TY - JOUR
AU - Divol, B
AB - Abstract Protease-secreting yeasts have broad biotechnological potential for application to various industrial processes, including winemaking. However, this activity is influenced by the yeast response to environmental factors such as nitrogen and protein sources, as are found in grape juice. In this study, the wine-relevant yeast Metschnikowia pulcherrima IWBT Y1123, with known protease-secreting ability, was subjected to different nitrogen-containing compounds to monitor their impact on protease secretion and activity. Protease activity increased above basal levels for haemoglobin-containing treatments, indicating an inductive influence of proteins. On the other hand, treatments containing both haemoglobin and assimilable nitrogen sources led to a delayed increase in protease activity and protein degradation, suggesting a nitrogen catabolite repression mechanism at work. Protease activity and expression were furthermore evaluated in grape juice, which revealed increased expression and activity levels over time as promising results for further investigations into the impact of this yeast on wine properties. Electronic supplementary material The online version of this article (10.1007/s10295-019-02227-w) contains supplementary material, which is available to authorized users. Introduction Yeast species in the winemaking environment other than Saccharomyces cerevisiae have, in recent years, been considered for mixed fermentations in winemaking due to their positive contributions to wine quality and processing [12]. Species from the genera Metschnikowia, Pichia, Torulaspora and Lachancea, amongst others, have come to be used commercially as co-fermentative starter cultures due to their release of aromatic volatile compounds and enhancement of the overall aromatic profile of the wine [28]. Investigations into the impact of non-Saccharomyces yeast species, which are mostly present during the initial stages of wine fermentation, on wine technological and oenological properties have come a long way in elucidating the metabolic attributes responsible for improving various aspects of wine quality. The production and secretion of hydrolytic enzymes in particular present the potential of positively influencing wine clarification and filtration, juice yield, colour and aroma extraction, and wine stability [24]. However, enzymes are commonly applied exogenously to wine fermentations for these purposes, after purification from media grown with various bacteria or filamentous fungi. For example, the impact of adding the acid-tolerant aspartic proteases produced by Aspergillus niger and Botrytis cinerea to grape juice fermentations has been investigated for their ability to reduce protein haze in wine [23, 34]. Although other factors play a substantial role, the incidence of haze in wine can be positively correlated with the concentration of heat-unstable grape proteins in the juice, specifically of chitinases and thaumatin-like proteins (TLPs) [25]. Protein degradation through protease activity, thus, presents a potential preventative strategy to wine haze formation, and those produced by A. niger and B. cinerea were proven effective in reducing haze with and without additional heat treatment, respectively. Reid et al. [30] isolated and sequenced a gene encoding an extracellular aspartic protease from the wine yeast strain Metschnikowia pulcherrima IWBT Y1123 based on sequence similarities with other known aspartic proteases. This enzyme, named MpAPr1, is, therefore, the only known extracellular aspartic protease secreted by M. pulcherrima IWBT Y1123. The activity of this enzyme, MpAPr1, was further characterised and its exogenous application to grape juice fermentations showed a partial degradation of grape proteins, particularly of chitinases, as well as a decrease in haze-forming potential after 48 h of incubation [39, 40]. However, an alternative could be the direct use of M. pulcherrima IWBT Y1123 itself as a starter culture in mixed fermentation with S. cerevisiae, providing that MpAPr1 be secreted into the fermentation matrix under winemaking conditions. An investigation into the regulation of this enzyme is, therefore, critical to elucidate the role that some environmental factors may play in its production, secretion and activity under winemaking conditions. Different factors relevant to the oenological environment such as pH and temperature, as well as carbon, nitrogen, sulphur and protein content, have been reported to influence enzymatic activity in yeasts [24, 35]. Nitrogen availability, and complexity of the available sources, has been shown to influence the regulation of extracellular proteases in yeast in particular, which is known to play a role in yeast nutrition through the degradation of proteins into low-molecular-weight, assimilable nitrogen sources [1, 6, 11, 35]. Nutrition is an essential prerequisite for the growth and development of microorganisms [41]. The ability of an organism to optimally utilise the nutrients available to it, and adapt to the nutritional limitations in its environment, confers an important advantage for its survival. The vital role of nitrogen in particular is manifested in the ability of free-living unicellular organisms to employ a vast array of metabolic resources for the transport and catabolism of many different nitrogenous compounds [16, 26]. However, not all nitrogen sources support growth equally well [2]. Yeast species such as S. cerevisiae and Candida albicans have developed molecular mechanisms to ensure the prioritised utilisation of preferred nitrogen sources like ammonium and amino acids. These processes form part of the regulatory mechanism called nitrogen catabolite repression (NCR), which is also involved in the regulation of mechanisms required for the utilisation of alternative nitrogen sources when preferred sources are unavailable [10]. Proteins can be considered as an alternative source of nitrogen in C. albicans, for example, as the expression of genes required for its utilisation is under the control of NCR [10]. This includes SAP2, a gene encoding