TY - JOUR
AU - Kuchitsu, Kazuyuki
AB - Abstract Induction of defense responses by pathogens or elicitors is often accompanied by growth inhibition in planta, but its molecular mechanisms are poorly understood. In this report, we characterized the molecular events that occur during cryptogein-induced cell cycle arrest at G2 phase in synchronously cultured tobacco Bright Yellow-2 (BY-2) cells. Concomitant with the proteinaceous elicitor-induced G2 arrest, we observed inhibition of the histone H1 kinase activity of cyclin-dependent kinases (CDKs), which correlated with a decrease in mRNA and protein levels of CDKB1. In contrast, the amount of CDKA was almost unaffected by cryptogein even at M phase. Cryptogein rapidly inhibited the expression not only of positive, e.g. A- and B-type cyclins and NtCAK, but also of negative cell cycle regulators such as WEE1, suggesting that cryptogein affects multiple targets to inactivate CDKA to induce G2 arrest by mechanisms distinct from known checkpoint regulation. Moreover, we show that CDKB1 and cyclin proteins are also rapidly degraded by cryptogein and that the proteasome-dependent protein degradation has a crucial role in the control of cryptogein-induced hypersensitive cell death. The nucleotide sequence reported in this paper has been submitted to DDBJ under accession number: NtCAK (AB293452). Introduction One important feature distinguishing plants from other multicellular organisms is that plants are sessile and thus have to endure environmental challenges. One of the adaptive responses is the reduction of growth by repression of cell division (May et al. 1998) to preserve the limited energy of the mother cell and to avoid heritable damage. Such growth inhibition is also seen during defense responses against pathogens. Treatment with pathogen-derived elicitors or pathogen/microbe-associated molecular patterns (PAMP/MAMPs) in plants induces both defense responses and growth inhibition (Gómez-Gómez et al. 1999). Elicitor treatment induces down-regulation of some cell cycle-related genes along with the induction of defense-related genes (Longmann et al. 1995, Suzuki et al. 2006), suggesting that the down-regulation of cell cycle-related genes may be involved in the growth inhibition. However, the molecular mechanisms for elicitor-induced growth inhibition are largely unknown. A 10 kDa proteinaceous elicitor, cryptogein, from a pathogenic oomycete, Phytophthora cryptogea, induces hypersensitive cell death in tobacco in planta (Ricci et al. 1989) as well as in cultured cells (Binet et al. 2001) including Bright Yellow-2 (BY-2) cells (Kadota et al. 2004a, Higaki et al. 2007). To analyze the interrelationship between elicitor-induced defense responses including programmed cell death (PCD) and the cell cycle, we developed a model system using synchronous culture of BY-2 cells (Kadota and Kuchitsu 2006). Cryptogein induces not only expression of defense-related genes and the PCD but also growth inhibition and cell cycle arrest in the G1 or G2 phases (Kadota et al. 2004b). Cryptogein-induced defense signaling pathways depend on the cell cycle phases, indicating a close relationship between the induction of defense responses and the cell cycle (Kadota et al. 2005). The cell cycle arrest is induced prior to the expression of defense-related genes and the PCD, suggesting that the cell cycle arrest is a prerequisite for the induction of the PCD and defense responses (Kadota et al. 2004b). Progression and arrest of the eukaryotic cell cycle are orchestrated by cyclin-dependent Ser/Thr protein kinases (CDKs). Their activity depends not only on the availability and binding of cyclin partners such as CDK inhibitors and/or other regulatory factors but also importantly on the phosphorylation/dephosphorylation status of the kinases themselves (Morgan, 1997). Phosphorylation of conserved residues (Thr161 or equivalent) within the T-loops is necessary to activate CDKs via a conformational change allowing