Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

First report of Maize rough dwarf virus (MRDV) on maize crops in Greece

First report of Maize rough dwarf virus (MRDV) on maize crops in Greece In summer 2002, maize ( Zea mays ) crops grown in northern Greece (Macedonia) showed severe dwarfing, reduced corncob size and, in some cases, leaf reddening. These symptoms were different from those caused by Maize dwarf mosaic virus , which is endemic in maize crops in Macedonia. The dwarfing disease was only epidemic in 2002 and in some maize‐growing regions (Imathia and Serres), where crop losses were estimated to be over 70%. In contrast, in 2003 only a few cases were recorded. The symptoms were similar to those caused by two closely related members of the genus Fijivirus , Maize rough dwarf virus (MRDV) and Rice black‐streaked dwarf virus (RBSDV) ( Azuhata ., 1993 ). The putative virus could not be transmitted mechanically (sap applied by rubbing the leaves) from maize to maize or to other indicator plants. An RT‐PCR was developed and optimized for the detection of both MRDV and RBSDV. Two primers (‘MRDV‐F1’, 5′‐AGCGGAGAACGTTTGGATC‐3′; and ‘MRDV‐R2’, 5′‐TTAACAACAGCAGCTTCACC‐3′) were designed from highly conserved regions within both viral genomes (segment 8 from MRDV and 9 from RBSDV). Total RNA was extracted, denatured at 95°C in the presence of 1 µ m primer ‘MRDV‐R2’ and 10% DMSO, before being used as template for reverse transcription (RT). RT and subsequent PCR were performed according to standard protocols ( Dovas ., 2001 ) with an annealing temperature of 60°C used in PCR. RT‐PCR using total RNA from 15 plants showing typical dwarfing symptoms gave the expected 568‐bp product, which was subsequently cloned and sequenced. Sequence comparisons revealed 96% identity with genome segment 8 of an Italian isolate of MRDV (L76561) ( Marzachi ., 1996 ), whereas identity with genome segment 9 of two RBSDV isolates from China (AF459812, AY050486) was 85% ( Bai ., 2002 ). The presence of MRDV was further confirmed by ELISA using polyclonal antibodies (Bio‐Rad Phyto‐Diagnostics, France). More than 50 samples collected from Imathia and Serres area, showing MRDV symptoms, tested positive by ELISA. This is the first report of MRDV in Greece. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Pathology Wiley

First report of Maize rough dwarf virus (MRDV) on maize crops in Greece

Dovas, C. I.; Eythymiou, K.; Katis, N. I.
Plant Pathology , Volume 53 (2) – Apr 1, 2004
Download PDF
1 page

Loading next page...
 
/lp/wiley/first-report-of-maize-rough-dwarf-virus-mrdv-on-maize-crops-in-greece-MoOtiwDrPt

References (4)

Publisher
Wiley
Copyright
Copyright © 2004 Wiley Subscription Services, Inc., A Wiley Company
ISSN
0032-0862
eISSN
1365-3059
DOI
10.1111/j.0032-0862.2004.00973.x
Publisher site
See Article on Publisher Site

Abstract

In summer 2002, maize ( Zea mays ) crops grown in northern Greece (Macedonia) showed severe dwarfing, reduced corncob size and, in some cases, leaf reddening. These symptoms were different from those caused by Maize dwarf mosaic virus , which is endemic in maize crops in Macedonia. The dwarfing disease was only epidemic in 2002 and in some maize‐growing regions (Imathia and Serres), where crop losses were estimated to be over 70%. In contrast, in 2003 only a few cases were recorded. The symptoms were similar to those caused by two closely related members of the genus Fijivirus , Maize rough dwarf virus (MRDV) and Rice black‐streaked dwarf virus (RBSDV) ( Azuhata ., 1993 ). The putative virus could not be transmitted mechanically (sap applied by rubbing the leaves) from maize to maize or to other indicator plants. An RT‐PCR was developed and optimized for the detection of both MRDV and RBSDV. Two primers (‘MRDV‐F1’, 5′‐AGCGGAGAACGTTTGGATC‐3′; and ‘MRDV‐R2’, 5′‐TTAACAACAGCAGCTTCACC‐3′) were designed from highly conserved regions within both viral genomes (segment 8 from MRDV and 9 from RBSDV). Total RNA was extracted, denatured at 95°C in the presence of 1 µ m primer ‘MRDV‐R2’ and 10% DMSO, before being used as template for reverse transcription (RT). RT and subsequent PCR were performed according to standard protocols ( Dovas ., 2001 ) with an annealing temperature of 60°C used in PCR. RT‐PCR using total RNA from 15 plants showing typical dwarfing symptoms gave the expected 568‐bp product, which was subsequently cloned and sequenced. Sequence comparisons revealed 96% identity with genome segment 8 of an Italian isolate of MRDV (L76561) ( Marzachi ., 1996 ), whereas identity with genome segment 9 of two RBSDV isolates from China (AF459812, AY050486) was 85% ( Bai ., 2002 ). The presence of MRDV was further confirmed by ELISA using polyclonal antibodies (Bio‐Rad Phyto‐Diagnostics, France). More than 50 samples collected from Imathia and Serres area, showing MRDV symptoms, tested positive by ELISA. This is the first report of MRDV in Greece.

Journal

Plant Pathology – Wiley

Published: Apr 1, 2004

There are no references for this article.