Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Molecular cloning and expression of the murine interleukin‐5 receptor.

Molecular cloning and expression of the murine interleukin‐5 receptor. The EMBO Journal vol.9 no.13 pp.4367-4374, 1990 Molecular cloning and expression of the murine interleukin-5 receptor Satoshi Takaki, Akira Tominaga, et Tominaga al., 1989, 1990), IL-5 induces expression of IL-2 receptor B Yasumichi Hitoshi, Seiji Mita, Eiichiro Sonoda, (Tac) on and T cells (Loughnan et al., 1987; Naoto Yamaguchi and Harada et al., 1987; Takatsu et al., 1987; Nakanishi et al., Kiyoshi Takatsu 1988), and promotes growth and differentiation of Department of Biology, Institute for Medical Immunology, Kumamoto eosinophils (Yokota et al., 1987; Sanderson et al., 1988; University Medical School, Kumamoto 860, Japan Yamaguchi et al., 1988). Communicated by G.Kohler To elucidate how IL-5 can mediate multiple functions in various target cells, we attempted to explore a molecular Murine interleukin-5 is known to play an essential (IL-5) and biochemical characteristics of the receptor. We have role in Ig production of B cells and proliferation and shown from the series of binding and cross-linking studies differentiation of eosinophils. Here, we have isolated that murine IL-5 binds to a specific cell surface receptor with cDNA clones encoding a murine IL-5 receptor by - - both high (KD 150 pM) and low affinity (KD 30 nM) expression screening of a library prepared from a murine and that at least two polypeptides may comprise the IL-5 dependent early B cell line. A cDNA library was functional IL-5 receptor (Mita et al., 1988, 1989). expressed in COS7 cells and screened by panning with Subsequently, we prepared two monoclonal antibodies the use of anti-IL-5 receptor monoclonal antibodies. The (MAbs), designated H7 and T21, which completely inhibit deduced amino acid sequence analysis demonstrates that the binding of IL-5 to its receptor (Yamaguchi et al., 1990; the receptor is a glycoprotein of 415 amino acids (Mr Hitoshi et al., 1990). The MAbs recognize a 60 kd cell- 45 284), including an N-terminal hydrophobic region (17 surface on protein expressed IL-5 responsive cells but not amino a acids), glycosylated extracellular domain (322 on IL-5 unresponsive cells. Thus, the 60 kd protein amino a acids), single transmembrane segment (22 amino recognized by both H7 and T21 MAbs is presumably a acids) and a tail cytoplasmic (54 amino acids). COS7 cells component of the IL-5 receptor. transfected with the cDNA expressed a 60 kd protein Here we report the isolation of a cDNA an encoding IL-5 that = bound IL-5 with a single class of affinity (KD receptor utilizing an from expression cloning strategy murine 2-10 nM). FDC-P1 cells transfected with the cDNA for B cell early line with the use of H7 and T21. Recombinant murine [L-5 receptor showed the expression of IL-5 bind- IL-5 receptor expressed on COS7 cells shows similar binding sites = ing with both low (KD 6 nM) and high affinity and biochemical characteristics to those of properties the = 30 (KD and acquired responsiveness to IL-5 for native with low on the surface of pM) receptor affinity murine proliferation, although parental FDC-P1 cells did not IL-5 responsive cell lines. the introduction Intriguingly, of show IL-S any detectable binding. In addition, several the cDNA into a murine IL-5 receptor hematopoietic cDNA clones encoding soluble forms of the IL-5 receptor progenitor cell line resulted in the expression of functional were isolated. Northern blot analysis showed that two murine IL-5 that the cloned receptor, indicating IL-5 receptor of species mRNAs (5.0 kb and 5.8 kb) were detected in is a of functional with component IL-5 receptor high affinity. cell lines that display binding sites for murine IL-5. We also isolated cDNA clones soluble forms of encoding Homology search for the amino acid sequence of the IL-S IL-5 receptor. Analysis of the of IL-5 sequence receptor receptor reveals that the IL-5 receptor contains a demonstrates that the IL-5 is a member of a receptor growth common motif of a cytokine receptor that is factor family receptor family (Bazan, 1989). recently identified. words: cDNA Key cloning/cytokine receptor family/murine Results IL-5 receptor/soluble receptor Isolation of the munne IL-5 receptor cDNA In order to isolate the cDNA clones for IL-5 we receptor, in have applied an COS7 cells expression screening strategy Introduction with of anti-murine H7 the use two IL-5 receptor MAbs, defined as T factor and T21. cDNA IL-5, previously cell-replacing (TRF) We constructed a x 106 library (-2 (Takatsu et al., or B cell factor II from a murine B cell 1980, 1990), growth clones) IL-5 dependent early line, Y16, et is an inducible in the mammalian CDM8 (BCGFII) (Swain al., 1983) glycoprotein expression vector, (Seed, 1987). primarily produced by activated T cells et Y16 cells surface (Takatsu al., 1988; (B220+, Ly-1 +, cytoplasmic Ig-, Ig-, Swain et et A cDNA la- and the most abundant number of al., 1988; Tominaga al., 1988). FcR+) expressed and human examined. murine et IL-5 IL-5 the cell lines that we encoding (Kinashi al., 1986) receptor among Plasmid has been were transfected into (Azuma et al., Yokota et DNAs of the cDNA COS7 1986; al., 1987) isolated, library cells, now available. has been shown clones rise and recombinant IL-5 is IL-5 and cDNA to the of the giving expression to a broader of activities. In were screened possess spectrum antigenic biological epitopes by panning procedures addition to and differentiation of H7 and T21 MAbs. After four of the using cycles inducing proliferation screening, B et Sonoda et clones were further screened the murine cells (Kinashi positive al., 1986; al., 1989; by panning using Press Oxford University et al. S.Takaki intact H7 MAbs and Petri dishes coated with F(ab')2 To avoid possible rearrangements and mutations of recovered fragments of anti-rat IgG to avoid the selection of cDNA plasmids from COS7 we screened the cells, original and encoding Fc receptor and these screenings were repeated other Y16 cDNA libraries using pIL-5R.8 cDNA as a twice. Resulting individual plasmid clones were transfected hybridization probe and isolated several independent cDNA into COS7 cells and analyzed for H7 binding by flow clones (pIL-5R. 13, pIL-5R.2, and pIL-5R.39) (Figure lA). cytofluorometry, and we finally obtained a clone pIL-5R.8. The inserts of and pIL-5R.8 pIL-5R. 13 were sequenced I I Sacl Hind III Sac Pst I I 5 b pIL-5R.8 pIL-5R.13 pIL-5R.2 pIL-5R.39 -302 GAAATAATTGGTAAACACAGAAAATGTTTCAATAGAAAAAAGAGGAAACAGAACACTGTGTAGC _ - 2 38 CCTGTTATCAGCAGAGACAGAGCTAMCGCTGGGGATACCAAACTAGAAGAAGCTCACTGGACAGGTCCCGGTATGCAGTTCTATTTTTGTTGATGGCTCTGTATCTAATGTGTTCATTT -119 GTACCAAGGATCTAACCAGGGTCTTCCAGAGTCTGAGCAAGCTTCTCCCACTGAGCTACATCACAGCCCCCTGTTTATTGGAAGAAGAAATACTTACACCTTTCCAGTATTCGGCTACC ATG GTG CCT GTG 1 TTA CTA ATT CTT GTG GGA GCT TTG GCA ACA CTG CAA GCT GAC TTA CTT AAT CAC AAA AAG TTT TTA CTT CTA CCT CCA Met Val Pro Val Leu Leul Ile LeuVal Glv Ala LuAla Thr Leu Gln Ala Leu Leu 1 Asn His Phe Leu Leu Leu Pro Pro Asp Lys Lys 91 GTC AAT TTT ACC ATT AAA GCC ACT GGA TTA GCT CAA GTT CTT TTA CATGGCCAATCTGCCAGGCAAGCTGT GACT Val Phe Thr Ile Ala Thr Leu Ala Gln 31 Lys Gly Val Lou Leu His Trp Asp Pro Asn Pro Asp Gln Glu Gln Arg His Val Asp Leu 181 GAG TAT CAC GTG AAA ATA AAT GCC CCA CAA GAA GAC GAA TAT GAT ACC AGA AAG ACT GAA AGC AAA TGT GTG ACC CCC CTT CAT GAA GGC Glu Val Ile Asn 61 Tyr His Lys Ala Pro Gln Glu Asp Glu Tyr Asp Thr Arg Lys Thr Glu Ser Lys Val Thr Pro Leu His Glu Gly Cys TTT GCA GCT AGC GTG AGG ACC ATT CTG AAG AGC AGC 271 CAT ACA ACT CTG GCC AGC AGT TGG GTT TCT GCT GAA CTC AAA GCT CCA CCA GGA Phe Ala Ala Ser Val Arg Thr Ile Leu Ser Ser His Thr Thr Leu Ala Ser Ser Ser Ala Glu Leu Ala Pro 91 Val Pro Lys Trp Lys Gly TCT 361 CCT GGA ACC TCG GTT ACG AAT TTA ACT TOT ACC ACA CAC ACT GTT GTA AGT AGC CAC ACC TTA CAC AGG CCA TAC CAA GTG TCC CTT Ser Pro Thr Ser Val 121 Gly Thr Asn Leu Thr Thr Thr His Thr Val Val Ser Ser His Thr His Leu Arg Pro Tyr Gln Val Ser Leu Cy! 451 CGT TGC ACC TGG CTT GTT GGG AAG GAT GCC CCT GAG GAC CAG ACA TAT TTC CTA TAC TAC AGG TTT GGT GTT TTG ACT GAA AAA TGC CAA 151 Cys Thr Trp Leu Val Gly Lys Ala Pro Glu Arg Asp Asp Thr Gln Tyr Phe Leu Tyr Tyr Arg Phe Gly Val Leu Thr Glu Lys Cys Gln GAA TAC AGC AGA GCA 541 GAT CTG AAC AGA AAT ACT GCA TGC TGG TTT CCC AGG ACA TTT ATC AAC AGC AAA GGG TTT GAA CAG CTT GCT GTG 181 Glu Ser Ala Tyr Arg Asp Lou Asn Arg Asn Thr Ala Phe Pro Thr Phe Ile Trp Arg Asn Ser Lys Gly Phe Glu Gln Leu Ala Val Cy! 631 C^C ATT AAT GGC TCA AGC AAG CGT GCT GCA ATC AAG CCC TTT GAT CAG CTG TTC AGT CCA CTT GCC ATT GAC CAA GTG AAT CCT CCA AGG His Ile ASn Gly Ser Ser Ala Ala Ile 211 Lys Arg Lys Pro Phe Asp Gln Leu Phe Ser Pro Leu Ala Ile Asp Gln Val Asn Pro Pro Arg 721 AAT GTC ACA GTG GAA ATT GAA AGC AAT TCT CTC TAT ATA CAG TGG GAG AAA CCA CTT TCT GCC TTT CCA GAT CAT TGC TTT AAC TAT GAG Thr 241 A Val Glu Ile Glu Ser Asn Ser Leu Tyr Ile Gln Glu Pro Leu Trp Lys Ser Ala Phe Pro Asp His Phe Asn Tyr Glu Cy 811 CTG AAA ATT TAC AAC ACA AAA AAT GGT CAC ATT CAG AAG GAA AAA CTG ATC GCC AAT AAG TTC ATC TCA AAA ATT GAT GAT GTT TCT ACA 271 Leu Ile Asn Thr Lys Tyr Lys Asn Gly His Ile Gln Lys Glu Lys Leu Ile Ala Asn Lys Phe Ile Ser Ile Val Lys Asp Asp ipr Thr 901 TAT TCC ATT CAA GTG AGA GCA GCT GTG AGC TCA CCT TGC AGA ATG CCA GGA AGG TGG GGC GAG TGG AGT CAA CCT ATT TAT GTG GGA AAG Ser Ile Gln Val Ala Val Ser Ser Pro Met Pro 301 Tyr Glu Ser Gln Pro Ile Val L Arg Ala Arg Gly Trp Gly Trp Tyr Gly Cy! Arq GAA AGG T 991 AAG TCC TTG GTA GAA TGG CAT T tC 1GC AGA GTG Glu Ser Glu 331 Arg Lys Lou Val Trp His TGTZO CAT TTA TGG ACC AGG TTG TTT CCA CCG GTT CCG GCC CCA AAG AGT AAC ATC AAA GAT CTC CCT GTG GTT ACT GAA TAT GAG AAA CCT Leu Thr Leu Phe Pro Pro Pro Pro Ser Asn Ile 361 His Trp Val Leu Pro Thr Glu Glu Pro Arg Ala Lys Lys Asp Val Val Tyr Lys 1171 TCG AAT GAA ACC AAA ATT GAA GTT GTA CAT TGT GTG GAA GAG GTT GGA TTT GAA GTC ATG GGA AAT TCC ACG TTT TGA TGGCATTTTGCCATT 391 Ser Asn Glu Thr Ile Glu Val Val --- Lys His Val Glu Glu Val Gly Phe Glu Val Met Gly Asn Ser Thr Phe Cy! CTGAAATGAACTCATACAGGACTCCGTGATAAGAGCAAGGACTGCTATTTCTTGGCAAGGAGGTATTTCAAATGAACACTCAGAGCCAGGCGGTGGTAGAGCTCGCCTTTAATACCAGC 13 83 ACCTGGGATGCACAGACGGGAGGATTTCTGAGTTCGAGGCCAGCTTGGTCTATAAAGTGAGTTCCAGGACAGCCAGAGCTACACAGAGAAACCCTGTCTCGAAAAAACAAACAAACAAA 1 5 02 CAAACAAACAAMAATGAACACTCAATTTGAATGCAAGTCACCAACCCATCCAGACATGAGTCACCAATGTCCCATTTCATAAAGTGTGCATGCCTCACTCAAACCTCCTTGCTCACAGC 162 1 ATAGCACCAGACTCACCCAGAGCATGGGCCTTTGGTTTCCTACCCAGAGTACCATGTTATACCAGTGTGTCTTTGAAAGTTGCTTGACTTACCTTGAACTTTTTGCACAGGAGACAGTT TTTTTAAGCTAATGTCACACATGTTTACTTTGGGTTAAGTTGCCAGTGGTAGCACTCAGCTACAGTGACAGGAGGAAAGGATAGAACTCATTGAGAGTGAACCCAAATTCAAGACTGTC TTTCCTGACGCAAGTGGGAGACACAATTTCATGGTGCTTTTCCCCTTTCAGTTCTAGAATAGTTTCCTTTCTAGAACTGTGCCTGTGTCTTAAAGCATAAGGTAACATTGAGGCAAAAA CAAAGACTATGTCCCACATGTCCCTGTGTTCCATAGGCCTGTTCAAGGAAATGTCTAAGCCAAAGTAAGTTTAAGTCACCGTGCCTGGGGTGAAAAAAGATGGTTCAGATGACGAAGAAG -----I--------------- 2097 ------ ........ ------- ------- -------- CATGAGGGCCTIAGATTGATCACCAGCATCAAGAAACAACAACAACAACAGCAGCACAACAACAAAACAGTGCAAGAAGCACATTCCTATAACCCCAGAGTTGGGAGATAAAGACAA GAGGATCCATGGGAATTGTAGTTCAACCAGTTTAGCCAATTATGTTATCTCTAGGTTCACTGAGAGAAATGGTCTTAAAAATTTAAGGTGGAGAGTGACTAGGCAGATCCTCTGATACT GACTTCTGCCCTAAATATGCATACACATGTACACACACAACACAAAGACACCATTCCCTATTGAGAGAGAAGACAGAAGCTTGTTCAAGGATTAAATTCTTCAAGGCTTCTAGGTACTC TGGAAATGACCTGAGAAAGACATTGAAAATAATTCTGCTTTGGAGGTGATTGCTGGATCTAGAATGTACTTCCCAAAGAGATGTTGATGAAAGAGCCTTCATGGCAACCTGTTGGTCAA CTCATGCTTAGTCAATTCTAATCTCTTAAATTAGGGTTTCCTATACATATTACAATTGTATAAAAATGTATTCTCTAAATATCTTCATTAATGAAGCTGTATCTATAGGTCTTTTTGAT GGGCTGAACATAGAAGCAAACACACTTATGTGTTGGGAAGAGGAATAAGTAGTGATAGAGGGACCTAGTGGTAGTTATTTTACATAGTCCTGAAGAGCTAAAGACAATGAAAGAAGAAA TGGTACTCACAAGAGAGAGAGCTATGTCGGGGTCCTGTCAGCCAAATCTTGCTAGTATATGCAATAGTGTCTGGGTTTGGTGGTTGTATATTGGATGGTTCCCTGGGTGGGGCAGTCTC TGGATGGTCTTTCCTTCCATCACAGCTCTGAAATTTGTCTCTGTAACTCCTTCCATGAGTATTTTGTTCCCCATTCTAAGAAGCAGTGAAGTATCCACACTTTGGTCTTCCTTCTTCTT GAGTTTCATGTGTTTTGCAAATTGTGTGCCTGGCAATACAGAAGCAGATGCTCACAGTCATCTATTGGATGAAACACAGGGCCCCTAATGAAGGAGCCAGAGAAAGTACCCAAGGAGCT AAAAGGGTCTGCAACCCTATAGCAGGAACAACAATATGAACTACCCAGCAACCCTCAGAA1TGTAAATGAAGAAAATATCTAATAAAAAAAAAAAAAAAAAA AA ACC TTC GAA TGA Thr --- Glu Glu Phe GT GTC ATT GGA CCA GGT TGT TAT TTC CAC CGG TTC CGG CCC CAA AGA GTA ACA TCA AAG ATC TCC CTG TGG TTA CTG AAT ATG AGA AAC Val Iie Pro Pro Phe His Val Thr Gly Tyr Gly Gly Cys Phe Gln Ser Ile Ser Leu Leu Leu Asn Asn Arg Arg Arg Lys Trp Met Arg D CTT CGA ATG C AAG TTG TAC ATT GTG TGG AAG AGG AAA TTG TTG TTG AAG TCA TGG GAA ATT CCA CGT AAACA GAT TTT GGC ATT TTG GAT Leu Met Pro Leu Leu Arg Lys Lys Lys Ile Val Leu Leu Ser Glu Tyr Trp Lys Arg Asp Lys Trp Ile Pro Phe Ile Leu Arg Asp Gly CCA TTC TGA --- Pro Phe 1. Structure of the murine IL-5 cDNA. Schematic Fig. and restriction of receptor (A) representation IL-5 cDNAs. map receptor The coding regions are boxed. The hatched boxes the solid boxes the represent transmembrane domain. signal sequence; represent Broken lines indicate regions lacking in and when with and pIL-5R.2 pIL-5R.39 and compared pIL-5R.8 pIL-5R.13. pIL-5R.8, pIL-5R.2 whose insert cDNAs were pIL-5R.39 primed random were isolated from a constructed in CDM8 vector. using primers 13 whose insert was library pIL-5R. primed using oligo(dT) primer was isolated from a constructed in AGS-3 vector. Nucleotide and deduced amino library acid of the (B) sequence murine IL-5 sequence receptor cDNA. The was deduced after DNA sequence of the above described complete sequence analysis cDNA clones. Nucleotides and amino acids are numbered on the left The first underlined 17 amino acid residues margin. the represent The transmembrane signal sequence. domain is marked by a box. The N-linked sites are shown double potential glycosylation underlines. The are marked by cysteines asterisks. The by (C) deduced amino acid sequence in which occurs the deletion of nucleotides pIL-5R.2, the following 986-1164, in designated by open triangle (V) (B). (D) The deduced amino acid in which occurs the deletion of sequence pIL-5R.39, nucleotides following the closed 986-1079, designated by triangle (V) in (B). 