the proper recognition of the substrates for the kinase reaction. This activating phosphorylation of CDKs is catalyzed by CDK-activating kinases (CAKs; Kaldis, 1999). Following the CAK-mediated activation, the CDK activity is further regulated by the inhibitory phosphorylation of Tyr15 and Thr14 of the catalytic subunit of CDKs by WEE1 family kinases (Berry and Gould, 1996). At the G2–M boundary, CDK1 must be dephosphorylated on the Tyr15 residue within the CDK–cyclin complex in order to drive the cell through mitosis. This activating dephosphorylation is mediated by a CDC25 phosphatase (Nurse 1990, Featherstone and Russell 1991, Kumagai and Dunphy 1991). In animal and yeast cells, stress-induced cell cycle arrest is controlled by specific genes, and mutations in these genes often result in increased sensitivity to damaging reagents, i.e. oxygen radicals. Moreover, these genes are commonly mutated in various kinds of cancers, highlighting their importance in the maintenance of the cell cycle (for a review, see van Vugt et al. 2005). One of these genes, encoding p53 protein, harbors mutations in more than half of human cancers (Vousden and Lu 2002). p53 takes part in the G1 arrest in response to DNA damage. The DNA damage-induced cell cycle arrest in the G1 and S phases may partly involve inhibition of the activity of G1 CDKs by the specific CDK inhibitor, p21 (Xiong et al. 1993). Furthermore, the mechanism underlying the DNA damage-induced G2 arrest was shown to involve a specific inhibitory phosphorylation of the mitotic kinase, CDK1, in human cells (O'Connor et al. 1993, Jin et al. 1996). In plant cells, in addition to the elicitor, cryptogein, cell cycle arrest is induced by various kinds of stress such as oxidative stress mediated by menadion (Reichheld et al. 1999) or KMnO4, hypo-osmotic stress (Sano et al. 2006) and DNA damage (De Schutter et al. 2007). However, no homologs of p53 have been found in plants (Arabidopsis Genome Initiative 2000, Yoshiyama et al. 2009), and the molecular mechanisms of stress-induced cell cycle arrest are mostly unknown. In the present study, to analyze the molecular mechanisms for the elicitor-induced cell cycle arrest, we have characterized mRNA and protein levels as well as activities of various cell cycle regulators including cyclins and CDKs during cryptogein-induced cell cycle arrest at G2 phase in synchronously cultured tobacco BY-2 cells. The cell cycle arrest is shown to be associated with inactivation of CDKA and CDKB1. In addition to the suppressed expression of various cell cycle-related genes, proteasome-dependent protein degradation of cell cycle regulators is induced by the elicitor. Possible molecular events during the elicitor-induced cell cycle arrest are discussed. Results Cryptogein negatively regulates the activity of CDKs The cell cycle was synchronized at S phase with aphidicolin, and cryptogein was added at 0.5 h after aphidicolin release (S phase). The cell cycle progression was monitored by both the mitotic index and flow cytometry (Fig. 1A, B). Cryptogein treatment during S phase induced cell cycle arrest at G2 phase prior to the hypersensitive cell death (Fig. 1A). Fig. 1 View largeDownload slide Application of cryptogein in the S phase induces cell cycle arrest at the G2 phase and down-regulates CDK activity. (A) The change in the mitotic index of non-treated cells (filled squares) and cells treated with cryptogein at 0.5 h after aphidicolin release (S phase; filled circles) after release from aphidicolin treatment. Arrows indicate the time when the cryptogein was added. (B) Flow cytometric analysis was performed on 8,200 nuclei of non-treated cells (control) and cells treated with cryptogein in S phase. (C) Histone H1 kinase activity in non-treated cells (control) and cells treated with cryptogein in S phase (cryptogein). Histone H1 loading was controlled by Coomassie Brilliant Blue (CBB) staining. (D) Northern blot (left panel) and Western blot (right panel) analysis