped with endoplasmic reticulum (ER) retention signal SEKDEL that was shown to increase the accumulation levels of recombinant proteins in plants ( Geyer , 2007 ). We screened 76 pBCHE and 130 hBChE independent transgenic plant lines for expression levels of the BChE enzyme. As expected, accumulation of BChE varied substantially among the individual transformants of each construct population with a lognormal distribution ( Geyer , 2007 ). However, overall BChE accumulated to a higher level in plants expressing the plant‐expression‐optimized pBCHE gene (mean ± SEM: 1.84 ± 0.22 U/mg protein; geometric mean [95% CI]: 0.67 [0.41 to 1.08] U/mg protein) than in plants expressing hBCHE (0.33 ± 0.03 U/mg protein; 0.14 [0.10 to 0.18] U/mg protein; see Figure 3 ). In fact, more than a third of the pBCHE plants accumulated the recombinant protein at medium to very high levels, while none of the hBCHE plants we screened accumulated the transgene’s product at these levels and practically all (∼95%) exhibited very low levels. 3 Genetic optimization increases BChE accumulation in plants. Transgenic N. Benthamiana were created via Agrobacterium‐ mediated transformation with binary expression vectors harbouring either the native human DNA sequence of BCHE ( hBCHE ) or the plant‐optimized sequence ( pBChE ). Leaf samples from kanamycin‐resistant independent pBCHE (76) and hBCHE (130) assayed for BChE activity in a modified Ellman assay using butyrylthiocholine as the substrate. Error bars represent the standard deviation from at least two independent determinations. The mean expression levels for each construct among the various lines are indicated by horizontal broken lines. An independent‐samples t ‐test was conducted to compare pBCHE plants (1.84 ± 0.22 U/mg protein; mean ± SEM) to hBCHE plants (0.33 ± 0.03 U/mg protein; t (204) = 8.588, P < 0.0001. Insert shows the distribution histogram of BChE expression levels among the various lines. Plants were grouped as according to their expression level as follows (in U/mg protein): VL‐ expression level X ≤ 1, L‐ 1 < X ≤ 2, M‐ 2 < X ≤ 4, H‐ 4 < X ≤ 8, VH‐ 8 < X. The extremely significant fivefold difference in the mean BChE activity ( t ‐test: t(204) = 6.089, P < 0.001) is also evidenced by the higher maximal value obtained for the pBCHE plant lines (10.1 U/mg protein, when compared to the best expressing hBCHE line at 2.2 U/mg protein). This level of activity represents a very high level of recombinant protein accumulation in transgenic plants: active BChE constituted 1.3% of total soluble protein (TSP). These results are in agreement with our previously published work which reported similar improvement in expression levels for the ‘synaptic’ ( Geyer , 2007 ) and ‘readthrough’ variants of AChE ( Evron , 2007 ). The plant with the highest level of accumulation (hereafter referred to simply as pBCHE ) was clonally propagated for further analyses and for seed production. Both segregation of kanamycin resistance among progeny of selected plants (data not shown) and genomic Southern blot analysis ( Figure 4 ) indicated that this highly expressing line has a single copy of the transgene. 4 DNA blot analysis reveals a single copy of the transgene in the best expressing pBChE line . Total DNA was isolated from the highly expressing pBChE plant line or from wild type plants, and 20‐μg samples were digested by either NcoI (N), HindIII (H) or EcoRI (E). Restriction fragments were resolved by agarose gel electrophoresis, transferred to nylon membrane and hybridized with a probe spanning sequence around the border between the 5′‐UTR and the coding region ( Figure 7 ). A single transgene copy is suggested by the generation of a unique fragment by the three different restriction enzymes. Purification of pBChE Purification of pBChE was performed by mechanical extraction of the soluble protein fraction from leaves of transgenic plants followed by ammonium sulphate fractionation and two in‐tandem affinity chromatography steps ( Table 3 ). Ammonium sulphate fractionation was conducted at pH 4.0 to facilitate the removal of the major protein constituent of the extract—the enzyme RuBisCO. The first chromatography step with Concanavalin A‐sepharose resin provided 6.8‐fold purification presumably by the interaction of the lectin with the abundant high‐mannose glycans decorating the ER‐retained pBChE. Final polishing with procainamide affinity chromatography removed essentially all of the remaining contaminants. Based on SDS‐PAGE and silver staining (data not shown), our purification procedure yielded a pure product with a specific activity of 765.5 U/mg, comparable to the purity of the enzyme obtained from human plasma ( Grunwald , 1997 ). 3 Purification of pBChE Purification Step Volume (mL) Activity (U) Yield (%) Sp. Activity (U/mg TSP) Purification (fold) Plant material—18 kg (fresh weight) Crude extract 13 500 170 584 100 7.8 1 30%–70% (NH 4 ) 2 SO 4 fraction 700 93 996 55 94.8 12.2 ConA sepharose 4B column 4.5 47 127 28 646.6 83.1 Procainamide column 2.25 21 510 13 765.5 98.4 Molecular forms of pBChE Human BChE is a glycoprotein existing in serum mostly as a homotetramer and is secreted via the ER‐Golgi secretory system. Proper folding is achieved only during passage through the ER and therefore depends on signal peptide‐mediated translocation into the ER and subsequent removal of the signal peptide. To determine whether that is the case also for plant‐derived pBChE, N‐terminal sequencing by Edman degradation was undertaken on highly pure preparations of pBChE. However, the N‐terminus of the protein appeared to be blocked, and we therefore turned to mass spectrometry analysis of trypsin fragments. This enabled us to identify the fragment matching to the N‐terminal region of the mature protein (.EDDIIIATKNGK.). We did not identify any fragments corresponding to upstream sequences belonging to the protein’s signal peptide, suggesting efficient and complete cleavage (data not shown). The electrophoretic mobilities of the plant‐derived recombinant protein and its plasma‐derived counterpart were compared ( Figure 5 ). Crude protein extracts of wild type and transgenic plants were resolved by SDS‐PAGE, revealing a unique protein band that was present only in the latter. The apparent molecular mass of the protein was ∼70 kDal, less than that of the plasma‐derived protein (∼85 kDal) but more than the expected mass of the mature protein (64 kDal). Further, immunoblotting revealed that the protein band seen on the stained gel actually consisted of two different closely migrating proteins masked by co‐migrating endogenous plant proteins in the stained gel. We estimate that the molecular masses of these two isoforms of pBChE were 68 kDal and 75 kDal. 5 pBChE has greater electrophoretic mobility than its human‐derived counterpart. (a) Samples of total soluble protein extracts (0.5 μg) from wild type plants (lane 1) or pBCHE transgenic (lane 2) plants and of a crude preparation of human plasma‐derived BChE (5 μg, Sigma, lane 3) were resolved by SDS‐PAGE, stained by silver stain (lane 1, 2) or coomassie brilliant blue (lane 3). Arrow heads point to the band corresponding to pBChE or human BChE. (b) Alternatively, proteins resolved by SDS‐PAGE were transferred to a polyvinylidenedifluoride membrane, immunodecorated by an anti‐human BChE antibody followed by HRP‐conjugated secondary antibody and visualized by chemiluminescence. (c) Samples of human plasma‐derived BChE (1 μg, lane 1) and plant‐derived pBChE (0.25, 0.5, 0.75 and 1 μg, lanes 2–5, respectively) were resolved by gel electrophoresis under non‐denaturing conditions. Gels were then stained by the method of Karnovsky and Roots as previously described ( Mor , 2001 ). Positions of high molecular mass forms of the enzyme (presumably tetramers) and low molecular mass form (presumably monomers) are indicated. When the plasma‐derived enzyme was resolved by non‐denaturing gel, most of the protein retained its tetrameric structure, although some lower molecular mass forms (potentially dimers and monomers) were also detected ( Figure 5c ). Similarly, pBChE mostly migrated as a broad band with mobility slightly lower than that of its plasma‐derived counterpart, implying a lower charge to mass ratio for the former. The differences in apparent molecular mass of the proteins imply different post‐translational modifications, because the predicted protein sequence for both should be identical except for the ER retention hexapeptide signal (absent from the plasma‐derived enzyme). Without conclusively excluding other explanations, differential N‐linked glycosylation is a likely post‐translational modification accounting for the distinct molecular mass forms. To test this possibility, pure preparations of pBChE and plasma‐derived hBChE were subjected to deglycosylation either chemically with the superacid trifluoromethanesulfonic acid (TFMSA) or with one of two N ‐linked glycan‐specific endoglycosidases, peptide N‐glycosidase F (PNGase F) and endoglycosidase H (Endo H). While Endo H mediates the selective removal of N ‐linked high‐mannose or hybrid glycans, PNGase F can also remove most Endo H‐resistant complex glycans. The treated proteins (and untreated controls) were then resolved by SDS‐PAGE and subjected to concanavalin A (ConA) blot analysis ( Figure 6 ). ConA can detect glucose and mannose residues on N ‐linked glycans. 6 pBChE bears high‐mannose glycans. Pure preparations of pBCHE and plasma‐derived hBCHE were subjected as indicated to deglycosylation either by endoglycosydase digestion with Endo H or PNGase F, chemically by the superacid trifluoromethanesulfonic acid, or left untreated. Proteins were then resolved SDS‐PAGE and blotted onto a nitrocellulose membrane. Membrane was decorated with HRP‐conjugated Con‐A and developed by ECL. Compatible with our use of ConA for affinity purification of the plant‐derived enzyme, the lectin decorated the control sample of pBChE as well as that of its plasma‐derived counterpart ( Figure 6 ). While hBChE was fully resistant to Endo H treatment, its digestion with PNGase F resulted in complete stripping of the glycans off the protein ( Figure 6 ). These results are indicative of complex glycosylation of this human plasma‐derived enzyme. In contrast, treatment of pBChE with Endo H resulted in efficient but incomplete deglycosylation suggesting the presence of high‐mannose or hybrid glycans ( Figure 6 ). The fact that the plant‐derived protein was refractory to the PNGase F treatment ( Figure 6 ) is further suggestive of the presence of core α(1,3)‐fucose on most of its glycans, as such structures are known to hinder hydrolysis by PNGase F ( Tretter , 1991 ). Finally, chemical deglycosylation was efficient in removing the glycans off pBChE ( Figure 6 ). Which (and how many) of the nine potential glycosylation sites on human BChE are occupied is not yet known, but the difference in size between the two enzymes suggests that fewer sites are occupied in pBChE. Enzymatic properties of pBChE The hydrolytic activity of pBChE towards butyrylthiocholine and the enzyme’s sensitivity to several cholinesterase inhibitors were tested in vitro in comparison with highly pure preparations of human plasma‐derived BChE ( Table 4 ). The affinities of the enzymes from either source to both substrate (i.e. the K M ) and inhibitors (i.e. the IC 50 values) are practically identical. The values we report here fall well within the range of those previously reported in the literature where considerable variability and lack of consensus exist ( Table 4 ). 