4368 Murine interleukin-5 receptor gene by standard procedures (Figure IB). In the composite disuccinimidyl tartarate (DST). A major broad band of sequence shown in Figure iB, pIL-5R.8 is represented by -97 kd was detected when COS7 cells transfected with nucleotides -302 and 1506 and clone pIL-5R.13 by pCAGGS-5R were cross-linked with 35S-labeled IL-5 nucleotides - 165 to 3269. Each sequence contains a large (Figure 3A, lane 3). Under reducing conditions, the size of open reading frame that encodes a polypeptide of 415 amino cross-linked complex decreased to 75 kd (lane 5) due to the acids (Figure iB). A hydropathy plot of the deduced amino 35S-labeled IL-5 from the major dissociation of monomeric acid sequence predicts two hydrophobic regions. The first cross-linked complex, because biologically active IL-5 binds hybrophobic region spans the NH2-terminal 17 amino acids to its receptor as disulfide-linked dimer (Takahashi et al., and may represent a signal sequence (von Heijne, 1986). 1990). These complexes were disappeared by the addition The second region (22 amino acids) spans from residues of excess amounts of unlabeled IL-5 (lanes 4 and 6). By 340-361 and appears to constitute a transmembrane domain contrast, none of cross-linked band was detected by cross- of the receptor molecule. The predicted mature poly- with vector alone (lanes IL-5 linking of COS7 cells transfected of with 1 Then we carried out the immunoprecipitation by peptide IL-5 receptor consists of 398 amino acids and 2). a calculated molecular size of 45 284 daltons. There are six using H7 MAb and cell lysates from cell-surface 125i- COS7 transfectants. H7 MAb immunoprecipitated potential N-linked glycosylation sites of which four are found labeled in the putative 322 amino acid extracellular domain. Such the 60 kd protein from cell lysates of 125I-labeled COS7 a post-translational modification may account for the cells transfected with pCAGGS-5R, but not from these difference of molecular sizes between the estimated mature transfected with control vector (Figure 3B). The sizes and IL-5 receptor (60 kd) (Yamaguchi et al., 1990) and the calculated one (45 kd). The putative transmembrane domain is followed by a 54 amino acid intracellular domain. A. _1 The nucleotide sequences of pIL-5R.2 and pIL-5R.39 were - 3 0 C,, identical to that of pIL-5R.8 except that they lacked 0I These nucleotides 986-1164 and 986- 1079, respectively. V' deletions in two cDNA clones will cause altered translational 2 - four amino acids reading frames that extend for an additional the end point (pIL-5R.2) or 62 amino acids (pIL-5R.39) after 0 1 2 3 4 5 lL 1- 135SI-1L- nMf of deletion, respectively (Figure IC and D). These two I -j-,-- %..-# predicted amino acid sequences lack the transmembrane domain. I I I I I I I I I I 4 6 8 10 Binding sites / oel (x10-3) Binding and biochemical characteristics of the cloned murine IL-5 receptor of in order We next expression studies pIL-5R.8 performed x6 _^ 3- 3- binds To to determine whether the cDNA product IL-5. attain levels of expression, we also utilized another higher Ir 2 Dr vector (kindly provided by 2- strong expression pCAGGS o..- the entire 0o i 2 into which the cDNA spanning coding Miyazaki), (nM) [35S}IL-5 charac- was inserted sequence (pCAGGS-5R). Binding 1* -- p on COS7 cells teristics of the cloned IL-5 receptor expressed 2A B. COS7 cells were shown in Figure and transiently with the transfected with and plasmid pIL-5R.8 expression and 4 were shown to bind with 35S-labeled IL-5 1 3 pCAGGS-5R 2 with unlabeled murine IL-5. The sites / cell its was competed Binding (x10-5) binding for to saturation curve 35S-labeled IL-5 binding binding A0 - 10. a class transfectants showed only single (low pIL-5R.8 C? . with an of IL-5 binding apparent equilibrium c, affinity) 3 Cl 3 of 2.0 nM and 1.2 x 104 dissociation constant (KD) When COS7 cells were binding sites per cell (Figure 2A). x with -70 times transfected pCAGGS-5R, they expressed x 105 sites than more IL-5 binding sites (-8.8 per cell) ( [2 with these on COS7 cells transfected pIL-5R.8. However, SI-IL-5 (nM) a ~~~~~135 _L a class (low of IL-5 we detected only single affinity) binding la c I1n an of 9.6 nM sites with KD (Figure 2B). apparent or cells transfected with COS7 cells COS7 Untransfected -I 4 6 not 0 alone showed no shown). 2 vector significant binding (data Binding sites cel showed (x10-3) the source of cDNA Y16 cells, library consistently sites = 20 1200 two IL-5 binding (high affinity, KD pM, 35S-labeled IL-5 to the 2. of Scatchard plot analysis binding = 5.1 22 000 sites Fig. sites low per per cell; affinity, KD nM, the cloned cDNA and to Y16 cells. The COS7 transfectants expressing 2C). cell) (Figure data total inset shows the direct binding (Ol, binding; *, non-specific characterize further the molecular structure of In order to means of determinations. COS7 Points are duplicate (A), binding). we chemical cross- COS7 cells transfected with recombinant IL-5 receptor, performed cells transfected with pIL-5R.8; (B), and Y16 cells. 35S-labeled and pCAGGS-5R; (C), with the use of IL-5 linking experiments 4369 S.Takaki et al. characteristics of of IL-5 is expressed molecules are similar to receptors really observed in cell lines that those express observed as a of the the IL-5 we major component (60 kd) IL-5 receptor, applied the PCR technique for the recep- tor on IL-5 cells ofcDNA dependent (Yamaguchi et amplification (Figure 4B). Such analysis revealed al., 1990). We then examined the characteristics of translation the existence of variant pro- transcripts corresponding to both the ducts of pIL-5R.2 and both lack membrane-bound form pIL-5R.39, nucleotides (Figure 4B, arrow a) and soluble encoding the transmembrane forms (arrow b,c) of IL-5 in cell region. pIL-5R.2 and receptor lines bearing IL-5 pIL-5R.39 cDNAs were inserted into receptor. As shown in the pCAGGS vector Figure 4B, transcripts for the resulting in pCAGGS-5R.2 and membrane-bound form to be pCAGGS-5R.39, respec- appeared expressed most tively, and transfected into COS7 cells. In the conditioned abundantly for the among transcripts IL-5 receptor. media of COS7 cells transfected with Unexpectedly, an extra band was detected in pCAGGS-5R.2, a IL-5 receptor 50 kd protein was and the of bearing cell lines This band seems secreted, binding radiolabeled (arrow d). to be derived IL-5 to Y16 cells was inhibited the conditioned from the IL-5 receptor transcripts, because by media corresponding (data not shown). This result that soluble bands could be obtained suggests IL-5 by using different combinations of receptor is secreted into extracellular media. The conditioned primers (data not This of shown). type mRNA might be a media of COS7 cells transfected with did product resulting from an alternative pCAGGS-5R.39 splicing of the precursor not inhibit the binding of IL-5 to Y16 cells. A translation mRNA for IL-5 receptor. product of a 60 kd protein which is from predictable the Expression of high affinity IL-5 receptor on FDC-P1 cDNA sequence was not detected in the media. transfectants FDC-P1 cells were cotransfected with pCAGGS-5R and Expression of the murine IL-5 receptor transcripts pSV2Neo, and stable transformants were selected as of Expression IL-5 receptor mRNA was examined by hybridization with a cDNA insert from pIL-5R.8 as a probe. The RNA blot analysis revealed the presence of two mRNAs (-- 5.0 kb and 5.8 A kb) whose expression was restricted to 1 2 3 4 5 6 7 cell lines (Y16, and MOPC104E) (Figure 4A) BCLI-B20 that have been identified as bearing the IL-5 receptor (Mita et In al., 1989). contrast, the expression of IL-5 receptor mRNA was not detected in IL-5 unresponsive cells, e.g. X5563, Ltk- FDC-P1, and MTH cells. the level Overall, 28S- of mRNA in expressed particular cells correlated well with the number of low affinity IL-5 receptor per cell. The relative ratio of 5.0 kb to 5.8 kb mRNA varied among IL-5 receptor 18S - bearing cell lines. To analyze whether the mRNA expression of variant types 2 :. 5 6 kD NM lp 4 5 6 7 Mvl 2 8 200 -- bp -- MO 116 - 116 1078 97 -- I. 66 - -~-w- -- a Ama. -- 43 - 43 - *- C 4M amp 234 unlabeied (_ IL-5 0 2ME _ ji U, Vcr p+- C) 6 Fig. 4. (A) An RNA blot o ci) analysis of IL-5R mRNA. Poly(A)+ RNA Vecto r pCAGGS-5R (2 ,cg) was subjected to each lane. HindIII-PstI fragment of pIL-5R.8 was used as a probe. Lane 1, Y16; lane 2, BCL1-B20; lane 3, MOPC104E; lane 4, X5563; lane 5, FDC-P1; lane 6, Ltk- and lane Fig. 3. (A) Affinity COS7 cells MTH. The cross-linking. transfected with 7, numbers of low and high affinity IL-5 binding sites per pCAGGS-5R (lanes 3-6) or control vector 1 cell were as (pCAGGS) (lanes and 2) follows: for Y16, 22 000 and 1200; for BCL1-B20, 7500 were incubated with 35S-labeled IL-5 (4 nM) for 10 and and for min at 37°C in 1000; MOPC104E, 18 000 and 50. (B) RNA from the the absence 3 (lanes 1, and 5) or presence (lanes 2, 4 and following sources or 6) of plasmid DNA was subjected to PCR-based 100-fold excess of unlabeled IL-S. The cell lysates were amplification as described in subjected to Materials and methods. Lane M, size SDS-PAGE under non-reducing (lanes 1-4) or 5 markers; lane 1, Y16; reducing (lanes and lane 2, lane 3, lane MOPC104E; 4, BCLI-B20; 6) and were conditions, analyzed by a Bio-Analyzer 100. FDC-P1; lane 5, pIL-5R.8; (B) lane 6, pIL-5R.39; lane 7, pIL-5R.2; lane Immunoprecipitation studies of the transformants. Cell lysates of 8, CDM8 vector. The primer used for PCR reaction (see Materials pCAGGS-5R transfected COS7 cells were immunoprecipitated as and methods) define fragments of 548 bp (for pIL-5R.8 type, arrow described in Materials and methods. The immunoprecipitated samples a), 454 bp (for pIL-5R.39 type, arrow b) and 369 bp (for pIL-5R.2 were to subjected SDS-PAGE under reducing conditions and analyzed type, arrow c). Arrow d is an extra band that does not correspond to a 100. by Bio-Analyzer the fragments derived from the cloned cDNAs. 