of CDKA and CDKB1 in non-treated cells (control) and cells treated with cryptogein in S phase (cryptogein). rRNA (loading control) visualized with ethidium bromide is shown as a control of the Northern blot. Crude extracts stained with CBB are shown in the lower panels for loading comparison. Fig. 1 View largeDownload slide Application of cryptogein in the S phase induces cell cycle arrest at the G2 phase and down-regulates CDK activity. (A) The change in the mitotic index of non-treated cells (filled squares) and cells treated with cryptogein at 0.5 h after aphidicolin release (S phase; filled circles) after release from aphidicolin treatment. Arrows indicate the time when the cryptogein was added. (B) Flow cytometric analysis was performed on 8,200 nuclei of non-treated cells (control) and cells treated with cryptogein in S phase. (C) Histone H1 kinase activity in non-treated cells (control) and cells treated with cryptogein in S phase (cryptogein). Histone H1 loading was controlled by Coomassie Brilliant Blue (CBB) staining. (D) Northern blot (left panel) and Western blot (right panel) analysis of CDKA and CDKB1 in non-treated cells (control) and cells treated with cryptogein in S phase (cryptogein). rRNA (loading control) visualized with ethidium bromide is shown as a control of the Northern blot. Crude extracts stained with CBB are shown in the lower panels for loading comparison. We affinity purified the CDK complexes with p13suc1 beads and assayed CDK activity using histone H1 as a substrate in the control and cryptogein-treated cells (Fig. 1C, left panel). In the control cells, the level of phosphorylated histone H1 peaked at the G2–M transition boundary (6.5–8.5 h, control) and declined to the basal level in G1 phase (12.5–14.5 h, control). In contrast, cryptogein inhibited the activation of the p13suc1-associated kinase activity during the G2–M transition boundary (6.5–10.5 h, cryptogein). p13suc1 beads can bind to both CDKA and CDKB protein, although CDKA had a higher affinity for p13suc1 beads than did CDKB (Harashima et al. 2007). We also monitored CDKB1 activity by immunoprecipitation with anti-CDKB1-specific antibody (Fig. 1C, right panel). In the control cells, the CDKB1 kinase activity increased at the G2–M transition (6.5–8.5 h, control), while this activation was abolished by cryptogein treatment. These results suggest that cryptogein inhibits the activity of both CDKA and CDKB1 during G2 to M phase. Cryptogein inhibits the accumulation of CDKB1;1 but not CDKA;3 To reveal the mechanisms for down-regulation of activities of CDKs, the effects of cryptogein on the mRNA and protein levels of A- and B-type CDKs were investigated under the same conditions as in Fig. 1C. The mRNA and protein levels of CDKA remained almost constant throughout the cell cycle, and were unaffected even at 8 h (M phase) after cryptogein application (Fig. 1D). CDKB1;1 mRNA levels started to increase at the S phase and reached a maximum at the G2 to early M phase in the control cells (Fig. 1D, left panel). Cryptogein treatment suppressed the CDKB1;1 mRNA levels from 4.5 h after aphidicolin release, which corresponds to the start of the G2 phase. The specific antibody against CDKB1 detected two bands in the control cells (Fig. 1D, right panel). Cryptogein treatment reduced the level of the major (lower) band and suppressed the increase in the upper band at G2 phase (Fig. 1A, 4.5 h). Treatment of the cell extract with calf intestine alkaline phosphatase prior to SDS–PAGE did not affect the levels of the two bands (data not shown), suggesting that the two bands do not represent the different phosphorylation status of CDKB1, but represent two different isoforms or other types of modification of CDKB1. These results suggest that CDKB1 is down-regulated at a transcriptional level in response to cryptogein. In contrast, the cryptogein-induced inhibition of CDKA activity seems not to be attributed to transcriptional or translational regulation