Access the full text.
Sign up today, get DeepDyve free for 14 days.
C. Chothia, A. Lesk, A. Tramontano, M. Levitt, S. Smith‐Gill, G. Air, S. Sheriff, E. Padlan, David Davies, W. Tulip, P. Colman, S. Spinelli, P. Alzari, R. Poljak (1989)
Conformations of immunoglobulin hypervariable regionsNature, 342
0 TAGGATATCCACCATGGAGACCCCCGCCCAGCTGCTGTTCC TGTTGCTGCTTTGGCTTCCAGATACTACCGGTGACATCCAGATGACCCAG-3 0
W. Pardridge (2001)
Brain drug targeting: Linker strategies: the engineering of multifunctional drug formulations
H. Lee, R. Boado, D. Braasch, D. Corey, W. Pardridge (2002)
Imaging gene expression in the brain in vivo in a transgenic mouse model of Huntington's disease with an antisense radiopharmaceutical and drug-targeting technology.Journal of nuclear medicine : official publication, Society of Nuclear Medicine, 43 7
L. Koetzner, S. Deng, T. Sumpter, Michael Weisslitz, Ronald Abner, D. Landry, J. Woods (2001)
Titer-dependent antagonism of cocaine following active immunization in rhesus monkeys.The Journal of pharmacology and experimental therapeutics, 296 3
D. Wu, J. Yang, W. Pardridge (1997)
Drug targeting of a peptide radiopharmaceutical through the primate blood-brain barrier in vivo with a monoclonal antibody to the human insulin receptor.The Journal of clinical investigation, 100 7
W. Pardridge, Young-Sook Kang, J. Buciak, Jing Yang (1995)
Human Insulin Receptor Monoclonal Antibody Undergoes High Affinity Binding to Human Brain Capillaries in Vitro and Rapid Transcytosis Through the Blood–Brain Barrier in Vivo in the PrimatePharmaceutical Research, 12
W. Pardridge, J. Eisenberg, Jing Yang (1985)
Human Blood—Brain Barrier Insulin ReceptorJournal of Neurochemistry, 44
Peter Jones, P. Dear, J. Foote, M. Neuberger, G. Winter (1986)
Replacing the complementarity-determining regions in a human antibody with those from a mouseNature, 321
Primer 3 forward 5 0
R. Boado, Jian Li, Marie Nagaya, Crystal Zhang, W. Pardridge (1999)
Selective expression of the large neutral amino acid transporter at the blood-brain barrier.Proceedings of the National Academy of Sciences of the United States of America, 96 21
P. Nicholls, V. Johnson, M. Blanford, S. Andrew (1993)
An improved method for generating single-chain antibodies from hybridomas.Journal of immunological methods, 165 1
W. Pardridge, J. Buciak, P. Friden (1991)
Selective transport of an anti-transferrin receptor antibody through the blood-brain barrier in vivo.The Journal of pharmacology and experimental therapeutics, 259 1
W. Hwang, J. Foote (2005)
Immunogenicity of engineered antibodies.Methods, 36 1
R. Boado, W. Pardridge (1991)
A One‐Step Procedure for Isolation of Poly(A)+ mRNA from Isolated Brain Capillaries and Endothelial Cells in CultureJournal of Neurochemistry, 57
E. Kabat, Te Wu (1991)
Identical V region amino acid sequences and segments of sequences in antibodies of different specificities. Relative contributions of VH and VL genes, minigenes, and complementarity-determining regions to binding of antibody-combining sites.Journal of immunology, 147 5
M. Coloma, Hwa Lee, A. Kurihara, Elliot Landaw, R. Boado, Sherie Morrison, W. Pardridge (2000)
Transport Across the Primate Blood-Brain Barrier of a Genetically Engineered Chimeric Monoclonal Antibody to the Human Insulin ReceptorPharmaceutical Research, 17
0 AGTGGTAGCGGTACCGACTACACCTTCACCATCAGCAGCTTACAGCCAGAGGACATCGCCACCTACTATTGCCTACAGTATTCTA GTTCT-3 0
Yun Zhang, F. Schlachetzki, W. Pardridge (2003)
Global non-viral gene transfer to the primate brain following intravenous administration.Molecular therapy : the journal of the American Society of Gene Therapy, 7 1
Jian Li, Keijiro Sugimura, R. Boado, Hwa Lee, Crystal Zhang, Stefan Duebel, W. Pardridge (1999)
Genetically engineered brain drug delivery vectors: cloning, expression and in vivo application of an anti-transferrin receptor single chain antibody-streptavidin fusion gene and protein.Protein engineering, 12 9
J. Mukherjee, B. Christian, T. Narayanan, B. Shi, J. Mantil (2001)
Evaluation of Dopamine D-2 Receptor Occupancy by Clozapine, Risperidone, and Haloperidol In Vivo in the Rodent and Nonhuman Primate Brain Using 18F-FallyprideNeuropsychopharmacology, 25
0 GTCCTGACTAGCCCGACAAGTAATGGTCACTCTGTCACCCAC
A murine monoclonal antibody (MAb) to the human insulin receptor (HIR) has been engineered for use as a brain drug delivery system for transport across the human blood–brain barrier (BBB). The HIRMAb was humanized by complementarity determining region (CDR) grafting on the framework regions (FR) of the human B43 IgG heavy chain and the human REI kappa light chain. A problem encountered in the humanization process was the poor secretion of the CDR‐grafted HIRMAb by myeloma cells. This problem was solved by the production of human/mouse hybrids of the engineered heavy chain variable region (VH), which led to the replacement of five amino acids in the FR3 of the VH with original murine amino acids. No replacement of FR amino acids in the light chain variable region (VL) was required. The affinity of the humanized HIRMAb for the HIR was decreased 27% relative to the murine HIRMAb. The humanized HIRMAb avidly bound to the HIR of isolated human brain capillaries, which are used as an in vitro model system of the human BBB. The HIRMAb cross reacts with the HIR of Old World primates such as the Rhesus monkey. The humanized HIRMAb was radiolabeled with 125‐iodine, and injected intravenously into an adult, anesthetized Rhesus monkey. Brain scanning showed the humanized HIRMAb was rapidly transported into all parts of the primate brain after intravenous administration. The humanized HIRMAb may be used as a brain drug and gene delivery system for the targeting of large molecule therapeutics across the BBB in humans. Biotechnol. Bioeng. 2007;96: 381–391. © 2006 Wiley Periodicals, Inc.
Biotechnology and Bioengineering – Wiley
Published: Feb 1, 2007
Keywords: blood–brain barrier; drug targeting; endothelium; Rhesus monkey
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.