Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Diagnosis of Chlamydia trachomatis cervical infection by detection of amplified DNA with an enzyme immunoassay.

Diagnosis of Chlamydia trachomatis cervical infection by detection of amplified DNA with an... Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://jcm.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve ERRATA LINDA BOBO, FRANCOIS COUTLEE, ROBERT H. YOLKEN, THOMAS QUINN, AND RAPHAEL P. VISCIDI The Eudowood Division of Infectious Diseases, Department of Pediatrics, and Division of Infectious Diseases, and Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; Department of Microbiology and Infectiology, Hopital Notre Dame, Montreal, Quebec, Canada; and Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892 Volume 28, no. 9, p. 1969, column 1, fine 14 from the bottom: "Ct. 0005" should read "Ct. 0005 (sense)." Page 1969, column 1, line 13 from the bottom: Should read "Ct. 06 (antisense) TTCACATCTGTTTGCAAAACACGGTCG AAAACAAAG." Page 1969, column 1, line 8 from the bottom: "Ct. 03T7" should read "Ct. 03T7 (sense)." Page 1969, column 1, line 6 from the bottom: Should read "Ct. 04 (antisense) CCATAGTAACCCATACGCATGCTG." Convenient Agarose Medium for Simultaneous Determination of the LowCalcium Response and Congo Red Binding by Virulent Strains http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Clinical Microbiology American Society For Microbiology

Diagnosis of Chlamydia trachomatis cervical infection by detection of amplified DNA with an enzyme immunoassay.

Diagnosis of Chlamydia trachomatis cervical infection by detection of amplified DNA with an enzyme immunoassay.

Journal of Clinical Microbiology , Volume volume 29 (issue 12) – Dec 1, 1991

Abstract

Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://jcm.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve ERRATA LINDA BOBO, FRANCOIS COUTLEE, ROBERT H. YOLKEN, THOMAS QUINN, AND RAPHAEL P. VISCIDI The Eudowood Division of Infectious Diseases, Department of Pediatrics, and Division of Infectious Diseases, and Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; Department of Microbiology and Infectiology, Hopital Notre Dame, Montreal, Quebec, Canada; and Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892 Volume 28, no. 9, p. 1969, column 1, fine 14 from the bottom: "Ct. 0005" should read "Ct. 0005 (sense)." Page 1969, column 1, line 13 from the bottom: Should read "Ct. 06 (antisense) TTCACATCTGTTTGCAAAACACGGTCG AAAACAAAG." Page 1969, column 1, line 8 from the bottom: "Ct. 03T7" should read "Ct. 03T7 (sense)." Page 1969, column 1, line 6 from the bottom: Should read "Ct. 04 (antisense) CCATAGTAACCCATACGCATGCTG." Convenient Agarose Medium for Simultaneous Determination of the LowCalcium Response and Congo Red Binding by Virulent Strains

Loading next page...
 
/lp/american-society-for-microbiology/diagnosis-of-chlamydia-trachomatis-cervical-infection-by-detection-of-7IGkwbkh72

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
American Society For Microbiology
Copyright
Copyright © 1991 by the American society for Microbiology.
ISSN
0095-1137
eISSN
1098-660X
Publisher site
See Article on Publisher Site

Abstract

Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://jcm.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve ERRATA LINDA BOBO, FRANCOIS COUTLEE, ROBERT H. YOLKEN, THOMAS QUINN, AND RAPHAEL P. VISCIDI The Eudowood Division of Infectious Diseases, Department of Pediatrics, and Division of Infectious Diseases, and Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; Department of Microbiology and Infectiology, Hopital Notre Dame, Montreal, Quebec, Canada; and Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892 Volume 28, no. 9, p. 1969, column 1, fine 14 from the bottom: "Ct. 0005" should read "Ct. 0005 (sense)." Page 1969, column 1, line 13 from the bottom: Should read "Ct. 06 (antisense) TTCACATCTGTTTGCAAAACACGGTCG AAAACAAAG." Page 1969, column 1, line 8 from the bottom: "Ct. 03T7" should read "Ct. 03T7 (sense)." Page 1969, column 1, line 6 from the bottom: Should read "Ct. 04 (antisense) CCATAGTAACCCATACGCATGCTG." Convenient Agarose Medium for Simultaneous Determination of the LowCalcium Response and Congo Red Binding by Virulent Strains

Journal

Journal of Clinical MicrobiologyAmerican Society For Microbiology

Published: Dec 1, 1991

There are no references for this article.