but to post-translational modification of the CDKA protein. To address this possibility, we next examined the effect of cryptogein on the accumulation of various transcripts of cyclins and other cell cycle-related factors. Cryptogein down-regulates gene expression of A- and B-type cyclins and G2/M phase-specific transcription factors Cyclins are crucial components of the cell cycle machinery as they bind to and activate CDKs in eukaryotes including plants. The effects of cryptogein on the accumulation of transcripts of cyclin genes (A-type; CYCA1;1; and B-type; CYCB1;1, CYCB1;2, and CYCB1;3) were investigated under the same conditions as in Fig. 1C. CYCA1;1 mRNA gradually accumulated throughout G2/M and deceased at G1 phase (Fig. 2). Cryptogein treatment at S phase suppressed induction of CYCA1;1 mRNA prior to the cell cycle arrest at G2 phase. Accumulation of all B-type cyclin genes, CYCB1;1, CYCB1;2 and CYCB1;3, peaked during late G2/M, followed by a decrease during G1 phase (12.5 h). Cryptogein completely inhibited induction of these B-type cyclin genes (Fig. 2), while it induced defense-related genes, such as Hsr203J, Hin1 and ACHN, as shown previously (Kadota et al. 2004b), and did not affect the expression of EF1-α (Fig. 2). Fig. 2 View largeDownload slide Effects of treatment with cryptogein on the amount of mRNA in synchronized BY-2 cells. RNA gel blot analysis of cell cycle-related gene expression (Nicta; CYCA1;1, Nicta; CYCB1;1, Nicta; CYCB1;2, Nicta; CYCB1;3, NtmybA2, NtmybB, NtCAK, NtWEE1 and EF1-α) in non-treated cells (control) and cells treated with cryptogein in S phase (cryptogein). rRNA (loading control) is the same as Fig. 1D. Fig. 2 View largeDownload slide Effects of treatment with cryptogein on the amount of mRNA in synchronized BY-2 cells. RNA gel blot analysis of cell cycle-related gene expression (Nicta; CYCA1;1, Nicta; CYCB1;1, Nicta; CYCB1;2, Nicta; CYCB1;3, NtmybA2, NtmybB, NtCAK, NtWEE1 and EF1-α) in non-treated cells (control) and cells treated with cryptogein in S phase (cryptogein). rRNA (loading control) is the same as Fig. 1D. Since cryptogein treatment abolished the induction of B-type cyclin genes during G2/M phase, we next investigated the effect of cryptogein on the expression level of G2/M phase-specific transcription factors regulating the expression of B-type cyclins. A cis-acting element, MSA (M-specific activator), is essential for G2/M phase-specific transcription in tobacco cells (Ito et al. 1998). Three Myb-family transcription factors (two activators, NtmybA1 and NtmybA2, and a repressor, NtmybB) are involved in the MSA-mediated transcription. Among them, NtmybA2 has been shown to play a predominant role in G2/M-specific transcriptional regulation (Ito et al. 2001). The effects of cryptogein on the expression patterns of both types of Ntmyb genes, NtmybA1and NtmybA2, were investigated. Expression of NtmybA2 mRNA increased from S phase and reached a maximum at late G2 phase in the control. Cryptogein treatment strongly reduced the NtmybA2 mRNA levels especially at late G2/M phases (6.5–8.5 h, cryptogein). NtmybB mRNA levels remained constant throughout the cell cycle, which was also suppressed by cryptogein (Fig. 2). These results suggest that cryptogein-induced transcriptional down-regulation of the B-type cyclin genes is not due to up-regulation of a negative regulator but may predominantly be due to down-regulation of transcript levels of a positive regulator. Effects of cryptogein on the expression of CAK and WEE1 Plant CDK–cyclin complexes are regulated by phosphorylation/dephosphorylation and the interaction with regulatory proteins as in yeasts and animals (Dewitte and Murray 2003). A CAK homolog, NtCAK (accession No. AB293452), has been identified, which was similar to those in rice (Hata 1991) and Arabidopsis (Umeda et al. 1998, Shimotohno et al. 2003, Umeda et al. 2005). In order to reveal whether the cryptogein-induced down-regulation of activity of CDKs is attributed