4 Substrate hydrolysis by pBChE and its sensitivity to various inhibitors pBChE Plasma hBChE This Work Literature Substrate: K M (μ m ) butyrylthiocholine 147 ± 24 146 ± 26 20 * ; 50 † ; 2200 ‡ Inhibitors: LogIC 50 Neostigmine −8.16 ± 0.06 −7.93 ± 0.08 −6.7 § Paraoxon ¶ −7.48 ± 0.06 −7.45 ± 0.08 −8.1 ** DFP †† −8.49 ± 0.06 −8.36 ± 0.03 −9.7 § ; −7.7 ‡ *Lockridge et al. (1997). † Kaplan (2001) . ‡ Gnatt (1994) . § Atack (1989) . ¶ O,O ‐Diethyl O ‐(4‐nitrophenyl) phosphate. ** Petroianu (2005) . †† Diisopropyl phosphorofluoridate. Plant‐derived BChE protects mice against OP challenge The above‐recounted results demonstrate the ability of pBChE to sequester OP anticholinesterases in vitro and prompted us to test whether pBChE can prophylactically protect animals against OP challenge in a mouse model of OP toxicity. Treatment with 1.1LD50 of paraoxon (750 μg/kg) was lethal in 100% of tested animals. In contrast, prophylactic administration of pBChE (42–62 mg/kg) fully protected the mice with no observable symptoms against a subsequent challenge. Discussion The search for prophylactic and therapeutic antidotes for nerve agent poisoning has evolved from small molecule agents (atropine, pralidoxime, diazepam) that simply mitigate mortality, to a search for true prophylactic agents which would maintain the patient fully cognizant and capable of performing appropriate duties such as those of a solider or a first‐responder. In the decades since ‘cholinesterase therapy’ was first proposed, we have gained an appreciation for the challenges inherent to this model. As a novel solution, we looked to plant production of BChE. In this work, we have demonstrated the feasibility of producing this tetrameric glycoprotein in plants and have further demonstrated the ability of plant‐derived BChE to sequester OP toxins both in vitro and in vivo providing protection from otherwise lethal doses of such toxins. Owing to the unfavourable expression levels of other native human cDNAs in heterologous systems, we hypothesized that removal of deleterious sequences such as cryptic introns, potential splice sites and RNA PolII termination sites in addition to codon optimization for dicotyledonous plants would enhance protein accumulation in transgenic plants system ( Figures 1, 2 and 7 , Tables 1, 2 and 5 ). Indeed, transgenic N. benthamiana plants that harboured and expressed the optimized pBCHE gene accumulated the BChE enzyme to fivefold higher levels when compared to control plants that expressed hBCHE , the human cDNA ( Figure 3 ). Similarly to our previous work with N. benthamiana ‐produced AChE ( Geyer , 2007 ), both variants of BChE‐expressing stable lines, human and plant‐optimized, displayed lognormal distribution of transgene product with maximal expression levels exceeding 1% of TSP. 7 Construction of vectors for the expression of hBCHE and pBCHE . (a) De novo synthesis of pBCHE . 1. The sequence of hBCHE was modified as described in details in the text to exclude various deleterious signals and to conform the codon preference to that of highly expressed plant genes to yield pBCHE . 2. Seventy‐five oligonucleotides corresponding to the dsDNA sequence of pBCHE were designed, so each half of any forward oligonucleotides would be complementary to two adjacent reverse oligonucleotides and vice versa . The oligonucleotides varied in length (41–65 bases) so the melting temperature of all complementary sections would be 60 ± 2 °C. 3. During the first round of PCR, low levels of correctly assembled oligonucleotides form a template for a second round of PCR. 4. During that second round, the entire gene was amplified. 5. The PCR fragment is then cloned and its sequence verified. (b) Plant expression cassettes for the human BCHE gene and its plant‐expression‐optimized counterpart ( hBCHE and pBCHE, respectively). 35S, the cauliflower mosaic virus 35S promoter (with duplicated enhancer); TEV, 5′‐UTR of the tobacco etch virus transcript; VSP, 3′‐UTR of the soybean vegetative storage protein gene, vspB. 5 Oligonucleotides used as primers in this study # Name 5′ Sequence 3′ 1 oTM191 ATGTCGACGAGCTCTTAGAGTTCATCCTTCTCAGAGAGACCCACACAACTTTCTTTC 2 oTM204 ATAAGCTTCCATGGGACATAGCAAAGTCACAATCATATGC 3 oTM207 GCACGGTAACAGCCTTTCTTGGGATTCCCTATGCACAGCCACC 4 oTM208 GGTGGCTGTGCATAGGGAATCCCAAGAAAGGCTGTTACCGTGC 5 oTM209 CAAAGTTTTCCAGGCTTCCACGGATCAGAGATGTGGAACCC 6 oTM210 GGGTTCCACATCTCTGATCCGTGGAAGCCTGGAAAACTTTG During the last couple of decades, the art of optimizing gene sequence for expression in foreign hosts has gained a firmer scientific footing that was based primarily on genome‐wide analyses of various parameters affecting transcription and post‐transcriptional events, including splicing, polyadenylation and transcript turnover ( Hebsgaard , 1996 ; Loke , 2005 ; Narsai , 2007 ). Similar high throughput analyses of synonymous codon bias suggested a role for natural selection on translation efficiency in shaping the codon bias in a given genome ( Kanaya , 2001 ; Ingvarsson, 2008 ; Mukhopadhyay , 2008 ; dos Reis and Wernisch, 2009 ). Specifically, it is generally well accepted that in dicotyledonous plants like Arabidopsis thaliana (and by extension Nicotiana species), there exists positive correlation between synonymous codon usage and iso‐accepting tRNA copy numbers, resulting in optimization of translation efficiency, particularly in the case of highly expressed constitutive genes ( Mukhopadhyay , 2008 ). Interestingly, the long‐held assertion regarding the positive correlation between synonymous codon bias and translation efficiency, first identified in Escherichia coli ( Ikemura, 1985 ), was recently challenged by Kudla (2009) . They argued that ‘codon bias did not correlate with gene expression’ and that the most relevant attributes contributing to high‐level expression are secondary structures near the initiatory AUG (2009). Without diminishing the importance of the 5′ region of the coding sequence, our analyses here and in published work of ours and others (e.g. Murray , 1989 ; Geyer , 2007 ; Liu, 2009 ), adapting the codon usage of the foreign gene to that of the host’s highly expressed genes, seems to us to be a major contributing, even critical, factor affecting the accumulation of (foreign) proteins in plants. The often‐used approach for codon optimization calls for conforming the codon usage of the transgene to that of the overall codon usage of the particular species often taken from the extensive Codon Usage Database (, e.g. Liu, 2009; Cai et al., 2008; Maclean et al., 2007; Suo et al., 2006). The results with this approach are often disappointing (e.g. Suo , 2006 ; Maclean , 2007 ). In contrast, we base our analysis on the codon usage of a select set of highly expressed genes with abundant protein products. In fact, CAI values calculated based on the codon bias of highly expressed genes better correlate with expression levels when compared to values calculated based on genome‐side codon usage. For example, based on the overall codon usage, the calculated CAI values are similar and rather high for both the poorly performing human BChE sequence (0.80) and the optimized synthetic gene (0.85). In contrast, as we show here, the CAI values calculated based on our highly expressed gene standard are better predictors of the two genes’ in planta performance at 0.60 and 0.83. In our approach, we pay a particular attention to eliminate consecutive stretches of unfavourable codons (unless present in the context of the source organism), which simply looking at the overall CAI may obscure. For example, a synthetic gene encoding the human papiloma virus L1 protein by Maclean (2007) , which was designed based on the overall codon usage of dicotyledonous plants, has a relatively high CAI when analysed using our set of standard genes (0.79), shrouding several long stretches of unpreferred codons. This may explain the poor performance of this ‘codon‐optimized’ transgene ( Maclean , 2007 ). An additional tenant of our strategy aims at greatly reducing the presence of unpreferred codons rather than using the single most preferred codon for every amino acid (so called ‘CAI = 1’ strategy, Cai , 2008 ). In our experience, the ‘CAI = 1’ strategy yielded particularly poor results with fewer transgenic events, which were often silenced or otherwise were characterized by very poor expression (data not shown). This is, perhaps, not surprising as the high demand for just few tRNA species may pose an unsustainable burden on synthesis of important cellular proteins. Our analysis ( Figure 5 , Table 4 ) demonstrated that pBChE shows very similar, if not identical, enzymatic properties when compared to the human serum BChE (as reported in the literature). It is unclear at this stage whether the differences noted in the affinity of the enzyme to some of the tested inhibitors point to some structural/functional attributes unique to the plant‐produced enzyme (for example, the differential glycosylation or the presence of the hexapeptide ER‐retention signal). However, it is important to note that there is an even bigger variance among the values for the human plasma‐derived enzyme as reported in the literature (e.g. Gnatt , 1994 ; Lockridge et al., 1997 ; Kaplan , 2001 ). This sizeable variance reflects, most probably, the differences in the way the assays were conducted, the source and purity of the enzymes and the reagents. As expected, producing BChE in plants resulted in a glycosylated enzyme. The differences in apparent molecular mass between pBChE and the plasma‐derived enzyme belie molecular differences which we partially attribute to N‐linked glycosylation that results in glycans that are distinct from the terminally sialylated glycans present on human serum BChE ( Gomord and Faye, 2004 ; Saint‐Jore‐Dupas , 2007 ). Previous work has indicated that high mannose type glycosylation predominates among ER‐retained N. benthamiana ‐produced proteins ( Matoba , 2009 ). Our data here suggest a somewhat more complicated picture regarding pBChE. While most of the oligosaccharides on the protein appear to be Endo H‐sensitive, hence suggesting they are of high mannose type, predicting their a‐priori sensitivity to PNGase F. However, the glycans seem to be resistant to PNGase F, strongly suggestive of the presence of core α(1,3)‐fucose residues ( Tretter , 1991 ). The escape of proteins equipped with the KDEL ER‐retention signal from the ER and their progress down the secretory pathway are intriguing, but not unheard of and will require further study ( Petruccelli , 2006 ). Differential glycosylation may explain the somewhat smaller charge to mass ratio observed in the plant‐derived enzyme when compared to its plasma‐derived counterpart, the glycans of which mostly carry negatively charged sialic acids as their terminal residues ( Hermentin , 1996 ). In turn, surface‐charge differences may contribute to the small differences in the enzymatic properties of plant‐derived and plasma BChE. More surprising was our finding that neither the presence of a C‐terminal SEKDEL sequence nor that of plant‐specific glycans compromised tetramerization of the enzyme. The oligomeric structure of BChE is that of a dimer of dimers. Each dimer consists of two monomeric subunits covalently attached to each other through a C‐terminal disulfide bridge. Tetramerization is then achieved through association of the dimers, mediated by conserved tryptophan amphiphilic tetramerization (WAT) domains of the C‐terminal peptides with a polyproline II helix. The proline‐rich attachment domain (PRAD) of Collagen Q serves as such a tetramerization pivot for the localization of both BChE and AChE in the basal lamina at the neuromuscular junction ( Bon , 2003 ; Lee , 2004 ). The PRiMA protein fulfils a similar function not only in peripheral synapses but also in the central nervous system ( Perrier , 2002 ). Polyproline peptides (such as co‐expressed PRAD peptide) increase the tetramerization of secreted recombinant BChE expressed in mammalian cells ( Duysen , 2002 ). The natural polyproline peptides responsible for the tetramerization of serum BChE were only recently identified by Lockridge and co‐workers as derivatives of the protein lamellipodin ( Li , 2008 ). Plants harbour a fair number of proline‐rich proteins that play critical roles, among others, in cell wall integrity and biogenesis ( Cannon , 2008 ) and plant defence responses. In some cases, poly‐proline peptides are derived by proteolysis from precursor proteins ( Pearce , 2007 ; Chen , 2008 ). A plausible speculation is that such proteins/peptides associate with the WAT domain of the recombinant pBChE promoting the association of the proteins into tetramers. Interestingly, only a minor fraction