an extracellular aspartic protease, which is induced in the presence of proteins but repressed when preferred sources are also available [10]. The grape juice environment includes the presence of both complex nitrogen-containing compounds such as grape proteins, and simpler, preferred nitrogen sources like ammonium ions and amino acids [26]. In this study, the influence of various available nitrogen sources on MpAPr1’s secretion and activity was assessed by growing M. pulcherrima IWBT Y1123 in a minimal yeast nitrogen base (YNB) or synthetic grape juice-like (SGJ) medium supplemented with complex (protein) or simpler (ammonium and amino acids) nitrogen-containing compounds, or a combination thereof. Furthermore, MpAPr1’s secretion and activity, and expression of MpAPr1, was subsequently monitored in Sauvignon blanc as a preliminary investigation into the potential of using M. pulcherrima IWBT Y1123 as a co-starter culture in grape juice fermentations. Materials and methods Strains and pre-culture conditions The yeast strain used in this study was Metschnikowia pulcherrima IWBT Y1123, isolated from grape juice which was pressed from Chardonnay grapes during the 2009 harvest season in Stellenbosch, South Africa [30]. Cultures were maintained in 30% glycerol at − 80 °C, and cultivated at 30 °C in yeast peptone dextrose (YPD) (Biolab diagnostics, Wadenville, South Africa). Media and treatment conditions Two different synthetic media were supplemented with different nitrogen sources in this study: Yeast Nitrogen Base (YNB) medium [20 g/L glucose, 1.7 g/L YNB base without amino acids and ammonium (Difco Laboratories, MI, USA)], prepared in McIlvaine’s buffer adjusted to pH 3.5; and synthetic grape juice (SGJ) as described by Henschke and Jiranek [17] but prepared without nitrogen sources, and adjusted to pH 3.2 with 2 M HCl. Nitrogen source supplementation of YNB and SGJ was performed with haemoglobin (Hb) (Sigma-Aldrich, MO, USA), haemoglobin and amino acids (Merck, Darmstadt, Germany) and ammonium chloride (Sigma-Aldrich) (Hb − NH4+ − AA) or only amino acids and ammonium chloride (NH4+ − AA) (Table 1). Amino acid composition was adapted from Henschke and Jiranek [17]. For each treatment, the nitrogen sources were adjusted to a final concentration of 0.2 g/L total YAN in YNB or SGJ. In the case of haemoglobin, the concentration required to reach 0.2 g/L free amino nitrogen if all peptide bonds were cleaved was considered. The final concentrations of each source in the various treatments are outlined in Table 1. Final concentrations of individual nitrogen source supplements to YNB and SGJ to achieve a total YAN concentration of 0.2 g/L in the different nitrogen treatments which included haemoglobin (Hb), ammonium (NH4+), amino acids (AA) or combinations thereof . . Treatment . Hb . Hb + NH4+ + AA . NH4+ + AA . Nitrogen source Hb 1.6 g/L 0.8 g/L – NH4+ + AA – 0.1 g/L 0.2 g/L . . Treatment . Hb . Hb + NH4+ + AA . NH4+ + AA . Nitrogen source Hb 1.6 g/L 0.8 g/L – NH4+ + AA – 0.1 g/L 0.2 g/L Open in new tab Final concentrations of individual nitrogen source supplements to YNB and SGJ to achieve a total YAN concentration of 0.2 g/L in the different nitrogen treatments which included haemoglobin (Hb), ammonium (NH4+), amino acids (AA) or combinations thereof . . Treatment . Hb . Hb + NH4+ + AA . NH4+ + AA . Nitrogen source Hb 1.6 g/L 0.8 g/L – NH4+ + AA – 0.1 g/L 0.2 g/L . . Treatment . Hb . Hb + NH4+ + AA . NH4+ + AA . Nitrogen source Hb 1.6 g/L 0.8 g/L – NH4+ + AA – 0.1 g/L 0.2 g/L Open in new tab The Sauvignon blanc grape juice used in this study was obtained from grapes harvested at the Welgevallen experimental vineyard (Stellenbosch University) in 2016. After thawing and prior to experimental use, grape juice was centrifuged at 8000×g for 15 min and subsequently filtered through 11-μM and 2.5-μM Whatman™ filter paper (GE Healthcare, IL, USA), and 1.2-μM, 0.45-μM and 0.2-μM filters (cellulose acetate filters, Sartorius Stedim, Göttingen, Germany) using a Nalgene® vacuum filtration system (Sigma-Aldrich). The grape juice pH was measured at pH 3.3, and the appropriate enzyme kits were used to determine the grape juice glucose and fructose concentrations at 116 g/L each (Enzytec™ Liquid d-Glucose, R-Biopharm, Darmstadt, Germany and d-Fructose, Thermo Scientific, MA, USA, respectively), as well as the ammonia and primary amino nitrogen (PAN) concentrations at 48.3 mg/L and 116 mg/L, respectively (Enzytec™ Fluid Ammonia, R-Biopharm and PANOPA Assay Kit, Megazyme, Bray, Ireland, respectively), in conjunction with photometric determination (Arena 20XT Photometric Analyzer, Thermo Scientific). Growth and sampling M. pulcherrima IWBT Y1123 cells suspended in the designated YNB, SGJ or grape juice were inoculated into the appropriate medium at an optical density of 2.4 at 600 nm and incubated at 25 °C with shaking at 110 rpm. Samples were taken over a period of 48 h for monitoring yeast growth using optical density measurements at 600 nm and protease activity against azocasein in liquid assays (as described below). Remaining samples were stored at − 20 °C prior to SDS-PAGE analysis (as described below). Additional 1-mL samples from grape juice experiments were resuspended in 20% glycerol and flash-frozen in liquid nitrogen, and subsequently stored at − 80 °C before RNA extractions and qPCR analyses (as described below). Endo-protease activity assay Protease activity in sample supernatants was measured against azocasein (Megazyme), a chromogenic substrate associated with the release of acid-soluble material in the presence of endopeptidase activity. Assay parameters were adapted from Theron et al. [39]. Cultures were centrifuged at 6000×g for 5 min, and supernatant was added to 2% azocasein substrate (dissolved in McIlvaine’s buffer pH 4.5) in a 1:1 ratio. Samples were taken before and after incubation at 40 °C for 24 h, and added to 20% trichloroacetic acid (TCA) solution in a 1:1 ratio to stop the reaction. The mixture was briefly vortexed and centrifuged at 16,000×g for 5 min, before measuring absorbance at 440 nm using a Thermo Scientific™ Multiskan™ GO Microplate Spectrophotometer with SkanIt™ software. One arbitrary unit (AU) of protease activity was defined as the amount of protease causing an increase in absorbance at 440 nm of 0.001 through a path length of 1 cm, per millilitre supernatant-substrate sample incubated at 40 °C for an hour. Protein extraction and quantification Culture samples from YNB and SGJ containing only haemoglobin, and haemoglobin with ammonium and amino acids, were thawed prior to protein extraction, and centrifuged at 6000×g for 5 min. Supernatant samples were diluted 5 × in MilliQ (18.2 MΩ), added to 100% acetone in a 1:3 ratio, and left at − 20 °C overnight before centrifugation at 21,380×g for 30 min. The pellet was resuspended in MilliQ and protein concentrations were determined using the Pierce® BCA Protein Assay kit (Thermo Scientific) according to the manufacturer’s instructions. Colorimetric detection was performed by measuring absorbance at 540 nm using a PowerWave™ Microplate Scanning Spectrophotometer (BioTek Instruments Inc, VT, USA). Protein visualisation For each treatment, protein samples were diluted to the same extent required for the non-inoculated control sample to reach 1 mg/mL total protein concentration. Thus, the Hb-only samples from YNB and SGJ were diluted 2 × more than samples from the Hb − NH4+ − AA combination treatment. Proteins were visualised through the use of sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) as previously described (Laemmli [21]). Gels containing 15% bis-acrylamide were loaded with 40 µL of the suspended protein samples, and run on a Bio-Rad Mini-Protean® Tetra Cell System (Bio-Rad Laboratories, CA, USA). Electrode chambers were filled with Tris–Glycine buffer (50 mM Tris, 200 mM glycine, 0.2% SDS). Gels were stained overnight in staining solution [1 g Coomassie blue R250 (Merck, Darmstadt, Germany) in 50% (v/v) ethanol, 10% (v/v) acetic acid], and destained with 12.5% isopropanol and 10% (v/v) acetic acid. Gel images were captured using a Molecular Imager® Gel Doc™ System (Bio-Rad Laboratories) using Image Lab™ Software v6.0 (Bio-Rad Laboratories). Relative protein degradation of bands visualised through SDS-PAGE was determined through densitometry analyses of protein band intensities using Image Lab™ Software v6.0 (Bio-Rad Laboratories). RNA extraction RNA extractions were performed on biological triplicates of grape juice cultures which were thawed and centrifuged at 21,380×g for 30 min before resuspending the pellet in saline. After centrifugation at 6000×g for 5 min, the saline wash step was repeated. The resultant pellet was resuspended in 600-µL high-salt buffer (0.5 M NaCl, 20 mM Tris/HCl, 10 mM EDTA, 2% SDS), to which 200-µL acid phenol and 200-µL chloroform was added before vortexing the mixture vigorously for 3 min in the presence of glass beads. The mixture was centrifuged at 15,000×g for 10 min, and the aqueous layer added to 400-µL chloroform. Another centrifugation step was performed at 15,000×g for 10 min before the aqueous layer was suspended in 1 mL 100% isopropanol and placed at − 20 °C overnight. After centrifugation at 21,380×g for 10 min, the pellet was resuspended in 100-µL MilliQ. Reverse transcription and qPCR Genomic DNA and RNA concentrations were quantified using a NanoDrop® ND-1000 spectrophotometer (NanoDrop Products, DE, USA). Contaminating DNA was removed with DNAse I treatments performed according to the manufacturer’s instructions (Roche, Mannheim, Germany). Reverse transcription of 760-ng RNA was performed using the 1st Strand cDNA Synthesis Kit for RT-PCR (AMV) (Roche) according to the manufacturer’s instructions. The oligo(dT)15 primer of the kit was used to initiate reverse transcription of poly(A)+ mRNA molecules. Quantitative PCR (qPCR) was performed in triplicate on the cDNA obtained from three biological repeats on a 7500 real-time PCR system (Applied Biosystems, Johannesburg, South Africa). Relative quantification was determined using the 2ΔΔCt method, and the ACT1 gene was used for normalisation purposes. Additionally, the linear regression of efficiency (LRE) method was used for absolute quantification of MpAPr1 transcripts present at the start of qPCR amplification, using the CAL1 amplicon from lambda DNA (Roche) as optical calibrator (Rutledge and Stewart [32]). The KAPA SYBR Fast qPCR kit (Kapa Biosystems, Cape Town, South Africa) was used for the reaction mix according to the manufacturer’s instructions. The primer sets MpAPr1-qPCR-fw/rev (ACACCCAAGGCGTCATACTC/ACAGGTCAATCGGGTACAGC) and MpACT1-qPCR-fw/rev (CTCCATGCCTCACGGTATTT/CTCCTGCTCAAAGTCCAAGG) were used to amplify the MpAPr1 and the ACT1 genes of Metschnikowia pulcherrima IWBT Y1123, respectively (Reid et al. [30]). The CAL1 forward (AGACGAATGCCAGGTCATCTGAAACAG) and reverse (CTTTTGCTCTGCGATGCTGATACCG) primers were used to amplify this gene in lambda DNA. The qPCR program consisted of an initial denaturation at 95 °C for 3 min followed by 40 cycles comprising of a denaturation step at 95 °C for 5 s and an annealing step at 60 °C for 1 min. The concentration of starting cDNA was subsequently determined using the Qubit® 2.0 Fluorometer (Thermo Scientific), and used to normalise the Ct values obtained from MpAPr1 and ACT1 amplification before application of the 2ΔΔCt method. The LRE Analyzer program (Rutledge [31]) was used to calculate the initial number of MpAPr1 transcripts, which were then normalised with starting cDNA concentrations. Statistical analysis Statistical analyses were performed using the computer software GraphPad Prism 6 (GraphPad, CA, USA) to determine significant differences between treatments and time-points. Results Growth performance Growth of M. pulcherrima IWBT Y1123 occurred in all treatments, including when haemoglobin was provided as the sole source of nitrogen (Fig. 1). In YNB, cell density in the Hb-only treatment was less pronounced than in treatments containing simple nitrogen sources during the first 8 h of growth (Fig. 1a). However, from 24 h after inoculation, growth in Hb-only had exceeded that of the other nitrogen conditions. This trend was amplified by 48 h when