to the transcriptional regulation of the CDK regulators CAK and WEE1 kinase, we examined the effect of cryptogein on the transcript levels of NtCAK and NtWEE1 (accession No. AJ715532; Gonzalez et al. 2004) using a full-length NtCAK fragment and a 329 bp cDNA probe for NtWEE1. In the control cells, the levels of NtCAK and NtWEE1 transcripts were shown to fluctuate differently during the cell cycle (Fig. 2). The level of NtCAK mRNA started to increase at the S phase and reached a maximum at G2 to early M phase, while the expression of NtWEE1 peaked at the S phase, decreased during G2 and M phase and then increased again at the late G1 phase. The accumulation of transcripts of NtCAK started to decrease 4 h after cryptogein application (4.5–14.5 h, cryptogein). Since CAK is an important activator for CDK, cryptogein-induced inhibition of CAK expression may be involved in the inactivation of CDK to induce the G2 arrest. Cryptogein treatment also induced reduction in transcripts of NtWEE1 along with those of NtMybB, suggesting that cryptogein also inhibited the expression of not only positive regulators but also negative regulators of cell cycle progression. Effects of a proteasome inhibitor on cryptogein-induced degradation of CDKB1 and hypersensitive cell death As described above, the level of CDKB1 protein started to decrease 4 h after cryptogein application (Fig. 1D). To determine whether the decrease in CDKB1 protein is due to the degradation by proteasome-dependent proteolysis, we applied 100 μM MG132 (carbobenzoxyl-leucinyl-leucinyl-leucinal), a specific inhibitor of proteasome activity (Genschick et al. 1998). Although MG132 treatment itself inhibited the accumulation of the upper band of CDKB1, MG132 clearly suppressed the cryptogein-induced decrease of the lower band of CDKB1 (Fig. 3A), suggesting that cryptogein induces degradation of CDKB1 by the proteasome-dependent pathway. Fig. 3 View largeDownload slide Cryptogein-induced CDKB1 degradation and cell death were suppressed by an inhibitor of proteasome activity. (A) Effect of treatment with MG132 on the stability of CDKB1 protein. Western blots were performed with the antibody against CDKB1. We repeated these experiments three times and representative data are shown. (B) Percentage of mitotic cells in distilled water (DW)-, dimethylsulfoxide (DMSO)-, MG132- and cryptogein-treated BY-2 cell cultures. As a control for DW, DMSO was used. Arrow indicate the time (0.5 h after aphidicolin release) when the DW, DMSO, 100 μM MG132 and 1 μM cryptogein were added. Samples were taken at several time points after aphidicolin release for Western blot analysis of A. The asterisks indicate the time chosen to assay. (C) The cell death induced by application of cryptogein at the S phase was suppressed by MG132 treatment. Cell death was analyzed 30 h after aphidicolin release. The data represent the average of three independent experiments. Error bars indicate the SEM (n = 3). Fig. 3 View largeDownload slide Cryptogein-induced CDKB1 degradation and cell death were suppressed by an inhibitor of proteasome activity. (A) Effect of treatment with MG132 on the stability of CDKB1 protein. Western blots were performed with the antibody against CDKB1. We repeated these experiments three times and representative data are shown. (B) Percentage of mitotic cells in distilled water (DW)-, dimethylsulfoxide (DMSO)-, MG132- and cryptogein-treated BY-2 cell cultures. As a control for DW, DMSO was used. Arrow indicate the time (0.5 h after aphidicolin release) when the DW, DMSO, 100 μM MG132 and 1 μM cryptogein were added. Samples were taken at several time points after aphidicolin release for Western blot analysis of A. The asterisks indicate the time chosen to assay. (C) The cell death induced by application of cryptogein at the S phase was suppressed by MG132 treatment. Cell death was analyzed 30 h after aphidicolin release. The data represent the average of three independent experiments. Error bars