Diagnosis of Chlamydia trachomatis cervical infection by detection of amplified DNA with an enzyme immunoassay.
Abstract
Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://jcm.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Downloaded from http://jcm.asm.org/ on December 13, 2011 by deepdyve ERRATA LINDA BOBO, FRANCOIS COUTLEE, ROBERT H. YOLKEN, THOMAS QUINN, AND RAPHAEL P. VISCIDI The Eudowood Division of Infectious Diseases, Department of Pediatrics, and Division of Infectious Diseases, and Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; Department of Microbiology and Infectiology, Hopital Notre Dame, Montreal, Quebec, Canada; and Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892 Volume 28, no. 9, p. 1969, column 1, fine 14 from the bottom: "Ct. 0005" should read "Ct. 0005 (sense)." Page 1969, column 1, line 13 from the bottom: Should read "Ct. 06 (antisense) TTCACATCTGTTTGCAAAACACGGTCG AAAACAAAG." Page 1969, column 1, line 8 from the bottom: "Ct. 03T7" should read "Ct. 03T7 (sense)." Page 1969, column 1, line 6 from the bottom: Should read "Ct. 04 (antisense) CCATAGTAACCCATACGCATGCTG." Convenient Agarose Medium for Simultaneous Determination of the LowCalcium Response and Congo Red Binding by Virulent Strains