4370 Murine interleukin-5 receptor gene described in the Materials and methods. Four transfected binding parameters calculated from Scatchard plots derived clones that were reactive to H7 MAb were established. One from the binding data show that FDC-5R cells express - 500 of these, FDC-5R was analyzed in detail for IL-5 binding binding sites per cell for IL-5 with an apparent KD of and IL-5 responsiveness compared with these cells 30 pM (high affinity) and 8000 binding sites per cell with transfected with pSV2Neo alone. Figure 5A shows binding of 6 nM (low affinity). These are close to the values KD experiments with 35S-labeled IL-5 on FDC-5R. FDC-5R for the IL-5 binding on IL-5 responsive cells. determined cells specifically bound IL-5, whereas FDC-PI cells Figure 5B shows that FDC-5R cells became IL-5 respon- transfected with pSV2Neo did not (data not shown). The for DNA synthesis, whereas neither parental FDC-PI sive nor FDC-Pl transfected pSV2Neo alone responded to IL-5. CO) Discussion v- To explore the mechanisms of signal transduction induced by various growth and differentiation factors, it is necessary Li to the structure of their receptors. Since receptors determine for hormones and cytokines including IL-5 are expressed in small numbers on the surface of target cells, isolation and of these receptors have been laborious. characterization receptors for several cytokines have been Recently, molecularly cloned by using various techniques (Sims et al., 1988; Yamasaki et al., 1988; D'Andrea et al., 1989a; ses / cell (x10-3) BinDing Hatakeyama et al., 1989; Mosley et al., 1989; Gearing et 1989; Itoh et al., 1990; Goodwin et al., 1990; al., Q1 Fukunaga et al., 1990). To isolate cDNA for IL-5 receptor, °x we used expression cloning strategy with an antibody- c 8- cell panning procedure developed by Seed and mediated 6- because we had already prepared MAbs Aruffo (1987), the receptor for IL-5. Where the cell source of a against 4- cDNA library bears abundant numbers of Fc receptors, Fc-mediated binding of MAbs caused a decrease in the 0% of screening in Seed's cloning system. We 13Illill- efficiency Mln 0.001 0.01 0.1 1 10 just such a situation. To overcome this problem, experienced IL-5 (pM) we modified the panning method with the use of Petri dishes coated with F(ab')2 fragments of anti-rat IgG instead of IL-5 binding to the plot analysis of 35S-labeled Fig. 5. (A) Scatchard intact anti-rat IgG. Since the binding of H7 MAb to FDC-P1 cells transfected with the cloned cDNA. The inset shows the direct binding data (O, total binding; *, non-specific binding). (B) recombinant Fc receptor expressed on COS7 cells was very IL-5 dependent proliferation of FDC-P1 transformants expressing the loose, H7 MAb easily dissociated from Fc receptor on the by FDC-P1 cells IL-5 receptor. [3H]thymidine incorporation murine cell surface by layering transfectants on 2% Ficoll in PBS (0), FDC-P1 cells transfected with pSV2Neo (A) and FDC-P1 cells followed centrifugation during the first antibody separa- by transfected with pCAGGS-5R and pSV2Neo (A) were determiined as et al., 1989). tion of the screening procedure. Introducing this previously described methods (Tominaga step w S N T TrIIH (16aa) R- T[lL (llaa) F f Y Y F (5aa) K Q (7aa) TrA)K WTEITI R (5 6aa) Q [i1 E mIL5R 128 E[j C RJ (56aa) E WI S S E L S E 36 TILIE NOD (Saa) IICISIWA (llaa) T Ll Ll Y[ Q (7aa) (10aa) H Cl V3-PI R mIL3RI TILILIYa C HIWIE FY P K S P V V RICIS [PV (46aa) 251 NWLQIC Ffi D (Saa) HICISIWIE (llaa) GCLl (7aa) (10aa) Y mIL3RI1 T I P R N (5aa) C v c HIMIE M (Slaa) TWJN 31 E T C F D (Saa) T E W F (llaa) (9aa) mIL4R C I (55aa) L 39 C l Q S H L L NiIFIE' F Q I K L T L N (9aa) TlSl E F L KY mIL7R SF (5aa) (12aa) (7aa) C W (60aa) S W E N S V S V1T AWV P D T E L L P (5aa) C N LLI L 33 QFIT Y (Saa) (llaa) (6aa) hIL2R§ C Ql V T W Q V aaL K P (5aa) F C L (56aa) hIL6R 118 riS C F R K (6aa) V C E W G (llaa) V|M| (llaa) Q -E]S C S L H W C S T (53aa) RI W L 49 E FFr0 (5aa) VlClFlWlE (llaa) (6aa) S Q (9aa) F mEPOR L C |LZ C C H N (53aa) RIWI K hGMCSFR 123 N F Y N C T W A (llaa) F1 Y IIR N (7aa) RI (6aa) V1G FIS C (5aa) EI.1 D Y K N F K (59aa) K W S I HK P (Saa) T C W W N (llaa) SILI TIYS K (7aa) P (4aa) CFC rPRLR 28 JV S C Y (57aa) R W E P S C H W T FJ T R (llaa) EI7 P D (4 aa) N F,N hGHR 53 F TKCR (Saa) (13aa) QJ R S R D V A K K N sai R (61aa) S J K mGCSFR 104 N LJM H (6aa) V C Q E (13aa) K S F (llaa) (2aa) SC aS TM domain r I L R IS N mIL5R (43aa) Ti S V A V (6aa) P 7G1 R w Qs L Y (12aa) (4aa) P P VIA IIQ RIA 122aa) K[M I Y A V T L (6aa) S G R sJ WS _-E.EV mIL3RI (53aa) RTn T Y R K W K K I P N P S K S L S Y C A R V P (4aa) D G I WS EW S - X1E Y (5aa) (26aa) (6aa) mIL3RII (46aa) R! Q A P L V A I I S T G T W S E W S - P S I (13aa) (6aa) W D RS mIL4R (51aa) Y Y T A R V R VR (3aa) (24aa} HLJK T L E Q L V R P K F W S E W S - P S S (14aa) (6aa) V VVWJflSILPD mIL7R (39aa) M Y E K (5aa) J 125aa} (6aa) P KL K C NT PD PS K (49aa) FV R P F T T W S zW S - P L A (12aa) (25aa} (4aa) WAL' hIL2RP E G K T S M H P P Y RAJ L hIL6R R F V R E P (3aa) Q TE W S E W SQ P A (48aa) (28aa) (6aa) KLLJ (47aa) A V R AR1M S F W S A W S E A S (9aa) ( 22aa} (6aa) Q I W P G IlX P E S E F E mEPOR (47aa) R T F (5aa) G R IKIDrn LN [5lN A H S V K I I L N W S S W S E AI E (5aa) (27aa) (7aa) PLIVPPVPIQ hGMCSFR (48aa) E PR (6aa) C11 F P P V P GWK IIKIG F|DIT rPRLR (48aa) K YL V CKP D - - H G Y W S S Q12aa) (24aa} (7aa) PIVIP. I JG ILDJP - N YGE SE V Y (24aa} (7aa) L11 | hGHR (48aa) YE V RSK Q R N SIGI (16aa) S L S S S§F,'WSDJDAHS T L C I R (3aa) P F W S P W S P G L Q(299aa) (6aa) mGCSFR (47aa) VY (24aa} GJ of the murine IL-5R to cytokine receptors. Murine IL-5R, domains I and II of murine IL-3R (Itoh et al., 1990), murine IL-4R Fig. 6. Alignment et murine IL-7R (Goodwin et al., 1990), human IL-2R beta-chain (Hatakeyama et al., 1989), human IL-6R (Yamasaki et al., (Mosley al., 1989), murine erythropoietin receptor (mEPOR) (D'Andrea et al., 1989a), human GM-CSFR (Gearing et al., 1989), rat prolactin receptor (rPRLR) 1988), human hormone (Leung et al., 1987), and murine G-CSFR (Fukunaga et al., 1990) are aligned. et growth receptor (hGHR) (Boutin al., 1988), indicate the amino acid number starting from the first methionine. Identical residues and conserved substitutions are marked by Numbers at the left dashed are introduced to maximize homology. solid boxes and boxes, respectively. Gaps 4371 S.Takaki et al. binding of IL-5 to IL-5 responsive Y 16 that modification, we succeeded in isolating a cDNA clone of cells, indicating pIL-5R.2 encodes soluble IL-5 receptor. COS7 cells the murine IL-5 receptor. Analysis of the sequence of the in the transfected with both pCAGGS-5R.2 and IL-5 receptor reveals significant homology pCAGGS-5R.39 expressed lesser levels of H7 on their extracellular domain to several receptors for cytokines, epitopes surface that have been cloned. compared with pCAGGS-5R transfectants not growth hormone and prolactin The (data shown). A small proportion of the products encoded extracellular region of these receptors contains two pairs of by the 'WSXWS' motif located close pCAGGS-5R.2 or pCAGGS-5R.39 remain on the cysteine residues and to may cell surface of COS7 cells transfected. we are unable the transmembrane domain (Figure 6) et Although (Gearing al., 1989; to detect the translation of Itoh et al., 1990). The murine IL-5 receptor product pCAGGS-5R.39 in the may, therefore, cultured it is not known whether belong to a recently proposed a new receptor gene family media, pIL-5R.39 is moment. In (D'Andrea et al., 1989b; Bazan, 1989; Gearing et al., 1989; functional at this IL-5 receptor mRNA evolved from a Itoh et al., 1990) and may have common expression, two classes of mRNAs (-5.0 kb and 5.8 kb) The in IL-5 lines ancestor of other cytokine receptors. IL-5 receptor has were detected only receptor bearing cell (Figure 127Thr we did not detect 3.5 kb mRNA another extra domain from to the 3). Interestingly, band in 18Asp preceding mRNA prepared from Y16 cells. As for the common motif, like GM-CSF receptor (Gearing et al., 1989) size of cDNA, et in pIL-5R. 13 cDNA might have primed by possible internal and IL-6 receptor (Yamasaki al., 1988). However, the does not residues 3' relation to this extra domain, IL-5 receptor poly(A) sequence among non-coding region. As to feature either with the mRNAs that encode the soluble forms of appear share the structural GM-CSF IL-5 receptor receptor or with IL-6 which is of would be only 179 bp (pIL-5R.2 form) or 94 receptor composed Ig-like bp (pIL-5R.39 than a of domain. form) shorter full-length transcript IL-5 receptor, features of extracellular it would not account for the difference in size of the two In contrast to conserved domain, of the murine is We the 5.8 kb mRNA the cytoplasmic domain IL-5 receptor transcripts. suppose may be the for neither considerably unique. The consensus sequences precursor transcript that has to be fully spliced before nor a domain of some maturation or may have different polyadenylation sites. It a tyrosine kinase domain catalytic kinases et were in the is important to examine whether transcripts for the soluble protein (Hanks al., 1988) present IL-5 the is not of forms of IL-5 receptor are in receptor. Moreover, IL-5 receptor composed expressed the IL-5 receptor serine-rich that is observed in of IL-2 cell lines. PCR we the region fl-chain bearing By technique, confirmed the et IL-4 to the soluble forms of receptor (Hatakeyama al., 1989), receptor (Mosley transcripts corresponding IL-5 et al., 1989), erythropoietin receptor (D'Andrea et al., receptor lacking putative transmembrane domain in 1989a), IL-3 receptor et al., 1990) and G-CSF receptor and MOPC104E as well as Y16 cells (Itoh (Figure BCLI-B20 (Fukunaga et al., 1990). However, the sequence from 4B). These results indicate that the transcripts for the soluble form of IL-5 are not to 367Leu to 380Asp in the IL-5 receptor following the receptor specific Y16 cells, and not transmembrane domain contains a which is so rare compared with the transcript for proline cluster, membrane-bound well conserved among receptors for GM-CSF forms. The for (Gearing receptors IL-4, IL-7 and growth hormone et et and have also been shown to be in al., 1989), prolactin (Boutin al., 1988), growth encoded both membrane- hormone (Leung et The in the bound and soluble forms (Mosley et al., al., 1987) (Figure 6). region 1989; Baumbach domain that is these et Goodwin et cytoplasmic homologous among al., 1989; al., 1990). The existence ofcDNAs receptors is likely to have some important role in an encoding soluble for factor receptors growth may suggest association with other membrane components which may be important regulatory roles of soluble receptors in responsible for IL-5 mediated signal transduction or hematopoiesis and immune response. The effect of the formation of functional high affinity IL-5 soluble forms of IL-5 in receptors. receptor IL-5-mediated signal Recombinant IL-5 receptor expressed on COS7 cells transduction must await further studies. displayed the low affinity class of IL-5 binding previously characterized on various IL-5 responsive cells Y16 Concluding remarks including cells. The biochemical data unequivocally demonstrate that The 60 kd protein, molecularly characterized in this study, the cDNA-encoded product is directly involved in the is able to bind to IL-5 with a single class of affinity (low formation of IL-5 receptor. However, this product did not affinity). The IL-5 receptor has a relatively short cytoplasmic reconstitute the high affinity IL-5 receptor. Intriguingly, tail and lacks known kinase domains. It is important to note FDC-P1 cells transfected with the IL-5 receptor cDNA that an additional molecule appears to be involved in the both and low expressed high affinity IL-5 binding sites and formation of the functional high affinity IL-5 receptor. became responsive to IL-5 of (Figure 5), although parental Availability the IL-5 receptor cDNA will allow us further FDC-PI cells showed neither IL-5 binding nor investigation of IL-5 IL-5-mediated signal transduction and responsiveness. These results indicate that recombinant IL-5 identification of an associated molecule(s) for the IL-5 receptor is really a component of the functional IL-5 receptor receptor complex. with high affinity. We consider that the 60 kd protein encoded by the cloned cDNA may associate with certain Materials and methods cellular protein(s), which may not bind IL-5 by itself, in FDC-P1 cells resulting in the formation of the high affinity Reagents and cell lines MAbs H7 (rat and T21 (rat against murine IL-S receptor were IL-5 receptor. IgG2a) IgGj) prepared and purified as described (Yamaguchi et al., 1990; Hitoshi et al., We isolated cDNA clones (pIL-SR.2 and pIL-5R.39) that 1990). The IL-5 dependent early B cell line, Y16, was established from lack the transmembrane portion of IL-5 receptor cDNA. The BALB/c bone marrow cells as described (Tominaga et 1989) and al., conditioned media of COS7 cells transfected with maintained in the presence of 10 pM IL-S in RPMI-1640 medium pCAGGS-SR.2 but not with pCAGGS-SR.39 inhibited the supplemented with 10% fetal calf serum (FCS), 50 2-ME, penicillin ItM 4372 receptor gene Murine interleukin-5 (100 U/mi) and streptomycin (100 The murine B cell chronic 1222-1241). PCR reaction (in a volume of 50 1l) contains 200 of each Ag/ml). tLM leukemic cell line BCL1-B20 (in vitro line), an IL-2 dependent CTLL 1 of each 10 mM Tris-HCI pH 8.3, 50 mM dNTP, specific primer, AM (MTH), an IL-3 dependent cell line (FDC-P1) and mouse myeloma cell KCI, 1.5 mM, MgCl2, 0.001% (w/v) gelatin and 1.25 units Taq lines (MOPC104E and X5563) were maintained as previously described 1 Elmer The conditions were: min at 94°C; polymerase (Perkin Cetus). procedures (Yamaguchi et al., 1990). 