indicate the SEM (n = 3). We further tested the effect of MG132 on cryptogein-induced hypersensitive cell death. Cryptogein-induced cell death was greatly suppressed by pre-treatment with MG132 (Fig. 3C), suggesting that proteasome-dependent protein degradation is a prerequisite for the induction of cryptogein-induced hypersensitive cell death. Since application of MG132 at S phase (at 0.5 h after aphidicolin release) itself induced cell cycle arrest (Fig. 3B), we could not test the effect of MG132 on the cryptogein-induced cell cycle arrest. Cryptogein induced proteasome-dependent degradation of CYCB2;2–GFP in the nucleus We attempted to test whether ectopic overexpression of cyclin B2 could overcome cryptogein-induced G2 arrest. We synchronized the BY-2 cell line expressing the rice CYCB2;2–green fluorescent protein (GFP) fusion protein under the control of an estrogen-regulated promoter, in which various features including the subcellular localization of CYCB2;2–GFP during mitosis have already been well characterized (Lee et al. 2003). As shown in Fig. 4A, the mitotic index of the CycB2;2–GFP-expressing cells reached a maximum 7 h after the removal of aphidicolin, and then declined as shown with the wild-type cells. Cryptogein treatment at S phase (0.5 h after aphidicolin release) completely abolished the cell cycle progression to mitosis similar to the wild-type cells irrespective of application of β-estradiol, indicating that overexpression of CYCB2;2–GFP did not affect the cryptogein-induced cell cycle arrest. Expression of OsCYCB2;2 alone did not override the cryptogein-induced cell cycle block in G2 phase. Fig. 4 View largeDownload slide Cryptogein induced rapid CYCB2;2 degradation by the proteasome-dependent pathway. (A) BY-2 cells were synchronized at S phase using aphidicolin. After removal of aphidicolin, progression of the cell cycle was monitored by counting the mitotic index. Cultures of transgenic plants were treated (+) or not (−) with 1 μM β-estradiol. Additionally, cells were treated (+) or not (−) with 1 μM cryptogein. The arrow indicates the time when the cryptogein was added. (B) Fluorescence microscopic images of the GFP fusion proteins and the corresponding bright field (BF) images are shown. Bar = 40 μm. Cells were treated in S phase (0.5 h after aphidicolin release) with 1 μM cryptogein and samples were taken at several time points after cryptogein application. The 1, 2, 3, 4 and 5 h correspond, respectively, to 1.5, 2.5, 3.5, 4.5 and 5.5 h after aphidicolin release. To reveal whether the cryptogein-induced disappearance of CYCB2;2–GFP-derived fluorescence was inhibited by the proteasome inhibitor MG132 treatment, cultures of transgenic plants were treated with 100 μM MG132 with or without 1 μM cryptogein. We repeated these experiments a minimum of three times and representative data are shown. (C) The average nuclear fluorescence intensity was quantified at the time points indicated above after cryptogein and/or MG132 application. Error bars indicate the SEM (n = 30). Fig. 4 View largeDownload slide Cryptogein induced rapid CYCB2;2 degradation by the proteasome-dependent pathway. (A) BY-2 cells were synchronized at S phase using aphidicolin. After removal of aphidicolin, progression of the cell cycle was monitored by counting the mitotic index. Cultures of transgenic plants were treated (+) or not (−) with 1 μM β-estradiol. Additionally, cells were treated (+) or not (−) with 1 μM cryptogein. The arrow indicates the time when the cryptogein was added. (B) Fluorescence microscopic images of the GFP fusion proteins and the corresponding bright field (BF) images are shown. Bar = 40 μm. Cells were treated in S phase (0.5 h after aphidicolin release) with 1 μM cryptogein and samples were taken at several time points after cryptogein application. The 1, 2, 3, 4 and 5 h correspond, respectively, to 1.5, 2.5, 3.5, 4.5 and 5.5 h after aphidicolin release. To reveal whether the cryptogein-induced disappearance