an optical density of 20 at 600 nm was reached compared to an average of 14 for those treatments containing simple nitrogen sources, with the Hb − NH4+ − AA combination treatment showing less growth than Hb-only but more so than samples without Hb. Fig. 1 Open in new tabDownload slide Growth of M. pulcherrima IWBT Y1123 represented by absorbance at 600 nm over 48 h. a In YNB media containing ammonium and amino acids (NH4+ + AA), ammonium and amino acids and haemoglobin (Hb + NH4+ + AA), or haemoglobin (Hb) only. b In SGJ media containing ammonium and amino acids (NH4+ + AA), ammonium and amino acids and haemoglobin (Hb + NH4+ + AA), or haemoglobin (Hb) only. c In Sauvignon blanc grape juice. The data points shown are means for three independent experiments and the error bars indicate standard deviation between triplicates In SGJ, although growth in the presence of ammonium and amino acids once again initially exceeded that of the Hb-only treatment from 6 h after inoculation, by 48 h this trend had persisted, unlike the YNB samples (Fig. 1b). By this time, the optical density of Hb-only samples reached 10 as opposed to 11 in NH4+ − AA -only samples. Yeast grown with a combination of haemoglobin and NH4+ − AA showed similar growth performance when grown in NH4+ − AA-only conditions from mid- to late exponential phase. When grown in Sauvignon blanc grape juice, by 48 h M. pulcherrima IWBT Y1123 had led to optical density values of 15.4, indicating higher levels of growth at this time than in all SGJ treatments, although lower than in the YNB Hb-only treatment (Fig. 1c). Protease activity Protease assays revealed a basal level of activity for all treatments throughout the duration of sampling (Fig. 2). In both YNB and SGJ, a significant increase in activity was recorded for Hb-only samples from 3 h as compared to simple nitrogen source-containing samples (Fig. 2a, b). In the Hb − NH4+ − AA combination treatment, a significant increase was observed from 6 h in YNB and from 9 h in SGJ. The maximum activity for the Hb-only and Hb − NH4+ − AA combination samples were measured at 48 h for both treatments with 425 AU and 414 AU in YNB, and 275 AU and 224 AU in SGJ, respectively (Fig. 2a, b). However, normalisation of activity to cell density revealed maximum levels occurring at 9 h with 41 AU in YNB and 24 h with 33 AU in SGJ (Fig. 2d, e). In Sauvignon blanc the maximum activity without normalisation was seen at 24 h with 80 AU, although normalisation with cell density revealed a constant level of activity until 24 h after inoculation after which it decreased (Fig. 2c and f). Data obtained from statistical comparison of means between time-points for the YNB and SGJ experiments can be found in Online Resource 1 (Tables S1–S4). Fig. 2 Open in new tabDownload slide Protease activity for M. pulcherrima IWBT Y1123 samples. a–c Expressed in AU. d–f Expressed in AU normalised by cell density. a and d Grown in YNB media containing ammonium and amino acids (NH4+ + AA), ammonium and amino acids and haemoglobin (Hb + NH4+ + AA), or haemoglobin only (Hb). b and e Grown in SGJ media containing ammonium and amino acids (NH4+ + AA), ammonium and amino acids and haemoglobin (Hb + NH4+ + AA), or haemoglobin only (Hb). c and f Grown in Sauvignon blanc grape juice. The data points shown are means for three independent experiments and the error bars indicate standard deviation between triplicates. In graphs a, b, d and e different letters indicate significant differences (P < 0.05) between samples from different treatments, within separate groups according to time-points (indicated by different numbers) as analysed by two-way ANOVA and the Fisher’s LSD test. Comparison of means between time-points can be found in Online Resource 1 (Tables S1–S4). In graphs c and f, different letters indicate significant differences (P < 0.05) between samples as analysed by one-way ANOVA and the Fisher’s LSD test Protein visualisation Haemoglobin degradation and the presence of MpAPr1 were monitored in samples taken over 48 h after M. pulcherrima IWBT Y1123 inoculation into YNB and SGJ containing the Hb-only and Hb − NH4+ − AA combination media. Extracted proteins were visualised using SDS-PAGE (Fig. 3). In the 0 h and control (incubated but non-inoculated medium) samples for both treatments, the different subunit associations of haemoglobin are clearly visible as bands at ~ 64 kDa, ~ 32 kDa and ~ 16 kDa, indicative of haemoglobin tetramers, dimers and monomers, respectively [18]. In YNB, these bands are faint or absent from subsequent samples taken 3 h to 48 h after inoculation, for both treatments (Fig. 3a, b). Disappearance of these bands is slightly delayed in SGJ in comparison, occurring from 6 h in Hb-only and from 12 h in the combination treatment (Fig. 3c, d). Additionally, a low-molecular-weight (< 10 kDa) smear appears in the 3-h lanes of YNB, and in SGJ in the 6-h, 12-h and 24-h lanes of Hb-only samples and the 12-h and 24-h lanes of the Hb − NH4+ − AA combination treatment samples, but is absent from subsequent samples. The appearance of a ~ 42 kDa band is evident from 6 h in both treatments of YNB, becoming more prominent towards 48 h. In SGJ, this band can be seen from 12 h after inoculation for the Hb-only treatment, and 24 h from the Hb − NH4+ − AA condition. This band can be attributed to the production of MpAPr1, through comparison of molecular weight [30, 39]. Fig. 3 Open in new tabDownload slide Visualisation of proteins precipitated from supernatant samples of the different growth media inoculated with M. pulcherrima IWBT Y1123. a and c Proteins obtained from haemoglobin-only (Hb) samples. b and d Proteins obtained from Hb − NH4+ − AA samples. a and b YNB samples taken at 0 h, 3 h, 6 h, 12 h and 48 h post inoculation, with a negative control obtained from incubated but non-inoculated medium. c and d SGJ samples taken at 0 h, 3 h, 6 h, 12 h and 48 h post inoculation, with a negative control obtained from incubated but non-inoculated medium. M molecular weight marker (PageRuler™ Prestained Protein Ladder, Thermo Scientific). Arrows to the right of the gels indicate