of recombinant human BChE produced in the milk of transgenic goats appears as stable tetramers ( Huang , 2007 ). A more detailed analysis of the oligomeric structure of plant‐derived human BChE is underway as are further pre‐clinical experiments to test the efficacy of pBChE against OP challenge. Experimental procedures Analyses of codon usage bias, presence of spurious RNA processing and destabilization signals and GC content Codon usage bias in genes encoding highly expressed proteins of dicotyledonous plants was assessed according to Sharp and Li (1987) . The reference set included cDNAs encoding the small subunit 1B of RuBisCO, chlorophyll A/B binding protein 2, ribosomal protein L1 and L2, 40S ribosomal protein S2, S3 and S4 (accession nos. NM_123204 , NM_102733 , NM_202757 , NM_201956 NM_115247 , NM_115247 and NM_125228 , respectively) of the model plant Arabidopsis thaliana . Table 1 lists the codon frequencies of the reference set (from the Codon Usage Database. See Nakamura, 2005 ). The relative synonymous codon usage (RSCU = observed frequency/unbiased frequency), the relative adaptiveness of a codon ( w , RSCU normalized to the most abundant synonymous codon for an amino acid, Table 1 ) and the codon adaptation index (CAI, geometric mean of w values over the entire length of the gene) values were calculated according to Sharp and Li (1987) . Unfavourable (or infrequently used) codons were defined here as codons with w < 0.5. Our codon bias analysis corresponds very well with a recently published analysis ( Mukhopadhyay , 2008 ). Putative RNA‐destabilizing sequences were analysed through a genome‐wide in silico study by Narsai (2007) , but only few such sequences were positively identified in planta , including the AU‐rich elements, AUUUA, AUAGAU and UUUUUU ( Table 2 , Feldbrugge , 2002 ; Narsai , 2007 ; Ohme‐Takagi , 1993 ). Table 2 also lists potential polyadenylation signals that were identified according to Loke (2005) and potential splicing signals that were recognized using the NetGene2 Server (, Hebsgaard , 1996 ). Construction of plant expression vectors for human BChE We used Expand High Fidelity PCR kit (Roche, Indianapolis, IN, USA) to amplify DNA fragments for cloning and QuickChange kit (Stratagene, Cedar Creek, TX, USA) for site‐directed mutagenesis. Coding region of each construct was sequence‐verified after every cloning step. The cDNA of human BChE (Genbank # NM_000055 , Prody , 1987 ) was PCR amplified from pSP 64 ‐ϕChE ( Soreq , 1989 ) using the primers oTM191 and oTM204 (see Table 5 for primers used in these studies) and cloned into pTOPO‐TA (Invitrogen, Carlsbad, CA, USA) to yield pTM293. To facilitate later cloning steps, a Sac I site was added at 3′‐end and an Nco I site was added at the 5′‐end (the latter necessitated an insertion of a Gly residue immediately following the initiatory Met). The ER retention hexapeptide SEKDEL was fused at the carboxyl‐terminus. Sequential site‐directed mutagenesis was performed to remove the internal Nco I and EcoRI and sites within the gene utilizing primers oTM209 and oTM210 (for the removal of Nco I) and then oTM207 and oTM208 (for removal of Eco RI referred to as hBCHE to yield pTM306 and finally pTM302. A synthetic gene encoding for the same amino acid sequence of hBChE was designed to improve the mRNA’s post‐transcriptional stability, processing accuracy and translatability by excluding various deleterious signals and conforming the codon preference to that of highly expressed plant genes ( Tables 1 and 2 , Figure 1 \Geyer, 2007 #3813). The gene, pBCHE , was constructed by de novo synthesis ( Figure 7 ) as was previously described in detail for another gene ( Geyer , 2007 ) and was cloned into pCMV3.1 to yield pTM298. Nco I ‐Sac I fragments encompassing the coding regions of hBCHE and pBCHE were (separately) cloned into an expression cassette consisting of the 35S CaMV promoter, the 5′ UTR of tobacco etch virus (TEV leader) and the 3′ UTR of soybean’s vspB gene (VSP terminator) by replacing the corresponding fragment in pTM034 ( Mor , 2001 ) to yield pTM318 and pTM303, respectively. The expression cassettes ( HindIII — EcoRI fragment) were then cloned into the pGPTV‐Kan plant expression vector to yield pTM322 and pTM307 ( Figure 7 , Becker , 1992 ). Agrobacterium tumefaciens ‐mediated transformation of N. benthamiana was as previously described ( Geyer , 2007 ; Matoba , 2009 ). The pBCHE plant line accumulating the highest level of enzymatic activity of the protein product (see below) was selected for propagation, seed production and further analysis. Purification of recombinant human BChE from transgenic plants Purification of plant‐derived BChE (pBChE) from N. benthamiana leaf material was as described, with modifications ( Geyer , 2005 ). Briefly, juice from leaves of 8 to 11‐week‐old transgenic plants was extracted by passing through a Green Power GB‐9001 Juicer (Samson Life, Danbury, CT, USA). Sodium metabisufite was added to the juice (final concentration 150 m m ). Pulp was discarded and juice was clarified by centrifugation at 22 000 g for 15 min and filtration through miracloth. The pH of the supernatant was lowered to 4.0 with 1 N HCl and subjected to ammonium sulphate fractionation. The 30%–70% fraction was collected by centrifugation at 22 000 g , for 30 min, re‐suspended in 0.125× PBS buffer, pH 7.4, dialysed against the same buffer overnight and concentrated by microsep 30 000 MWCO omega centrifugal devices (Pall corporation, East Hills, NY, USA). The concentrated preparation was then subjected to two in‐tandem steps of affinity chromatography. First, the sample (700 mL at 1.42 mg protein/mL) was adsorbed to Concanavalin A‐Sepharose 4B resin (ConA; GE Healthcare, Piscataway, NJ, USA) previously equilibrated with 20 m m NaH 2 PO 4 /Na 2 HPO 4 (NaPi) buffer, pH 8.0, containing 500 m m sodium chloride. Unbound pBChE and other contaminating proteins were removed by washing the column with 15 column volume (CV) of the equilibration buffer. Bound pBChE was batch‐eluted from the resin in successive steps with elution buffer 1 (20 m m NaPi buffer, pH 8.0, 500 m m NaCl and 100 m m methyl‐α‐D‐glucopyranoside), elution buffer 2 (20 m m NaPi buffer, pH 4.5, 500 m m NaCl and 100 m m methyl‐α‐D‐glucopyranoside), elution buffer 3 (20 m m NaPi buffer, pH 8.0, 500 m m NaCl, 500 m m methyl‐α‐D‐glucopyranoside and 100 m m methyl‐α‐D‐mannopyranoside) and elution buffer 4 (20 m m NaPi buffer, pH 4.5, 500 m m NaCl, 500 m m methyl‐α‐D‐glucopyranoside and 100 m m methyl‐α‐D‐mannopyranoside). The resin was incubated while mixing for 30 min (buffer 1 and 2) or 60 min (buffer 3 and 4). Additional elution steps under more stringent conditions and longer incubation yielded more enzyme but not enough to justify the longer procedure. Eluted fractions containing pBChE were pooled and dialysed overnight against 0.125× PBS buffer, pH 7.4 and concentrated as described above. These highly enriched ConA‐pBChE preparations were further purified using procanamide‐agarose gel custom resin (Sigma, St. Louis, MO, USA) by adsorbing it (4.5 mL at 12 mg protein/mL) to the pre‐equilibrated resin (20 m m NaPi buffer, pH 8.0). The column was washed with 10 CV of the same buffer to remove non‐specifically bound contaminants. The tightly bound pBChE was eluted (batch wise) with equilibration buffer consecutively supplemented with 100 m m NaCl (1), 1 m NaCl (2), 100 m m NaCl and 200 m m procanamide‐HCl (3), 500 m m NaCl and 200 m m procanamide‐HCl (4), and finally with 1 m NaCl and 500 m m procanamide‐HCl (5). Eluate 1 and pooled eluates 2–5 were dialysed overnight against 0.125× phosphate‐buffered saline, pH 7.4, and concentrated. Purified plant‐derived pBChE was kept in 0.125× phosphate‐buffered saline, pH 7.4 with 0.02% azide at 4 °C for up to 6 months. Biochemical analyses Protein preparations were resolved by SDS‐PAGE on 8% gels and were either stained with GelCode SilverSNAP Stain Kit II (Pierce, Rockford, IL, USA), Coomassie brilliant blue, or transferred to a polyvinylidenedifluoride (PVDF) membrane and immune‐decorated with rabbit polyclonal anti‐hBChE Abs (the generous gift of Oksana Lockridge, University of Nebraska Medical Center). Horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit IgGs (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and the ECL‐plus kit (Amersham, Piscataway, NJ, USA) were used for detection. Total soluble protein (TSP) was determined as described ( Mor , 2001 ). Protein resolution by non‐denaturing PAGE (10%) and detection of BChE activity in the gels (with butyrylthiocholine as substrate) were previously described. Endoglycosidase digestions were performed according to the manufacturer’s protocols (New England Biolabs, Ipswich, MA, USA). Purified preparations (10 μg) of pBChE and plasma‐derived human BChE (the kind gift of David Lenz and Douglas Cerasoli, US Army Medical Research Institute of Chemical Defense) were denatured in glycoprotein‐denaturing buffer (0.5% SDS, 40 m m DTT) at 100 °C for 10 min. Samples were centrifuged at 13750 g for 1 min, and the supernatant was subjected to digestion with either PNGase F (1000 U) or Endo H (2000 U) at 37 °C for 3 h. Chemical deglycosylation with TFMSA was conducted as follows ( Wang , 1993 ). TFMSA (50 μL, Sigma) and anisole (25 μL, Sigma) were added in this order to a lyophilized sample of pBChE (100 μg) sample in a 3‐mL Pyrex tube on ice. The mixture was further incubated on ice for 3 h and was then neutralized with 125 μL of N‐ethylmorpholine (Sigma). Protein was precipitated by addition of 10 volumes of acetone. The suspension was incubated overnight at −20 °C and then centrifuged for 10 min at 7000 g . Protein pellet was dried under vacuum for ∼30 min and then re‐suspended in 100 μL SDS‐PAGE sample. Deglycosylated and untreated control samples resolved by SDS‐PAGE followed by lectin blot analysis using HRP‐conjugated ConA (New England Biolabs) as previously described ( Matoba , 2009 ). BChE activity was assayed by a modified Ellman assay ( Geyer , 2005, 2007 ) with butyrylthiocholine iodide (BTCh, Sigma) as substrate. Total protein levels were derived as previously described with BSA as standard. The specific activity of pure BChE (∼ 760 U/mg protein, Grunwald , 1997 ) was used for conversion of specific activity data into %TSP. To determine the K M , activity was measured in the presence of varying concentrations of BTCh, the results were plotted and non‐linear regression was applied (GraphPad Prism v 4.0; GraphPad Software, San Diego, CA, USA). IC50 values were determined by fitting Inhibition curves (obtained by performing a modified Ellman assay with 1 m m BTCh in the presence increasing concentrations of inhibitors). The results to the equation Y = BOTTOM + (TOP‐BOTTOM)/(1 + 10^(X ‐ logIC50)) using GraphPad Prism. Statistical analyses Statistical analyses were performed using Prism (GraphPad). Acknowledgements This work was funded in part by the National Institutes of Health CounterACT Program through the National Institute of Neurological Disorders and Stroke under the U‐54‐NSO58183‐01 award—a consortium grant awarded to USAMRICD and contracted to TSM under the research cooperative agreement number W81XWH‐07‐2‐0023. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the federal USA government. References Atack , J.R. , Yu , Q.S. , Soncrant , T.T. , Brossi , A. and Rapoport , S.I. ( 1989 ) Comparative inhibitory effects of various physostigmine analogs against acetyl‐ and butyrylcholinesterases . J. Pharmacol. Exp. Ther. , 249 , 194 – 202 . Becker , D. , Kemper , E. , Schell , J. and Masterson , R. ( 1992 ) New plant binary vectors with selectable markers located proximal to the left T‐DNA border . Plant Mol. Biol. , 20 , 1195 – 1197 . Bon , S. , Ayon , A. , Leroy , J. and Massoulie , J. ( 2003 ) Trimerization domain of the collagen tail of acetylcholinesterase . Neurochem. Res. , 28 , 523 – 535 . Cai , Y. , Sun , J. , Wang , J. , Ding , Y. , Tian , N. , Liao , X. and Xu , W. ( 2008 ) Optimizing the codon usage of synthetic gene with QPSO algorithm . J. Theor. Biol. , 254 , 123 – 127 . Cannon , M.C. , Terneus , K. , Hall , Q. , Tan , L. , Wang , Y. , Wegenhart , B.L. , Chen , L. , Lamport , D.T. , Chen , Y. and Kieliszewski , M.J. ( 2008 ) Self‐assembly of the plant cell wall requires an extensin scaffold . Proc. Natl. Acad. Sci. USA , 105 , 2226 – 2231 . Catano , H.C. , Carranza , E. , Huamani , C. and Hernandez , A.F. ( 2008 ) Plasma cholinesterase levels and health symptoms in peruvian farm workers exposed to organophosphate pesticides . Arch. Environ. Contam. Toxicol. , 55 , 153 – 159 . Chen , Y.C. , Siems , W.F. , Pearce , G. and Ryan , C.A. ( 2008 ) Six peptide wound signals derived from a single precursor protein in Ipomoea batatas leaves activate the expression of the defense gene sporamin . J. Biol. Chem. , 283 , 11469 – 11476 . Doctor , B.P. and Saxena , A. ( 2005 ) Bioscavengers for the protection of humans against organophosphate toxicity . Chem. Biol. Interact. , 157–158 , 167 – 171 . Duysen , E.G. , Bartels , C.F. and Lockridge , O. ( 2002 ) Wild‐Type and A328W mutant human butyrylcholinesterase tetramers expressed in Chinese hamster ovary cells have a 16‐hour half‐life in the circulation and protect mice from cocaine toxicity . J. Pharmacol. Exp. Ther. , 302 , 751 – 758 . Evron , T. , Geyer , B.C. , Cherni , I. , Muralidharan , M. , Kilbourne , J. , Fletcher , S.P. , Soreq , H. and Mor , T.S. ( 2007 ) Plant‐derived human acetylcholinesterase‐R provides protection from lethal organophosphate poisoning and its chronic aftermath . FASEB J. , 21 , 2961 – 2969 . Feldbrugge , M. , Arizti , P. , Sullivan , M.L. , Zamore , P.D. , Belasco , J.G. and Green , P.J. ( 2002 ) Comparative analysis of the plant mRNA‐destabilizing element, DST, in mammalian and tobacco cells . Plant Mol. Biol. , 49 , 215 – 223 . Geyer , B.C. , Muralidharan , M. , Cherni , I. , Doran , J. , Fletcher , S.P. , Evron , T. , Soreq , H. and Mor , T.S. ( 2005 ) Purification of transgenic plant‐derived recombinant human acetylcholinesterase‐R . Chem. Biol. Interact. , 157–158 , 331 – 334 . Geyer , B.C. , Fletcher , S.P. , Griffin , T.A. , Lopker , M.J. , Soreq , H. and Mor , T.S. ( 2007 ) Translational control of recombinant human acetylcholinesterase accumulation in plants . BMC Biotechnol , 7 , 27 . Gnatt , A. , Loewenstein , Y. , Yaron , A. , Schwarz , M. and Soreq , H. ( 1994 ) Site‐directed mutagenesis of active site residues reveals plasticity of human butyrylcholinesterase in substrate and inhibitor interactions . J. Neurochem. , 62 , 749 – 755 . Gomord , V. and Faye , L. ( 2004 ) Posttranslational modification of therapeutic proteins in plants . Curr. Opin. Plant Biol. , 7 , 171 – 181 . Greenfield , R.A. , Brown , B.R. , Hutchins , J.B. , Iandolo , J.J. , Jackson , R. , Slater , L.N. and Bronze , M.S. ( 2002 ) Microbiological, biological, and chemical weapons of warfare and terrorism . Am. J. Med. Sci. , 323 , 326 – 340 . Grunwald , J. , Marcus , D. , Papier , Y. , Raveh , L. , Pittel , Z. and Ashani , Y. ( 1997 ) Large‐scale purification and long‐term stability of human butyrylcholinesterase: a potential bioscavenger drug . J. Biochem. Biophys. Methods , 34 , 123 – 135 . Hebsgaard , S.M. , Korning , P.G. , Tolstrup , N. , Engelbrecht , J. , Rouze , P. and Brunak , S. ( 1996 ) Splice site prediction in Arabidopsis thaliana pre‐mRNA by combining local and global sequence information . Nucleic Acids Res. , 24 , 3439 – 3452 . Hermentin , P. , Witzel , R. , Kanzy , E.J. , Diderrich , G. , Hoffmann , D. , Metzner , H. , Vorlop , J. and Haupt , H. ( 1996 ) The hypothetical N‐glycan charge: a number that characterizes protein glycosylation . Glycobiology , 6 , 217 – 230 . Huang , Y.J. , Huang , Y. , Baldassarre , H. , Wang , B. , Lazaris , A. , Leduc , M. , Bilodeau , A.S. , Bellemare , A. , Cote , M. , Herskovits , P. , Touati , M. , Turcotte , C. , Valeanu , L. , Lemee , N. , Wilgus , H. , Begin , I. , Bhatia , B. , Rao , K. , Neveu , N. , Brochu , E. , Pierson , J. , Hockley , D.K. , Cerasoli , D.M. , Lenz , D.E. , Karatzas , C.N. and Langermann , S. ( 2007 ) Recombinant human butyrylcholinesterase from milk of transgenic animals to protect against organophosphate poisoning . Proc. Natl. Acad. Sci. USA , 104 , 13603 – 13608 . Ikemura , T. ( 1985 ) Codon usage and tRNA content in unicellular and multicellular organisms . Mol. Biol. Evol. , 2 , 13 – 34 . Ingvarsson , P.K. ( 2008 ) Molecular evolution of synonymous codon usage in Populus . BMC Evol Biol. , 8 , 307 . Jintana , S. , Sming , K. , Krongtong , Y. and Thanyachai , S. ( 2009 ) Cholinesterase activity, pesticide exposure and health impact in a population exposed to organophosphates . Int Arch Occup Environ Health , 82 , 833 – 842 . Johnson , N.H. , Larsen , J.C. and Meek , E. ( 2009 ) Historical Perspective of Chemical Warfare Agents . In Handbook of Toxicology of Chemical Warfare Agents ( Ramesh , C.G. , ed.), pp. 7 – 16 , San Diego: Academic Press . Kanaya , S. , Yamada , Y. , Kinouchi , M. , Kudo , Y. and Ikemura , T. ( 2001 ) Codon usage and tRNA genes in eukaryotes: correlation of codon usage diversity with translation efficiency and with CG‐dinucleotide usage as assessed by multivariate analysis . J. Mol. Evol. , 53 , 290 – 298 . Kaplan , D. , Ordentlich , A. , Barak , D. , Ariel , N. , Kronman , C. , Velan , B. and Shafferman , A. ( 2001 ) Does “butyrylization” of acetylcholinesterase through substitution of the six divergent aromatic amino acids in the active center gorge generate an enzyme mimic of butyrylcholinesterase? Biochemistry , 40 , 7433 – 7445 . Komar , A.A. ( 2009 ) A pause for thought along the co‐translational folding pathway . Trends Biochem. Sci. , 34 , 16 – 24 . Kudla , G. , Murray , A.W. , Tollervey , D. and Plotkin , J.B. ( 2009 ) Coding‐sequence determinants of gene expression in Escherichia coli . Science , 324 , 255 – 258 . Lee , E.C. ( 2003 ) Clinical manifestations of sarin nerve gas exposure . JAMA , 290 , 659 – 662 . Lee , H.H. , Choi , R.C. , Ting , A.K. , Siow , N.L. , Jiang , J.X. , Massoulie , J. and Tsim , K.W. ( 2004 ) Transcriptional regulation of acetylcholinesterase‐associated collagen ColQ: differential expression in fast and slow twitch muscle fibers is driven by distinct promoters . J. Biol. Chem. , 279 , 27098 – 27107 . Li , H. , Schopfer , L.M. , Masson , P. and Lockridge , O. ( 2008 ) Lamellipodin proline rich peptides associated with native plasma butyrylcholinesterase tetramers . Biochem. J. , 411 , 425 – 432 . Liu , D. ( 2009 ) Design of gene constructs for transgenic maize . Methods Mol. Biol. , 526 , 3 – 20 . Lockridge , O. , Blong , R.M. , Masson , P. , Froment , M.T. , Millard , C.B. and Broomfield , C.A. ( 1997 ) A single amino acid substitution, Gly117His, confers phosphotriesterase (organophosphorus acid anhydride hydrolase) activity on human butyrylcholinesterase . Biochemistry , 36 , 786 – 795 . Loke , J.C. , Stahlberg , E.A. , Strenski , D.G. , Haas , B.J. , Wood , P.C. and Li , Q.Q. ( 2005 ) Compilation of mRNA polyadenylation signals in Arabidopsis revealed a new signal element and potential secondary structures . Plant Physiol. , 138 , 1457 – 1468 . Maclean , J. , Koekemoer , M. , Olivier , A.J. , Stewart , D. , Hitzeroth II , Rademacher , T. , Fischer , R. , Williamson , A.L. and Rybicki , E.P. ( 2007 ) Optimization of human papillomavirus type 16 (HPV‐16) L1 expression in plants: comparison of the suitability of different HPV‐16 L1 gene variants and different cell‐compartment localization . J. Gen. Virol. , 88 , 1460 – 1469 . Matoba , N. , Kajiura , H. , Cherni , I. , Doran , J.D. , Alfsen , A. , Bomsel , M. , Fujiyama , K. and Mor , T.S. ( 2009 ) Biochemical and immunological characterization of the plant‐derived candidate HIV‐1 mucosal vaccine CTB MPR 649 684 . Plant Biotechnol. J. , 7 , 129 – 145 . Mor , T.S. , Sternfeld , M. , Soreq , H. , Arntzen , C.J. and Mason , H.S. ( 2001 ) Expression of recombinant human acetylcholinesterase in transgenic tomato plants . Biotechnol Bioeng , 75 , 259 – 266 . Mukhopadhyay , P. , Basak , S. and Ghosh , T.C. ( 2008 ) Differential selective constraints shaping codon usage pattern of housekeeping and tissue‐specific homologous genes of rice and arabidopsis . DNA Res. , 15 , 347 – 356 . Murray , E.E. , Lotzer , J. and Eberle , M. ( 1989 ) Codon usage in plant genes . Nucleic Acids Res. , 17 , 477 – 498 . Nakamura , Y. ( 2005 ) Codon Usage Database . Narsai , R. , Howell , K.A. , Millar , A.H. , O’Toole , N. , Small , I. and Whelan , J. ( 2007 ) Genome‐wide analysis of mRNA decay rates and their determinants in Arabidopsis thaliana . Plant Cell , 19 , 3418 – 3436 . Ohme‐Takagi , M. , Taylor , C.B. , Newman , T.C. and Green , P.J. ( 1993 ) The effect of sequences with high AU content on mRNA stability in tobacco . Proc. Natl. Acad. Sci. USA , 90 , 11811 – 11815 . Pearce , G. , Siems , W.F. , Bhattacharya , R. , Chen , Y.C. and Ryan , C.A. ( 2007 ) Three hydroxyproline‐rich glycopeptides derived from a single petunia polyprotein precursor activate defensin I, a pathogen defense response gene . J. Biol. Chem. , 282 , 17777 – 17784 . Perrier , A.L. , Massoulie , J. and Krejci , E. ( 2002 ) PRiMA: the membrane anchor of acetylcholinesterase in the brain . Neuron , 33 , 275 – 285 . Petroianu , G.A. , Arafat , K. , Schmitt , A. and Hasan , M.Y. ( 2005 ) Weak inhibitors protect cholinesterases from strong inhibitors (paraoxon): in vitro effect of ranitidine . J. Appl. Toxicol. , 25 , 60 – 67 . Petruccelli , S. , Otegui , M.S. , Lareu , F. , Tran Dinh , O. , Fitchette , A.C. , Circosta , A. , Rumbo , M. , Bardor , M. , Carcamo , R. , Gomord , V. and Beachy , R.N. ( 2006 ) A KDEL‐tagged monoclonal antibody is efficiently retained in the endoplasmic reticulum in leaves, but is both partially secreted and sorted to protein storage vacuoles in seeds . Plant Biotechnol. J. , 4 , 511 – 527 . Prody , C.A. , Zevin‐Sonkin , D. , Gnatt , A. , Goldberg , O. and Soreq , H. ( 1987 ) Isolation and characterization of full‐length cDNA clones coding for cholinesterase from fetal human tissues . Proc. Natl Acad. Sci. USA , 84 , 3555 – 3559 . Ray , D.E. and Richards , P.G. ( 2001 ) The potential for toxic effects of chronic, low‐dose exposure to organophosphates . Toxicol. Lett. , 120 , 343 – 351 . Dos Reis , M. and Wernisch , L. ( 2009 ) Estimating translational selection in eukaryotic genomes . Mol. Biol. Evol. , 26 , 451 – 461 . Rosano , G.L. and Ceccarelli , E.A. ( 2009 ) Rare codon content affects the solubility of recombinant proteins in a codon bias‐adjusted Escherichia coli strain . Microb Cell Fact , 8 , 41 . Saint‐Jore‐Dupas , C. , Faye , L. and Gomord , V. ( 2007 ) From planta to pharma with glycosylation in the toolbox . Trends Biotechnol , 25 , 317 – 323 . Saxena , A. , Sun , W. , Luo , C. , Myers , T.M. , Koplovitz , I. , Lenz , D.E. and Doctor , B.P. ( 2006 ) Bioscavenger for protection from toxicity of organophosphorus compounds . J. Mol. Neurosci. , 30 , 145 – 148 . Sharp , P.M. and Li , W.H. ( 1987 ) The codon Adaptation Index‐‐a measure of directional synonymous codon usage bias, and its potential applications . Nucleic Acids Res. , 15 , 1281 – 1295 . Soreq , H. , Seidman , S. , Dreyfus , P.A. , Zevin‐Sonkin , D. and Zakut , H. ( 1989 ) Expression and tissue‐specific assembly of human butyrylcholine esterase in microinjected xenopus‐laevis oocytes . J. Biol. Chem. , 264 , 10608 – 10613 . Suo , G. , Chen , B. , Zhang , J. , Duan , Z. , He , Z. , Yao , W. , Yue , C. and Dai , J. ( 2006 ) Effects of codon modification on human BMP2 gene expression in tobacco plants . Plant Cell Rep. , 25 , 689 – 697 . Tretter , V. , Altmann , F. and Marz , L. ( 1991 ) Peptide‐N4‐(N‐acetyl‐beta‐glucosaminyl)asparagine amidase F cannot release glycans with fucose attached alpha 1‐‐‐‐3 to the asparagine‐linked N‐acetylglucosamine residue . Eur. J. Biochem. , 199 , 647 – 652 . Wang , I.N. , Li , Y. , Que , Q. , Bhattacharya , M. , Lane , L.C. , Chaney , W.G. and Van Etten , J.L. ( 1993 ) Evidence for virus‐encoded glycosylation specificity . Proc. Natl. Acad. Sci. USA , 90 , 3840 – 3844 . http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Biotechnology Journal Wiley

Transgenic plants as a source for the bioscavenging enzyme, human butyrylcholinesterase

Download PDF
14 pages

Loading next page...
