TY - JOUR
AU - Al-Alwan, Monther
AB - Abstract An emerging dogma shows that tumors are initiated and maintained by a subpopulation of cancer cells that hijack some stem cell features and thus referred to as “cancer stem cells” (CSCs). The exact mechanism that regulates the maintenance of CSC pool remains largely unknown. Fascin is an actin-bundling protein that we have previously demonstrated to be a major regulator of breast cancer chemoresistance and metastasis, two cardinal features of CSCs. Here, we manipulated fascin expression in breast cancer cell lines and used several in vitro and in vivo approaches to examine the relationship between fascin expression and breast CSCs. Fascin knockdown significantly reduced stem cell-like phenotype (CD44hi/CD24lo and ALDH+) and reversal of epithelial to mesenchymal transition. Interestingly, expression of the embryonic stem cell transcriptional factors (Oct4, Nanog, Sox2, and Klf4) was significantly reduced when fascin expression was down-regulated. Functionally, fascin-knockdown cells were less competent in forming colonies and tumorspheres, consistent with lower basal self-renewal activity and higher susceptibility to chemotherapy. Fascin effect on CSC chemoresistance and self-renewability was associated with Notch signaling. Activation of Notch induced the relevant downstream targets predominantly in the fascin-positive cells. Limiting-dilution xenotransplantation assay showed higher frequency of tumor-initiating cells in the fascin-positive group. Collectively, our data demonstrated fascin as a critical regulator of breast CSC pool at least partially via activation of the Notch self-renewal signaling pathway and modification of the expression embryonic transcriptional factors. Targeting fascin may halt CSCs and thus presents a novel therapeutic approach for effective treatment of breast cancer. Video Highlight: https://youtu.be/GxS4fJ_Ow-o Fascin expression in breast cancer cell is critical for the maintenance of cancer stem cells (CSCs) via the up-regulation of the notch self-renewal pathway. Open in new tabDownload slide Open in new tabDownload slide Breast cancer, Fascin, Cancer stem cell, Metastasis, Chemoresistance Significance Statement It is widely believed that cancer stem cells (CSCs) are the most tumorigenic fraction of the tumor cells. This study identifies a novel target protein (fascin) that regulates the function of CSCs and promotes their chemoresistance in the breast. Findings reported in this study provide a new window for therapeutic targeting of fascin for effective treatment of breast cancer from its root. Introduction Cancer is one of the leading causes of death worldwide and breast cancer is the most common cause of tumor-related mortality in women [1]. While surgery and chemotherapy are the treatment of choice for breast cancer, recent years have witnessed significant advances in the development of new therapy. Nonetheless, tumor mortality remained high mainly due to residual cancer cells, which are small in numbers but are chemoresistant and retain the potential to reseed the tumor and metastasize to distant organs [2]. Many referred to this small subset of cancer cells as cancer stem cells, since they acquire features of normal stem cell including the self-renewability [3], resistance to radiotherapy [4], and chemotherapy [5]. Therefore, there is a strong believe that the better we understand about cancer stem cell phenotype and the mechanisms that regulate their function, the easier we can target them to effectively treat cancer from its root. Cancer stem cell phenotype can vary depending on the type of cancer. In glioma, cancer stem cells were identified by the expression of CD133 [6], while melanoma cancer stem cells were identified by the expression of ATP-binding cassette sub-family B member 5 [7]. In the breast, cancer stem cells were identified by expression of CD44hi/CD24lo [8] and being aldehyde dehydrogenase (ALDH)hi [9]. Several in vitro assays were developed to measure the cancer stem cell self-renewability including colony forming assay and tumorsphere assay (reviewed in [10]). The golden standard method of assessing cancer stem cells is the ability to initiate tumor when injected at limited dilution in immunocompromised animals [10]. Several transcriptional factors such as Oct3/4 [11, 12], Sox2 [13], and Nanog [14, 15], which are critical for the maintenance of embryonic stem cells pluripotency, were also reported to be up-regulated during tumorgenesis. Several other genes, which were reported to contribute to the long-term maintenance of the embryonic stem cell phenotype, were also frequently upregulated in tumors. These genes include Stat3 [16, 17], E-Ras [18], c-myc [19], Klf4 [20], and β-catenin [21, 22]. Up-regulation of genes that regulate and maintain embryonic stem cell pluripotency provides further evidence for existence of cancer stem cells within the tumor bulk. Self-renewal is a main feature of stem cells, which can be maintained by three signaling pathways namely; Notch, Wnt, and Hedgehog [23]. In the breast, Notch signaling pathway has been shown to be critical in the development of mammary gland [24]. Notch is a group of transmembrane proteins that are important for cell fate decisions [25]. Upon interaction with its ligands, Notch intracellular domain is cleaved by gamma-secretase complex and translocated to the nucleus, where it activates transcription via CSL. Interaction of Notch and CSL induces target gene expression including members of the HES and HEY families of transcription factors that ultimately prevent cell differentiation. Integrity of the Notch signaling pathway play a critical role in the maintenance of breast cancer stem cells, where its blockade through pharmacological reagents or Notch-1 knockdown, inhibited sphere formation from breast cancer cell lines [26]. In addition, inhibition of Notch function decreases in vivo tumorigenicity. Therapy resistant and metastasis are key features of cancer stem cells. Our previous results demonstrated a key role for the actin-bundling protein (fascin) in regulating breast cancer chemoresistance [27] and metastasis [28]. Here, we investigated the role of fascin expression in the maintenance of breast cancer stem cells. Our results demonstrated an important role for fascin in regulating the transcriptional factors of pluripotency and self-renewability mainly through the activation of Notch self-renewal pathway. Most importantly, fascin expression was essential for the tumor initiation in xenograft model. Fascin may present a novel diagnostic maker and an attractive therapeutic target in chemoresistant and metastatic breast cancer. Material and Methods Animal and Cell Lines Nude mice were from Jackson Laboratories, Bar Harbor, Maine, USA. The animals were housed and maintained in accordance with the protocols approved by the Animal Care and Use Committee of the King Faisal Specialist Hospital and Research Centre. The human breast cancer cell lines MDA-MB-231 (HTB-26) and T-47D (HTB-133) were purchased from ATCC, Manassas, VA, USA. The stable fascin knockdown (ShFascin) or control (ShCon) MDA-MB-231 cells were generated as described previously [28] using lentiviral vectors (from Thermo Scientific, Paisley, UK) expressing either fascin shRNA (clone Id: TRCN0000123039; sequence TTCCAGTTTGAAAGGCAAGGG) or scrambled shRNA, respectively. The second stable fascin knockdown (GFP-ShFascin) or control (GFP-ShCon) in MDA-MB-231 cells were generated using retrovial GFP vectors (from OriGene, Rockville, MD, USA) expressing either fascin shRNA (GFP-ShFascin; TL312916C; sequence GACAAGGACGGCAACGTGACCTGCGAGCG) or scrambled shRNA (GFP-ShCon; TR30013), respectively. Fascin expression in T-47D cells was previously described [28] using wild-type GFP fusion construct [29], which was kindly provided to us by Dr. Josephine C. Adam (Cleveland Clinic Foundation, Ohio, USA). Fascin was overexpressed in MDA-MB-231 cells using lentiviral particles (from Genecopoeia) expressing either ORF-fascin (LP-D0369-Lv105-0205-S) or ORF-control (LP-NEG-LV105-02000205). The efficiency of fascin knockdown, expression or overexpression was confirmed using flow cytometery and western blot. Cells were grown in DMEM containing 10% fetal bovine serum (Invitrogen, Paisley, UK), 200 mM L-glutamine (Invitrogen) and antibiotic-antimycotic liquid (Invitrogen) at 37°C in a 5% CO2 humidified