protein bands tentatively identified as MpAPr1 or various structural conformations of haemoglobin through comparison of molecular weight [18, 39] The presence of MpAPr1 and degradation of grape proteins was monitored in grape juice inoculated with M. pulcherrima IWBT Y1123 (Fig. 4). Bands corresponding to the known molecular weight of MpAPr1 could be observed at 12 h, 24 h and 48 h after inoculation (Fig. 4a). Grape proteins with known molecular weights corresponding to the bands on the gel are also indicated. The partial degradation of these proteins, particularly of chitinases as analysed through densitometry, can be inferred from the fading intensity of their bands at 12 h, 24 h and 48 h (Fig. 4b). Fig. 4 Open in new tabDownload slide Visual analysis of proteins precipitated from samples taken 0 h, 3 h, 6 h, 12 h, 24 h and 48 h after M. pulcherrima IWBT Y1123 inoculation into grape juice. a Gel image obtained after SDS-PAGE. M: molecular weight marker (PageRuler™ Unstained Low Range Protein Ladder, Thermo Scientific). Arrows to the right of the gel indicate protein bands identified as MpAPr1 or grape proteins through comparison of molecular weight [33, 39]. b Densitometry analysis of bands tentatively identified as chitinases. Band intensities were compared between samples, using the chitinase band from the 0-h sample as reference Protease gene expression The expression of the MpAPr1 gene was furthermore monitored in M. pulcherrima IWBT Y1123 grown in Sauvignon blanc grape juice using quantitative PCR (qPCR) analysis (Fig. 5). The Ct values obtained were normalised by the concentration of the initial cDNA template of the appropriate sample. Subsequently, two different normalisation techniques were compared: the use of ACT1 as a reference gene (Fig. 5a, b) and LRE (linear regression of efficiency) (Fig. 5c). In Fig. 5a, despite an apparent initial decrease in expression from 0 to 3 h, expression increased significantly from 3 to 9 h after inoculation. Expression levels reached a maximum at 12 h and plateaued until 24 h, before decreasing to 48 h. Figure 5b shows an increasing fold change in expression relative to 0 h from 3 to 24 h, for samples already normalised to ACT1. The change becomes less pronounced by 48 h. The number of MpAPr1 transcripts (N0) reverse transcribed into cDNA before qPCR amplification was calculated using the LRE method, and normalised to cDNA concentration of the initial cDNA template (Fig. 5c). This method demonstrated a significant increase in relative transcript levels from 0 to 3 h, and again from 9 to 12 h. The maximum level of transcripts was reached at 12 h and subsequently decreased by 24 h. Transcripts were almost absent from 48-h samples. Fig. 5 Open in new tabDownload slide Gene expression analysis of MpAPr1 in samples of M. pulcherrima IWBT Y1123 taken throughout the first 48 h of growth in Sauvignon blanc juice. a MpAPr1 expression relative to ACT1. Ct values were normalised with cDNA concentration obtained through Qubit analysis before calculating dCt (Ct(ACT1)-Ct(MpAPr1)). b Fold change of MpAPr1 expression over time obtained through normalisation of dCt values to T0 (2ddCt). c Number of MpAPr1 transcripts present at the start of qPCR amplification quantified using LRE with the CAL1 amplicon from lambda DNA as optical calibrator, normalised with cDNA concentration. The data points shown are means for three independent experiments and the error bars indicate standard deviation between triplicates. Different letters indicate significant differences between samples (P < 0.05) for similar protein bands as analysed independently by one-way ANOVA and the Fisher’s LSD test Discussion and conclusion In this study, protease activity and production of MpAPr1, as well as the degradation of protein substrate, were monitored in media supplemented with different nitrogen sources and inoculated with M. pulcherrima IWBT Y1123. Haemoglobin (Hb) is a tetrameric, acid-soluble protein and has been used extensively as a substrate for the detection of protease activity, and for this reason, was used as the complex nitrogen source in the acidic conditions employed in this study even though it does not naturally occur in grape juice [19, 36]. Protease activity assays revealed a distinct and reproducible response to Hb-only and NH4+ − AA-only conditions. In the absence of complex nitrogen sources in NH4+ − AA-only treatments, only basal activity levels were evident. Similar observations have been reported for the protease-producing yeasts Candida humicola and Debaryomyces hansenii, in which only a basal level of activity was observed when yeasts were grown with ammonium as the sole nitrogen source [3, 29]. This suggests that the presence of more complex nitrogen sources, such as proteins, are required for the induction of protease activity, a hypothesis accepted for the extracellular protease-producing fungi Neurospora crassa and C. albicans [9, 10, 35]. Additionally, work with C. albicans showed that a basal level of protease activity produced micromolar concentrations of amino acids from protein degradation, which acted as end-product inducers for expression of the protease-encoding gene SAP2 [10]. The results described in this study show that M. pulcherrima IWBT Y1123 grown in the presence of haemoglobin led to significantly increased protease production when compared to NH4+ − AA-only treatments. Treatments containing a combination of haemoglobin and simple nitrogen sources showed a similar response to that of Hb-only, although delayed in timing of onset. This observation suggests that another factor is playing a role in protease regulation regarding the nature and availability of nitrogen sources: that protease production and activity is influenced not only by the presence of complex nitrogen sources, but also by that of simple nitrogen sources such as ammonium and amino acids. This corresponds well with NCR regulation, and this hypothesis has been explored extensively for numerous protease-producing yeast and fungal species including C. albicans, Yarrowia lipolytica, D. hansenii, Geotrichum candidum, Penicillium