 
/lp/wiley/transgenic-plants-as-a-source-for-the-bioscavenging-enzyme-human-RBYXDC8kOC

References (59)

Publisher
Wiley
Copyright
"Copyright © 2010 Wiley Subscription Services, Inc., A Wiley Company"
eISSN
1467-7652
DOI
10.1111/j.1467-7652.2010.00515.x
pmid
20353404
Publisher site
See Article on Publisher Site

Abstract

Introduction Oragnophosphorous (OP) compounds are highly toxic inhibitors of the acetylcholine‐hydrolyzing enzymes acetylcholinesterase (AChE) and butyrylcholinesterase (BChE). Although first explored as insecticides, the extreme toxicity of OPs towards mammals prompted their development as chemical warfare agents, and the first military grade OP nerve agents, tabun, sarin and soman, were synthesized in Nazi Germany immediately prior to and during World War II. The cold war era saw the unfortunate proliferation of the technology and the development of yet more toxic compounds such as VX, Russian‐VX and cyclosarin ( Greenfield , 2002 ; Lee, 2003 ; Johnson , 2009 ). In fact, nerve agents are relatively easy to produce, store and weaponize, and their use by terrorists and rogue governments (notoriously exemplified by the Tokyo subway sarin attack by Aum Shinrikyo in 1995) pose a major threat to civilians and military personnel ( Johnson , 2009 ). In addition, the widespread and sometimes irresponsible use of OP pesticides increases the chance of environmental and occupational exposure of individuals and communities ( Ray and Richards, 2001 ; Catano , 2008 ; Jintana , 2009 ). Such concerns over exposure from overuse and misuse of OP pesticides and nerve agents have led to detailed studies of how such agents work and how to prevent or ameliorate their effects. However, developing safe and effective prophylactic treatments was met with considerable complications. For over a decade, application of cholinesterases, especially BChE, acting as scavengers of OPs has been explored as a promising medical intervention for prophylaxis and post‐exposure treatment against nerve agents. In the near term, outdated human plasma can be a first generation source of BChE for human clinical trials to validate its safety ( Saxena , 2006 ). In the longer term, a cost‐effective, sustainable supply of cholinesterases from an alternative source must be identified to establish and maintain a strategic reserve of the bioscavengers as they are needed in stoichiometric rather than catalytic quantities. In lieu of other expression systems for cholinesterases (e.g. transgenic goats, see Huang , 2007 ), we initially focused our attention on plant production of human AChE ( Mor , 2001 ; Geyer , 2005, 2007 ; Evron , 2007 ), and in this work, we demonstrate the applicability of plants as a production platform for human BChE, the OP bioscavenger of choice ( Doctor and Saxena, 2005 ; Saxena , 2006 ). We describe and discuss our strategy for codon optimization, which is based on conforming the codon usage of the transgene to that of a selected group of highly expressed plant genes rather than to the general codon usage. Using this strategy, we efficiently produced human BChE in plant and purified it to homogeneity. Our work demonstrates that the plant‐derived enzyme is glycosylated, assembled into tetramers, efficiently binds OP cholinesterase inhibitors and protects mice from OP challenge. Results Re‐engineering the gene encoding human BChE for high‐level expression in plants The human BChE cDNA ( hBCHE) was redesigned in silico for high‐level expression in Nicotiana benthamiana ( Figure 1 ). Extensive optimization included replacing unfavourable codons with more favourable alternatives and introducing silent mutations to disrupt sequences that can function as potential mRNA polyadenylation sites ( Loke , 2005 ), splicing signals ( Hebsgaard , 1996 ) and mRNA‐destabilizing determinants ( Narsai , 2007 ). 1 Sequence alignment of hBCHE and pBCHE genes and their expected translation product. Both genes encode for an identical protein (top line), but the nucleotide sequence of hBCHE (middle line) was adapted to allow higher level of expression in designing pBCHE (bottom line). Various molecular features that were targeted in optimizing the gene are labelled as shown on the figure. Both genes include two insertions (highlighted grey): a single residue near the N‐terminus (Gly2) and the C‐terminal ER retention signal (SEKDEL). In addition, two silent mutations (A174T and C312T, underlined) were introduced into the hBCHE to disrupt an EcoRI and an NcoI sites. Ribosome pausing as a result of long stretches of rare codons was implicated in correct co‐translational folding of certain protein domains ( Komar, 2009 ; Rosano and Ceccarelli, 2009 ). When considered within the context of the Homo sapiens codon usage, the BCHE gene has a value of 0.67 with only 16% unpreferred codons (i.e. with adaptiveness value w < 0.5, Table 1, see Experimental Procedures for explanation of w and CAI). These are generally spread throughout the gene’s sequence without clusters of more than three consecutive unpreferred codons (data not shown). Thus, in the case of the BCHE gene, translation elongation rates may play only a minor role, if any, in ensuring proper folding of the BChE protein. We therefore concluded that no specific rare codons in specific locations should be maintained when optimizing the gene’s sequence for expression in plants. In the context of the plant codon usage, more than 30% of the BCHE gene’s codons are unpreferred ( Tables 1 and 2 ). The overall CAI value of 0.60 is moderately low, but in three extensive regions of the genes, the localized CAI values are considerably lower ( Figure 2 ). In fact, there are seven different regions with four or more consecutive unpreferred codons (including one with eight codons). In adapting the sequence of BCHE for expression in plants, we eliminated the majority of rarely used codons (down to 7%), completely abolished the long clusters of such codons, and increased the CAI value to 0.83 ( Figures 1 and 2 , Table 2 ). These features conform to those of a gene encoding a highly abundant plant protein, the small subunit of ribulose bisphosphate carboxylase (RuBisCO) (CAI = 0.81, Figure 2 ). 1 Codon usage (frequency) of h BCHE and the plant‐expression‐optimized pBCHE genes 2 Codon usage of pBCHE is comparable to that of a highly expressed plant gene. Plotted values of the relative adaptiveness, w, of each codon represent a moving average (geometric mean, window size 51) centring on each codon for the coding regions of hBCHE, pBCHE and rbcS1B (encoding the small subunit of the enzyme RuBisCO). The codon adaptation index (CAI, relative adaptiveness averaged over the entire length of a sequence) for each gene is shown as a broken line. 2 Molecular features of h BCHE and the plant‐expression‐optimized pBCHE genes hBCHE pBCHE Codon usage Total 609 609 Unfavourable 189 45 % 31 7 Clusters of 2–3 31 2 4≤ 7 0 CAI 0.60 0.83 RNA‐destabilizing sequences AUUUA* 3 0 AUAGAU* 1 0 UUUUUU* 3 0 1–10 seqs of Narsai et al. 19 9 Polyadenylation signals 1–10 seqs of Loke et al. 9 1 1–100 seqs of Loke et al. 61 5 Donor splice sites Highly likely 1 0 Potential 1 1 Acceptor splice sites Potential 3 1 Branch point splice sites Potential 3 1 Potential DNA methylation sites CG 10 3 CNG 76 55 % GC 40 46 *Sequences previously demonstrated to affect stability. In addition to codon‐usage adaptation, we replaced sequences that were demonstrated to reduce transcript stability and reduced the number of putative RNA‐destabilizing sequences ( Table 2 , Narsai , 2007 ; and references therein). We further drastically reduced the number of putative plant near‐up‐stream polyadenylation sequences, predicted plant splicing signals and potential methylation sites ( Table 2 , Hebsgaard , 1996 ; Loke , 2005 ). Finally, the newly designed gene G+C content was higher than that of the native human gene and closer to that of a typical dicotyledonous plant gene (44.9% and 39.7%, respectively). Expression of human BChE in plants The de novo ‐synthesized pBCHE gene was cloned into a plant expression vector that was then used to create transgenic N. benthamiana plants via Agrobacterium ‐mediated transformation. In parallel, we created transgenic plants expressing the native (i.e. non‐plant expression‐optimized) hBCHE gene. Both genes were equipped with endoplasmic reticulum (ER) retention signal SEKDEL that was shown to increase the accumulation levels of recombinant proteins in plants ( Geyer , 2007 ). We screened 76 pBCHE and 130 hBChE independent transgenic plant lines for expression levels of the BChE enzyme. As expected, accumulation of BChE varied substantially among the individual transformants of each construct population with a lognormal distribution ( Geyer , 2007 ). However, overall BChE accumulated to a higher level in plants expressing the plant‐expression‐optimized pBCHE gene (mean ± SEM: 1.84 ± 0.22 U/mg protein; geometric mean [95% CI]: 0.67 [0.41 to 1.08] U/mg protein) than in plants expressing hBCHE (0.33 ± 0.03 U/mg protein; 0.14 [0.10 to 0.18] U/mg protein; see Figure 3 ). In fact, more than a third of the pBCHE plants accumulated the recombinant protein at medium to very high levels, while none of the hBCHE plants we screened accumulated the transgene’s product at these levels and practically all (∼95%) exhibited very low levels. 3 Genetic optimization increases BChE accumulation in plants. Transgenic N. Benthamiana were created via Agrobacterium‐ mediated transformation with binary expression vectors harbouring either the native human DNA sequence of BCHE ( hBCHE ) or the plant‐optimized sequence ( pBChE ). Leaf samples from kanamycin‐resistant independent pBCHE (76) and hBCHE (130) assayed for BChE activity in a modified Ellman assay using butyrylthiocholine as the substrate. Error bars represent the standard deviation from at least two independent determinations. The mean expression levels for each construct among the various lines are indicated by horizontal broken lines. An independent‐samples t ‐test was conducted to compare pBCHE plants (1.84 ± 0.22 U/mg protein; mean ± SEM) to hBCHE plants (0.33 ± 0.03 U/mg protein; t (204) = 8.588, P < 0.0001. Insert shows the distribution histogram of BChE expression levels among the various lines. Plants were grouped as according to their expression level as follows (in U/mg protein): VL‐ expression level X ≤ 1, L‐ 1 < X ≤ 2, M‐ 2 < X ≤ 4, H‐ 4 < X ≤ 8, VH‐ 8 < X. The extremely significant fivefold difference in the mean BChE activity ( t ‐test: t(204) = 6.089, P < 0.001) is also evidenced by the higher maximal value obtained for the pBCHE plant lines (10.1 U/mg protein, when compared to the best expressing hBCHE line at 2.2 U/mg protein). This level of activity represents a very high level of recombinant protein accumulation in transgenic plants: active BChE constituted 1.3% of total soluble protein (TSP). These results are in agreement with our previously published work which reported similar improvement in expression levels for the ‘synaptic’ ( Geyer , 2007 ) and ‘readthrough’ variants of AChE ( Evron , 2007 ). The plant with the highest level of accumulation (hereafter referred to simply as pBCHE ) was clonally propagated for further analyses and for seed production. Both segregation of kanamycin resistance among progeny of selected plants (data not shown) and genomic Southern blot analysis ( Figure 4 ) indicated that this highly expressing line has a single copy of the transgene. 4 DNA blot analysis reveals a single copy of the transgene in the best expressing pBChE line . Total DNA was isolated from the highly expressing pBChE plant line or from wild type plants, and 20‐μg samples were digested by either NcoI (N), HindIII (H) or EcoRI (E). Restriction fragments were resolved by agarose gel electrophoresis, transferred to nylon membrane and hybridized with a probe spanning sequence around the border between the 5′‐UTR and the coding region ( Figure 7 ). A single transgene copy is suggested by the generation of a unique fragment by the three different restriction enzymes. Purification of pBChE Purification of pBChE was performed by mechanical extraction of the soluble protein fraction from leaves of transgenic plants followed by ammonium sulphate fractionation and two in‐tandem affinity chromatography steps ( Table 3 ). Ammonium sulphate fractionation was conducted at pH 4.0 to facilitate the removal of the major protein constituent of the extract—the enzyme RuBisCO. The first chromatography step with Concanavalin A‐sepharose resin provided 6.8‐fold purification presumably by the interaction of the lectin with the abundant high‐mannose glycans decorating the ER‐retained pBChE. Final polishing with procainamide affinity chromatography removed essentially all of the remaining contaminants. Based on SDS‐PAGE and silver staining (data not shown), our purification procedure yielded a pure product with a specific activity of 765.5 U/mg, comparable to the purity of the enzyme obtained from human plasma ( Grunwald , 1997 ). 