atmosphere. Antibodies and Reagents The anti-fascin mAb was purchased from Dako and the APC-conjugated goat ant-mouse IgG1 secondary Ab was purchased from Jackson ImmunoResearch Laboratories, West Grove, PA, USA. The APC-labeled anti-CD44 and PE-labeled anti-CD24 were from BD Biosciences, San Jose, CA, USA. The GAPDH and β-actin antibodies were obtained from Santa Cruz, Dallas, TX, USA. The secondary anti mouse IgG1 HRP conjugated and anti-rabbit IgG HRP-conjugated were from Southern Biotech (Birmingham, AL, USA) and Promega (Madison, WI, USA), respectively. The antibodies against cleaved Notch-1, −2, −3, and HES-1 were purchased from Cell Signaling, Danvers, MA, USA. The remaining antibodies were from BD Bioscience. The Vybrant apoptosis assay kit was purchased from Molecular Probes, Eugene, OR, USA. The poly-HEMA [Poly(2-hydroxyethyl methacrylate)], cleaved Notch-4 and doxorubicin were purchased from Sigma, St. Louis, MO, USA and the docetaxel was from Aventis Pharma, UK. The ALDEFLUOR™ Kit which measure aldehyde dehydrogenase (ALDH) activity was purchased from StemCell Technologies (Vancouver, BC, Canada). The recombinant human Notch ligand (DLLI) was purchased from Creative BioMart (Shirley, NY, USA) and the Notch signaling inhibitor (FLI-06) was purchased from Selleckchem (Houston, TX, USA). Flow Cytometry and Cell Sorting Cell surface staining and permeablization to detect fascin were performed as previously described [27]. Fluorescence was analyzed on a total of 104 live cells per sample using a flow cytometer (LSR II; Becton Dickinson, Mountain View, CA). Staining and analysis of the ALDH was done as per the manufacture protocol and as previously established in our laboratory [30]. All MDA-MB-231 cells are double positive for CD44 (y axis) and CD24 (x axis). Therefore, we gated life cell out by DAPI exclusion followed by gating on the top left corner (CD44hi/CD24lo, around 5%) and top right corner (CD44lo/CD24hi, around 5%) to be sorted using FACSAria (Becton Dickinson, Mountain View, CA). For ALDH-positive cell sorting, life cells (DAPI-negative) were considered ALDH-positive if they show expression above the DEAB-treated cells. The number of cells sorted depended on the requirement of the assay. Apoptosis Vybrant apoptosis assay kit was used to evaluate cell viability as per the manufacturer recommendation. Briefly, both adherent and floating cells were collected after different time points of treatment with drugs. For serum starvation experiments, cells were seeded in 10% serum for 48–72 hours (60–80% confluent). The cells were then harvested, washed with pbs 2x, seeded at the various concentration of serum for 48 hrs. For anoikis resistance experiments, cells (105) were seeded in 10% serum on ploy-HEMA coated 6-well plate in the presence or absence of doxorubicin for 24 hours. In some experiments, cells were pre-incubated with suboptimal dose (5 µM) of Notch inhibitor (FLI-06) or DMSO (control) prior to their treatment with the doxorubicin. To eliminate potential bleeding that may be caused by the doxorubicin into the PE channel, DAPI was used instead of the propidium iodide (PI). Fluorescence was analyzed on a total of 104 cells per sample using a flow cytometer and cells were considered viable if they are double negative for Annexin V and DAPI. RT-PCR Total RNA (∼2 µg) was extracted using QiagenRNAesy Mini Kit (QIAGEN, Valencia, CA, USA). cDNA was synthesized using High Capacity RNA-to-cDNA Kit (Applied Biosystems, Paisley, UK). TaqManTM master-mix and probes for the specific gene were purchased from Life Technologies (Paisley, UK). All real-Time PCR reactions were run using Applied Biosystems 7500 Fast detection system. The data were normalized to the house keeping gene (GAPDH) and presented as relative RNA expression. Calculation of the RNA levels was assessed as previously described [28]. All RT-PCR results were presented as mean of triplicates ± SD of 3 independent experiments. Western Blot Cells were harvested and washed with cold PBS before being lysed using RIPA buffer containing protease inhibitors (Leupeptin 50 µg/ml, Pepstatin 20 µg/ml, Aprotitin 0.1 µg/ml, Phenylmethylsulfonyl Fluoride 174 µg/ml). The cells where incubated with the lysis buffer for 2 hours, vortexed every 10 minutes before centrifugation at 14,000 rpm at 4°C for 15 minutes. The protein concentration was determined using Bradford Assay (Bio-Rad, Philadelphia, PA, USA). 20 µg of total cell lysate were loaded onto 10% SDS-PAGE gel and transferred using iBlot premade nitrocellulose membrane and dry transfer system (Bay Cities Tool & Supply Inc., Newark, CA, USA). Following the transfer, membranes were incubated in 5% (w/v) skimmed milk in PBS containing 0.05% Tween-20 (PBST) to block non-specific binding. Blots were then incubated with primary antibodies overnight at 4°C, washed with PBST 4 times and incubated with HRP-secondary antibody for 1 hour. Chemiluminescence Super Signal System (Thermo Scientific) was used for subsequent detection of bound antibodies and bands were detected using ImageQuant LAS4010 Biomolecular Imager (GE Healthcare, Pittsburgh, PA, USA). Bands corresponding to the right size of the detected proteins were then semi-quantified using Quantity One program (Bio-Rad). Blots shown are representative of a minimum of three separate experiments. Notch Reporter Assay Dynamic Notch activity was measured on live fascin-positive or -negative breast cancer cells using Cignal GFP reporter assay (QIAGEN) as per the manufacturer recommendation. Briefly, equal number of cells (2 × 105) was transfected with the Notch reporter or controls. Negative and positive controls were used to eliminate background reporter activity and to confirm the transfection efficiency, retrospectively. Cells were collected after 48 hours and the Notch pathway activity was measured as percentage of cells expressing GFP, which was assessed using LSR II flow cytometer as above. Tumorsphere and Colony Forming Assays The tumorsphere assay was performed as previously described [30]. Briefly, 500 cells were seeded in 96-well ultra-low attachment plates (Corning) in 100 μl/well of a special medium that was previously described by Dontu et al. [31]. The number of spheres was counted at day 7–10 with the cut off size of 50 µ. Primary tumorspheres were collected and dissociated with Accutase to generate single cell population. Dissociated single cells (500) were then seeded and the number of secondary tumorspheres was assessed as above. The colony forming assay was performed in 6-well plates (Corning). Cells (500) were seeded in 3 ml of complete DMEM media. At day 14, media were removed followed by washing and fixation. Crystal violet staining was used to visualize and count colonies as blue dots. Limiting Dilution Xenograft Assay Female nude mice (6 per group) at 6–8 weeks of age were injected subcutaneously into the mammary fat pad with serial dilution (500, 100, and 50) of cells (50 μl of PBS:matrigel) of fascin-positive (ShCon) and negative (ShFascin) MDA-MB-231 cells breast cancer cells. The xenografts were monitored for 120 days and were palpated every week for tumor formation. ELDA software was used to calculate the extreme limiting dilution and the frequency of the stem cell as previously described [32]. All animal experiments were conducted in accordance with the protocols approved by the Animal Care and Use Committee of the King Faisal Specialist Hospital and Research Centre. Statistical Analysis Statistical significance was assessed using a one-way ANOVA (GraphPad InStat, San Diego, CA). Wherever stated, NS denotes a p value of >.05, while the p values were rounded to three digits or presented as <.001 when the p values were less than .001. Results Fascin Expression in Breast Cancer Cells Is Associated with Cancer Stem Cell Phenotype We have previously shown that fascin regulates metastasis associated proteins, which explained the strong association between fascin expression in breast cancer patients and poor prognosis, including shorter survival and metastasis [28]. More recently, we have demonstrated that fascin regulates breast cancer cell chemoresistance [27]. Cancer stem cells are chemoresistant cells that are believed to contribute to tumor relapse upon therapy [5]. In this study, we investigated the role of fascin expression in cancer stem cells and their chemoresistance. We used a metastatic fascin-positive breast