rocqueforti, Rhizopus oligosporus and Aspergillus oryzae [4, 5, 8, 10, 13, 15, 27, 35]. Growth of these yeasts in the presence of proteins with and without low-molecular-weight nitrogen sources such as ammonium revealed that the protease secretion and activity evident with only protein did not occur when easily assimilable and preferred nitrogen sources were available. For example, Sap2 secretion by C. albicans and the subsequent degradation and utilisation of BSA as a nitrogen source was blocked when low-molecular weight nitrogen sources were also available in the medium [11]. Thus, in the context of media containing both simple and complex nitrogen sources, a consequence of NCR regulation is the preferential consumption of low-molecular-weight compounds before mechanisms required for the utilisation of alternative sources are activated. Indeed, in the presence of proteins, protease-producing Saccharomyces strains showed increased protease activity only after easily assimilable nitrogen sources had been mostly consumed [22, 37]. It is, therefore, possible that this is the phenomenon being observed for M. pulcherrima IWBT Y1123 under conditions including both haemoglobin and NH4+ − AA. As assimilable nitrogen sources in combination treatments are consumed, protease repression is alleviated, leading to an increase in protease activity. Activity in haemoglobin-containing treatments as detected through endo-protease assays could furthermore be correlated with the complete degradation of haemoglobin, as well as the detection of MpAPr1 using SDS-PAGE techniques. Differences in yeast growth performance as well as the timing and magnitude of protease activity were evident between YNB and SGJ media. Activity normalised to cell density in YNB peaked at 9 h as opposed to 24 h in SGJ. Furthermore, an out-performance of cells grown in NH4+ − AA-containing media by Hb-only grown cells occurred in YNB, allowing a correlation between protease activity and enhanced cell growth presumably due to the release of an additional pool of assimilable nitrogen sources, but not in SGJ. A major difference in the composition between the two media, besides the presence of various vitamins, salts and trace elements in SGJ, is sugar concentration. The YNB medium was made up of 20 g/L glucose, whereas SGJ consists of 230 g/L total sugars (115 g/L glucose and 115 g/L fructose), thus making it 11.5 × more concentrated. It is possible that the delay in MpAPr1 production as observed both in protease assays and SDS-PAGE, and the lower levels of growth, could be attributed to an extended adaptation period of M. pulcherrima IWBT Y1123 to the high sugar concentrations of SGJ as opposed to YNB, due to osmotic shock and stress. Furthermore, it may be that the complex SGJ medium introduced factors in addition to elevated sugar levels that interfered with the protease activity assay conditions, possibly leading to competition for the azocasein substrate or inhibition of protease activity, a phenomenon previously observed for MpAPr1 [39]. However, carbon catabolite repression of proteases, for the prevention of the release and subsequent utilisation of amino acids as alternative carbon sources when preferred sources such as glucose are available, has been reported for several protease-producing yeast and fungal species and could also be playing a role in M. pulcherrima IWBT Y1123, leading to the delayed de-repression of protease production and subsequent release of assimilable nitrogen sources for growth in SGJ [6, 7, 9, 14, 20, 27, 35]. Nevertheless, although the presence of NH4+ − AA and high levels of glucose and fructose played a role in the repression of MpAPr1, this effect only served to delay the onset of protease activity and protein degradation. Having, thus, established the secretion and activity of MpAPr1 under conditions mimicking that of grape juice, M. pulcherrima IWBT Y1123 was subsequently grown in Sauvignon blanc grape juice. As observed previously when grown in the presence of both simple and complex nitrogen sources, protease activity could be detected, indicating that low-molecular-weight nitrogenous compounds were not inhibitory of protease expression in this matrix. However, the maximum activity normalised to cell density detected was 9 AU—3.5-fold less than in SGJ with haemoglobin as protein substrate. This could be attributed to limitations experienced by the activity assay due to grape juice composition in terms of potential protease inhibitors or competitors for protein substrate. Nevertheless, grape proteins, especially chitinases and TLPs, are known to be highly resistant to proteases in their native state due to their rigid peptide backbone structure [33]. If, as mentioned earlier, protease regulation involves induction by degradation products produced from basal protease activity, it is possible that lower activity levels were the result of lower concentrations of these products due to inefficient degradation of grape proteins by MpAPr1. Nevertheless, protein degradation as analysed using SDS-PAGE and densitometry indicated a 44% decrease in intensity for the band tentatively identified as chitinase from 0 to 48 h after inoculation, which could be partly due to natural degradation or precipitation as a result of environmental conditions such as pH changes, or interaction with wine components like polyphenolics. Protease presence and activity as detected by SDS-PAGE techniques and endo-protease assays could furthermore be correlated with the expression of MpAPr1. Relative to ACT1 expression, MpAPr1 was up-regulated from 3 to 24 h, the same period during which protease activity increased and within which time MpAPr1 appeared on the gel obtained through SDS-PAGE. Although the band tentatively identified as MpAPr1 is visible only from 12 h, this could be that the level of MpAPr1 present was below the detection threshold and due to the low binding efficiency of this protein to the Coomassie stain used [40]. ACT1 has previously been used as a reference gene to normalise the expression of MpAPr1, and is commonly used for gene expression analysis in