2 min at 3 min at for 25 in a DNA thermal cycler. A 56°C; 72°C cycles of PCR reaction was electrophoresed through a 1 % agarose gel. portion Construction of cDNA libraries Total RNA was prepared from Y16 cells by the guanidium isothio- Binding assay cyanate/CsTFA method (Okayama et al., 1987) and poly(A)+ RNA was Recombinant murine and labeled IL-5 were IL-5 [35S]methionine prepared selected by oligo(dT)-cellulose column chromatography. Double-stranded Takahashi to as described et according procedures (Tominaga al., 1988; DNA was synthesized according to procedures described by Gubler and et For the COS7 transfectants were harvested, al., 1990). binding assay, Hoffman (1983) with modifications using a kit from BRL.Life Technologies. x 100 of the medium at 2- 10 104 l1 resuspended per binding The blunt-end cDNA was ligated with BstXI non-palindromic linkers and medium/25 mM HEPES 7.2/0.1 % and incubated (RPMI-1640 pH BSA), cDNA longer than 1.0 kb was isolated by 5-20% potassium acetate gradient with concentrations of 35S-labeled IL-5 at 370C for 10 min increasing (Mita centrifugation (Seed and Aruffo, 1987). The size fractionated cDNA was cells were harvested et For Y16 cells and FDC-P1 al., 1988). transformants, cloned into BstXI-digested CDM8 (Seed, 1987) or pAGS-3 (Miyazaki et al., x x of and at 1 cells and 1 106 100 the resuspended I05 per binding 1989). out as described and were carried medium, respectively, binding assays as the difference above. In all was defined binding assays, specific binding Screening of cDNA libraries obtained in the of between total and binding non-specific binding presence A pool of CDM8 library representing -2 x 106 cDNA clones was and an number of 100-fold excess of unlabeled IL-5. The KD average expressed in COS7 cells and screened by panning method with a mixture Scatchard of the sites cell were calculated plot analysis binding binding per by of MAbs H7 and T2 1. Two to three days after transfection, cells were data. incubated with H7 and T21 MAb, layered on 2% Ficoll solution and centrifuged at 200 g for 5 min. After centrifugation cell pellets were Chemical cross-linking resuspended in PBS containing 0.5 mM EDTA and 5% FCS and distributed x incubated Transfected cells 5 were with COS7 (- 106) harvested, 35S- into panning dishes (60 mm in diameter) that had been coated with purified for 10 in the absence or of labeled IL-5 at min (4 nM) 37°C presence anti-rat IgG (Cappel). Episomal DNA was collected from adherent cross-linked with 1 mM goat 100-fold excess of unlabeled IL-5 and subsequently Transformed E. coli were then washed and with cells to the dishes and introduced into Escherichia coli. DST at for 30 min. Cells (PIERCE) 4°C lysed were fused with COS7 cells after the treatment with lysozyme, and subjected X-100 in the of inhibitors buffer 1% Triton lysis containing presence protease to a second round of panning. These panning procedures were repeated mM 2 mM 10 mM 2 JIM (2 EGTA, EDTA, phenylmethylsulfonyl fluoride, four times as described (Seed and Aruffo, 1987). Then positive clones were 2 mM and at pepstatin, leupeptin, o-phenanthroline, aprotinin tiM further screened by the panning using intact H7 MAbs and Petri dishes coated as described et The extraction KIU/ml) (Mita al., 1989). detergent with F(ab')2 fragments of anti-rat IgG (Cappel). This screening process was to SDS -PAGE with 7.5% under mixture was subjected polyacrylamide repeated twice. Resulting individual plasmid clones were transfected into and then a or Bio-Analyzer non-reducing reducing conditions, analyzed by COS7 cells by DEAE-dextran method as described (Seed and Aruffo, 100 Photo Film Co. Ltd). (Fuji 1987). Cells were harvested 2 days after transfection and stained with H7 MAb and FITC-conjugated F(ab')2 fragments of goat anti-rat IgG (Cappel). and SDS - PAGE Immunoprecipitation Cells were then washed and with a flow cytometer (FACScan, x radioiodinated with the use of IODO-BEADS analyzed Cells were (-5 106) Becton Dickinson Immunocytometry Systems). with PBS cells were After using lysis (PIERCE). washing (pH 7.2), lysed in the above section. lodinated cell were then buffer as described lysates DNA sequencing H7 followed the incubation with Protein incubated with by G-coupled cDNA inserts of clones pIL-SR. 13, pIL-5R.2 and pIL-5R.39 The pIL-5R.8, at for 12 h. The were boiled Sepharose (Pharmacia) 4°C immunoprecipitates the chain termination method (Sanger et al., were sequenced by dideoxy buffer with 5% 2-ME for 3 and in SDS min sample analyzed by the modified T7 polymerase (Sequenase, USB). 1977) using Gels were then a SDS-PAGE on 9% polyacrylamide gels. analyzed by Bio-Analyzer of the IL-5 cDNA Expression receptor A mammalian expression vector pCAGGS (provided by Dr Miyazaki, of Kumamoto Medical School) is a derivative pAGS-3 (Miyazaki University Acknowledgements et al., 1989), and contains an SV40 origin of replication, cytomegalovirus followed a enhancer and a chicken ,B-actin promoter by sequence sequence Drs B.Seed and and for vector We thank J.-I.Miyazaki pCDM8 A.Aruffo, The from the rabbit ,B-globin gene (J.-I.Miyazaki, personal communication). and Drs T.Kunisada and and pCAGGS vector, respectively; J.-I.Miyazaki, was inserted cDNA obtained by digestion of pIL-5R.8 with XhoI sequence valauble advice and critical of this for S.-I.Nishikawa reading manuscript. into a EcoRI site of an XhoI linker, resulting in unique pCAGGS using a Grant-in-Aid for Scientific Research and for in part by Special Supported were inserted The of and pCAGGS-5R. coding region pIL-5R.2 pIL-5R.39 Cancer from the of Education, Project Research, Bioscience, Ministry to the same as that of Transfections were pCAGGS by procedures pIL-5R.8. Coordination Funds for Science and and Culture, Promoting by Special DEAE-dextran method. Cells were at 8 h performed by trypsinized post- of the Science and Science and Technology Agency, Japan. Technology transfection and re-seeded in Petri dishes. After 2 or 3 day incubation, cells harvested after a brief treatment with 0.5 mM EDTA and subjected were to further For FDC-PI and pSV2Neo were analysis. cells, pCAGGS-5R References were selected in transfected Stable transformants by electroporation. medium G418-containing (400 /Ag/ml). Kinashi,T., Noma,T., Matsuda,F., Azuma,C., Tanabe,T., Konishi,M., Severinson,E. Hammarstr6m,L., Smith,C.I.E., Yaoita,Y., Takatsu,K., RNA blot analysis and colony hybridization Acids 9149-9158. Nucleic and Res., 14, Honjo,T. (1986) and Genes cell lines were to Dev., 3, Poly(A)+ RNA (2 ttg) prepared from various subjected (1989) Baumbach,W.R., Horner,D.L. Logan,J.S. 1 2.2 M as 1199-1205. electrophoresis through % agarose gel containing formaldehyde Res. 788-795. et and transferred to Gene Screen Biochem. Commun., 164, described (Sambrook al., 1989), (Du Pont). Bazan,J.F. (1989) Biophys. was carried out to manufacturer's recommendation. Shirota,M., Hybridization according Jolicoeur,C., Okamura,H., Gagnon,J., Edery,M., Boutin,J.-M., and Cell, was carried out as described et (1988) Colony hybridization (Sambrook al., 1989). Banville,D., Dusanter-Fourt,I., Djiane,J. Kelly,P.A. with 69-77. the HindIII-PstI of was labeled 32p As a probe, fragment pIL-5R.8 53, 277-285. kit from Pharmacia. and Cell, 57, random method a (1989a) by primer labeling using D'Andrea,A.D., Lodish,H.F. Wong,G.G. and Cell, 58, Fasman,G.D. Lodish,H.F. (1989b) D'Andrea,A.D., 1023-1024. RNA detection using PCR and Cell, 61, RNA was used to the Seto,Y. (1990) For PCR 1 of generate Ishizaka-Ikeda,E., Nagata,S. amplification, ug poly(A)+ Fukunaga,R., 341-350. fifth of the cDNA reaction mixture was first strand cDNA. One subjected Plasmid DNA was used as control. The Gearing,D.P., King,J.A., Gough,N.M. and Nicola,N.A. (1989) EMBO to PCR amplification. (10 ng) 3667-3676. for PCR reaction were 5'-GCCATTGACCAAGTGAATCC used J., 8, primers and 5'-GTGGAATTTCCCATGACTTC Falk,B.A., 694-7 (position Goodwin,R.G., Friend,D., Jerzy,R., Gimpel,S., (position 13) Ziegler,S.F., 4373 et al. S.Takaki Taniguchi,T., Hirano,T. and Kishimoto,T. (1988) Science, 241, Dower,S.K., March,C.J., Namen,A.E. and Park,L.S. (1990) Cosman,D., 825-828. Cell, 60, 941 -951. et al. Proc. Natl. Acad. Sci. USA, 84, 7388-7392. Gubler,U. and Hoffman,B.J. (1983) Gene, 25, 263-269. Yokota,T. (1987) Quinn,A.M. and Hunter,T. (1988) Science, 241, 42-52. Hanks,S.K., Received on August 20, 1990; revised on October 4, 1990 Harada,N., Matsumoto,M., Koyama,N., Shimizu,A., Honjo,T., Tominaga,A. and Takatsu,K. (1987)Immnunol. Lett., 15, 205-215. Hatakeyama,M., Tsudo,M., Minamoto,S., Kono,T., Doi,T., Miyata,T., Note added in proof Miyasaka,M. and Taniguchi,T. (1989) Science, 244, 551-556. Hitoshi,Y., Yamaguchi,N., Mita,S., Sonoda,E., Takaki,S., Tominaga,A. The nucleotide sequence data reported here will appear in the EMBL, and Takatsu,K. (1990)J. Inmunol., 144, 4218-4225. GenBank and DDBJ Nucleotide Sequence Databases under the accession Itoh,N., Yonehara,S., Schreurs,J., Gorman,D.M., Maruyama,K., Ishii,A., number D90205. Yahara,I., Arai,K.-I. and Miyajima,A. (1990) Science, 247, 324-327. Kinashi,T., Harada,N., Severinson,E., Tanabe,T., Sideras,P., Konishi,M., Azuma,C., Tominaga,A., Bergstedt-Lindqvist,S., Takahashi,M., Matsuda,F., Yaoita,Y., Takatsu,K. and Honjo,T. (1986) Nature, 324, 70-73. Leung,D.W., Spencer,S.A., Cahianes,G., Hammonds,R.G., Collins,C., Henzel,W.J., Bamard,R., Waters,M.J. and Wood,W.I. (1987) Nature, 330, 537-543. Loughnan,M.S., Takatsu,K., Harada,N. and Nossal,G.J.V. (1987) Proc. Natl. Acad. Sci. USA, 84, 5399-5403. Mita,S., Harada,N., Naomi,S., Hitoshi,Y., Sakamoto,K., Akagi,M., Tominaga,A. and Takatsu,K. (1988) J. Exp. Med., 168, 863-878. Mita,S., Tominaga,A., Hitoshi,Y., Sakamoto,K., Honjo,T., Akagi,M., Kikuchi,Y., Yamaguchi,N. and Takatsu,K. (1989) Proc. Natl. Acad. Sci. USA, 86, 2311-2315. Miyazaki,J.-I., Takaki,S., Araki,K., Tashiro,F., Tominaga,A., Takatsu,K. and Yamamura,K.-I. (1989) Gene, 79, 269-277. Mosley,B. et al. (1989) Cell, 59, 335-348. Nakanishi,K., Yoshimoto,T., Katoh,Y., Ono,S., Matsui,K., Hiroishi,K., Noma,T., Honjo,T., Takatsu,K., Higashino,K. and Hamaoka,T. (1988) J. Immunol., 140, 1168-1174. Okayama,H., Kawaichi,M., Brownstein,M., Lee,F., Yokota,T. and Arai,K.-I. (1987) Methods Enzymol., 154, 3-27. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning. A Laboratory Manual (2nd edn). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanderson,C.J., Campbell,H.D. and Young,I.G. (1988) Immunol. Rev., 102, 51-76. Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA, 74, 5463-5467. Seed,B. (1987) Nature, 329, 840-842. Seed,B. and Aruffo,A. (1987) Proc. Natl. Acad. Sci. USA, 84, 3365-3369. Sims,J.E. et al. (1988) Science, 241, 585-589. Sonoda,E., Matsumoto,R., Hitoshi,Y., Ishii,T., Sugimoto,M., Araki,S., Tominaga,A., Yamaguchi,N. and Takatsu,K. (1989) J. Exp. Med., 170, 1415-1420. Swain,S.L., Howard,M., Kappler,J., Marrack,P., Watson,J., Booth,R., Wetzel,G.D. and Dutton,R.W. (1983) J. Exp. Med., 158, 822-835. Swain,S.L., McKenzie,D.T., Dutton,R.W., Tonkonogy,S.L. and English,M. (1988) Immunol. Rev., 102, 77-105. Takahashi,T., Yamaguchi,N., Mita,S., Yamaguchi,Y., Suda,T., Tominaga,A., Kikuchi,Y., Miura,Y. and Takatsu,K. (1990) Mol. lnmunol., 27, 911-920. Takatsu,K., Tanaka,K., Tominaga,A., Kumahara,Y. and Hamaoka,T. (1980) J. Immunol., 125, 2646-2653. Takatsu,K., Kikuchi,Y., Takahashi,T., Honjo,T., Matsumoto,M., Harada,N., Yamaguchi,N. and Tominaga,A. (1987) Proc. Natl. Acad. Sci. USA, 84, 4234-4238. Takatsu,K., Tominaga,A., Harada,N., Mita,S., Matsumoto,M., Kikuchi,Y., Takahashi,T. and Yamaguchi,N. (1988) Immunol. Rev., 102, 107-135. Takatsu,K., Yamaguchi,N., Hitoshi,Y., Sonoda,E., Mita,S. and Tominaga,A. (1990) Cold Spring Harbor Symp. Quant. Biol., 54, 745 -751. Tominaga,A., Matsumoto,M., Harada,N., Takahashi,T., Kikuchi,Y. and Takatsu,K. (1988) J. Immunol., 140, 1175-1181. Tominaga,A., Nishikawa,S.-I., Mita,S., Ogawa,M., Kikuchi,Y., Hitoshi,Y. and Takatsu,K. (1989) Growth Factors, 1, 135-146. Tominaga,A., Takahashi,T., Kikuchi,Y., Mita,S., Naomi,S., Harada,N., Yamaguchi,N. and Takatsu,K. (1990) J. Immunol., 144, 1345-1352. von Heijne,G. (1986) Nucleic Acids Res., 14, 4683-4690. Yamaguchi,Y., Suda,T., Suda,J., Eguchi,M., Miura,Y., Harada,N., Tominaga,A. and Takatsu,K. (1988) J. Exp. Med., 167, 43-56. Yamaguchi,N., Hitoshi,Y., Mita,S., Hosoya,Y., Murata,Y., Kikuchi,Y., and Takatsu,K. (1990) International Immunol., 2, 181-187. Tominaga,A. Yawata,H., Kawanishi,Y., Seed,B., Yamasaki,K., Hirata,Y., Taga,T., http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

Molecular cloning and expression of the murine interleukin‐5 receptor.