3 Purification of pBChE Purification Step Volume (mL) Activity (U) Yield (%) Sp. Activity (U/mg TSP) Purification (fold) Plant material—18 kg (fresh weight) Crude extract 13 500 170 584 100 7.8 1 30%–70% (NH 4 ) 2 SO 4 fraction 700 93 996 55 94.8 12.2 ConA sepharose 4B column 4.5 47 127 28 646.6 83.1 Procainamide column 2.25 21 510 13 765.5 98.4 Molecular forms of pBChE Human BChE is a glycoprotein existing in serum mostly as a homotetramer and is secreted via the ER‐Golgi secretory system. Proper folding is achieved only during passage through the ER and therefore depends on signal peptide‐mediated translocation into the ER and subsequent removal of the signal peptide. To determine whether that is the case also for plant‐derived pBChE, N‐terminal sequencing by Edman degradation was undertaken on highly pure preparations of pBChE. However, the N‐terminus of the protein appeared to be blocked, and we therefore turned to mass spectrometry analysis of trypsin fragments. This enabled us to identify the fragment matching to the N‐terminal region of the mature protein (.EDDIIIATKNGK.). We did not identify any fragments corresponding to upstream sequences belonging to the protein’s signal peptide, suggesting efficient and complete cleavage (data not shown). The electrophoretic mobilities of the plant‐derived recombinant protein and its plasma‐derived counterpart were compared ( Figure 5 ). Crude protein extracts of wild type and transgenic plants were resolved by SDS‐PAGE, revealing a unique protein band that was present only in the latter. The apparent molecular mass of the protein was ∼70 kDal, less than that of the plasma‐derived protein (∼85 kDal) but more than the expected mass of the mature protein (64 kDal). Further, immunoblotting revealed that the protein band seen on the stained gel actually consisted of two different closely migrating proteins masked by co‐migrating endogenous plant proteins in the stained gel. We estimate that the molecular masses of these two isoforms of pBChE were 68 kDal and 75 kDal. 5 pBChE has greater electrophoretic mobility than its human‐derived counterpart. (a) Samples of total soluble protein extracts (0.5 μg) from wild type plants (lane 1) or pBCHE transgenic (lane 2) plants and of a crude preparation of human plasma‐derived BChE (5 μg, Sigma, lane 3) were resolved by SDS‐PAGE, stained by silver stain (lane 1, 2) or coomassie brilliant blue (lane 3). Arrow heads point to the band corresponding to pBChE or human BChE. (b) Alternatively, proteins resolved by SDS‐PAGE were transferred to a polyvinylidenedifluoride membrane, immunodecorated by an anti‐human BChE antibody followed by HRP‐conjugated secondary antibody and visualized by chemiluminescence. (c) Samples of human plasma‐derived BChE (1 μg, lane 1) and plant‐derived pBChE (0.25, 0.5, 0.75 and 1 μg, lanes 2–5, respectively) were resolved by gel electrophoresis under non‐denaturing conditions. Gels were then stained by the method of Karnovsky and Roots as previously described ( Mor , 2001 ). Positions of high molecular mass forms of the enzyme (presumably tetramers) and low molecular mass form (presumably monomers) are indicated. When the plasma‐derived enzyme was resolved by non‐denaturing gel, most of the protein retained its tetrameric structure, although some lower molecular mass forms (potentially dimers and monomers) were also detected ( Figure 5c ). Similarly, pBChE mostly migrated as a broad band with mobility slightly lower than that of its plasma‐derived counterpart, implying a lower charge to mass ratio for the former. The differences in apparent molecular mass of the proteins imply different post‐translational modifications, because the predicted protein sequence for both should be identical except for the ER retention hexapeptide signal (absent from the plasma‐derived enzyme). Without conclusively excluding other explanations, differential N‐linked glycosylation is a likely post‐translational modification accounting for the distinct molecular mass forms. To test this possibility, pure preparations of pBChE and plasma‐derived hBChE were subjected to deglycosylation either chemically with the superacid trifluoromethanesulfonic acid (TFMSA) or with one of two N ‐linked glycan‐specific endoglycosidases, peptide N‐glycosidase F (PNGase F) and endoglycosidase H (Endo H). While Endo H mediates the selective removal of N ‐linked high‐mannose or hybrid glycans, PNGase F can also remove most Endo H‐resistant complex glycans. The treated proteins (and untreated controls) were then resolved by SDS‐PAGE and subjected to concanavalin A (ConA) blot analysis ( Figure 6 ). ConA can detect glucose and mannose residues on N ‐linked glycans. 6 pBChE bears high‐mannose glycans. Pure preparations of pBCHE and plasma‐derived hBCHE were subjected as indicated to deglycosylation either by endoglycosydase digestion with Endo H or PNGase F, chemically by the superacid trifluoromethanesulfonic acid, or left untreated. Proteins were then resolved SDS‐PAGE and blotted onto a nitrocellulose membrane. Membrane was decorated with HRP‐conjugated Con‐A and developed by ECL. Compatible with our use of ConA for affinity purification of the plant‐derived enzyme, the lectin decorated the control sample of pBChE as well as that of its plasma‐derived counterpart ( Figure 6 ). While hBChE was fully resistant to Endo H treatment, its digestion with PNGase F resulted in complete stripping of the glycans off the protein ( Figure 6 ). These results are indicative of complex glycosylation of this human plasma‐derived enzyme. In contrast, treatment of pBChE with Endo H resulted in efficient but incomplete deglycosylation suggesting the presence of high‐mannose or hybrid glycans ( Figure 6 ). The fact that the plant‐derived protein was refractory to the PNGase F treatment ( Figure 6 ) is further suggestive of the presence of core α(1,3)‐fucose on most of its glycans, as such structures are known to hinder hydrolysis by PNGase F ( Tretter , 1991 ). Finally, chemical deglycosylation was efficient in removing the glycans off pBChE ( Figure 6 ). Which (and how many) of the nine potential glycosylation sites on human BChE are occupied is not yet known, but the difference in size between the two enzymes suggests that fewer sites are occupied in pBChE. Enzymatic properties of pBChE The hydrolytic activity of pBChE towards butyrylthiocholine and the enzyme’s sensitivity to several cholinesterase inhibitors were tested in vitro in comparison with highly pure preparations of human plasma‐derived BChE ( Table 4 ). The affinities of the enzymes from either source to both substrate (i.e. the K M ) and inhibitors (i.e. the IC 50 values) are practically identical. The values we report here fall well within the range of those previously reported in the literature where considerable variability and lack of consensus exist ( Table 4 ). 4 Substrate hydrolysis by pBChE and its sensitivity to various inhibitors pBChE Plasma hBChE This Work Literature Substrate: K M (μ m ) butyrylthiocholine 147 ± 24 146 ± 26 20 * ; 50 † ; 2200 ‡ Inhibitors: LogIC 50 Neostigmine −8.16 ± 0.06 −7.93 ± 0.08 −6.7 § Paraoxon ¶ −7.48 ± 0.06 −7.45 ± 0.08 −8.1 ** DFP †† −8.49 ± 0.06 −8.36 ± 0.03 −9.7 § ; −7.7 ‡ *Lockridge et al. (1997). † Kaplan (2001) . ‡ Gnatt (1994) . § Atack (1989) . ¶ O,O ‐Diethyl O ‐(4‐nitrophenyl) phosphate. ** Petroianu (2005) . †† Diisopropyl phosphorofluoridate. Plant‐derived BChE protects mice against OP challenge The above‐recounted results demonstrate the ability of pBChE to sequester OP anticholinesterases in vitro and prompted us to test whether pBChE can prophylactically protect animals against OP challenge in a mouse model of OP toxicity. Treatment with 1.1LD50 of paraoxon (750 μg/kg) was lethal in 100% of tested animals. In contrast, prophylactic administration of pBChE (42–62 mg/kg) fully protected the mice with no observable symptoms against a subsequent challenge. Discussion The search for prophylactic and therapeutic antidotes for nerve agent poisoning has evolved from small molecule agents (atropine, pralidoxime, diazepam) that simply mitigate mortality, to a search for true prophylactic agents which would maintain the patient fully cognizant and capable of performing appropriate duties such as those of a solider or a first‐responder. In the decades since ‘cholinesterase therapy’ was first proposed, we have gained an appreciation for the challenges inherent to this model. As a novel solution, we looked to plant production of BChE. In this work, we have demonstrated the feasibility of producing this tetrameric glycoprotein in plants and have further demonstrated the ability of plant‐derived BChE to sequester OP toxins both in vitro and in vivo providing protection from otherwise lethal doses of such toxins. Owing to the unfavourable expression levels of other native human cDNAs in heterologous systems, we hypothesized that removal of deleterious sequences such as cryptic introns, potential splice sites and RNA PolII termination sites in addition to codon optimization for dicotyledonous plants would enhance protein accumulation in transgenic plants system ( Figures 1, 2 and 7 , Tables 1, 2 and 5 ). Indeed, transgenic N. benthamiana plants that harboured and expressed the optimized pBCHE gene accumulated the BChE enzyme to fivefold higher levels when compared to control plants that expressed hBCHE , the human cDNA ( Figure 3 ). Similarly to our previous work with N. benthamiana ‐produced AChE ( Geyer , 2007 ), both variants of BChE‐expressing stable lines, human and plant‐optimized, displayed lognormal distribution of transgene product with maximal expression levels exceeding 1% of TSP. 7 Construction of vectors for the expression of hBCHE and pBCHE . (a) De novo synthesis of pBCHE . 1. The sequence of hBCHE was modified as described in details in the text to exclude various deleterious signals and to conform the codon preference to that of highly expressed plant genes to yield pBCHE . 2. Seventy‐five oligonucleotides corresponding to the dsDNA sequence of pBCHE were designed, so each half of any forward oligonucleotides would be complementary to two adjacent reverse oligonucleotides and vice versa . The oligonucleotides varied in length (41–65 bases) so the melting temperature of all complementary sections would be 60 ± 2 °C. 3. During the first round of PCR, low levels of correctly assembled oligonucleotides form a template for a second round of PCR. 4. During that second round, the entire gene was amplified. 5. The PCR fragment is then cloned and its sequence verified. (b) Plant expression cassettes for the human BCHE gene and its plant‐expression‐optimized counterpart ( hBCHE and pBCHE, respectively). 35S, the cauliflower mosaic virus 35S promoter (with duplicated enhancer); TEV, 5′‐UTR of the tobacco etch virus transcript; VSP, 3′‐UTR of the soybean vegetative storage protein gene, vspB. 5 Oligonucleotides used as primers in this study # Name 5′ Sequence 3′ 1 oTM191 ATGTCGACGAGCTCTTAGAGTTCATCCTTCTCAGAGAGACCCACACAACTTTCTTTC 2 oTM204 ATAAGCTTCCATGGGACATAGCAAAGTCACAATCATATGC 3 oTM207 GCACGGTAACAGCCTTTCTTGGGATTCCCTATGCACAGCCACC 4 oTM208 GGTGGCTGTGCATAGGGAATCCCAAGAAAGGCTGTTACCGTGC 5 oTM209 CAAAGTTTTCCAGGCTTCCACGGATCAGAGATGTGGAACCC 6 oTM210 GGGTTCCACATCTCTGATCCGTGGAAGCCTGGAAAACTTTG During the last couple of decades, the art of optimizing gene sequence for expression in foreign hosts has gained a firmer scientific footing that was based primarily on genome‐wide analyses of various parameters affecting transcription and post‐transcriptional events, including splicing, polyadenylation and transcript turnover ( Hebsgaard , 1996 ; Loke , 2005 ; Narsai , 2007 ). Similar high throughput analyses of synonymous codon bias suggested a role for natural selection on translation efficiency in shaping the codon bias in a given genome ( Kanaya , 2001 ; Ingvarsson, 2008 ; Mukhopadhyay , 2008 ; dos Reis and Wernisch, 2009 ). Specifically, it is generally well accepted that in dicotyledonous plants like Arabidopsis thaliana (and by extension Nicotiana species), there exists positive correlation between synonymous codon usage and iso‐accepting tRNA copy numbers, resulting in optimization of translation efficiency, particularly in the case of highly expressed constitutive genes ( Mukhopadhyay , 2008 ). Interestingly, the long‐held assertion regarding the positive correlation between synonymous codon bias and translation efficiency, first identified in Escherichia coli ( Ikemura, 1985 ), was recently challenged by Kudla (2009) . They argued that ‘codon bias did not correlate with gene expression’ and that the most relevant attributes contributing to high‐level expression are secondary structures near the initiatory AUG (2009). Without diminishing the importance of the 5′ region of the coding sequence, our analyses here and in published work of ours and others (e.g. Murray , 1989 ; Geyer , 2007 ; Liu, 2009 ), adapting the codon usage of the foreign gene to that of the host’s highly expressed genes, seems to us to be a major contributing, even critical, factor affecting the accumulation of (foreign) proteins in plants. The often‐used approach for codon optimization calls for conforming the codon usage of the transgene to that of the overall codon usage of the particular species often taken from the extensive Codon Usage Database (, e.g. Liu, 2009; Cai et al., 2008; Maclean et al., 2007; Suo et al., 2006). The results with this approach are often disappointing (e.g. Suo , 2006 ; Maclean , 2007 ). In contrast, we base our analysis on the codon usage of a select set of highly expressed genes with abundant protein products. In fact, CAI values calculated based on the codon bias of highly expressed genes better correlate with expression levels when compared to values calculated based on genome‐side codon usage. For example, based on the overall codon usage, the calculated CAI values are similar and rather high for both the poorly performing human BChE sequence (0.80) and the optimized synthetic gene (0.85). In contrast, as we show here, the CAI values calculated based on our highly expressed gene standard are better predictors of the two genes’ in planta performance at 0.60 and 0.83. In our approach, we pay a particular attention to eliminate consecutive stretches of unfavourable codons (unless present in the context of the source organism), which simply looking at the overall CAI may obscure. For example, a synthetic gene encoding the human papiloma virus L1 protein by Maclean (2007) , which was designed based on the overall codon usage of dicotyledonous plants, has a relatively high CAI when analysed using our set of standard genes (0.79), shrouding several long stretches of unpreferred codons. This may explain the poor performance of this ‘codon‐optimized’ transgene ( Maclean , 2007 ). An additional tenant of our strategy aims at greatly reducing the presence of unpreferred codons rather than using the single most preferred codon for every amino acid (so called ‘CAI = 1’ strategy, Cai , 2008 ). In our experience, the ‘CAI = 1’ strategy yielded particularly poor results with fewer transgenic events, which were often silenced or otherwise were characterized by very poor expression (data not shown). This is, perhaps, not surprising as the high demand for just few tRNA species may pose an unsustainable burden on synthesis of important cellular proteins. Our