Access the full text.
Sign up today, get DeepDyve free for 14 days.
W. Hess, A. Prombona, Birte Fieder, A. Subramanian, T. Börner (1993)
Chloroplast rps15 and the rpoB/C1/C2 gene cluster are strongly transcribed in ribosome‐deficient plastids: evidence for a functioning non‐chloroplast‐encoded RNA polymerase.The EMBO Journal, 12
C. Raskin, G. Diaz, W. Mcallister (1993)
T7 RNA polymerase mutants with altered promoter specificities.Proceedings of the National Academy of Sciences of the United States of America, 90
Y. Sasaki, T. Konishi, Y. Nagano (1995)
The Compartmentation of Acetyl-Coenzyme A Carboxylase in Plants, 108
(1993)
Primer extension reactions were carried out on 10 mg (wild-type) or Baumgartner
G. lgloi, H. Kössel (1992)
The transcriptional apparatus of chloroplastsCritical Reviews in Plant Sciences, 10
M. Kim, J. Mullet (1995)
Identification of a sequence-specific DNA binding factor required for transcription of the barley chloroplast blue light-responsive psbD-psbC promoter.The Plant cell, 7
A. Dubell, J. Mullet (1995)
Differential Transcription of Pea Chloroplast Genes during Light-Induced Leaf Development (Continuous Far-Red Light Activates Chloroplast Transcription), 109
K. Shinozaki, M. Ohme, Minoru Tanaka, T. Wakasugi, N. Hayashida, T. Matsubayashi, N. Zaita, J. Chunwongse, J. Obokata, K. Yamaguchi-Shinozaki, C. Ohto, K. Torazawa, B. Meng, M. Sugita, H. Deno, T. Kamogashira, Kyoji Yamada, J. Kusuda, F. Takaiwa, A. Kato, N. Tohdoh, H. Shimada, M. Sugiura (1986)
The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expressionThe EMBO Journal, 5
E. Sun, B. Wu, K. Tewari (1989)
In vitro analysis of the pea chloroplast 16S rRNA gene promoterMolecular and Cellular Biology, 9
(1995)
Differential transcription of pea ORF 1901 31451 CTTCATGCATAAGGATACTAGATTACC chloroplast genes during light - induced leaf development
K. Wolfe, C. Morden, J. Palmer (1992)
Small single-copy region of plastid DNA in the non-photosynthetic angiosperm Epifagus virginiana contains only two genes. Differences among dicots, monocots and bryophytes in gene organization at a non-bioenergetic locus.Journal of molecular biology, 223 1
Underlined oligonucleotides were transcribed early in barley (Hordeum vulgare) chloroplast also used to generate the capping constructs
J. Mullet (1993)
Dynamic Regulation of Chloroplast Transcription, 103
(1989)
Initiation and processing of atp 6 , T - locus
S. Lerbs-Mache (1993)
The 110-kDa polypeptide of spinach plastid DNA-dependent RNA polymerase: single-subunit enzyme or catalytic core of multimeric enzyme complexes?Proceedings of the National Academy of Sciences of the United States of America, 90 12
W. Gruissem, J. Tonkyn (1993)
Control mechanisms of plastid gene expressionCritical Reviews in Plant Sciences, 12
G. Link (1996)
Green life: Control of chloroplast gene transcriptionBioEssays, 18
B. Baumgartner, J. Rapp, John Mullet (1993)
Plastid Genes Encoding the Transcription/Translation Apparatus Are Differentially Transcribed Early in Barley (Hordeum vulgare) Chloroplast Development (Evidence for Selective Stabilization of psbA mRNA), 101
Gerhard Link (1994)
Plastid differentiation: organelle promoters and transcription factors.Results and problems in cell differentiation, 20
B. Cammue, K. Thevissen, Marijke Hendriks, K. Eggermont, lnge Goderis, P. Proost, J. Damme, R. Osborn, Franqoise Guerbette, J. Kader, W. Broekaert (1995)
A Potent Antimicrobial Protein from Onion Seeds Showing Sequence Homology to Plant Lipid Transfer Proteins, 109
Yukiko Sasaki, Kazuhiko Hakamada, Yukiko Suama, Yukio Nagano, Iwao FurusawaS, R. Matsuno (1993)
Chloroplast-encoded protein as a subunit of acetyl-CoA carboxylase in pea plant.The Journal of biological chemistry, 268 33
D. Dempsey, maris Amick, K. Wobbe, D. Klessig (1993)
Resistance and susceptible responses of Arabidopsis thaliana to turnip crinkle virusPhytopathology, 83
L. Allison, L. Simon, P. Maliga (1996)
Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants.The EMBO Journal, 15
Lori Allison, P. Maliga (1995)
Light‐responsive and transcription‐enhancing elements regulate the plastid psbD core promoter.The EMBO Journal, 14
M. Maurizi, W. Clark, Soon-Young Kim, S. Gottesman (1990)
Clp P represents a unique family of serine proteases.The Journal of biological chemistry, 265 21
R. Iratni, L. Baeza, A. Andreeva, R. Mache, S. Lerbs-Mache (1994)
Regulation of rDNA transcription in chloroplasts: promoter exclusion by constitutive repression.Genes & development, 8 23
The plastid genome in photosynthetic higher plants encodes subunits of an Escherichia coli‐like RNA polymerase (PEP) which initiates transcription from E.coli σ70‐type promoters. We have previously established the existence of a second nuclear‐encoded plastid RNA polymerase (NEP) in photosynthetic higher plants. We report here that many plastid genes and operons have at least one promoter each for PEP and NEP (Class II transcription unit). However, a subset of plastid genes, including photosystem I and II genes, are transcribed from PEP promoters only (Class I genes), while in some instances (e.g. accD) genes are transcribed exclusively by NEP (Class III genes). Sequence alignment identified a 10 nucleotide NEP promoter consensus around the transcription initiation site. Distinct NEP and PEP promoters reported here provide a general mechanism for group‐specific gene expression through recognition by the two RNA polymerases.
The EMBO Journal – Wiley
Published: Jan 1, 1997
Keywords: ; ; ; ;
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.