cancer cell line (MDA-MB-231), which we have previously established as scrambled or fascin-ShRNA silenced cells (Supporting Information Fig. 1A) [28]. To directly test the link between fascin expression and breast cancer stem cells, we assessed our chemotherapy-treated fascin-positive and -negative breast cancer cells for the expression of CD44hi/CD24lo, a cell surface phenotype that is associated with breast cancer stem cells [8]. The baseline level of CD44hi/CD24lo cells was significantly higher in fascin-positive group as compared to the fascin-negative group (Supporting Information Fig. 1B and Fig. 1A). Interestingly, when fascin-positive and -negative breast cancer cells were exposed to chemotherapeutic agents, CD44hi/CD24lo cells were more resistant to chemotherapy-induced apoptosis compared with the CD44lo/CD24hi population (Fig. 1B–1C), consistent with their cancer stem cell feature. Irrespective of the fascin expression, majority of the chemotherapy-induced apoptosis was observed in the CD44lo/CD24hi population. However, fascin-negative group showed more apoptosis and higher percentage of CD44lo/CD24hi population, which increased upon drug treatment (Fig. 1C). Similarly, the percentage of CD44hi/CD24lo population was significantly reduced when another fascin-ShRNA (GFP-tagged) was used (Supporting Information Fig. 2). Conversely, overexpression of fascin in MDA-MB-231 cells using Fascin ORF (ORF-Fascin) significantly increased the percentage of CD44hi/CD24lo population compared with the Control ORF (Supporting Information Fig. 3). To validate this link between fascin expression and CD44hi/CD24lo in another breast cancer cells, we used a fascin-negative breast cancer cell line (T-47D), where we have previously induced wild type fascin expression in them (Supporting Information Fig. 4A) [28]. Slightly increase expression of CD44hi/CD24lo and drastic decrease in CD24 expression was observed in wild type-expressing T-47D breast cancer cells when compared with the fascin-negative parental cells (Supporting Information Fig. 4B). Figure 1 Open in new tabDownload slide Fascin expression is associated with increased CD44hi/CD24lo profile, ALDH+ and chemoresistance. Fascin-positive (ShCon) or -negative (ShFascin) cells were double stained for CD24 and CD44. (A): Bar graph showing the percentage (mean ± SD) of CD44hi/CD24lo in fascin-positive or -negative cells of 5 independent experiments. Fascin-positive (B) or -negative (C) were exposed to different doses of doxorubicin prior to staining for CD24, CD44, Annexin V and DAPI. Chemotherapy-mediated apoptosis was assessed in the CD44hi/CD24lo and CD44lo/CD24hi populations. Numbers in each quadrant indicated the percentage, while the number on the right of the dot plots indicated the total number of apoptotic cells in each plot. (D): Fascin-positive (ShCon) or -negative (ShFascin) cells were incubated with activated Aldefluor reagent in the presence or absence of efflux inhibitor (DEAB) to control for background fluorescence. Bar graph showing the percentage (mean ± SD) of ALDH-positive cells gated in reference to the DEAB control in fascin-positive or -negative group of 5 independent experiments. Figure 1 Open in new tabDownload slide Fascin expression is associated with increased CD44hi/CD24lo profile, ALDH+ and chemoresistance. Fascin-positive (ShCon) or -negative (ShFascin) cells were double stained for CD24 and CD44. (A): Bar graph showing the percentage (mean ± SD) of CD44hi/CD24lo in fascin-positive or -negative cells of 5 independent experiments. Fascin-positive (B) or -negative (C) were exposed to different doses of doxorubicin prior to staining for CD24, CD44, Annexin V and DAPI. Chemotherapy-mediated apoptosis was assessed in the CD44hi/CD24lo and CD44lo/CD24hi populations. Numbers in each quadrant indicated the percentage, while the number on the right of the dot plots indicated the total number of apoptotic cells in each plot. (D): Fascin-positive (ShCon) or -negative (ShFascin) cells were incubated with activated Aldefluor reagent in the presence or absence of efflux inhibitor (DEAB) to control for background fluorescence. Bar graph showing the percentage (mean ± SD) of ALDH-positive cells gated in reference to the DEAB control in fascin-positive or -negative group of 5 independent experiments. Aldehyde dehydrogenase (ALDH) is another common stem cell maker that is expressed by many types of cancer as well as normal stem cells [9]. The expression of ALDH was significantly reduced in fascin-negative breast cancer cells compared with their fascin-positive counterparts (Supporting Information Fig. 5A and Fig. 1D). Similarly, the other fascin-ShRNA knockdown in MDA-MB-231 cells (GFP-ShFascin) showed significantly reduced percentage of ALDH+ population compared with the GFP-ShCon counterparts (Supporting Information Fig. 5B). Conversely, fascin-overexpressing MDA-MB-231 cells (ORF-Fascin) demonstrated significantly increased percentage of ALDH+ population compared with their ORF-Con counterparts (Supporting Information Fig. 5C). Interestingly, expression of wild type fascin in T-47D induced higher ALDH+ cells compared to fascin-negative parental cells (Supporting Information Fig. 6). Altogether, our data demonstrated that fascin expression in breast cancer cells is strongly associated with cancer stem cell phenotype. Fascin Regulates the Expression of the Embryonic Stem Cell Genes in Breast Cancer Cells To further investigate the relationship between fascin expression and cancer stem cell, we examined whether fascin is associated with the increased expression of stem cell transcriptional factors. Oct3/4 [11, 12], Sox2 [13], and Nanog [14, 15] are key transcriptional factors that regulate the pluripotency of the embryonic stem cells (ESCs). In addition, Klf4 [20] is frequently up-regulated in tumors and have been shown to contribute to the long-term maintenance of the ESC phenotype and their rapid proliferation in culture. Significant inhibition of Oct4 (55%), Sox2 (75%), Nanog (50%), and Klf4 (37%) was observed in fascin knockdown cells (Fig. 2). Similarly, the other fascin-ShRNA knockdown in MDA-MB-231 cells (GFP-ShFascin) showed significantly reduced levels of Oct4, Sox2 and Nanog (data not shown). On the other hand, fascin-overexpressing MDA-MB-231 cells (ORF-Fascin) demonstrated significantly increased levels of Oct4, Sox2, and Nanog (data not shown). In gain of function experiments, wild type fascin-expressing T-47D cells demonstrated significantly increased expression of Oct4, Sox2, Nanog and Klf4 (Supporting Information Fig. 7). These data demonstrated an association between the fascin expression and increased ESC transcriptional factors in breast cancer stem cells. Figure 2 Open in new tabDownload slide Increased expression of embryonic stem cell transcriptional factors in fascin-positive breast cancer cells. Bar graph showing relative RNA expression of fascin or different transcriptional factors of embryonic stem cells. Results showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in fascin-negative cells (ShFascin). Figure 2 Open in new tabDownload slide Increased expression of embryonic stem cell transcriptional factors in fascin-positive breast cancer cells. Bar graph showing relative RNA expression of fascin or different transcriptional factors of embryonic stem cells. Results showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in fascin-negative cells (ShFascin). Fascin Regulates Epithelial to Mesenchymal Transition in Breast Cancer Cells We have shown that knockdown of fascin is associated with increase of stem cell phenotype. To further investigate the association between fascin expression and cancer stem cell pool, we used epithelial to mesenchymal transition (EMT), a dynamic process that enriches for cancer stem cells [33]. We checked whether fascin expression in our breast cancer cells is associated with EMT genes and promoting transcriptional factors. We used human mammary epithelial cells (HMLE) that can be induced to undergo EMT via treatment with TGF-β [33]. Treatment of HMLE cells with TGF-β induced noticeable EMT as measured by the significant decrease in E-cadherin (5-folds) and the increase in Vimentin (30-folds) at the RNA levels (Supporting Information Fig. 8A) and similar pattern at the protein levels (Supporting Information Fig. 8B). Consistent with the phenotypical changes, TGF-β-treated cells showed