analysis ( Figure 5 , Table 4 ) demonstrated that pBChE shows very similar, if not identical, enzymatic properties when compared to the human serum BChE (as reported in the literature). It is unclear at this stage whether the differences noted in the affinity of the enzyme to some of the tested inhibitors point to some structural/functional attributes unique to the plant‐produced enzyme (for example, the differential glycosylation or the presence of the hexapeptide ER‐retention signal). However, it is important to note that there is an even bigger variance among the values for the human plasma‐derived enzyme as reported in the literature (e.g. Gnatt , 1994 ; Lockridge et al., 1997 ; Kaplan , 2001 ). This sizeable variance reflects, most probably, the differences in the way the assays were conducted, the source and purity of the enzymes and the reagents. As expected, producing BChE in plants resulted in a glycosylated enzyme. The differences in apparent molecular mass between pBChE and the plasma‐derived enzyme belie molecular differences which we partially attribute to N‐linked glycosylation that results in glycans that are distinct from the terminally sialylated glycans present on human serum BChE ( Gomord and Faye, 2004 ; Saint‐Jore‐Dupas , 2007 ). Previous work has indicated that high mannose type glycosylation predominates among ER‐retained N. benthamiana ‐produced proteins ( Matoba , 2009 ). Our data here suggest a somewhat more complicated picture regarding pBChE. While most of the oligosaccharides on the protein appear to be Endo H‐sensitive, hence suggesting they are of high mannose type, predicting their a‐priori sensitivity to PNGase F. However, the glycans seem to be resistant to PNGase F, strongly suggestive of the presence of core α(1,3)‐fucose residues ( Tretter , 1991 ). The escape of proteins equipped with the KDEL ER‐retention signal from the ER and their progress down the secretory pathway are intriguing, but not unheard of and will require further study ( Petruccelli , 2006 ). Differential glycosylation may explain the somewhat smaller charge to mass ratio observed in the plant‐derived enzyme when compared to its plasma‐derived counterpart, the glycans of which mostly carry negatively charged sialic acids as their terminal residues ( Hermentin , 1996 ). In turn, surface‐charge differences may contribute to the small differences in the enzymatic properties of plant‐derived and plasma BChE. More surprising was our finding that neither the presence of a C‐terminal SEKDEL sequence nor that of plant‐specific glycans compromised tetramerization of the enzyme. The oligomeric structure of BChE is that of a dimer of dimers. Each dimer consists of two monomeric subunits covalently attached to each other through a C‐terminal disulfide bridge. Tetramerization is then achieved through association of the dimers, mediated by conserved tryptophan amphiphilic tetramerization (WAT) domains of the C‐terminal peptides with a polyproline II helix. The proline‐rich attachment domain (PRAD) of Collagen Q serves as such a tetramerization pivot for the localization of both BChE and AChE in the basal lamina at the neuromuscular junction ( Bon , 2003 ; Lee , 2004 ). The PRiMA protein fulfils a similar function not only in peripheral synapses but also in the central nervous system ( Perrier , 2002 ). Polyproline peptides (such as co‐expressed PRAD peptide) increase the tetramerization of secreted recombinant BChE expressed in mammalian cells ( Duysen , 2002 ). The natural polyproline peptides responsible for the tetramerization of serum BChE were only recently identified by Lockridge and co‐workers as derivatives of the protein lamellipodin ( Li , 2008 ). Plants harbour a fair number of proline‐rich proteins that play critical roles, among others, in cell wall integrity and biogenesis ( Cannon , 2008 ) and plant defence responses. In some cases, poly‐proline peptides are derived by proteolysis from precursor proteins ( Pearce , 2007 ; Chen , 2008 ). A plausible speculation is that such proteins/peptides associate with the WAT domain of the recombinant pBChE promoting the association of the proteins into tetramers. Interestingly, only a minor fraction of recombinant human BChE produced in the milk of transgenic goats appears as stable tetramers ( Huang , 2007 ). A more detailed analysis of the oligomeric structure of plant‐derived human BChE is underway as are further pre‐clinical experiments to test the efficacy of pBChE against OP challenge. Experimental procedures Analyses of codon usage bias, presence of spurious RNA processing and destabilization signals and GC content Codon usage bias in genes encoding highly expressed proteins of dicotyledonous plants was assessed according to Sharp and Li (1987) . The reference set included cDNAs encoding the small subunit 1B of RuBisCO, chlorophyll A/B binding protein 2, ribosomal protein L1 and L2, 40S ribosomal protein S2, S3 and S4 (accession nos. NM_123204 , NM_102733 , NM_202757 , NM_201956 NM_115247 , NM_115247 and NM_125228 , respectively) of the model plant Arabidopsis thaliana . Table 1 lists the codon frequencies of the reference set (from the Codon Usage Database. See Nakamura, 2005 ). The relative synonymous codon usage (RSCU = observed frequency/unbiased frequency), the relative adaptiveness of a codon ( w , RSCU normalized to the most abundant synonymous codon for an amino acid, Table 1 ) and the codon adaptation index (CAI, geometric mean of w values over the entire length of the gene) values were calculated according to Sharp and Li (1987) . Unfavourable (or infrequently used) codons were defined here as codons with w < 0.5. Our codon bias analysis corresponds very well with a recently published analysis ( Mukhopadhyay , 2008 ). Putative RNA‐destabilizing sequences were analysed through a genome‐wide in silico study by Narsai (2007) , but only few such sequences were positively identified in planta , including the AU‐rich elements, AUUUA, AUAGAU and UUUUUU ( Table 2 , Feldbrugge , 2002 ; Narsai , 2007 ; Ohme‐Takagi , 1993 ). Table 2 also lists potential polyadenylation signals that were identified according to Loke (2005) and potential splicing signals that were recognized using the NetGene2 Server (, Hebsgaard , 1996 ). Construction of plant expression vectors for human BChE We used Expand High Fidelity PCR kit (Roche, Indianapolis, IN, USA) to amplify DNA fragments for cloning and QuickChange kit (Stratagene, Cedar Creek, TX, USA) for site‐directed mutagenesis. Coding region of each construct was sequence‐verified after every cloning step. The cDNA of human BChE (Genbank # NM_000055 , Prody , 1987 ) was PCR amplified from pSP 64 ‐ϕChE ( Soreq , 1989 ) using the primers oTM191 and oTM204 (see Table 5 for primers used in these studies) and cloned into pTOPO‐TA (Invitrogen, Carlsbad, CA, USA) to yield pTM293. To facilitate later cloning steps, a Sac I site was added at 3′‐end and an Nco I site was added at the 5′‐end (the latter necessitated an insertion of a Gly residue immediately following the initiatory Met). The ER retention hexapeptide SEKDEL was fused at the carboxyl‐terminus. Sequential site‐directed mutagenesis was performed to remove the internal Nco I and EcoRI and sites within the gene utilizing primers oTM209 and oTM210 (for the removal of Nco I) and then oTM207 and oTM208 (for removal of Eco RI referred to as hBCHE to yield pTM306 and finally pTM302. A synthetic gene encoding for the same amino acid sequence of hBChE was designed to improve the mRNA’s post‐transcriptional stability, processing accuracy and translatability by excluding various deleterious signals and conforming the codon preference to that of highly expressed plant genes ( Tables 1 and 2 , Figure 1 \Geyer, 2007 #3813). The gene, pBCHE , was constructed by de novo synthesis ( Figure 7 ) as was previously described in detail for another gene ( Geyer , 2007 ) and was cloned into pCMV3.1 to yield pTM298. Nco I ‐Sac I fragments encompassing the coding regions of hBCHE and pBCHE were (separately) cloned into an expression cassette consisting of the 35S CaMV promoter, the 5′ UTR of tobacco etch virus (TEV leader) and the 3′ UTR of soybean’s vspB gene (VSP terminator) by replacing the corresponding fragment in pTM034 ( Mor , 2001 ) to yield pTM318 and pTM303, respectively. The expression cassettes ( HindIII — EcoRI fragment) were then cloned into the pGPTV‐Kan plant expression vector to yield pTM322 and pTM307 ( Figure 7 , Becker , 1992 ). Agrobacterium tumefaciens ‐mediated transformation of N. benthamiana was as previously described ( Geyer , 2007 ; Matoba , 2009 ). The pBCHE plant line accumulating the highest level of enzymatic activity of the protein product (see below) was selected for propagation, seed production and further analysis. Purification of recombinant human BChE from transgenic plants Purification of plant‐derived BChE (pBChE) from N. benthamiana leaf material was as described, with modifications ( Geyer , 2005 ). Briefly, juice from leaves of 8 to 11‐week‐old transgenic plants was extracted by passing through a Green Power GB‐9001 Juicer (Samson Life, Danbury, CT, USA). Sodium metabisufite was added to the juice (final concentration 150 m m ). Pulp was discarded and juice was clarified by centrifugation at 22 000 g for 15 min and filtration through miracloth. The pH of the supernatant was lowered to 4.0 with 1 N HCl and subjected to ammonium sulphate fractionation. The 30%–70% fraction was collected by centrifugation at 22 000 g , for 30 min, re‐suspended in 0.125× PBS buffer, pH 7.4, dialysed against the same buffer overnight and concentrated by microsep 30 000 MWCO omega centrifugal devices (Pall corporation, East Hills, NY, USA). The concentrated preparation was then subjected to two in‐tandem steps of affinity chromatography. First, the sample (700 mL at 1.42 mg protein/mL) was adsorbed to Concanavalin A‐Sepharose 4B resin (ConA; GE Healthcare, Piscataway, NJ, USA) previously equilibrated with 20 m m NaH 2 PO 4 /Na 2 HPO 4 (NaPi) buffer, pH 8.0, containing 500 m m sodium chloride. Unbound pBChE and other contaminating proteins were removed by washing the column with 15 column volume (CV) of the equilibration buffer. Bound pBChE was batch‐eluted from the resin in successive steps with elution buffer 1 (20 m m NaPi buffer, pH 8.0, 500 m m NaCl and 100 m m methyl‐α‐D‐glucopyranoside), elution buffer 2 (20 m m NaPi buffer, pH 4.5, 500 m m NaCl and 100 m m methyl‐α‐D‐glucopyranoside), elution buffer 3 (20 m m NaPi buffer, pH 8.0, 500 m m NaCl, 500 m m methyl‐α‐D‐glucopyranoside and 100 m m methyl‐α‐D‐mannopyranoside) and elution buffer 4 (20 m m NaPi buffer, pH 4.5, 500 m m NaCl, 500 m m methyl‐α‐D‐glucopyranoside and 100 m m methyl‐α‐D‐mannopyranoside). The resin was incubated while mixing for 30 min (buffer 1 and 2) or 60 min (buffer 3 and 4). Additional elution steps under more stringent conditions and longer incubation yielded more enzyme but not enough to justify the longer procedure. Eluted fractions containing pBChE were pooled and dialysed overnight against 0.125× PBS buffer, pH 7.4 and concentrated as described above. These highly enriched ConA‐pBChE preparations were further purified using procanamide‐agarose gel custom resin (Sigma, St. Louis, MO, USA) by adsorbing it (4.5 mL at 12 mg protein/mL) to the pre‐equilibrated resin (20 m m NaPi buffer, pH 8.0). The column was washed with 10 CV of the same buffer to remove non‐specifically bound contaminants. The tightly bound pBChE was eluted (batch wise) with equilibration buffer consecutively supplemented with 100 m m NaCl (1), 1 m NaCl (2), 100 m m NaCl and 200 m m procanamide‐HCl (3), 500 m m NaCl and 200 m m procanamide‐HCl (4), and finally with 1 m NaCl and 500 m m procanamide‐HCl (5). Eluate 1 and pooled eluates 2–5 were dialysed overnight against 0.125× phosphate‐buffered saline, pH 7.4, and concentrated. Purified plant‐derived pBChE was kept in 0.125× phosphate‐buffered saline, pH 7.4 with 0.02% azide at 4 °C for up to 6 months. Biochemical analyses Protein preparations were resolved by SDS‐PAGE on 8% gels and were either stained with GelCode SilverSNAP Stain Kit II (Pierce, Rockford, IL, USA), Coomassie brilliant blue, or transferred to a polyvinylidenedifluoride (PVDF) membrane and immune‐decorated with rabbit polyclonal anti‐hBChE Abs (the generous gift of Oksana Lockridge, University of Nebraska Medical Center). Horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit IgGs (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and the ECL‐plus kit (Amersham, Piscataway, NJ, USA) were used for detection. Total soluble protein (TSP) was determined as described ( Mor , 2001 ). Protein resolution by non‐denaturing PAGE (10%) and detection of BChE activity in the gels (with butyrylthiocholine as substrate) were previously described. Endoglycosidase digestions were performed according to the manufacturer’s protocols (New England Biolabs, Ipswich, MA, USA). Purified preparations (10 μg) of pBChE and plasma‐derived human BChE (the kind gift of David Lenz and Douglas Cerasoli, US Army Medical Research Institute of Chemical Defense) were denatured in glycoprotein‐denaturing buffer (0.5% SDS, 40 m m DTT) at 100 °C for 10 min. Samples were centrifuged at 13750 g for 1 min, and the supernatant was subjected to digestion with either PNGase F (1000 U) or Endo H (2000 U) at 37 °C for 3 h. Chemical deglycosylation with TFMSA was conducted as follows ( Wang , 1993 ). TFMSA (50 μL, Sigma) and anisole (25 μL, Sigma) were added in this order to a lyophilized sample of pBChE (100 μg) sample in a 3‐mL Pyrex tube on ice. The mixture was further incubated on ice for 3 h and was then neutralized with 125 μL of N‐ethylmorpholine (Sigma). Protein was precipitated by addition of 10 volumes of acetone. The suspension was incubated overnight at −20 °C and then centrifuged for 10 min at 7000 g . Protein pellet was dried under vacuum for ∼30 min and then re‐suspended in 100 μL SDS‐PAGE sample. Deglycosylated and untreated control samples resolved by SDS‐PAGE followed by lectin blot analysis using HRP‐conjugated ConA (New England Biolabs) as previously described ( Matoba , 2009 ). BChE activity was assayed by a modified Ellman assay ( Geyer , 2005, 2007 ) with butyrylthiocholine iodide (BTCh, Sigma) as substrate. Total protein levels were derived as previously described with BSA as standard. The specific activity of pure BChE (∼ 760 U/mg protein, Grunwald , 1997 ) was used for conversion of specific activity data into %TSP. To determine the K M , activity was measured in the presence of varying concentrations of BTCh, the results were plotted and non‐linear regression was applied (GraphPad Prism v 4.0; GraphPad Software, San Diego, CA, USA). IC50 values were determined by fitting Inhibition curves (obtained by performing a modified Ellman assay with 1 m m BTCh in the presence increasing concentrations of inhibitors). The results to the equation Y = BOTTOM + (TOP‐BOTTOM)/(1 + 10^(X ‐ logIC50)) using GraphPad Prism. Statistical analyses Statistical analyses were performed using Prism (GraphPad). Acknowledgements This work was funded in part by the National Institutes of Health CounterACT Program through the National Institute of Neurological Disorders and Stroke under the U‐54‐NSO58183‐01 award—a consortium grant awarded to USAMRICD and contracted to TSM under the research cooperative agreement number W81XWH‐07‐2‐0023. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the federal USA government. References Atack , J.R. , Yu , Q.S. , Soncrant , T.T. , Brossi , A. and Rapoport , S.I. ( 1989 ) Comparative inhibitory effects of various physostigmine analogs against acetyl‐ and butyrylcholinesterases . J. Pharmacol. Exp. Ther. , 249 , 194 – 202 . Becker , D. , Kemper , E. , Schell , J. and Masterson , R. ( 1992 ) New plant binary vectors with selectable markers located proximal to the left T‐DNA border . Plant Mol. Biol. , 20 , 1195 – 1197 . Bon , S. , Ayon , A. , Leroy , J. and Massoulie , J. ( 2003 ) Trimerization domain of the collagen tail of acetylcholinesterase . Neurochem. Res. , 28 , 523 – 535 . Cai , Y. , Sun , J. , Wang , J. , Ding , Y. , Tian , N. , Liao , X. and Xu , W. ( 2008 ) Optimizing the codon usage of synthetic gene with QPSO algorithm . J. Theor. Biol. , 254 , 123 – 127 . Cannon , M.C. , Terneus , K. , Hall , Q. , Tan , L. , Wang , Y. , Wegenhart , B.L. , Chen , L. , Lamport , D.T. , Chen , Y. and Kieliszewski , M.J. ( 2008 ) Self‐assembly of the plant cell wall requires an extensin scaffold . Proc. Natl. Acad. Sci. USA , 105 , 2226 – 2231 . Catano , H.C. , Carranza , E. , Huamani , C. and Hernandez , A.F. ( 2008 ) Plasma cholinesterase levels and health symptoms in peruvian farm workers exposed to organophosphate pesticides . Arch. Environ. Contam. Toxicol. , 55 , 153 – 159 . Chen , Y.C. , Siems , W.F. , Pearce , G. and Ryan , C.A. ( 2008 ) Six peptide wound signals derived from a single precursor protein in Ipomoea batatas leaves activate the expression of the defense gene sporamin . J. Biol. Chem. , 283 , 11469 – 11476 . Doctor , B.P. and Saxena , A. ( 2005 ) Bioscavengers for the protection of humans against organophosphate toxicity . Chem. Biol. Interact. , 157–158 , 167 – 171 . Duysen , E.G. , Bartels , C.F. and Lockridge , O. ( 2002 ) Wild‐Type and A328W mutant human butyrylcholinesterase tetramers expressed in Chinese hamster ovary cells have a 16‐hour half‐life in the circulation and protect mice from cocaine toxicity . J. Pharmacol. Exp. Ther. , 302 , 751 – 758 . Evron , T. , Geyer , B.C. , Cherni , I. , Muralidharan , M. , Kilbourne , J. , Fletcher , S.P. , Soreq , H. and Mor , T.S. ( 2007 ) Plant‐derived human acetylcholinesterase‐R provides protection from lethal organophosphate poisoning and its chronic aftermath . FASEB J. , 21 , 2961 – 2969 . Feldbrugge , M. , Arizti , P. , Sullivan , M.L. , Zamore , P.D. , Belasco , J.G. and Green , P.J. ( 2002 ) Comparative analysis of the plant mRNA‐destabilizing element, DST, in mammalian and tobacco cells . Plant Mol. Biol. , 49 , 215 – 223 . Geyer , B.C. , Muralidharan , M. , Cherni , I. , Doran , J. , Fletcher , S.P. , Evron , T. , Soreq , H. and Mor , T.S. ( 2005 ) Purification of transgenic plant‐derived recombinant human acetylcholinesterase‐R . Chem. Biol. Interact. , 157–158 , 331 – 334 . Geyer , B.C. , Fletcher , S.P. , Griffin , T.A. , Lopker , M.J. , Soreq , H. and Mor , T.S. ( 2007 ) Translational control of recombinant human acetylcholinesterase accumulation in plants . BMC Biotechnol , 7 , 27 . Gnatt , A. , Loewenstein , Y. , Yaron , A. , Schwarz , M. and Soreq , H. ( 1994 ) Site‐directed mutagenesis of active site residues reveals plasticity of human butyrylcholinesterase in substrate and inhibitor interactions . J. Neurochem. , 62 , 749 – 755 . Gomord , V. and Faye , L. ( 2004 ) Posttranslational modification of therapeutic proteins in plants . Curr. Opin. Plant Biol. , 7 , 171 – 181 . Greenfield , R.A. , Brown , B.R. , Hutchins , J.B. , Iandolo , J.J. , Jackson , R. , Slater , L.N. and Bronze , M.S. ( 2002 ) Microbiological, biological, and chemical weapons of warfare and terrorism . Am. J. Med. Sci. , 323 , 326 – 340 . Grunwald , J. , Marcus , D. , Papier , Y. , Raveh , L. , Pittel , Z. and Ashani , Y. ( 1997 ) Large‐scale purification and long‐term stability of human butyrylcholinesterase: a potential bioscavenger drug . J. Biochem. Biophys. Methods , 34 , 123 – 135 . Hebsgaard , S.M. , Korning , P.G. , Tolstrup , N. , Engelbrecht , J. , Rouze , P. and Brunak , S. ( 1996 ) Splice site prediction in Arabidopsis thaliana pre‐mRNA by combining local and global sequence information . Nucleic Acids Res. , 24 , 3439 – 3452 . Hermentin , P. , Witzel , R. , Kanzy , E.J. , Diderrich , G. , Hoffmann , D. , Metzner , H. , Vorlop , J. and Haupt , H. ( 1996 ) The hypothetical N‐glycan charge: a number that characterizes protein glycosylation . Glycobiology , 6 , 217 – 230 . Huang , Y.J. , Huang , Y. , Baldassarre , H. , Wang , B. , Lazaris , A. , Leduc , M. , Bilodeau , A.S. , Bellemare , A. , Cote , M. , Herskovits , P. , Touati , M. , Turcotte , C. , Valeanu , L. , Lemee , N. , Wilgus , H. , Begin , I. , Bhatia , B. , Rao , K. , Neveu , N. , Brochu , E. , Pierson , J. , Hockley , D.K. , Cerasoli , D.M. , Lenz , D.E. , Karatzas , C.N. and Langermann , S. ( 2007 ) Recombinant human butyrylcholinesterase from milk of transgenic animals to protect against organophosphate poisoning . Proc. Natl. Acad. Sci. USA , 104 , 13603 – 13608 . Ikemura , T. ( 1985 ) Codon usage and tRNA content in unicellular and multicellular organisms . Mol. Biol. Evol. , 2 , 13 – 34 . Ingvarsson , P.K. ( 2008 ) Molecular evolution of synonymous codon usage in Populus . BMC Evol Biol. , 8 , 307 . Jintana , S. , Sming , K. , Krongtong , Y. and Thanyachai , S. ( 2009 ) Cholinesterase activity, pesticide exposure and health impact in a population exposed to organophosphates . Int Arch Occup Environ Health , 82 , 833 – 842 . Johnson , N.H. , Larsen , J.C. and Meek , E. ( 2009 ) Historical Perspective of Chemical Warfare Agents . In Handbook of Toxicology of Chemical Warfare Agents ( Ramesh , C.G. , ed.), pp. 7 – 16 , San Diego: Academic Press . Kanaya , S. , Yamada , Y. , Kinouchi , M. , Kudo , Y. and Ikemura , T. ( 2001 ) Codon usage and tRNA genes in eukaryotes: correlation of codon usage diversity with translation efficiency and with CG‐dinucleotide usage as assessed by multivariate analysis . J. Mol. Evol. , 53 , 290 – 298 . Kaplan , D. , Ordentlich , A. , Barak , D. , Ariel , N. , Kronman , C. , Velan , B. and Shafferman , A. ( 2001 ) Does “butyrylization” of acetylcholinesterase through substitution of the six divergent aromatic amino acids in the active center gorge generate an enzyme mimic of butyrylcholinesterase? Biochemistry , 40 , 7433 – 7445 . Komar , A.A. ( 2009 ) A pause for thought along the co‐translational folding pathway . Trends Biochem. Sci. , 34 , 16 – 24 . Kudla , G. , Murray , A.W. , Tollervey , D. and Plotkin , J.B. ( 2009 ) Coding‐sequence determinants of gene expression in Escherichia coli . Science , 324 , 255 – 258 . Lee , E.C. ( 2003 ) Clinical manifestations of sarin nerve gas exposure . JAMA , 290 , 659 – 662 . Lee , H.H. , Choi , R.C. , Ting , A.K. , Siow , N.L. , Jiang , J.X. , Massoulie , J. and Tsim , K.W. ( 2004 ) Transcriptional regulation of acetylcholinesterase‐associated collagen ColQ: differential expression in fast and slow twitch muscle fibers is driven by distinct promoters . J. Biol. Chem. , 279 , 27098 – 27107 . Li , H. , Schopfer , L.M. , Masson , P. and Lockridge , O. ( 2008 ) Lamellipodin proline rich peptides associated with native plasma butyrylcholinesterase tetramers . Biochem. J. , 411 , 425 – 432 . Liu , D. ( 2009 ) Design of gene constructs for transgenic maize . Methods Mol. Biol. , 526 , 3 – 20 . Lockridge , O. , Blong , R.M. , Masson , P. , Froment , M.T. , Millard , C.B. and Broomfield , C.A. ( 1997 ) A single amino acid substitution, Gly117His, confers phosphotriesterase (organophosphorus acid anhydride hydrolase) activity on human butyrylcholinesterase . Biochemistry , 36 , 786 – 795 . Loke , J.C. , Stahlberg , E.A. , Strenski , D.G. , Haas , B.J. , Wood , P.C. and Li , Q.Q. ( 2005 ) Compilation of mRNA polyadenylation signals in Arabidopsis revealed a new signal element and potential secondary structures . Plant Physiol. , 138 , 1457 – 1468 . Maclean , J. , Koekemoer , M. , Olivier , A.J. , Stewart , D. , Hitzeroth II , Rademacher , T. , Fischer , R. , Williamson , A.L. and Rybicki , E.P. ( 2007 ) Optimization of human papillomavirus type 16 (HPV‐16) L1 expression in plants: comparison of the suitability of different HPV‐16 L1 gene variants and different cell‐compartment localization . J. Gen. Virol. , 88 , 1460 – 1469 . Matoba , N. , Kajiura , H. , Cherni , I. , Doran , J.D. , Alfsen , A. , Bomsel , M. , Fujiyama , K. and Mor , T.S. ( 2009 ) Biochemical and immunological characterization of the plant‐derived candidate HIV‐1 mucosal vaccine CTB MPR 649 684 . Plant Biotechnol. J. , 7 , 129 – 145 . Mor , T.S. , Sternfeld , M. , Soreq , H. , Arntzen , C.J. and Mason , H.S. ( 2001 ) Expression of recombinant human acetylcholinesterase in transgenic tomato plants . Biotechnol Bioeng , 75 , 259 – 266 . Mukhopadhyay , P. , Basak , S. and Ghosh , T.C. ( 2008 ) Differential selective constraints shaping codon usage pattern of housekeeping and tissue‐specific homologous genes of rice and arabidopsis . DNA Res. , 15 , 347 – 356 . Murray , E.E. , Lotzer , J. and Eberle , M. ( 1989 ) Codon usage in plant genes . Nucleic Acids Res. , 17 , 477 – 498 . Nakamura , Y. ( 2005 ) Codon Usage Database . Narsai , R. , Howell , K.A. , Millar , A.H. , O’Toole , N. , Small , I. and Whelan , J. ( 2007 ) Genome‐wide analysis of mRNA decay rates and their determinants in Arabidopsis thaliana . Plant Cell , 19 , 3418 – 3436 . Ohme‐Takagi , M. , Taylor , C.B. , Newman , T.C. and Green , P.J. ( 1993 ) The effect of sequences with high AU content on mRNA stability in tobacco . Proc. Natl. Acad. Sci. USA , 90 , 11811 – 11815 . Pearce , G. , Siems , W.F. , Bhattacharya , R. , Chen , Y.C. and Ryan , C.A. ( 2007 ) Three hydroxyproline‐rich glycopeptides derived from a single petunia polyprotein precursor activate defensin I, a pathogen defense response gene . J. Biol. Chem. , 282 , 17777 – 17784 . Perrier , A.L. , Massoulie , J. and Krejci , E. ( 2002 ) PRiMA: the membrane anchor of acetylcholinesterase in the brain . Neuron , 33 , 275 – 285 . Petroianu , G.A. , Arafat , K. , Schmitt , A. and Hasan , M.Y. ( 2005 ) Weak inhibitors protect cholinesterases from strong inhibitors (paraoxon): in vitro effect of ranitidine . J. Appl. Toxicol. , 25 , 60 – 67 . Petruccelli , S. , Otegui , M.S. , Lareu , F. , Tran Dinh , O. , Fitchette , A.C. , Circosta , A. , Rumbo , M. , Bardor , M. , Carcamo , R. , Gomord , V. and Beachy , R.N. ( 2006 ) A KDEL‐tagged monoclonal antibody is efficiently retained in the endoplasmic reticulum in leaves, but is both partially secreted and sorted to protein storage vacuoles in seeds . Plant Biotechnol. J. , 4 , 511 – 527 . Prody , C.A. , Zevin‐Sonkin , D. , Gnatt , A. , Goldberg , O. and Soreq , H. ( 1987 ) Isolation and characterization of full‐length cDNA clones coding for cholinesterase from fetal human tissues . Proc. Natl Acad. Sci. USA , 84 , 3555 – 3559 . Ray , D.E. and Richards , P.G. ( 2001 ) The potential for toxic effects of chronic, low‐dose exposure to organophosphates . Toxicol. Lett. , 120 , 343 – 351 . Dos Reis , M. and Wernisch , L. ( 2009 ) Estimating translational selection in eukaryotic genomes . Mol. Biol. Evol. , 26 , 451 – 461 . Rosano , G.L. and Ceccarelli , E.A. ( 2009 ) Rare codon content affects the solubility of recombinant proteins in a codon bias‐adjusted Escherichia coli strain . Microb Cell Fact , 8 , 41 . Saint‐Jore‐Dupas , C. , Faye , L. and Gomord , V. ( 2007 ) From planta to pharma with glycosylation in the toolbox . Trends Biotechnol , 25 , 317 – 323 . Saxena , A. , Sun , W. , Luo , C. , Myers , T.M. , Koplovitz , I. , Lenz , D.E. and Doctor , B.P. ( 2006 ) Bioscavenger for protection from toxicity of organophosphorus compounds . J. Mol. Neurosci. , 30 , 145 – 148 . Sharp , P.M. and Li , W.H. ( 1987 ) The codon Adaptation Index‐‐a measure of directional synonymous codon usage bias, and its potential applications . Nucleic Acids Res. , 15 , 1281 – 1295 . Soreq , H. , Seidman , S. , Dreyfus , P.A. , Zevin‐Sonkin , D. and Zakut , H. ( 1989 ) Expression and tissue‐specific assembly of human butyrylcholine esterase in microinjected xenopus‐laevis oocytes . J. Biol. Chem. , 264 , 10608 – 10613 . Suo , G. , Chen , B. , Zhang , J. , Duan , Z. , He , Z. , Yao , W. , Yue , C. and Dai , J. ( 2006 ) Effects of codon modification on human BMP2 gene expression in tobacco plants . Plant Cell Rep. , 25 , 689 – 697 . Tretter , V. , Altmann , F. and Marz , L. ( 1991 ) Peptide‐N4‐(N‐acetyl‐beta‐glucosaminyl)asparagine amidase F cannot release glycans with fucose attached alpha 1‐‐‐‐3 to the asparagine‐linked N‐acetylglucosamine residue . Eur. J. Biochem. , 199 , 647 – 652 . Wang , I.N. , Li , Y. , Que , Q. , Bhattacharya , M. , Lane , L.C. , Chaney , W.G. and Van Etten , J.L. ( 1993 ) Evidence for virus‐encoded glycosylation specificity . Proc. Natl. Acad. Sci. USA , 90 , 3840 – 3844 .

Journal

Plant Biotechnology Journal – Wiley

Published: Oct 1, 2010

Keywords: ; ; ; ; ;

There are no references for this article.