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/molecular-cloning-and-expression-of-the-murine-interleukin-5-receptor-FNQu0v4O4n

References (4)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 1990
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1002/j.1460-2075.1990.tb07886.x
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal vol.9 no.13 pp.4367-4374, 1990 Molecular cloning and expression of the murine interleukin-5 receptor Satoshi Takaki, Akira Tominaga, et Tominaga al., 1989, 1990), IL-5 induces expression of IL-2 receptor B Yasumichi Hitoshi, Seiji Mita, Eiichiro Sonoda, (Tac) on and T cells (Loughnan et al., 1987; Naoto Yamaguchi and Harada et al., 1987; Takatsu et al., 1987; Nakanishi et al., Kiyoshi Takatsu 1988), and promotes growth and differentiation of Department of Biology, Institute for Medical Immunology, Kumamoto eosinophils (Yokota et al., 1987; Sanderson et al., 1988; University Medical School, Kumamoto 860, Japan Yamaguchi et al., 1988). Communicated by G.Kohler To elucidate how IL-5 can mediate multiple functions in various target cells, we attempted to explore a molecular Murine interleukin-5 is known to play an essential (IL-5) and biochemical characteristics of the receptor. We have role in Ig production of B cells and proliferation and shown from the series of binding and cross-linking studies differentiation of eosinophils. Here, we have isolated that murine IL-5 binds to a specific cell surface receptor with cDNA clones encoding a murine IL-5 receptor by - - both high (KD 150 pM) and low affinity (KD 30 nM) expression screening of a library prepared from a murine and that at least two polypeptides may comprise the IL-5 dependent early B cell line. A cDNA library was functional IL-5 receptor (Mita et al., 1988, 1989). expressed in COS7 cells and screened by panning with Subsequently, we prepared two monoclonal antibodies the use of anti-IL-5 receptor monoclonal antibodies. The (MAbs), designated H7 and T21, which completely inhibit deduced amino acid sequence analysis demonstrates that the binding of IL-5 to its receptor (Yamaguchi et al., 1990; the receptor is a glycoprotein of 415 amino acids (Mr Hitoshi et al., 1990). The MAbs recognize a 60 kd cell- 45 284), including an N-terminal hydrophobic region (17 surface on protein expressed IL-5 responsive cells but not amino a acids), glycosylated extracellular domain (322 on IL-5 unresponsive cells. Thus, the 60 kd protein amino a acids), single transmembrane segment (22 amino recognized by both H7 and T21 MAbs is presumably a acids) and a tail cytoplasmic (54 amino acids). COS7 cells component of the IL-5 receptor. transfected with the cDNA expressed a 60 kd protein Here we report the isolation of a cDNA an encoding IL-5 that = bound IL-5 with a single class of affinity (KD receptor utilizing an from expression cloning strategy murine 2-10 nM). FDC-P1 cells transfected with the cDNA for B cell early line with the use of H7 and T21. Recombinant murine [L-5 receptor showed the expression of IL-5 bind- IL-5 receptor expressed on COS7 cells shows similar binding sites = ing with both low (KD 6 nM) and high affinity and biochemical characteristics to those of properties the = 30 (KD and acquired responsiveness to IL-5 for native with low on the surface of pM) receptor affinity murine proliferation, although parental FDC-P1 cells did not IL-5 responsive cell lines. the introduction Intriguingly, of show IL-S any detectable binding. In addition, several the cDNA into a murine IL-5 receptor hematopoietic cDNA clones encoding soluble forms of the IL-5 receptor progenitor cell line resulted in the expression of functional were isolated. Northern blot analysis showed that two murine IL-5 that the cloned receptor, indicating IL-5 receptor of species mRNAs (5.0 kb and 5.8 kb) were detected in is a of functional with component IL-5 receptor high affinity. cell lines that display binding sites for murine IL-5. We also isolated cDNA clones soluble forms of encoding Homology search for the amino acid sequence of the IL-S IL-5 receptor. Analysis of the of IL-5 sequence receptor receptor reveals that the IL-5 receptor contains a demonstrates that the IL-5 is a member of a receptor growth common motif of a cytokine receptor that is factor family receptor family (Bazan, 1989). recently identified. words: cDNA Key cloning/cytokine receptor family/murine Results IL-5 receptor/soluble receptor Isolation of the munne IL-5 receptor cDNA In order to isolate the cDNA clones for IL-5 we receptor, in have applied an COS7 cells expression screening strategy Introduction with of anti-murine H7 the use two IL-5 receptor MAbs, defined as T factor and T21. cDNA IL-5, previously cell-replacing (TRF) We constructed a x 106 library (-2 (Takatsu et al., or B cell factor II from a murine B cell 1980, 1990), growth clones) IL-5 dependent early line, Y16, et is an inducible in the mammalian CDM8 (BCGFII) (Swain al., 1983) glycoprotein expression vector, (Seed, 1987). primarily produced by activated T cells et Y16 cells surface (Takatsu al., 1988; (B220+, Ly-1 +, cytoplasmic Ig-, Ig-, Swain et et A cDNA la- and the most abundant number of al., 1988; Tominaga al., 1988). FcR+) expressed and human examined. murine et IL-5 IL-5 the cell lines that we encoding (Kinashi al., 1986) receptor among Plasmid has been were transfected into (Azuma et al., Yokota et DNAs of the cDNA COS7 1986; al., 1987) isolated, library cells, now available. has been shown clones rise and recombinant IL-5 is IL-5 and cDNA to the of the giving expression to a broader of activities. In were screened possess spectrum antigenic biological epitopes by panning procedures addition to and differentiation of H7 and T21 MAbs. After four of the using cycles inducing proliferation screening, B et Sonoda et clones were further screened the murine cells (Kinashi positive al., 1986; al., 1989; by panning using Press Oxford University et al. S.Takaki intact H7 MAbs and Petri dishes coated with F(ab')2 To avoid possible rearrangements and mutations of recovered fragments of anti-rat IgG to avoid the selection of cDNA plasmids from COS7 we screened the cells, original and encoding Fc receptor and these screenings were repeated other Y16 cDNA libraries using pIL-5R.8 cDNA as a twice. Resulting individual plasmid clones were transfected hybridization probe and isolated several independent cDNA into COS7 cells and analyzed for H7 binding by flow clones (pIL-5R. 13, pIL-5R.2, and pIL-5R.39) (Figure lA). cytofluorometry, and we finally obtained a clone pIL-5R.8. The inserts of and pIL-5R.8 pIL-5R. 13 were sequenced I I Sacl Hind III Sac Pst I I 5 b pIL-5R.8 pIL-5R.13 pIL-5R.2 pIL-5R.39 -302 GAAATAATTGGTAAACACAGAAAATGTTTCAATAGAAAAAAGAGGAAACAGAACACTGTGTAGC _ - 2 38 CCTGTTATCAGCAGAGACAGAGCTAMCGCTGGGGATACCAAACTAGAAGAAGCTCACTGGACAGGTCCCGGTATGCAGTTCTATTTTTGTTGATGGCTCTGTATCTAATGTGTTCATTT -119 GTACCAAGGATCTAACCAGGGTCTTCCAGAGTCTGAGCAAGCTTCTCCCACTGAGCTACATCACAGCCCCCTGTTTATTGGAAGAAGAAATACTTACACCTTTCCAGTATTCGGCTACC ATG GTG CCT GTG 1 TTA CTA ATT CTT GTG GGA GCT TTG GCA ACA CTG CAA GCT GAC TTA CTT AAT CAC AAA AAG TTT TTA CTT CTA CCT CCA Met Val Pro Val Leu Leul Ile LeuVal Glv Ala LuAla Thr Leu Gln Ala Leu Leu 1 Asn His Phe Leu Leu Leu Pro Pro Asp Lys Lys 91 GTC AAT TTT ACC ATT AAA GCC ACT GGA TTA GCT CAA GTT CTT TTA CATGGCCAATCTGCCAGGCAAGCTGT GACT Val Phe Thr Ile Ala Thr Leu Ala Gln 31 Lys Gly Val Lou Leu His Trp Asp Pro Asn Pro Asp Gln Glu Gln Arg His Val Asp Leu 181 GAG TAT CAC GTG AAA ATA AAT GCC CCA CAA GAA GAC GAA TAT GAT ACC AGA AAG ACT GAA AGC AAA TGT GTG ACC CCC CTT CAT GAA GGC Glu Val Ile Asn 61 Tyr His Lys Ala Pro Gln Glu Asp Glu Tyr Asp Thr Arg Lys Thr Glu Ser Lys Val Thr Pro Leu His Glu Gly Cys TTT GCA GCT AGC GTG AGG ACC ATT CTG AAG AGC AGC 271 CAT ACA ACT CTG GCC AGC AGT TGG GTT TCT GCT GAA CTC AAA GCT CCA CCA GGA Phe Ala Ala Ser Val Arg Thr Ile Leu Ser Ser His Thr Thr Leu Ala Ser Ser Ser Ala Glu Leu Ala Pro 91 Val Pro Lys Trp Lys Gly TCT 361 CCT GGA ACC TCG GTT ACG AAT TTA ACT TOT ACC ACA CAC ACT GTT GTA AGT AGC CAC ACC TTA CAC AGG CCA TAC CAA GTG TCC CTT Ser Pro Thr Ser Val 121 Gly Thr Asn Leu Thr Thr Thr His Thr Val Val Ser Ser His Thr His Leu Arg Pro Tyr Gln Val Ser Leu Cy! 451 CGT TGC ACC TGG CTT GTT GGG AAG GAT GCC CCT GAG GAC CAG ACA TAT TTC CTA TAC TAC AGG TTT GGT GTT TTG ACT GAA AAA TGC CAA 151 Cys Thr Trp Leu Val Gly Lys Ala Pro Glu Arg Asp Asp Thr Gln Tyr Phe Leu Tyr Tyr Arg Phe Gly Val Leu Thr Glu Lys Cys Gln GAA TAC AGC AGA GCA 541 GAT CTG AAC AGA AAT ACT GCA TGC TGG TTT CCC AGG ACA TTT ATC AAC AGC AAA GGG TTT GAA CAG CTT GCT GTG 181 Glu Ser Ala Tyr Arg Asp Lou Asn Arg Asn Thr Ala Phe Pro Thr Phe Ile Trp Arg Asn Ser Lys Gly Phe Glu Gln Leu Ala Val Cy! 631 C^C ATT AAT GGC TCA AGC AAG CGT GCT GCA ATC AAG CCC TTT GAT CAG CTG TTC AGT CCA CTT GCC ATT GAC CAA GTG AAT CCT CCA AGG His Ile ASn Gly Ser Ser Ala Ala Ile 211 Lys Arg Lys Pro Phe Asp Gln Leu Phe Ser Pro Leu Ala Ile Asp Gln Val Asn Pro Pro Arg 721 AAT GTC ACA GTG GAA ATT GAA AGC AAT TCT CTC TAT ATA CAG TGG GAG AAA CCA CTT TCT GCC TTT CCA GAT CAT TGC TTT AAC TAT GAG Thr 241 A Val Glu Ile Glu Ser Asn Ser Leu Tyr Ile Gln Glu Pro Leu Trp Lys Ser Ala Phe Pro Asp His Phe Asn Tyr Glu Cy 811 CTG AAA ATT TAC AAC ACA AAA AAT GGT CAC ATT CAG AAG GAA AAA CTG ATC GCC AAT AAG TTC ATC TCA AAA ATT GAT GAT GTT TCT ACA 271 Leu Ile Asn Thr Lys Tyr Lys Asn Gly His Ile Gln Lys Glu Lys Leu Ile Ala Asn Lys Phe Ile Ser Ile Val Lys Asp Asp ipr Thr 901 TAT TCC ATT CAA GTG AGA GCA GCT GTG AGC TCA CCT TGC AGA ATG CCA GGA AGG TGG GGC GAG TGG AGT CAA CCT ATT TAT GTG GGA AAG Ser Ile Gln Val Ala Val Ser Ser Pro Met Pro 301 Tyr Glu Ser Gln Pro Ile Val L Arg Ala Arg Gly Trp Gly Trp Tyr Gly Cy! Arq GAA AGG T 991 AAG TCC TTG GTA GAA TGG CAT T tC 1GC AGA GTG Glu Ser Glu 331 Arg Lys Lou Val Trp His TGTZO CAT TTA TGG ACC AGG TTG TTT CCA CCG GTT CCG GCC CCA AAG AGT AAC ATC AAA GAT CTC CCT GTG GTT ACT GAA TAT GAG AAA CCT Leu Thr Leu Phe Pro Pro Pro Pro Ser Asn Ile 361 His Trp Val Leu Pro Thr Glu Glu Pro Arg Ala Lys Lys Asp Val Val Tyr Lys 1171 TCG AAT GAA ACC AAA ATT GAA GTT GTA CAT TGT GTG GAA GAG GTT GGA TTT GAA GTC ATG GGA AAT TCC ACG TTT TGA TGGCATTTTGCCATT 391 Ser Asn Glu Thr Ile Glu Val Val --- Lys His Val Glu Glu Val Gly Phe Glu Val Met Gly Asn Ser Thr Phe Cy! CTGAAATGAACTCATACAGGACTCCGTGATAAGAGCAAGGACTGCTATTTCTTGGCAAGGAGGTATTTCAAATGAACACTCAGAGCCAGGCGGTGGTAGAGCTCGCCTTTAATACCAGC 13 83 ACCTGGGATGCACAGACGGGAGGATTTCTGAGTTCGAGGCCAGCTTGGTCTATAAAGTGAGTTCCAGGACAGCCAGAGCTACACAGAGAAACCCTGTCTCGAAAAAACAAACAAACAAA 1 5 02 CAAACAAACAAMAATGAACACTCAATTTGAATGCAAGTCACCAACCCATCCAGACATGAGTCACCAATGTCCCATTTCATAAAGTGTGCATGCCTCACTCAAACCTCCTTGCTCACAGC 162 1 ATAGCACCAGACTCACCCAGAGCATGGGCCTTTGGTTTCCTACCCAGAGTACCATGTTATACCAGTGTGTCTTTGAAAGTTGCTTGACTTACCTTGAACTTTTTGCACAGGAGACAGTT TTTTTAAGCTAATGTCACACATGTTTACTTTGGGTTAAGTTGCCAGTGGTAGCACTCAGCTACAGTGACAGGAGGAAAGGATAGAACTCATTGAGAGTGAACCCAAATTCAAGACTGTC TTTCCTGACGCAAGTGGGAGACACAATTTCATGGTGCTTTTCCCCTTTCAGTTCTAGAATAGTTTCCTTTCTAGAACTGTGCCTGTGTCTTAAAGCATAAGGTAACATTGAGGCAAAAA CAAAGACTATGTCCCACATGTCCCTGTGTTCCATAGGCCTGTTCAAGGAAATGTCTAAGCCAAAGTAAGTTTAAGTCACCGTGCCTGGGGTGAAAAAAGATGGTTCAGATGACGAAGAAG -----I--------------- 2097 ------ ........ ------- ------- -------- CATGAGGGCCTIAGATTGATCACCAGCATCAAGAAACAACAACAACAACAGCAGCACAACAACAAAACAGTGCAAGAAGCACATTCCTATAACCCCAGAGTTGGGAGATAAAGACAA GAGGATCCATGGGAATTGTAGTTCAACCAGTTTAGCCAATTATGTTATCTCTAGGTTCACTGAGAGAAATGGTCTTAAAAATTTAAGGTGGAGAGTGACTAGGCAGATCCTCTGATACT GACTTCTGCCCTAAATATGCATACACATGTACACACACAACACAAAGACACCATTCCCTATTGAGAGAGAAGACAGAAGCTTGTTCAAGGATTAAATTCTTCAAGGCTTCTAGGTACTC TGGAAATGACCTGAGAAAGACATTGAAAATAATTCTGCTTTGGAGGTGATTGCTGGATCTAGAATGTACTTCCCAAAGAGATGTTGATGAAAGAGCCTTCATGGCAACCTGTTGGTCAA CTCATGCTTAGTCAATTCTAATCTCTTAAATTAGGGTTTCCTATACATATTACAATTGTATAAAAATGTATTCTCTAAATATCTTCATTAATGAAGCTGTATCTATAGGTCTTTTTGAT GGGCTGAACATAGAAGCAAACACACTTATGTGTTGGGAAGAGGAATAAGTAGTGATAGAGGGACCTAGTGGTAGTTATTTTACATAGTCCTGAAGAGCTAAAGACAATGAAAGAAGAAA TGGTACTCACAAGAGAGAGAGCTATGTCGGGGTCCTGTCAGCCAAATCTTGCTAGTATATGCAATAGTGTCTGGGTTTGGTGGTTGTATATTGGATGGTTCCCTGGGTGGGGCAGTCTC TGGATGGTCTTTCCTTCCATCACAGCTCTGAAATTTGTCTCTGTAACTCCTTCCATGAGTATTTTGTTCCCCATTCTAAGAAGCAGTGAAGTATCCACACTTTGGTCTTCCTTCTTCTT GAGTTTCATGTGTTTTGCAAATTGTGTGCCTGGCAATACAGAAGCAGATGCTCACAGTCATCTATTGGATGAAACACAGGGCCCCTAATGAAGGAGCCAGAGAAAGTACCCAAGGAGCT AAAAGGGTCTGCAACCCTATAGCAGGAACAACAATATGAACTACCCAGCAACCCTCAGAA1TGTAAATGAAGAAAATATCTAATAAAAAAAAAAAAAAAAAA AA ACC TTC GAA TGA Thr --- Glu Glu Phe GT GTC ATT GGA CCA GGT TGT TAT TTC CAC CGG TTC CGG CCC CAA AGA GTA ACA TCA AAG ATC TCC CTG TGG TTA CTG AAT ATG AGA AAC Val Iie Pro Pro Phe His Val Thr Gly Tyr Gly Gly Cys Phe Gln Ser Ile Ser Leu Leu Leu Asn Asn Arg Arg Arg Lys Trp Met Arg D CTT CGA ATG C AAG TTG TAC ATT GTG TGG AAG AGG AAA TTG TTG TTG AAG TCA TGG GAA ATT CCA CGT AAACA GAT TTT GGC ATT TTG GAT Leu Met Pro Leu Leu Arg Lys Lys Lys Ile Val Leu Leu Ser Glu Tyr Trp Lys Arg Asp Lys Trp Ile Pro Phe Ile Leu Arg Asp Gly CCA TTC TGA --- Pro Phe 1. Structure of the murine IL-5 cDNA. Schematic Fig. and restriction of receptor (A) representation IL-5 cDNAs. map receptor The coding regions are boxed. The hatched boxes the solid boxes the represent transmembrane domain. signal sequence; represent Broken lines indicate regions lacking in and when with and pIL-5R.2 pIL-5R.39 and compared pIL-5R.8 pIL-5R.13. pIL-5R.8, pIL-5R.2 whose insert cDNAs were pIL-5R.39 primed random were isolated from a constructed in CDM8 vector. using primers 13 whose insert was library pIL-5R. primed using oligo(dT) primer was isolated from a constructed in AGS-3 vector. Nucleotide and deduced amino library acid of the (B) sequence murine IL-5 sequence receptor cDNA. The was deduced after DNA sequence of the above described complete sequence analysis cDNA clones. Nucleotides and amino acids are numbered on the left The first underlined 17 amino acid residues margin. the represent The transmembrane signal sequence. domain is marked by a box. The N-linked sites are shown double potential glycosylation underlines. The are marked by cysteines asterisks. The by (C) deduced amino acid sequence in which occurs the deletion of nucleotides pIL-5R.2, the following 986-1164, in designated by open triangle (V) (B). (D) The deduced amino acid in which occurs the deletion of sequence pIL-5R.39, nucleotides following the closed 986-1079, designated by triangle (V) in (B). 4368 Murine interleukin-5 receptor gene by standard procedures (Figure IB). In the composite disuccinimidyl tartarate (DST). A major broad band of sequence shown in Figure iB, pIL-5R.8 is represented by -97 kd was detected when COS7 cells transfected with nucleotides -302 and 1506 and clone pIL-5R.13 by pCAGGS-5R were cross-linked with 35S-labeled IL-5 nucleotides - 165 to 3269. Each sequence contains a large (Figure 3A, lane 3). Under reducing conditions, the size of open reading frame that encodes a polypeptide of 415 amino cross-linked complex decreased to 75 kd (lane 5) due to the acids (Figure iB). A hydropathy plot of the deduced amino 35S-labeled IL-5 from the major dissociation of monomeric acid sequence predicts two hydrophobic regions. The first cross-linked complex, because biologically active IL-5 binds hybrophobic region spans the NH2-terminal 17 amino acids to its receptor as disulfide-linked dimer (Takahashi et al., and may represent a signal sequence (von Heijne, 1986). 1990). These complexes were disappeared by the addition The second region (22 amino acids) spans from residues of excess amounts of unlabeled IL-5 (lanes 4 and 6). By 340-361 and appears to constitute a transmembrane domain contrast, none of cross-linked band was detected by cross- of the receptor molecule. The predicted mature poly- with vector alone (lanes IL-5 linking of COS7 cells transfected of with 1 Then we carried out the immunoprecipitation by peptide IL-5 receptor consists of 398 amino acids and 2). a calculated molecular size of 45 284 daltons. There are six using H7 MAb and cell lysates from cell-surface 125i- COS7 transfectants. H7 MAb immunoprecipitated potential N-linked glycosylation sites of which four are found labeled in the putative 322 amino acid extracellular domain. Such the 60 kd protein from cell lysates of 125I-labeled COS7 a post-translational modification may account for the cells transfected with pCAGGS-5R, but not from these difference of molecular sizes between the estimated mature transfected with control vector (Figure 3B). The sizes and IL-5 receptor (60 kd) (Yamaguchi et al., 1990) and the calculated one (45 kd). The putative transmembrane domain is followed by a 54 amino acid intracellular domain. A. _1 The nucleotide sequences of pIL-5R.2 and pIL-5R.39 were - 3 0 C,, identical to that of pIL-5R.8 except that they lacked 0I These nucleotides 986-1164 and 986- 1079, respectively. V' deletions in two cDNA clones will cause altered translational 2 - four amino acids reading frames that extend for an additional the end point (pIL-5R.2) or 62 amino acids (pIL-5R.39) after 0 1 2 3 4 5 lL 1- 135SI-1L- nMf of deletion, respectively (Figure IC and D). These two I -j-,-- %..-# predicted amino acid sequences lack the transmembrane domain. I I I I I I I I I I 4 6 8 10 Binding sites / oel (x10-3) Binding and biochemical characteristics of the cloned murine IL-5 receptor of in order We next expression studies pIL-5R.8 performed x6 _^ 3- 3- binds To to determine whether the cDNA product IL-5. attain levels of expression, we also utilized another higher Ir 2 Dr vector (kindly provided by 2- strong expression pCAGGS o..- the entire 0o i 2 into which the cDNA spanning coding Miyazaki), (nM) [35S}IL-5 charac- was inserted sequence (pCAGGS-5R). Binding 1* -- p on COS7 cells teristics of the cloned IL-5 receptor expressed 2A B. COS7 cells were shown in Figure and transiently with the transfected with and plasmid pIL-5R.8 expression and 4 were shown to bind with 35S-labeled IL-5 1 3 pCAGGS-5R 2 with unlabeled murine IL-5. The sites / cell its was competed Binding (x10-5) binding for to saturation curve 35S-labeled IL-5 binding binding A0 - 10. a class transfectants showed only single (low pIL-5R.8 C? . with an of IL-5 binding apparent equilibrium c, affinity) 3 Cl 3 of 2.0 nM and 1.2 x 104 dissociation constant (KD) When COS7 cells were binding sites per cell (Figure 2A). x with -70 times transfected pCAGGS-5R, they expressed x 105 sites than more IL-5 binding sites (-8.8 per cell) ( [2 with these on COS7 cells transfected pIL-5R.8. However, SI-IL-5 (nM) a ~~~~~135 _L a class (low of IL-5 we detected only single affinity) binding la c I1n an of 9.6 nM sites with KD (Figure 2B). apparent or cells transfected with COS7 cells COS7 Untransfected -I 4 6 not 0 alone showed no shown). 2 vector significant binding (data Binding sites cel showed (x10-3) the source of cDNA Y16 cells, library consistently sites = 20 1200 two IL-5 binding (high affinity, KD pM, 35S-labeled IL-5 to the 2. of Scatchard plot analysis binding = 5.1 22 000 sites Fig. sites low per per cell; affinity, KD nM, the cloned cDNA and to Y16 cells. The COS7 transfectants expressing 2C). cell) (Figure data total inset shows the direct binding (Ol, binding; *, non-specific characterize further the molecular structure of In order to means of determinations. COS7 Points are duplicate (A), binding). we chemical cross- COS7 cells transfected with recombinant IL-5 receptor, performed cells transfected with pIL-5R.8; (B), and Y16 cells. 35S-labeled and pCAGGS-5R; (C), with the use of IL-5 linking experiments 4369 S.Takaki et al. characteristics of of IL-5 is expressed molecules are similar to receptors really observed in cell lines that those express observed as a of the the IL-5 we major component (60 kd) IL-5 receptor, applied the PCR technique for the recep- tor on IL-5 cells ofcDNA dependent (Yamaguchi et amplification (Figure 4B). Such analysis revealed al., 1990). We then examined the characteristics of translation the existence of variant pro- transcripts corresponding to both the ducts of pIL-5R.2 and both lack membrane-bound form pIL-5R.39, nucleotides (Figure 4B, arrow a) and soluble encoding the transmembrane forms (arrow b,c) of IL-5 in cell region. pIL-5R.2 and receptor lines bearing IL-5 pIL-5R.39 cDNAs were inserted into receptor. As shown in the pCAGGS vector Figure 4B, transcripts for the resulting in pCAGGS-5R.2 and membrane-bound form to be pCAGGS-5R.39, respec- appeared expressed most tively, and transfected into COS7 cells. In the conditioned abundantly for the among transcripts IL-5 receptor. media of COS7 cells transfected with Unexpectedly, an extra band was detected in pCAGGS-5R.2, a IL-5 receptor 50 kd protein was and the of bearing cell lines This band seems secreted, binding radiolabeled (arrow d). to be derived IL-5 to Y16 cells was inhibited the conditioned from the IL-5 receptor transcripts, because by media corresponding (data not shown). This result that soluble bands could be obtained suggests IL-5 by using different combinations of receptor is secreted into extracellular media. The conditioned primers (data not This of shown). type mRNA might be a media of COS7 cells transfected with did product resulting from an alternative pCAGGS-5R.39 splicing of the precursor not inhibit the binding of IL-5 to Y16 cells. A translation mRNA for IL-5 receptor. product of a 60 kd protein which is from predictable the Expression of high affinity IL-5 receptor on FDC-P1 cDNA sequence was not detected in the media. transfectants FDC-P1 cells were cotransfected with pCAGGS-5R and Expression of the murine IL-5 receptor transcripts pSV2Neo, and stable transformants were selected as of Expression IL-5 receptor mRNA was examined by hybridization with a cDNA insert from pIL-5R.8 as a probe. The RNA blot analysis revealed the presence of two mRNAs (-- 5.0 kb and 5.8 A kb) whose expression was restricted to 1 2 3 4 5 6 7 cell lines (Y16, and MOPC104E) (Figure 4A) BCLI-B20 that have been identified as bearing the IL-5 receptor (Mita et In al., 1989). contrast, the expression of IL-5 receptor mRNA was not detected in IL-5 unresponsive cells, e.g. X5563, Ltk- FDC-P1, and MTH cells. the level Overall, 28S- of mRNA in expressed particular cells correlated well with the number of low affinity IL-5 receptor per cell. The relative ratio of 5.0 kb to 5.8 kb mRNA varied among IL-5 receptor 18S - bearing cell lines. To analyze whether the mRNA expression of variant types 2 :. 5 6 kD NM lp 4 5 6 7 Mvl 2 8 200 -- bp -- MO 116 - 116 1078 97 -- I. 66 - -~-w- -- a Ama. -- 43 - 43 - *- C 4M amp 234 unlabeied (_ IL-5 0 2ME _ ji U, Vcr p+- C) 6 Fig. 4. (A) An RNA blot o ci) analysis of IL-5R mRNA. Poly(A)+ RNA Vecto r pCAGGS-5R (2 ,cg) was subjected to each lane. HindIII-PstI fragment of pIL-5R.8 was used as a probe. Lane 1, Y16; lane 2, BCL1-B20; lane 3, MOPC104E; lane 4, X5563; lane 5, FDC-P1; lane 6, Ltk- and lane Fig. 3. (A) Affinity COS7 cells MTH. The cross-linking. transfected with 7, numbers of low and high affinity IL-5 binding sites per pCAGGS-5R (lanes 3-6) or control vector 1 cell were as (pCAGGS) (lanes and 2) follows: for Y16, 22 000 and 1200; for BCL1-B20, 7500 were incubated with 35S-labeled IL-5 (4 nM) for 10 and and for min at 37°C in 1000; MOPC104E, 18 000 and 50. (B) RNA from the the absence 3 (lanes 1, and 5) or presence (lanes 2, 4 and following sources or 6) of plasmid DNA was subjected to PCR-based 100-fold excess of unlabeled IL-S. The cell lysates were amplification as described in subjected to Materials and methods. Lane M, size SDS-PAGE under non-reducing (lanes 1-4) or 5 markers; lane 1, Y16; reducing (lanes and lane 2, lane 3, lane MOPC104E; 4, BCLI-B20; 6) and were conditions, analyzed by a Bio-Analyzer 100. FDC-P1; lane 5, pIL-5R.8; (B) lane 6, pIL-5R.39; lane 7, pIL-5R.2; lane Immunoprecipitation studies of the transformants. Cell lysates of 8, CDM8 vector. The primer used for PCR reaction (see Materials pCAGGS-5R transfected COS7 cells were immunoprecipitated as and methods) define fragments of 548 bp (for pIL-5R.8 type, arrow described in Materials and methods. The immunoprecipitated samples a), 454 bp (for pIL-5R.39 type, arrow b) and 369 bp (for pIL-5R.2 were to subjected SDS-PAGE under reducing conditions and analyzed type, arrow c). Arrow d is an extra band that does not correspond to a 100. by Bio-Analyzer the fragments derived from the cloned cDNAs. 