morphological changes where they acquired the typical spindle mesenchymal-like shape and loss the epithelial-like shape consistent with EMT (Supporting Information Fig. 8C). Interestingly, induction of EMT in HMLE cells significantly increased (3.5-folds) fascin expression at the RNA levels (Supporting Information Fig. 9A). At the protein levels, all HMLE cells were fascin positive, but TGF-β-mediated EMT significantly increased (2.5-folds) the expression of fascin (Supporting Information Fig. 9B, 9C). This data demonstrates a significant link between fascin expression and the EMT, a process that is known to enrich for cancer stem cells. We have demonstrated above that TGF-β-mediated EMT in HMLE cells can up-regulate fascin expression, we then asked whether this process is associated with the regulation of the transcriptional factors that regulate the pluripotency. Our data showed significant increase in expression of Oct4 (1.5-folds), Sox2 (2.8-folds), and Nanog (1.5-folds) in the TGF-β-treated HMLE cells (Supporting Information Fig. 10). These data further support the link between fascin expression and regulation of the pluripotency transcriptional factors. We then investigated the impact of fascin expression on EMT in our breast cancer cells. Increased expression of the epithelial markers (E-cadherin and CD24) and decreased expression of mesenchymal markers (Vimentin, N-cadherin, and Fibronectin 1) was observed in fascin-negative MDA-MB-231 breast cancer cells (Fig. 3A). Consistent with the changes in the expression pattern of Vimentin and E-cadherin that was observed when fascin was knocked down, cell morphology showed loss of the typical spindle mesenchymal-like shape and acquisition of the more rounded epithelial-like shape consistent with the loss of EMT (Fig. 3B). Furthermore, fascin knockdown cells demonstrated significant reduction in the expression of all the transcriptional factors that regulate EMT (TWIST-1, TWIST-2, ZEB-1, ZEB-2) except SNAIL-1, which showed increased expression and SNAIL-2, which was not detected (Fig. 3C). Expression of wild type fascin in T-47D cells decreased the epithelial markers (E-cadherin and CD24) and increased the mesenchymal markers (Vimentin and Fibronectin 1) (Supporting Information Fig. 11A). In parallel, wild type expressing T-47D cells showed increased expression of the EMT promoting transcriptional factors TWIST-1 and SNAIL-1 (Supporting Information Fig. 11B). The expression of TWIST-2 and ZEB-1 were slightly increased but not significant (data not shown). Collectively, induction of EMT in HMLE cells up-regulated fascin expression and the fascin knockdown in our breast cancer cells associated with mesenchymal to epithelial transition. Figure 3 Open in new tabDownload slide Fascin expression in breast cancer cells correlated with EMT traits. (A): Bar graph showing relative RNA expression of epithelial (E-cadherin and CD24) and mesenchymal (Vimentin, Fibronectin and N-cadherin) markers. (B): Representative images showing morphology of fascin-positive and -negative cells in culture. (C): Bar graph showing relative RNA expression of EMT promoting transcriptional factors. Results (A and C) showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in fascin-negative cells (ShFascin). Figure 3 Open in new tabDownload slide Fascin expression in breast cancer cells correlated with EMT traits. (A): Bar graph showing relative RNA expression of epithelial (E-cadherin and CD24) and mesenchymal (Vimentin, Fibronectin and N-cadherin) markers. (B): Representative images showing morphology of fascin-positive and -negative cells in culture. (C): Bar graph showing relative RNA expression of EMT promoting transcriptional factors. Results (A and C) showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in fascin-negative cells (ShFascin). Fascin-Positive Breast Cancer Cells Are More Competent at Tumorsphere Formation A main feature of cancer stem cells is their self-renewal potential and thus we wanted to evaluate whether fascin expression in breast cancer stem cells is involved in regulating this stem cell unique characteristic. To test whether the reduced expression of embryonic stem cell genes in fascin knockdown cells would affect their stemness activity, we used functional assays such as the colony- [34] and the tumorsphere- [31] forming assays. Fascin-positive cells demonstrated higher colony forming capability than their fascin-negative counterparts (Fig. 4A). Furthermore, when single cells were cultured in ultra-low attachment setting, fascin negative cells formed less tumorspheres than their fascin-positive counterparts (Fig. 4B). Dissociation of primary tumorsphere into single cells and reseeding them in stem cell specific-media showed more potency of fascin-positive cells at forming secondary tumorspheres as compared with the fascin-negative counterparts (Fig. 4C), further confirming the link between fascin expression and the presence of more cancer initiating cells with self-renewable capability. Similarly, wild type-fascin expressing T-47D cells were more efficient at forming primary and secondary tumorspheres than the fascin-negative parental cells (Supporting Information Fig. 12). To identify whether enhancement of tumorsphere formation potential observed in the fascin-positive group, is the results of its effect on the expression of cancer stem cell markers such as CD44hi/CD24lo or ALDH+, which we have demonstrated earlier (Fig. 1), we sorted both populations from fascin-positive and -negative cells. Increased tumorspheres were observed in CD44hi/CD24lo (1.5-folds) and ALDH+ (1.8-folds) sorted group from fascin-positive breast cancer cells as compared with the bulk population (Fig. 4D, 4E). Most importantly, sorted cells that maintain the same phenotype of CD44hi/CD24lo or ALDH+, which applied the same gate setting that we used for fascin-positive cells, but lack fascin expression showed significantly reduced ability to form tumorspheres, confirming that the role of fascin in tumorsphere formation is independent of the breast cancer stem cell markers. Furthermore, fascin-positive breast cancer cells were more resistance to stress condition-induced apoptosis such as serum deprivation and anoikis, which is survival under anchorage-independent condition (Supporting Information Fig. 13A, 13B). Altogether, these results showed a role for fascin in regulating the self-renewability (tumorsphere formation) of cancer stem cells and indicated that this effect is independent of fascin influence on the expression of CD44hi/CD24lo or ALDH+ stem cell markers. Figure 4 Open in new tabDownload slide Fascin-positive breast cancer cells showed increased tumorsphere and colony forming potential. (A): Bar graph showing the percentage (mean of triplicates ± SD) of colonies of 3 independent experiments. Representative images of colonies are shown on the right. Bar graph showing the percentage (mean of triplicates ± SD) of primary (B) or secondary (C) tumorspheres of 5 independent experiments. Results showing the means ± SD after normalization to fascin-positive cells (ShCon). Representative images of tumorspheres (∗) are shown on the right. Sorted ALDH+ (D) and CD44hi/CD24lo (E) cells were compared with their ALDH- and CD44lo/CD24hi, respectively. The unsorted fraction (bulk) from each group was used as a reference for the basal tumorsphere forming potential. Bar graph showing the percentage of primary tumorspheres of 3 independent experiments. Results showing the means ± SD after normalization to unsorted fascin-positive cells (ShCon). Figure 4 Open in new tabDownload slide Fascin-positive breast cancer cells showed increased tumorsphere and colony forming potential. (A): Bar graph showing the percentage (mean of triplicates ± SD) of colonies of 3 independent experiments. Representative images of colonies are shown on the right. Bar graph showing the percentage (mean of triplicates ± SD) of primary (B) or secondary (C) tumorspheres of 5 independent experiments. Results showing the means ± SD after normalization to fascin-positive cells (ShCon). Representative images of tumorspheres (∗) are shown on the right. Sorted ALDH+ (D) and CD44hi/CD24lo (E) cells were compared with their ALDH- and CD44lo/CD24hi, respectively. The unsorted fraction (bulk) from each group was used as a reference for the basal tumorsphere forming potential. Bar graph showing the percentage of primary