S. cerevisiae, its stable expression in M. pulcherrima IWBT Y1123 has not been validated [30, 38]. The genome of M. pulcherrima IWBT Y1123 had not been sequenced or annotated at the time of the experiment to assist the search for additional candidate reference genes; thus, the LRE method was utilised as an alternative. Despite the difference in normalisation techniques, a similar trend of MpAPr1 up-regulation was observed after LRE analysis where a significant increase in expression is evident from 3 to 12 h. Taken together, these results show that MpAPr1 expression was up-regulated in M. pulcherrima IWBT Y1123 upon inoculation into grape juice, reaching maximum expression levels around 12 h after inoculation and leading to the production and secretion of MpAPr1 and its subsequent activity which peaked at 24 h. The results obtained in this study aid in elucidating the regulatory role that some environmental factors play in the production and activity of MpAPr1 by M. pulcherrima IWBT Y1123. Although nitrogen catabolite repression leads to the repression of protease activity when easily assimilable nitrogen sources are present, this mechanism is balanced by protease induction in the presence of proteins. Furthermore, high sugar levels present in the medium led to a delayed increase in protease activity. When M. pulcherrima IWBT Y1123 was inoculated into grape juice, which includes a combination of simple and complex nitrogen sources as well as high sugar levels, MpAPr1 expression was up-regulated and protease secretion and activity could be observed. These results show promise for the use of M. pulcherrima IWBT Y1123 as a protease-producing co-starter culture to grape juice fermentations. However, the impact thereof on wine properties such as protein haze formation remains to be explored in further depth. Acknowledgements This work is based on research supported in part by the National Research Foundation of South Africa (Grant number: 113303) and Winetech for their financial support. Compliance with ethical standards Conflict of interest The authors declare that they have no competing interests. Research involving human and animal participants This article does not involve any studies with human participants or animals performed by any of the authors. References 1. Alexandre H , Heintz D, Chassagne D, Guilloux-Benatier M, Charpentier C, Feuillat M Protease A activity and nitrogen fractions released during alcoholic fermentation and autolysis in enological conditions J Ind Microbiol Biotechnol 2001 26 235 240 Google Scholar Crossref Search ADS PubMed WorldCat 2. Beltran G , Novo M, Rozès N, Mas A, Guillamón JM Nitrogen catabolite repression in Saccharomyces cerevisiae during wine fermentations FEMS Yeast Res 2004 4 625 632 Google Scholar Crossref Search ADS PubMed WorldCat 3. Bolumar T , Sanz Y, Aristoy MC, Toldrá F Protease (PrA and PrB) and prolyl and arginyl aminopeptidase activities from Debaryomyces hansenii as a function of growth phase and nutrient sources Int J Food Microbiol 2006 107 20 26 Google Scholar Crossref Search ADS PubMed WorldCat 4. Bolumar T , Sanz Y, Aristoy MC, Toldrá F Purification and characterisation of Proteases A and D from Debaryomyces hansenii Int J Food Microbiol 2008 124 135 141 Google Scholar Crossref Search ADS PubMed WorldCat 5. Boutrou R , Kerriou L, Gassi JY Contribution of Geotrichum candidum to the proteolysis of soft cheese Int Dairy J 2006 16 775 783 Google Scholar Crossref Search ADS WorldCat 6. Braaksma M , Smilde AK, van der Werf MJ, Punt PJ The effect of environmental conditions on extracellular protease activity in controlled fermentations of Aspergillus niger Microbiology 2009 155 3430 3439 Google Scholar Crossref Search ADS PubMed WorldCat 7. Chaud LCS , Lario LD, Bonugli-Santos RC, Sette LD, Junior AP, Felipe MGA Improvement in extracellular protease production by the marine antarctic yeast Rhodotorula mucilaginosa L7 N Biotechnol 2016 33 807 814 Google Scholar Crossref Search ADS PubMed WorldCat 8. Christensen T , Hynes MJ, Davis MA Role of the regulatory gene areA of Aspergillus oryzae in nitrogen metabolism Appl Environ Microbiol 1998 64 3232 3237 106715 Google Scholar Crossref Search ADS PubMed WorldCat 9. Cohen BL , Morris JE, Drucker H Regulation of two extracellular proteases of Neurospora crassa by induction and by carbon-nitrogen and sulfur-metabolite repression Arch Biochem Biophys 1975 169 324 330 Google Scholar Crossref Search ADS PubMed WorldCat 10. Dabas N , Morschhäuser J A transcription factor regulatory cascade controls secreted aspartic protease expression in Candida albicans Mol Microbiol 2008 69 586 602 Google Scholar Crossref Search ADS PubMed WorldCat 11. Dunkel N , Biswas K, Hiller E, Fellenberg K, Satheesh SV, Rupp S, Morschhäuser J Control of morphogenesis, protease secretion and gene expression in Candida albicans by the preferred nitrogen source ammonium Microbiology 2014 160 1599 1608 Google Scholar Crossref Search ADS PubMed WorldCat 12. Escribano R , González-Arenzana L, Garijo P, Berlanas C, López-Alfaro I, López R, Gutiérrez AR, Santamaría P Screening of enzymatic activities within different enological non-Saccharomyces yeasts J Food Sci Technol 2017 54 1555 1564 5430188 Google Scholar Crossref Search ADS PubMed WorldCat 13. Farley PC , Ikasari L Regulation of the secretion of Rhizopus oligosporus extracellular carboxyl proteinase J Gen Microbiol 1992 138 2539 2544 Google Scholar Crossref Search ADS PubMed WorldCat 14. Geisseler D , Horwath WR Regulation of extracellular protease activity in soil in response to different sources and concentrations of nitrogen and carbon Soil Biol Biochem 2008 40 3040 3048 Google Scholar Crossref Search ADS WorldCat 15. Gente S , Poussereau N, Fèvre M Isolation and expression of a nitrogen regulatory gene, nmc, of Penicillium roqueforti FEMS Microbiol Lett 1999 175 291 297 Google Scholar Crossref Search ADS PubMed WorldCat 16. Godard P , Urrestarazu A, Vissers S, Kontos K, Bontempi G, van Helden J, André B Effect of 21 different nitrogen sources on global gene expression in the yeast Saccharomyces cerevisiae Mol Cell Biol 2007 27 3065 3086 1899933 Google Scholar Crossref Search ADS PubMed WorldCat 17. Henschke PA , Jiranek V Fleet GH Yeasts—metabolism of nitrogen compounds Wine microbiology and biotechnology 1993 Cornwall Taylor & Francis 77 164 Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 18. Huang YX , Wu ZJ, Huang BT, Luo M Pathway and mechanism of pH dependent human hemoglobin tetramer-dimer-monomer dissociations PLoS One 2013 8 e81708 3842943 Google Scholar Crossref Search ADS PubMed WorldCat 19. Kalisz HM Microbial proteinases Adv Biochem Eng 1988 36 1 65 Google Scholar OpenURL Placeholder Text WorldCat 20. Katz ME , Bernardo SM, Cheetham BF The interaction of induction, repression and starvation in the regulation of extracellular proteases in Aspergillus nidulans: evidence for a role for CreA in the response to carbon starvation Curr Genet 2008 54 47 55 Google Scholar Crossref Search ADS PubMed WorldCat 21. Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 1970 227 680 685 5432063 Google Scholar Crossref Search ADS PubMed WorldCat 22. Lekkas C , Hill AE, Taidi B, Hodgson J, Stewart GG The role of small wort peptides in brewing fermentations J Inst Brew 2009 115 134 139 Google Scholar Crossref Search ADS WorldCat 23. Marangon M , Van Sluyter SC, Robinson EMC, Muhlack RA, Holt HE, Haynes PA, Godden PW, Smith PA, Waters EJ Degradation of white wine haze proteins by Aspergillopepsin I and II during juice flash pasteurization Food Chem 2012 135 1157 1165 Google Scholar Crossref Search ADS PubMed WorldCat 24. Maturano YP , Assaf LAR, Toro ME, Nally MC, Vallejo M, de Figueroa LIC, Combina M, Vazquez F Multi-enzyme production by pure and mixed cultures of Saccharomyces and non-Saccharomyces yeasts during wine fermentation Int J Food Microbiol 2012 155 43 50 Google Scholar Crossref Search ADS PubMed WorldCat 25. McRae JM , Schulkin A, Dambergs RG, Smith PA Effect of white wine composition on protein haze potential Aust J Grape Wine Res 2018 24 1 6 Google Scholar OpenURL Placeholder Text WorldCat 26. Mendes-Ferreira A , Barbosa C, Lage P, Mendes-Faia A The impact of nitrogen on yeast fermentation and wine quality Ciência e Técnica Vitivinic 2011 26 17 32 Google Scholar OpenURL Placeholder Text WorldCat 27. Ogrydziak DM , Demain AL, Tannenbaum SR Regulation of extracellular protease production in Candida lipolytica Biochim Biophys Acta 1977 497 525 538 Google Scholar Crossref Search ADS PubMed WorldCat 28. Oro L , Ciani M, Comitini F Antimicrobial activity of Metschnikowia pulcherrima on wine yeasts J Appl Microbiol 2014 116 1209 1217 Google Scholar Crossref Search ADS PubMed WorldCat 29. Ray MK , Devi KU, Kumar GS, Shivaji S Extracellular protease from the antarctic yeast Candida humicola Appl Environ Microbiol 1992 58 1918 1923 195704 Google Scholar Crossref Search ADS PubMed WorldCat 30. Reid VJ , Theron LW, du Toit M, Divol B Identification and partial characterization of extracellular aspartic protease genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384 Appl Environ Microbiol 2012 78 6838 6849 3457490 Google Scholar Crossref Search ADS PubMed WorldCat 31. Rutledge RG A java program for LRE-based real-time qPCR that enables large-scale absolute quantification PLoS One 2011 6 e17636 3047581 Google Scholar Crossref Search ADS PubMed WorldCat 32. Rutledge RG , Stewart D Assessing the performance capabilities of LRE-based assays for absolute quantitative real-time PCR PLoS One 2010 5 e9731 2840021 Google Scholar Crossref Search ADS PubMed WorldCat 33. Van Sluyter SC , McRae JM, Falconer RJ, Smith PA, Bacic A, Waters EJ, Marangon M Wine protein haze: mechanisms of formation and advances in prevention J Agric Food Chem 2015 63 4020 4030 Google Scholar Crossref Search ADS PubMed WorldCat 34. Van Sluyter SC , Warnock NI, Schmidt S, Anderson P, van Kan JAL, Bacic A, Waters EJ Aspartic acid protease from Botrytis cinerea removes haze-forming proteins during white winemaking J Agric Food Chem 2013 61 9705 9711 Google Scholar PubMed OpenURL Placeholder Text WorldCat 35. Snyman C , Theron L, Divol B Understanding the regulation of extracellular protease gene expression in fungi: a key step towards their biotechnological applications Appl Microbiol Biotechnol 2019 103 5517 5532 Google Scholar Crossref Search ADS PubMed WorldCat 36. Sternberg MZ The separation of proteins with heteropolyacids Biotechnol Bioeng 1970 12 1 17 Google Scholar Crossref Search ADS PubMed WorldCat 37. Szopinska A , Christ E, Planchon S, König H, Evers D, Renaut J Stuck at work? Quantitative proteomics of environmental wine yeast strains reveals the natural mechanism of overcoming stuck fermentation Proteomics 2016 16 593 608 Google Scholar Crossref Search ADS PubMed WorldCat 38. Teste MA , Duquenne M, François JM, Parrou JL Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae BMC Mol Biol 2009 10 99 114 2776018 Google Scholar Crossref Search ADS PubMed WorldCat 39. Theron LW , Bely M, Divol B Characterisation of the enzymatic properties of MpAPr1, an aspartic protease secreted by the wine yeast Metschnikowia pulcherrima J Sci Food Agric 2017 97 3584 3593 Google Scholar Crossref Search ADS PubMed WorldCat 40. Theron LW , Bely M, Divol B Monitoring the impact of an aspartic protease (MpAPr1) on grape proteins and wine properties Appl Microbiol Biotechnol 2018 102 5173 5183 Google Scholar Crossref Search ADS PubMed WorldCat 41. Zaman S , Lippman SI, Zhao X, Broach JR How Saccharomyces responds to nutrients Annu Rev Genet 2008 42 27 81 Google Scholar Crossref Search ADS PubMed WorldCat Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. © Society for Industrial Microbiology 2019 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model) © Society for Industrial Microbiology 2019
TI - The expression, secretion and activity of the aspartic protease MpAPr1 in Metschnikowia pulcherrima IWBT Y1123
JF - Journal of Industrial Microbiology and Biotechnology
DO - 10.1007/s10295-019-02227-w
DA - 2019-12-01
UR - https://www.deepdyve.com/lp/oxford-university-press/the-expression-secretion-and-activity-of-the-aspartic-protease-mpapr1-zWzF29G6AP
SP - 1733
EP - 1743
VL - 46
IS - 12
DP - DeepDyve
ER -