4370 Murine interleukin-5 receptor gene described in the Materials and methods. Four transfected binding parameters calculated from Scatchard plots derived clones that were reactive to H7 MAb were established. One from the binding data show that FDC-5R cells express - 500 of these, FDC-5R was analyzed in detail for IL-5 binding binding sites per cell for IL-5 with an apparent KD of and IL-5 responsiveness compared with these cells 30 pM (high affinity) and 8000 binding sites per cell with transfected with pSV2Neo alone. Figure 5A shows binding of 6 nM (low affinity). These are close to the values KD experiments with 35S-labeled IL-5 on FDC-5R. FDC-5R for the IL-5 binding on IL-5 responsive cells. determined cells specifically bound IL-5, whereas FDC-PI cells Figure 5B shows that FDC-5R cells became IL-5 respon- transfected with pSV2Neo did not (data not shown). The for DNA synthesis, whereas neither parental FDC-PI sive nor FDC-Pl transfected pSV2Neo alone responded to IL-5. CO) Discussion v- To explore the mechanisms of signal transduction induced by various growth and differentiation factors, it is necessary Li to the structure of their receptors. Since receptors determine for hormones and cytokines including IL-5 are expressed in small numbers on the surface of target cells, isolation and of these receptors have been laborious. characterization receptors for several cytokines have been Recently, molecularly cloned by using various techniques (Sims et al., 1988; Yamasaki et al., 1988; D'Andrea et al., 1989a; ses / cell (x10-3) BinDing Hatakeyama et al., 1989; Mosley et al., 1989; Gearing et 1989; Itoh et al., 1990; Goodwin et al., 1990; al., Q1 Fukunaga et al., 1990). To isolate cDNA for IL-5 receptor, °x we used expression cloning strategy with an antibody- c 8- cell panning procedure developed by Seed and mediated 6- because we had already prepared MAbs Aruffo (1987), the receptor for IL-5. Where the cell source of a against 4- cDNA library bears abundant numbers of Fc receptors, Fc-mediated binding of MAbs caused a decrease in the 0% of screening in Seed's cloning system. We 13Illill- efficiency Mln 0.001 0.01 0.1 1 10 just such a situation. To overcome this problem, experienced IL-5 (pM) we modified the panning method with the use of Petri dishes coated with F(ab')2 fragments of anti-rat IgG instead of IL-5 binding to the plot analysis of 35S-labeled Fig. 5. (A) Scatchard intact anti-rat IgG. Since the binding of H7 MAb to FDC-P1 cells transfected with the cloned cDNA. The inset shows the direct binding data (O, total binding; *, non-specific binding). (B) recombinant Fc receptor expressed on COS7 cells was very IL-5 dependent proliferation of FDC-P1 transformants expressing the loose, H7 MAb easily dissociated from Fc receptor on the by FDC-P1 cells IL-5 receptor. [3H]thymidine incorporation murine cell surface by layering transfectants on 2% Ficoll in PBS (0), FDC-P1 cells transfected with pSV2Neo (A) and FDC-P1 cells followed centrifugation during the first antibody separa- by transfected with pCAGGS-5R and pSV2Neo (A) were determiined as et al., 1989). tion of the screening procedure. Introducing this previously described methods (Tominaga step w S N T TrIIH (16aa) R- T[lL (llaa) F f Y Y F (5aa) K Q (7aa) TrA)K WTEITI R (5 6aa) Q [i1 E mIL5R 128 E[j C RJ (56aa) E WI S S E L S E 36 TILIE NOD (Saa) IICISIWA (llaa) T Ll Ll Y[ Q (7aa) (10aa) H Cl V3-PI R mIL3RI TILILIYa C HIWIE FY P K S P V V RICIS [PV (46aa) 251 NWLQIC Ffi D (Saa) HICISIWIE (llaa) GCLl (7aa) (10aa) Y mIL3RI1 T I P R N (5aa) C v c HIMIE M (Slaa) TWJN 31 E T C F D (Saa) T E W F (llaa) (9aa) mIL4R C I (55aa) L 39 C l Q S H L L NiIFIE' F Q I K L T L N (9aa) TlSl E F L KY mIL7R SF (5aa) (12aa) (7aa) C W (60aa) S W E N S V S V1T AWV P D T E L L P (5aa) C N LLI L 33 QFIT Y (Saa) (llaa) (6aa) hIL2R§ C Ql V T W Q V aaL K P (5aa) F C L (56aa) hIL6R 118 riS C F R K (6aa) V C E W G (llaa) V|M| (llaa) Q -E]S C S L H W C S T (53aa) RI W L 49 E FFr0 (5aa) VlClFlWlE (llaa) (6aa) S Q (9aa) F mEPOR L C |LZ C C H N (53aa) RIWI K hGMCSFR 123 N F Y N C T W A (llaa) F1 Y IIR N (7aa) RI (6aa) V1G FIS C (5aa) EI.1 D Y K N F K (59aa) K W S I HK P (Saa) T C W W N (llaa) SILI TIYS K (7aa) P (4aa) CFC rPRLR 28 JV S C Y (57aa) R W E P S C H W T FJ T R (llaa) EI7 P D (4 aa) N F,N hGHR 53 F TKCR (Saa) (13aa) QJ R S R D V A K K N sai R (61aa) S J K mGCSFR 104 N LJM H (6aa) V C Q E (13aa) K S F (llaa) (2aa) SC aS TM domain r I L R IS N mIL5R (43aa) Ti S V A V (6aa) P 7G1 R w Qs L Y (12aa) (4aa) P P VIA IIQ RIA 122aa) K[M I Y A V T L (6aa) S G R sJ WS _-E.EV mIL3RI (53aa) RTn T Y R K W K K I P N P S K S L S Y C A R V P (4aa) D G I WS EW S - X1E Y (5aa) (26aa) (6aa) mIL3RII (46aa) R! Q A P L V A I I S T G T W S E W S - P S I (13aa) (6aa) W D RS mIL4R (51aa) Y Y T A R V R VR (3aa) (24aa} HLJK T L E Q L V R P K F W S E W S - P S S (14aa) (6aa) V VVWJflSILPD mIL7R (39aa) M Y E K (5aa) J 125aa} (6aa) P KL K C NT PD PS K (49aa) FV R P F T T W S zW S - P L A (12aa) (25aa} (4aa) WAL' hIL2RP E G K T S M H P P Y RAJ L hIL6R R F V R E P (3aa) Q TE W S E W SQ P A (48aa) (28aa) (6aa) KLLJ (47aa) A V R AR1M S F W S A W S E A S (9aa) ( 22aa} (6aa) Q I W P G IlX P E S E F E mEPOR (47aa) R T F (5aa) G R IKIDrn LN [5lN A H S V K I I L N W S S W S E AI E (5aa) (27aa) (7aa) PLIVPPVPIQ hGMCSFR (48aa) E PR (6aa) C11 F P P V P GWK IIKIG F|DIT rPRLR (48aa) K YL V CKP D - - H G Y W S S Q12aa) (24aa} (7aa) PIVIP. I JG ILDJP - N YGE SE V Y (24aa} (7aa) L11 | hGHR (48aa) YE V RSK Q R N SIGI (16aa) S L S S S§F,'WSDJDAHS T L C I R (3aa) P F W S P W S P G L Q(299aa) (6aa) mGCSFR (47aa) VY (24aa} GJ of the murine IL-5R to cytokine receptors. Murine IL-5R, domains I and II of murine IL-3R (Itoh et al., 1990), murine IL-4R Fig. 6. Alignment et murine IL-7R (Goodwin et al., 1990), human IL-2R beta-chain (Hatakeyama et al., 1989), human IL-6R (Yamasaki et al., (Mosley al., 1989), murine erythropoietin receptor (mEPOR) (D'Andrea et al., 1989a), human GM-CSFR (Gearing et al., 1989), rat prolactin receptor (rPRLR) 1988), human hormone (Leung et al., 1987), and murine G-CSFR (Fukunaga et al., 1990) are aligned. et growth receptor (hGHR) (Boutin al., 1988), indicate the amino acid number starting from the first methionine. Identical residues and conserved substitutions are marked by Numbers at the left dashed are introduced to maximize homology. solid boxes and boxes, respectively. Gaps 4371 S.Takaki et al. binding of IL-5 to IL-5 responsive Y 16 that modification, we succeeded in isolating a cDNA clone of cells, indicating pIL-5R.2 encodes soluble IL-5 receptor. COS7 cells the murine IL-5 receptor. Analysis of the sequence of the in the transfected with both pCAGGS-5R.2 and IL-5 receptor reveals significant homology pCAGGS-5R.39 expressed lesser levels of H7 on their extracellular domain to several receptors for cytokines, epitopes surface that have been cloned. compared with pCAGGS-5R transfectants not growth hormone and prolactin The (data shown). A small proportion of the products encoded extracellular region of these receptors contains two pairs of by the 'WSXWS' motif located close pCAGGS-5R.2 or pCAGGS-5R.39 remain on the cysteine residues and to may cell surface of COS7 cells transfected. we are unable the transmembrane domain (Figure 6) et Although (Gearing al., 1989; to detect the translation of Itoh et al., 1990). The murine IL-5 receptor product pCAGGS-5R.39 in the may, therefore, cultured it is not known whether belong to a recently proposed a new receptor gene family media, pIL-5R.39 is moment. In (D'Andrea et al., 1989b; Bazan, 1989; Gearing et al., 1989; functional at this IL-5 receptor mRNA evolved from a Itoh et al., 1990) and may have common expression, two classes of mRNAs (-5.0 kb and 5.8 kb) The in IL-5 lines ancestor of other cytokine receptors. IL-5 receptor has were detected only receptor bearing cell (Figure 127Thr we did not detect 3.5 kb mRNA another extra domain from to the 3). Interestingly, band in 18Asp preceding mRNA prepared from Y16 cells. As for the common motif, like GM-CSF receptor (Gearing et al., 1989) size of cDNA, et in pIL-5R. 13 cDNA might have primed by possible internal and IL-6 receptor (Yamasaki al., 1988). However, the does not residues 3' relation to this extra domain, IL-5 receptor poly(A) sequence among non-coding region. As to feature either with the mRNAs that encode the soluble forms of appear share the structural GM-CSF IL-5 receptor receptor or with IL-6 which is of would be only 179 bp (pIL-5R.2 form) or 94 receptor composed Ig-like bp (pIL-5R.39 than a of domain. form) shorter full-length transcript IL-5 receptor, features of extracellular it would not account for the difference in size of the two In contrast to conserved domain, of the murine is We the 5.8 kb mRNA the cytoplasmic domain IL-5 receptor transcripts. suppose may be the for neither considerably unique. The consensus sequences precursor transcript that has to be fully spliced before nor a domain of some maturation or may have different polyadenylation sites. It a tyrosine kinase domain catalytic kinases et were in the is important to examine whether transcripts for the soluble protein (Hanks al., 1988) present IL-5 the is not of forms of IL-5 receptor are in receptor. Moreover, IL-5 receptor composed expressed the IL-5 receptor serine-rich that is observed in of IL-2 cell lines. PCR we the region fl-chain bearing By technique, confirmed the et IL-4 to the soluble forms of receptor (Hatakeyama al., 1989), receptor (Mosley transcripts corresponding IL-5 et al., 1989), erythropoietin receptor (D'Andrea et al., receptor lacking putative transmembrane domain in 1989a), IL-3 receptor et al., 1990) and G-CSF receptor and MOPC104E as well as Y16 cells (Itoh (Figure BCLI-B20 (Fukunaga et al., 1990). However, the sequence from 4B). These results indicate that the transcripts for the soluble form of IL-5 are not to 367Leu to 380Asp in the IL-5 receptor following the receptor specific Y16 cells, and not transmembrane domain contains a which is so rare compared with the transcript for proline cluster, membrane-bound well conserved among receptors for GM-CSF forms. The for (Gearing receptors IL-4, IL-7 and growth hormone et et and have also been shown to be in al., 1989), prolactin (Boutin al., 1988), growth encoded both membrane- hormone (Leung et The in the bound and soluble forms (Mosley et al., al., 1987) (Figure 6). region 1989; Baumbach domain that is these et Goodwin et cytoplasmic homologous among al., 1989; al., 1990). The existence ofcDNAs receptors is likely to have some important role in an encoding soluble for factor receptors growth may suggest association with other membrane components which may be important regulatory roles of soluble receptors in responsible for IL-5 mediated signal transduction or hematopoiesis and immune response. The effect of the formation of functional high affinity IL-5 soluble forms of IL-5 in receptors. receptor IL-5-mediated signal Recombinant IL-5 receptor expressed on COS7 cells transduction must await further studies. displayed the low affinity class of IL-5 binding previously characterized on various IL-5 responsive cells Y16 Concluding remarks including cells. The biochemical data unequivocally demonstrate that The 60 kd protein, molecularly characterized in this study, the cDNA-encoded product is directly involved in the is able to bind to IL-5 with a single class of affinity (low formation of IL-5 receptor. However, this product did not affinity). The IL-5 receptor has a relatively short cytoplasmic reconstitute the high affinity IL-5 receptor. Intriguingly, tail and lacks known kinase domains. It is important to note FDC-P1 cells transfected with the IL-5 receptor cDNA that an additional molecule appears to be involved in the both and low expressed high affinity IL-5 binding sites and formation of the functional high affinity IL-5 receptor. became responsive to IL-5 of (Figure 5), although parental Availability the IL-5 receptor cDNA will allow us further FDC-PI cells showed neither IL-5 binding nor investigation of IL-5 IL-5-mediated signal transduction and responsiveness. These results indicate that recombinant IL-5 identification of an associated molecule(s) for the IL-5 receptor is really a component of the functional IL-5 receptor receptor complex. with high affinity. We consider that the 60 kd protein encoded by the cloned cDNA may associate with certain Materials and methods cellular protein(s), which may not bind IL-5 by itself, in FDC-P1 cells resulting in the formation of the high affinity Reagents and cell lines MAbs H7 (rat and T21 (rat against murine IL-S receptor were IL-5 receptor. IgG2a) IgGj) prepared and purified as described (Yamaguchi et al., 1990; Hitoshi et al., We isolated cDNA clones (pIL-SR.2 and pIL-5R.39) that 1990). The IL-5 dependent early B cell line, Y16, was established from lack the transmembrane portion of IL-5 receptor cDNA. The BALB/c bone marrow cells as described (Tominaga et 1989) and al., conditioned media of COS7 cells transfected with maintained in the presence of 10 pM IL-S in RPMI-1640 medium pCAGGS-SR.2 but not with pCAGGS-SR.39 inhibited the supplemented with 10% fetal calf serum (FCS), 50 2-ME, penicillin ItM 4372 receptor gene Murine interleukin-5 (100 U/mi) and streptomycin (100 The murine B cell chronic 1222-1241). PCR reaction (in a volume of 50 1l) contains 200 of each Ag/ml). tLM leukemic cell line BCL1-B20 (in vitro line), an IL-2 dependent CTLL 1 of each 10 mM Tris-HCI pH 8.3, 50 mM dNTP, specific primer, AM (MTH), an IL-3 dependent cell line (FDC-P1) and mouse myeloma cell KCI, 1.5 mM, MgCl2, 0.001% (w/v) gelatin and 1.25 units Taq lines (MOPC104E and X5563) were maintained as previously described 1 Elmer The conditions were: min at 94°C; polymerase (Perkin Cetus). procedures (Yamaguchi et al., 1990). 