tumorspheres of 3 independent experiments. Results showing the means ± SD after normalization to unsorted fascin-positive cells (ShCon). Fascin Regulates the Self-Renewal Activity of Breast Cancer Stem Cells The data above showed that fascin expression may provide breast cancer stem cells an extra advantage by enhancing their self-renewable activity. Notch signaling pathway is known to be important for the fate of stem cells in normal human mammary glands [35, 36] and for the development of cancer stem cells in invasive breast cancer [37, 38]. Therefore, we tested the effect of fascin expression on the Notch signaling activity. Expression of Notch-1 was significantly down-regulated (17%) in fascin knockdown cells (Fig. 5A) paralleled by inhibition of Notch downstream targets; HES-1 (54%) and HEY-2 (58%) with the exception of HEY-1 which increased (40%). We observed no significant effect on the expression of NUMB, the negative regulator of Notch [39]. Expression of Nicastrin, which is a member of the gamma secretase enzyme that is known to activate Notch signaling and expand breast cancer stem cells and their invasive behavior [40], was significantly reduced (28%) when fascin was knocked down. Finally, Notch reporter assay demonstrated suppressed activity of Notch in fascin knockdown cells (Fig. 5B). Similarly, expression of Notch-1 and its downstream target HES-1 were significantly reduced when fascin was knocked down in MDA-MB-231 cells using the other fascin-ShRNA (GFP-ShFascin) (data not shown). Conversely, fascin overexpressing MDA-MB-231 cells (ORF-Fascin) showed increased expression of Notch-1 and its downstream target HES-1 (data not shown). Furthermore, increased expression of HES-1 and decreased expression of NUMB were also observed in wild type-fascin expressing T-47D cells, when compared with the fascin-negative parental cells (Supporting Information Fig. 14). These data established a key role for fascin in regulating the Notch signaling pathway, which in turn may regulate cancer stem cells. Figure 5 Open in new tabDownload slide Increased Notch activity in fascin-positive breast cancer cells. (A): Bar graph showing relative RNA expression of Notch-1, downstream targets (HES and HEY), activator (Nicastrin) or inhibitor (Numb). Results showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in fascin-negative cells (ShFascin). (B): Bar graph showing Notch activity as assessed by GFP reporter assay. Notch activity was measured as a percentage of GFP-positive cells and expressed as means ± SD of 3 independent experiments. (C): Bar graph showing relative RNA expression of the Notch downstream target (HES-1) following treatment with 10µM of Notch inhibitor (FLI-06) or DMSO (control). Results showing the mean of triplicates ± SD of 3 independent experiments after normalization to the expression levels in fascin-positive cells (ShCon). (D): Bar graph showing the percentage (mean of triplicates ± SD) of primary tumorspheres of 3 independent experiments following treatment with 10µM of Notch inhibitor (FLI-06) or DMSO (control). E) Bar graph showing relative RNA expression of Notch-1, downstream targets (HES and HEY), activator (Nicastrin) or inhibitor (Numb) after fascin-positive (solid bars) or -negative (open bars) cells were treated with Notch ligand (DLL1). Results showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in the DMSO treated group. Figure 5 Open in new tabDownload slide Increased Notch activity in fascin-positive breast cancer cells. (A): Bar graph showing relative RNA expression of Notch-1, downstream targets (HES and HEY), activator (Nicastrin) or inhibitor (Numb). Results showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in fascin-negative cells (ShFascin). (B): Bar graph showing Notch activity as assessed by GFP reporter assay. Notch activity was measured as a percentage of GFP-positive cells and expressed as means ± SD of 3 independent experiments. (C): Bar graph showing relative RNA expression of the Notch downstream target (HES-1) following treatment with 10µM of Notch inhibitor (FLI-06) or DMSO (control). Results showing the mean of triplicates ± SD of 3 independent experiments after normalization to the expression levels in fascin-positive cells (ShCon). (D): Bar graph showing the percentage (mean of triplicates ± SD) of primary tumorspheres of 3 independent experiments following treatment with 10µM of Notch inhibitor (FLI-06) or DMSO (control). E) Bar graph showing relative RNA expression of Notch-1, downstream targets (HES and HEY), activator (Nicastrin) or inhibitor (Numb) after fascin-positive (solid bars) or -negative (open bars) cells were treated with Notch ligand (DLL1). Results showing the mean of triplicates ± SD of 3 independent experiments and each gene is normalized to the expression levels in the DMSO treated group. To confirm the link between fascin expression and activation of the Notch pathway, we assessed the effect of Notch inhibition on tumorsphere formation in presence or absence of fascin. Inhibition of Notch with FLI-06 significantly reduced the Notch downstream target HES-1 in fascin-positive cells to nearly the same level as the baseline of fascin-negative cells (Fig. 5C). In the presence of intact Notch signaling pathway, fascin-positive breast cancer cells were more competent at tumorsphere formation than their fascin-negative counterparts (Fig. 5D). However, inhibition of Notch signaling using FLI-06 eliminated the difference between the two groups, supporting that the increased tumorsphere formation potential of the fascin-positive cells is due to activation of the Notch pathway. To further confirm this link between fascin expression and increased Notch activity, we triggered Notch activation using recombinant Delta-like 1 (DLL1) protein, a homolog of the Notch delta ligand [23]. Interestingly, DLL1 treatment induced expression of Notch-1 and its downstream targets, HEY-1, HEY-2 and HES-1 only in fascin-positive cells, while triggered no effect or significant inhibition of these genes in the fascin-negative counterparts (Fig. 5E). Consistent with the up-regulation of these genes, there was induction of Nicastrin in fascin-positive cells that were treated with DLL1. Furthermore, triggering of Notch signaling with DLL1 significantly reduced NUMB expression in fascin-positive cells and showed no significant effect on fascin-negative group. Collectively, these data support a role for fascin in Notch pathway active cells like cancer stem cells. Fascin-Dependent Chemoresistant Breast Cancer Cells Is Associated with Enhanced Notch Activity Previous studies have reported that increased Notch activation as one of the mechanisms that mediate chemoresistance of various types of tumor (reviewed in [41]). Our data above showed a significant role for fascin in regulating Notch activity and maintenance of breast cancer stem cell pool. We have demonstrated in this study and previously [27] that fascin regulates breast cancer chemoresistance specifically in cancer stem cells. Here, we have tested whether Notch activation in breast cancer stem cells confers chemoresistance that is dependent on fascin expression. Activation of Notch was assessed using antibody that selectively binds to the cleaved form (intracellular domain) in fascin-positive and -negative cells following treatment with various doses of chemotherapy (doxorubicin). There was a clear induction of cleaved Notch-1 in fascin-positive cells upon treatment with various doses of chemotherapy (Fig. 6A). Fascin-positive cells also induced cleaved Notch-2 and −3, but more pronouncedly at the higher chemotherapy dose. This observation was paralleled by chemotherapy-mediated reduction of cleaved Notch-1, −2, and −3 in the fascin-negative counterparts. On the contrary, cleaved Notch-4 showed induced expression in fascin-negative cells and parallel suppression in fascin-positive cells upon chemotherapy treatment (Fig. 6A). Consistent with the activation of the Notch signaling pathway following fascin-positive cells treatment with chemotherapy, there was parallel induction of the Notch downstream target (HES-1) in this group (Fig. 6B). Collectively, these data showed that fascin play a critical role in the resistance of breast cancer stem cells to chemotherapy via activation of Notch signaling pathway. Figure 6 Open in new tabDownload slide Increased Notch activity in fascin-positive breast cancer cells. (A): Left: Representative western blots showing the levels of cleaved Notch expression in ShCon and ShFascin total cell lysates after treatment with increased doses of doxorubicin. (B): Left: Representative western blots showing the levels of nuclear HES-1 expression in ShCon and ShFascin after treatment with increased doses of doxorubicin. (A and B) Right: Bar graph showing quantitation of the indicated proteins after treatment with various doses of doxorubicin. Results showing the mean ± SD of triplicates after normalization to GAPDH (A) or TATA (B) and each time point is normalized to 0 time. (C): Fascin-positive or -negative cells were pre-incubated in the presence or absence of Notch inhibitor for 16 hours followed by treatment with or without doxorubicin (200 ng/ml) for 72 hours. Cells were harvested and assessed for apoptosis as in the methods. Results showing mean viable cell of triplicates ± SD and data is representative of 3 independent experiments. Figure 6 Open in new tabDownload slide Increased Notch activity in fascin-positive breast cancer cells. (A): Left: Representative western blots showing the levels of cleaved Notch expression in ShCon and ShFascin total cell lysates after treatment with increased doses of doxorubicin. (B): Left: Representative western blots showing the levels of nuclear HES-1 expression in ShCon and ShFascin after treatment with increased doses of doxorubicin. (A and B) Right: Bar graph showing quantitation of the indicated proteins after treatment with various doses of doxorubicin. Results showing the mean ± SD of triplicates after normalization to GAPDH (A) or TATA (B) and each time point is normalized to 0 time. (C): Fascin-positive or -negative cells were pre-incubated in the presence or absence of Notch inhibitor for 16 hours followed by treatment with or without doxorubicin (200 ng/ml) for 72 hours. Cells were harvested and assessed for apoptosis as in the methods. Results showing mean viable cell of triplicates ± SD and data is representative of 3 independent experiments. Our results above (Fig. 6A) showed chemotherapy-mediated Notch activation in fascin-positive cells. To test whether fascin-enhanced Notch signaling can directly confer chemoresistance, we measured survival of fascin-positive and -negative cells in response to chemotherapy in the presence or absence of the Notch inhibitor (FLI-06). As we have previously demonstrated [27], doxorubicin alone triggered more apoptosis in fascin-negative cells than in their -positive counterparts (Fig. 6C). While inhibition of Notch (FLI-06) in fascin-positive cells elicited more apoptosis than doxorubicin alone, it abolished the difference between fascin-positive and -negative apoptotic cell death. When cells were treated with doxorubicin in presence of the Notch inhibitor there was a synergistic increase in apoptosis in both groups. Interestingly, inhibition of Notch pathway eliminated the difference in chemotherapy-mediated apoptotic cell death between fascin-positive and -negative cells. These data demonstrated strong association between chemotherapy-mediated Notch activation and fascin expression in breast cancer cells and revealed a novel mechanism for fascin-mediated chemoresistance. Fascin-Positive Breast Cancer Cells Contain Higher Frequency of Cancer Stem Cells In Vivo The data presented above established a significant role for fascin in regulating cancer stem cell features and function in vitro. The cardinal feature of cancer stem cells is the ability to initiate tumor when injected at a serial limiting dilution into immune-compromised animals. We thus carried out limiting dilution xenograft experiments using fascin-positive or -negative breast cancer cells and monitored the mice over a period of 120 days to determine the frequencies of cancer stem cells in each group. The estimated frequency of cancer stem cells in fascin-positive or -negative populations was calculated by extreme limiting dilution assay (ELDA) [32]. At the lowest cell number (50 cells), 33% of the mice (2/6) inoculated with fascin-positive cells were able to form tumor while none of the mice injected with fascin-negative cells showed any tumor (Table 1), suggesting the presence of more tumor initiating cells in the fascin-positive group. Data analysis using ELDA software [32] demonstrated that the estimated frequency of tumor initiating cells in the fascin-positive group was 1 in 266 cells, whereas that in the fascin-negative group was 1 in 774 cells (p 0.0478), showing a significant decrease in self-renewing breast-propagating cells subpopulation following fascin knockdown. Altogether, our data demonstrated that fascin-positive breast cancer cells comprised more tumor initiating/cancer stem cells as they were more competent than their fascin-negative counterparts in reinitiating tumor when tested in a serial limiting dilution assay. Table 1 Limiting dilution data showing the frequency of tumor initiating cells of fascin-positive (ShCon) and -negative (ShFascin) breast cancer cells in Nude mice. Cell . Number injected . Tested/responder . Stem cell frequency . ShCon 500 6/4 1/266 100 6/3 50 6/2 ShFascin 500 6/4 1/774 100 6/2 50 6/0 Cell . Number injected . Tested/responder . Stem cell frequency . ShCon 500 6/4 1/266 100 6/3 50 6/2 ShFascin 500 6/4 1/774 100 6/2 50 6/0 Shown is the number of animals that were tested positive (responder) after injection. Open in new tab Table 1 Limiting dilution data showing the frequency of tumor initiating cells of fascin-positive (ShCon) and -negative (ShFascin) breast cancer cells in Nude mice. Cell . Number injected . Tested/responder . Stem cell frequency . ShCon 500 6/4 1/266 100 6/3 50 6/2 ShFascin 500 6/4 1/774 100 6/2 50 6/0 Cell . Number injected . Tested/responder . Stem cell frequency . ShCon 500 6/4 1/266 100 6/3 50 6/2 ShFascin 500 6/4 1/774 100 6/2 50 6/0 Shown is the number of animals that were tested positive (responder) after injection. Open in new tab Discussion In this report, we have shown that fascin-positive breast cancer cells exhibit higher numbers of CD44hi/CD24lo and ALDH+, higher levels of the embryonic stem cell transcriptional factors, increased activation of self-renewal Notch signaling pathway, increased tumorspheres and colony forming potency, and enhanced tumor initiating potential. Collectively, these data provide strong evidences that fascin is a key regulator of breast cancer stem cells mainly through activation of the Notch self-renewal signaling pathway. Many research groups used several experimental approaches to identify the phenotype and to characterize the function of cancer stem cells from different organs. In the breast, Al-Hajj et al identified these cells as CD44hi/CD24lo/-, where they showed that as little as 100 of these cells were able to form tumor in mice as compared with thousands of other phenotypes [8]. Our results that showed increased CD44hi/CD24lo profile in the fascin-positive breast cells and as little as 50 cells were able to initiate tumor in mice are consistent with enrichment of cancer stem cells in this group. Higher ALDH enzymatic activity has been described as another standard maker of stem cells in many types of cancer and normal tissues [9]. Consistent with this notion, our fascin-positive breast cancer cells demonstrated increased ALDH activity, in line with the increased CD44hi/CD24lo profile. Collectively, using the standard makers of cancer stem cells in the breast provided evidences for the role of fascin expression in the maintenance of this subpopulation. The Notch self-renewal pathway plays a central role in the breast development and tumorigenesis. Indeed, over-expression of activated Notch-1 and Notch-3 in murine breast impaired mammary gland development and induced tumor formation [42]. In human breast, high expression of Notch-1 and its ligand were found to associate with poor outcome [43]. Activation of Notch signaling in the breast was shown to increase cell migration and invasion [44]. This is consistent with our findings of enhanced activation of Notch signaling pathway in fascin-positive breast cancer cells, which we also have previously reported to exhibit an increased migration and invasion activity [28]. The findings of increased expression of activated Notch (cleaved Notch) only in fascin-positive cells following treatment with chemotherapy emphasized the link between fascin expression in