2 min at 3 min at for 25 in a DNA thermal cycler. A 56°C; 72°C cycles of PCR reaction was electrophoresed through a 1 % agarose gel. portion Construction of cDNA libraries Total RNA was prepared from Y16 cells by the guanidium isothio- Binding assay cyanate/CsTFA method (Okayama et al., 1987) and poly(A)+ RNA was Recombinant murine and labeled IL-5 were IL-5 [35S]methionine prepared selected by oligo(dT)-cellulose column chromatography. Double-stranded Takahashi to as described et according procedures (Tominaga al., 1988; DNA was synthesized according to procedures described by Gubler and et For the COS7 transfectants were harvested, al., 1990). binding assay, Hoffman (1983) with modifications using a kit from BRL.Life Technologies. x 100 of the medium at 2- 10 104 l1 resuspended per binding The blunt-end cDNA was ligated with BstXI non-palindromic linkers and medium/25 mM HEPES 7.2/0.1 % and incubated (RPMI-1640 pH BSA), cDNA longer than 1.0 kb was isolated by 5-20% potassium acetate gradient with concentrations of 35S-labeled IL-5 at 370C for 10 min increasing (Mita centrifugation (Seed and Aruffo, 1987). The size fractionated cDNA was cells were harvested et For Y16 cells and FDC-P1 al., 1988). transformants, cloned into BstXI-digested CDM8 (Seed, 1987) or pAGS-3 (Miyazaki et al., x x of and at 1 cells and 1 106 100 the resuspended I05 per binding 1989). out as described and were carried medium, respectively, binding assays as the difference above. In all was defined binding assays, specific binding Screening of cDNA libraries obtained in the of between total and binding non-specific binding presence A pool of CDM8 library representing -2 x 106 cDNA clones was and an number of 100-fold excess of unlabeled IL-5. The KD average expressed in COS7 cells and screened by panning method with a mixture Scatchard of the sites cell were calculated plot analysis binding binding per by of MAbs H7 and T2 1. Two to three days after transfection, cells were data. incubated with H7 and T21 MAb, layered on 2% Ficoll solution and centrifuged at 200 g for 5 min. After centrifugation cell pellets were Chemical cross-linking resuspended in PBS containing 0.5 mM EDTA and 5% FCS and distributed x incubated Transfected cells 5 were with COS7 (- 106) harvested, 35S- into panning dishes (60 mm in diameter) that had been coated with purified for 10 in the absence or of labeled IL-5 at min (4 nM) 37°C presence anti-rat IgG (Cappel). Episomal DNA was collected from adherent cross-linked with 1 mM goat 100-fold excess of unlabeled IL-5 and subsequently Transformed E. coli were then washed and with cells to the dishes and introduced into Escherichia coli. DST at for 30 min. Cells (PIERCE) 4°C lysed were fused with COS7 cells after the treatment with lysozyme, and subjected X-100 in the of inhibitors buffer 1% Triton lysis containing presence protease to a second round of panning. These panning procedures were repeated mM 2 mM 10 mM 2 JIM (2 EGTA, EDTA, phenylmethylsulfonyl fluoride, four times as described (Seed and Aruffo, 1987). Then positive clones were 2 mM and at pepstatin, leupeptin, o-phenanthroline, aprotinin tiM further screened by the panning using intact H7 MAbs and Petri dishes coated as described et The extraction KIU/ml) (Mita al., 1989). detergent with F(ab')2 fragments of anti-rat IgG (Cappel). This screening process was to SDS -PAGE with 7.5% under mixture was subjected polyacrylamide repeated twice. Resulting individual plasmid clones were transfected into and then a or Bio-Analyzer non-reducing reducing conditions, analyzed by COS7 cells by DEAE-dextran method as described (Seed and Aruffo, 100 Photo Film Co. Ltd). (Fuji 1987). Cells were harvested 2 days after transfection and stained with H7 MAb and FITC-conjugated F(ab')2 fragments of goat anti-rat IgG (Cappel). and SDS - PAGE Immunoprecipitation Cells were then washed and with a flow cytometer (FACScan, x radioiodinated with the use of IODO-BEADS analyzed Cells were (-5 106) Becton Dickinson Immunocytometry Systems). with PBS cells were After using lysis (PIERCE). washing (pH 7.2), lysed in the above section. lodinated cell were then buffer as described lysates DNA sequencing H7 followed the incubation with Protein incubated with by G-coupled cDNA inserts of clones pIL-SR. 13, pIL-5R.2 and pIL-5R.39 The pIL-5R.8, at for 12 h. The were boiled Sepharose (Pharmacia) 4°C immunoprecipitates the chain termination method (Sanger et al., were sequenced by dideoxy buffer with 5% 2-ME for 3 and in SDS min sample analyzed by the modified T7 polymerase (Sequenase, USB). 1977) using Gels were then a SDS-PAGE on 9% polyacrylamide gels. analyzed by Bio-Analyzer of the IL-5 cDNA Expression receptor A mammalian expression vector pCAGGS (provided by Dr Miyazaki, of Kumamoto Medical School) is a derivative pAGS-3 (Miyazaki University Acknowledgements et al., 1989), and contains an SV40 origin of replication, cytomegalovirus followed a enhancer and a chicken ,B-actin promoter by sequence sequence Drs B.Seed and and for vector We thank J.-I.Miyazaki pCDM8 A.Aruffo, The from the rabbit ,B-globin gene (J.-I.Miyazaki, personal communication). and Drs T.Kunisada and and pCAGGS vector, respectively; J.-I.Miyazaki, was inserted cDNA obtained by digestion of pIL-5R.8 with XhoI sequence valauble advice and critical of this for S.-I.Nishikawa reading manuscript. into a EcoRI site of an XhoI linker, resulting in unique pCAGGS using a Grant-in-Aid for Scientific Research and for in part by Special Supported were inserted The of and pCAGGS-5R. coding region pIL-5R.2 pIL-5R.39 Cancer from the of Education, Project Research, Bioscience, Ministry to the same as that of Transfections were pCAGGS by procedures pIL-5R.8. Coordination Funds for Science and and Culture, Promoting by Special DEAE-dextran method. Cells were at 8 h performed by trypsinized post- of the Science and Science and Technology Agency, Japan. Technology transfection and re-seeded in Petri dishes. After 2 or 3 day incubation, cells harvested after a brief treatment with 0.5 mM EDTA and subjected were to further For FDC-PI and pSV2Neo were analysis. cells, pCAGGS-5R References were selected in transfected Stable transformants by electroporation. medium G418-containing (400 /Ag/ml). Kinashi,T., Noma,T., Matsuda,F., Azuma,C., Tanabe,T., Konishi,M., Severinson,E. Hammarstr6m,L., Smith,C.I.E., Yaoita,Y., Takatsu,K., RNA blot analysis and colony hybridization Acids 9149-9158. Nucleic and Res., 14, Honjo,T. (1986) and Genes cell lines were to Dev., 3, Poly(A)+ RNA (2 ttg) prepared from various subjected (1989) Baumbach,W.R., Horner,D.L. Logan,J.S. 1 2.2 M as 1199-1205. electrophoresis through % agarose gel containing formaldehyde Res. 788-795. et and transferred to Gene Screen Biochem. Commun., 164, described (Sambrook al., 1989), (Du Pont). Bazan,J.F. (1989) Biophys. was carried out to manufacturer's recommendation. Shirota,M., Hybridization according Jolicoeur,C., Okamura,H., Gagnon,J., Edery,M., Boutin,J.-M., and Cell, was carried out as described et (1988) Colony hybridization (Sambrook al., 1989). Banville,D., Dusanter-Fourt,I., Djiane,J. Kelly,P.A. with 69-77. the HindIII-PstI of was labeled 32p As a probe, fragment pIL-5R.8 53, 277-285. kit from Pharmacia. and Cell, 57, random method a (1989a) by primer labeling using D'Andrea,A.D., Lodish,H.F. Wong,G.G. and Cell, 58, Fasman,G.D. Lodish,H.F. (1989b) D'Andrea,A.D., 1023-1024. RNA detection using PCR and Cell, 61, RNA was used to the Seto,Y. (1990) For PCR 1 of generate Ishizaka-Ikeda,E., Nagata,S. amplification, ug poly(A)+ Fukunaga,R., 341-350. fifth of the cDNA reaction mixture was first strand cDNA. One subjected Plasmid DNA was used as control. The Gearing,D.P., King,J.A., Gough,N.M. and Nicola,N.A. (1989) EMBO to PCR amplification. (10 ng) 3667-3676. for PCR reaction were 5'-GCCATTGACCAAGTGAATCC used J., 8, primers and 5'-GTGGAATTTCCCATGACTTC Falk,B.A., 694-7 (position Goodwin,R.G., Friend,D., Jerzy,R., Gimpel,S., (position 13) Ziegler,S.F., 4373 et al. S.Takaki Taniguchi,T., Hirano,T. and Kishimoto,T. (1988) Science, 241, Dower,S.K., March,C.J., Namen,A.E. and Park,L.S. (1990) Cosman,D., 825-828. Cell, 60, 941 -951. et al. Proc. Natl. Acad. Sci. USA, 84, 7388-7392. Gubler,U. and Hoffman,B.J. (1983) Gene, 25, 263-269. Yokota,T. (1987) Quinn,A.M. and Hunter,T. (1988) Science, 241, 42-52. Hanks,S.K., Received on August 20, 1990; revised on October 4, 1990 Harada,N., Matsumoto,M., Koyama,N., Shimizu,A., Honjo,T., Tominaga,A. and Takatsu,K. (1987)Immnunol. Lett., 15, 205-215. Hatakeyama,M., Tsudo,M., Minamoto,S., Kono,T., Doi,T., Miyata,T., Note added in proof Miyasaka,M. and Taniguchi,T. (1989) Science, 244, 551-556. Hitoshi,Y., Yamaguchi,N., Mita,S., Sonoda,E., Takaki,S., Tominaga,A. The nucleotide sequence data reported here will appear in the EMBL, and Takatsu,K. (1990)J. Inmunol., 144, 4218-4225. GenBank and DDBJ Nucleotide Sequence Databases under the accession Itoh,N., Yonehara,S., Schreurs,J., Gorman,D.M., Maruyama,K., Ishii,A., number D90205. Yahara,I., Arai,K.-I. and Miyajima,A. (1990) Science, 247, 324-327. Kinashi,T., Harada,N., Severinson,E., Tanabe,T., Sideras,P., Konishi,M., Azuma,C., Tominaga,A., Bergstedt-Lindqvist,S., Takahashi,M., Matsuda,F., Yaoita,Y., Takatsu,K. and Honjo,T. (1986) Nature, 324, 70-73. Leung,D.W., Spencer,S.A., Cahianes,G., Hammonds,R.G., Collins,C., Henzel,W.J., Bamard,R., Waters,M.J. and Wood,W.I. (1987) Nature, 330, 537-543. Loughnan,M.S., Takatsu,K., Harada,N. and Nossal,G.J.V. (1987) Proc. Natl. Acad. Sci. USA, 84, 5399-5403. Mita,S., Harada,N., Naomi,S., Hitoshi,Y., Sakamoto,K., Akagi,M., Tominaga,A. and Takatsu,K. (1988) J. Exp. Med., 168, 863-878. Mita,S., Tominaga,A., Hitoshi,Y., Sakamoto,K., Honjo,T., Akagi,M., Kikuchi,Y., Yamaguchi,N. and Takatsu,K. (1989) Proc. Natl. Acad. Sci. USA, 86, 2311-2315. Miyazaki,J.-I., Takaki,S., Araki,K., Tashiro,F., Tominaga,A., Takatsu,K. and Yamamura,K.-I. (1989) Gene, 79, 269-277. Mosley,B. et al. (1989) Cell, 59, 335-348. Nakanishi,K., Yoshimoto,T., Katoh,Y., Ono,S., Matsui,K., Hiroishi,K., Noma,T., Honjo,T., Takatsu,K., Higashino,K. and Hamaoka,T. (1988) J. Immunol., 140, 1168-1174. Okayama,H., Kawaichi,M., Brownstein,M., Lee,F., Yokota,T. and Arai,K.-I. (1987) Methods Enzymol., 154, 3-27. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning. A Laboratory Manual (2nd edn). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanderson,C.J., Campbell,H.D. and Young,I.G. (1988) Immunol. Rev., 102, 51-76. Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA, 74, 5463-5467. Seed,B. (1987) Nature, 329, 840-842. Seed,B. and Aruffo,A. (1987) Proc. Natl. Acad. Sci. USA, 84, 3365-3369. Sims,J.E. et al. (1988) Science, 241, 585-589. Sonoda,E., Matsumoto,R., Hitoshi,Y., Ishii,T., Sugimoto,M., Araki,S., Tominaga,A., Yamaguchi,N. and Takatsu,K. (1989) J. Exp. Med., 170, 1415-1420. Swain,S.L., Howard,M., Kappler,J., Marrack,P., Watson,J., Booth,R., Wetzel,G.D. and Dutton,R.W. (1983) J. Exp. Med., 158, 822-835. Swain,S.L., McKenzie,D.T., Dutton,R.W., Tonkonogy,S.L. and English,M. (1988) Immunol. Rev., 102, 77-105. Takahashi,T., Yamaguchi,N., Mita,S., Yamaguchi,Y., Suda,T., Tominaga,A., Kikuchi,Y., Miura,Y. and Takatsu,K. (1990) Mol. lnmunol., 27, 911-920. Takatsu,K., Tanaka,K., Tominaga,A., Kumahara,Y. and Hamaoka,T. (1980) J. Immunol., 125, 2646-2653. Takatsu,K., Kikuchi,Y., Takahashi,T., Honjo,T., Matsumoto,M., Harada,N., Yamaguchi,N. and Tominaga,A. (1987) Proc. Natl. Acad. Sci. USA, 84, 4234-4238. Takatsu,K., Tominaga,A., Harada,N., Mita,S., Matsumoto,M., Kikuchi,Y., Takahashi,T. and Yamaguchi,N. (1988) Immunol. Rev., 102, 107-135. Takatsu,K., Yamaguchi,N., Hitoshi,Y., Sonoda,E., Mita,S. and Tominaga,A. (1990) Cold Spring Harbor Symp. Quant. Biol., 54, 745 -751. Tominaga,A., Matsumoto,M., Harada,N., Takahashi,T., Kikuchi,Y. and Takatsu,K. (1988) J. Immunol., 140, 1175-1181. Tominaga,A., Nishikawa,S.-I., Mita,S., Ogawa,M., Kikuchi,Y., Hitoshi,Y. and Takatsu,K. (1989) Growth Factors, 1, 135-146. Tominaga,A., Takahashi,T., Kikuchi,Y., Mita,S., Naomi,S., Harada,N., Yamaguchi,N. and Takatsu,K. (1990) J. Immunol., 144, 1345-1352. von Heijne,G. (1986) Nucleic Acids Res., 14, 4683-4690. Yamaguchi,Y., Suda,T., Suda,J., Eguchi,M., Miura,Y., Harada,N., Tominaga,A. and Takatsu,K. (1988) J. Exp. Med., 167, 43-56. Yamaguchi,N., Hitoshi,Y., Mita,S., Hosoya,Y., Murata,Y., Kikuchi,Y., and Takatsu,K. (1990) International Immunol., 2, 181-187. Tominaga,A. Yawata,H., Kawanishi,Y., Seed,B., Yamasaki,K., Hirata,Y., Taga,T.,

Journal

The EMBO Journal – Springer Journals

Published: Dec 1, 1990

There are no references for this article.