breast cancer and Notch activation and strongly suggested a role for this crosstalk in regulating drug resistance. Indeed, fascin-positive breast cancer cells were more chemoresistant in the presence of active Notch pathway. While Nocth-4 was also found to be important for the development of normal mammary and mammary tumors in mice [45, 46], others found that Notch-4 knockout mouse has no defect in mammary gland development and speculated that Notch-4 and −1 may have an overlapping roles [47]. Our fascin-positive cells showed activation of the Notch downstream target HES-1, but Notch-4 expression upon chemotherapy treatment was not induced. This data suggested that Notch-4 is not critical for fascin-mediated chemotherapy resistance. Down-regulation of epithelial markers and up-regulation of mesenchymal traits during the EMT process in the breast was found to be critical for cancer metastasis and resistance to chemotherapy [48]. Moreover, acquisition of the mesenchymal traits by breast epithelial cells was found to enrich for cancer stem cells, where they expressed CD44hi/CD24lo profile and became more efficient at tumorsphere formation and tumor initiation when injected in mice [33]. Furthermore, EMT was linked to activation of Notch signaling and increased cell migration and invasion [44]. Our data showed direct relationship between the expression of EMT makers and EMT-promoting transcriptional factors and fascin expression in breast cancer cells. The increased activation of Notch-1 signaling that we observed in fascin-positive breast cancer cells, which have also showed acquisition of mesenchymal traits and enhanced tumor initiation potential, strongly suggest a role for fascin in enriching for cancer stem cells. Suman et al. showed that the inhibition of Notch-1 signaling suppressed EMT and halted the growth of breast cancer stem cells [49]. We have also showed that the dynamic induction of EMT in mammary epithelial cells resulted in up-regulation of fascin expression at the RNA and protein levels. These data provided further evidence that link fascin expression to enrichment of cancer stem cells in a dynamic fashion. More recently, Li et al. showed that the EMT promoting transcriptional factor SNAIL-2 to regulate fascin transcription in pancreatic ductal adenocarcinoma, providing direct evidence that link fascin to EMT and worst outcome [50]. Up-regulation of Oct4, Sox2, and Nanog was observed in various type of cancers [51-54] and was used as another method to identify cancer stem cells. Indeed, high expression of Oct4, Sox2, and Nanog was observed in MDA-MB-231PAC10, paclitaxel resistant breast cancer cells derived from MDA-MB-231 cell line [55]. This study showed that the increased expression of the stemness genes in cancer stem cells may confer chemoresistance. Our findings of enhanced expression of the stemness genes in fascin-positive breast cancer cells, which showed more chemoresistance, elevated Notch activity and higher tumor initiation potential, is consistent with fascin-mediated enrichment of cancer stem cells in breast. Breast cancer resistance to chemotherapy presents a major challenge for effective eradication of the tumor. Cancer stem cells were found to contribute not only to tumor initiation, but also to drug resistance and tumor relapse. Therefore, cancer stem cells have gained attention to understand their biology and develop drugs that can selectively target them. Chen et al were able to block breast cancer metastasis to the lung using Migrastatin, which selectively bind fascin and inhibit its activity [56]. The findings in this study suggest that the selective targeting of fascin-positive breast cancer stem cells, which contributed to chemoresistance [27] and metastasis [28], might be a good therapeutic approach for breast cancer. Acknowledgments We are grateful to the administration of Research Centre and Research Affair Council for their support. We are grateful to Dr Josephine C Adam for providing the fascin-GFP fusion constructs, Pulicat Manogaran and Amer Almazrou for helping in the analysis of FACS data. This work was supported by the Research Advisory Council (proposal grant 2060 016), King Faisal Specialist Hospital and Research Centre. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. R.B. and S.A. contributed equally to this work. Author contributions M.A.: Conceived and designed the experiments; R.B., S.A., G.S., A.S., and H.G.: Performed the in vitro experiments; A.D. and F.M.: Performed the animal experiments; R.B. and M.A.: Analyzed the data; M.A.: Wrote the paper. Disclosure of Potential Conflicts of Interest The authors indicate no potential conflicts of interest. References 1 Jemal A , Tiwari RC, Murray T et al. Cancer statistics . CA: Cancer J Clin 2004 ; 54 : 8 – 29 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 2 Nicolini A , Giardino R, Carpi A et al. Metastatic breast cancer: an updating . Biomed Pharmacother 2006 ; 60 : 548 – 556 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Gupta PB , Chaffer CL Weinberg RA. Cancer stem cells: mirage or reality? Nat Med 2009 ; 15 : 1010 – 1012 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Bao S , Wu Q, McLendon RE et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response . Nature 2006 ; 444 : 756 – 760 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Frank NY , Margaryan A, Huang Y et al. ABCB5-mediated doxorubicin transport and chemoresistance in human malignant melanoma . Cancer Res 2005 ; 65 : 4320 – 4333 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Ye XZ , Xu SL, Xin YH et al. Tumor-associated microglia/macrophages enhance the invasion of glioma stem-like cells via TGF-beta1 signaling pathway . J Immunol 2012 ; 189 : 444 – 453 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Schatton T , Murphy GF, Frank NY et al. Identification of cells initiating human melanomas . Nature 2008 ; 451 : 345 – 349 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Al-Hajj M , Wicha MS, Benito-Hernandez A et al. Prospective identification of tumorigenic breast cancer cells . Proc Natl Acad Sci USA 2003 ; 100 : 3983 – 3988 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Ginestier C , Hur MH, Charafe-Jauffret E et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome . Cell Stem Cell 2007 ; 1 : 555 – 567 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Visvader JE Lindeman GJ. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions . Nat Rev 2008 ; 8 : 755 – 768 . Google Scholar Crossref Search ADS WorldCat 11 Nichols J , Zevnik B, Anastassiadis K et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4 . Cell 1998 ; 95 : 379 – 391 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Niwa H. Molecular mechanism to maintain stem cell renewal of ES cells . Cell Struct Funct 2001 ; 26 : 137 – 148 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Avilion AA , Nicolis SK, Pevny LH et al. Multipotent cell lineages in early mouse development depend on SOX2 function . Genes Dev 2003 ; 17 : 126 – 140 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Chambers I , Colby D, Robertson M et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells . Cell 2003 ; 113 : 643 – 655 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Mitsui K , Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells . Cell 2003 ; 113 : 631 – 642 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Matsuda T , Nakamura T, Nakao K et al. STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells . Embo J 1999 ; 18 : 4261 – 4269 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Niwa H , Burdon T, Chambers I et al. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3 . Genes Dev 1998 ; 12 : 2048 – 2060 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Takahashi C , Bronson RT, Socolovsky M et al. Rb and N-ras function together to control differentiation in the mouse . Mol Cell Biol 2003 ; 23 : 5256 – 5268 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Cartwright P , McLean C, Sheppard A et al. LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism . Development 2005 ; 132 : 885 – 896 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Li Y , McClintick J, Zhong L et al. Murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by the zinc finger transcription factor Klf4 . Blood 2005 ; 105 : 635 – 637 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Kielman MF , Rindapaa M, Gaspar C et al. Apc modulates embryonic stem-cell differentiation by controlling the dosage of beta-catenin signaling . Nat Gen 2002 ; 32 : 594 – 605 . Google Scholar Crossref Search ADS WorldCat 22 Satoh K , Kasai M, Ishidao T et al. Anteriorization of neural fate by inhibitor of beta-catenin and T cell factor (ICAT), a negative regulator of Wnt signaling . Proc Natl Acad Sci USA 2004 ; 101 : 8017 – 8021 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Takebe N , Warren RQ Ivy SP. Breast cancer growth and metastasis: interplay between cancer stem cells, embryonic signaling pathways and epithelial-to-mesenchymal transition . Breast Cancer Res 2011 ; 13 : 211 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Dontu G , Jackson KW, McNicholas E et al. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells . Breast Cancer Res 2004 ; 6 : R605 – R615 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Miele L. Notch signaling . Clin Cancer Res 2006 ; 12 : 1074 – 1079 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Grudzien P , Lo S, Albain KS et al. Inhibition of Notch signaling reduces the stem-like population of breast cancer cells and prevents mammosphere formation . Anticancer Res 2010 ; 30 : 3853 – 3867 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 27 Ghebeh H , Al-Khaldi S, Olabi S et al. Fascin is involved in the chemotherapeutic resistance of breast cancer cells predominantly via the PI3K/Akt pathway . Br J Cancer 2014 ; 111 : 1552 – 1561 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Al-Alwan M , Olabi S, Ghebeh H et al. Fascin is a key regulator of breast cancer invasion that acts via the modification of metastasis-associated molecules . PLoS ONE 2011 ; 6 : e27339 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Adams JC Schwartz MA. Stimulation of fascin spikes by thrombospondin-1 is mediated by the GTPases Rac and Cdc42 . J Cell Biol 2000 ; 150 : 807 – 822 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Ghebeh H , Sleiman GM, Manogaran PS et al. Profiling of normal and malignant breast tissue show CD44high/CD24low phenotype as a predominant stem/progenitor marker when used in combination with Ep-CAM/CD49f markers . BMC Cancer 2013 ; 13 : 289 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Dontu G , Abdallah WM, Foley JM et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells . Genes Devel 2003 ; 17 : 1253 – 1270 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Hu Y Smyth GK. ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays . J Immunol Methods 2009 ; 347 : 70 – 78 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Mani SA , Guo W, Liao MJ et al. The epithelial-mesenchymal transition generates cells with properties of stem cells . Cell 2008 ; 133 : 704 – 715 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Franken NA , Rodermond HM, Stap J et al. Clonogenic assay of cells in vitro . Nat Protocols 2006 ; 1 : 2315 – 2319 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Raouf A , Zhao Y, To K et al. Transcriptome analysis of the normal human mammary cell commitment and differentiation process . Cell Stem Cell 2008 ; 3 : 109 – 118 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Yalcin-Ozuysal O , Fiche M, Guitierrez M et al. Antagonistic roles of Notch and p63 in controlling mammary epithelial cell fates . Cell Death Diff 2010 ; 17 : 1600 – 1612 . Google Scholar Crossref Search ADS WorldCat 37 Farnie G , Clarke RB, Spence K et al. Novel cell culture technique for primary ductal carcinoma in situ: role of Notch and epidermal growth factor receptor signaling pathways . J Natl Cancer Inst 2007 ; 99 : 616 – 627 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Stylianou S , Clarke RB Brennan K. Aberrant activation of notch signaling in human breast cancer . Cancer Res 2006 ; 66 : 1517 – 1525 . Google Scholar Crossref Search ADS PubMed WorldCat 39 Berdnik D , Torok T, Gonzalez-Gaitan M et al. The endocytic protein alpha-Adaptin is required for numb-mediated asymmetric cell division in Drosophila . Dev Cell 2002 ; 3 : 221 – 231 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Lombardo Y , Filipovic A, Molyneux G et al. Nicastrin regulates breast cancer stem cell properties and tumor growth in vitro and in vivo . Proc Natl Acad Sci USA 2012 ; 109 : 16558 – 16563 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Capaccione KM Pine SR. The Notch signaling pathway as a mediator of tumor survival . Carcinogenesis 2013 ; 34 : 1420 – 1430 . Google Scholar Crossref Search ADS PubMed WorldCat 42 Hu C , Dievart A, Lupien M et al. Overexpression of activated murine Notch1 and Notch3 in transgenic mice blocks mammary gland development and induces mammary tumors . Am J Pathol 2006 ; 168 : 973 – 990 . Google Scholar Crossref Search ADS PubMed WorldCat 43 Reedijk M , Odorcic S, Chang L et al. High-level coexpression of JAG1 and NOTCH1 is observed in human breast cancer and is associated with poor overall survival . Cancer Res 2005 ; 65 : 8530 – 8537 . Google Scholar Crossref Search ADS PubMed WorldCat 44 Chen J , Imanaka N, Chen J et al. Hypoxia potentiates Notch signaling in breast cancer leading to decreased E-cadherin expression and increased cell migration and invasion . Br J Cancer 2010 ; 102 : 351 – 360 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Smith GH , Gallahan D, Diella F et al. Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs differentiation and functional development . Cell Growth Diff 1995 ; 6 : 563 – 577 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 46 Soriano JV , Uyttendaele H, Kitajewski J et al. Expression of an activated Notch4(int-3) oncoprotein disrupts morphogenesis and induces an invasive phenotype in mammary epithelial cells in vitro . Int J Cancer 2000 ; 86 : 652 – 659 . Google Scholar Crossref Search ADS PubMed WorldCat 47 Krebs LT , Xue Y, Norton CR et al. Notch signaling is essential for vascular morphogenesis in mice . Genes Dev 2000 ; 14 : 1343 – 1352 . Google Scholar Crossref Search ADS PubMed WorldCat 48 Cheng GZ , Chan J, Wang Q et al. Twist transcriptionally up-regulates AKT2 in breast cancer cells leading to increased migration, invasion, and resistance to paclitaxel . Cancer Res 2007 ; 67 : 1979 – 1987 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Suman S , Das TP Damodaran C. Silencing NOTCH signaling causes growth arrest in both breast cancer stem cells and breast cancer cells . Br J Cancer 2013 ; 109 : 2587 – 2596 . Google Scholar Crossref Search ADS PubMed WorldCat 50 Li A , Morton JP, Ma Y et al. Fascin is regulated by slug, promotes progression of pancreatic cancer in mice, and is associated with patient outcomes . Gastroenterology 2014 ; 146 : 1386 – 1396 . e1381-1317. Google Scholar Crossref Search ADS PubMed WorldCat 51 Albers AE , Chen C, Koberle B et al. Stem cells in squamous head and neck cancer . Crit Rev Oncol Hematol 2012 ; 81 : 224 – 240 . Google Scholar Crossref Search ADS PubMed WorldCat 52 Eramo A , Haas TL De Maria R. Lung cancer stem cells: tools and targets to fight lung cancer . Oncogene 2010 ; 29 : 4625 – 4635 . Google Scholar Crossref Search ADS PubMed WorldCat 53 Gibbs CP , Kukekov VG, Reith JD et al. Stem-like cells in bone sarcomas: implications for tumorigenesis . Neoplasia 2005 ; 7 : 967 – 976 . Google Scholar Crossref Search ADS PubMed WorldCat 54 Tirino V , Desiderio V, Paino F et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo . FASEB J 2011 ; 25 : 2022 – 2030 . Google Scholar Crossref Search ADS PubMed WorldCat 55 Liu P , Kumar IS, Brown S et al. Disulfiram targets cancer stem-like cells and reverses resistance and cross-resistance in acquired paclitaxel-resistant triple-negative breast cancer cells . Br J Cancer 2013 ; 109 : 1876 – 1885 . Google Scholar Crossref Search ADS PubMed WorldCat 56 Chen L , Yang S, Jakoncic J et al. Migrastatin analogues target fascin to block tumour metastasis . Nature 2010 ; 464 : 1062 – 1066 . Google Scholar Crossref Search ADS PubMed WorldCat © 2016 AlphaMed Press This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Fascin Is Critical for the Maintenance of Breast Cancer Stem Cell Pool Predominantly via the Activation of the Notch Self-Renewal Pathway
JF - Stem Cells
DO - 10.1002/stem.2473
DA - 2016-12-01
UR - https://www.deepdyve.com/lp/oxford-university-press/fascin-is-critical-for-the-maintenance-of-breast-cancer-stem-cell-pool-zf2qjq4zms
SP - 2799
EP - 2813
VL - 34
IS - 12
DP - DeepDyve
ER -