of CYCB2;2–GFP-derived fluorescence was inhibited by the proteasome inhibitor MG132 treatment, cultures of transgenic plants were treated with 100 μM MG132 with or without 1 μM cryptogein. We repeated these experiments a minimum of three times and representative data are shown. (C) The average nuclear fluorescence intensity was quantified at the time points indicated above after cryptogein and/or MG132 application. Error bars indicate the SEM (n = 30). We also monitored the fluorescence of CYCB2;2–GFP expressed in the cells. Without cryptogein treatment, CYCB2;2–GFP was constantly expressed in the nuclei of interphase cells. In contrast, the CYCB2;2–GFP fluorescence rapidly vanished within 3 h by cryptogein treatment (Fig. 4B, C, cryptogein 3–5 h). To test whether this phenomenon is due to the degradation of CYCB2;2–GFP by a specific proteolysis, we analyzed the effect of 100 μM MG132 on the fluorescence of CYCB2;2–GFP. MG132 counteracted the cryptogein-induced reduction of the CYCB2;2–GFP fluorescence (Fig. 4B, lower panel and C). As a control, the fluorescence of GFP in the GFP-expressing cells was not affected by cryptogein treatment (data not shown). Discussion Cryptogein, a proteinaceous elicitor from a pathogenic oomycete, induced growth inhibition and cell cycle arrest at G1 or G2 phase before the induction of cell death in tobacco BY-2 cells (Kadota et al. 2004b). We here characterized molecular events during cryptogein-induced G2 arrest to determine possible effectors of the elicitor-induced cell cycle block. Cryptogein inhibited the kinase activity of both CDKA and CDKB1 from the start of the G2 phase. The relative amount of CDKB1 mRNA and proteins (Fig. 1D) correlated with the decrease in CDKB1 activity (Fig. 1C), suggesting that the level of CDKB1 is transcriptionally inactivated in response to cryptogein. In contrast, mRNA and protein levels of CDKA were almost unaffected even at 8 h (M phase) after cryptogein application, but the activity of p13suc1-associated CDKA was inactivated at 4.5 h (G2 phase), suggesting that CDKA activity is down-regulated by cryptogein at a post-translational level. Their activities depend largely on several other factors: the phosphorylation of conserved residues, the presence or absence of inhibitor proteins from the KRP family, and the availability of their activating cyclin partner, which have a cell cycle-dependent expression pattern and are degraded in a strictly regulated fashion (Mironov et al. 1999). The cyclins A1 and B1 have been suggested to be involved in the progression from G2 to M phase in plants (Mironov et al. 1999, John et al. 2001). Cryptogein down-regulated the expression of cyclin A and cyclin B, suggesting that the inhibition of CDKA activity is in part attributed to the decrease in these cyclins. It has indeed been shown that the overexpression of positive regulators such as B-type cyclins can override various checkpoint controls at G2 phase, including the topoisomerase II checkpoint (Gimenez-Abian et al. 2002). However, overexpression of CYCB2;2–GFP did not override the cryptogein-induced cell cycle block in G2 (Fig. 4A). Surprisingly, the CYCB2;2–GFP signal disappeared 3 h after cryptogein application even during the interphase, which was severely suppressed by a proteasome inhibitor, MG132 (Fig. 4B, C). These results suggest that overexpression of CYCB2;2 could not override the cryptogein-induced cell cycle arrest because cryptogein induced proteasome-dependent degradation of CYCB2;2 during the cell cycle arrest. A recent study indicated that MSA in the promoters of plant B-type cyclin genes is responsible for the G2/M phase-specific transcription in tobacco cells (Ito et al. 1998). Since the CYCB1 gene itself is a target of transcriptional activation by NtmybA2, a positive feedback loop has been postulated, in which transcription of the cyclin B gene is activated by NtmybA2, which is, in turn, activated by a CDK in a complex with cyclin B (Araki et al. 2004). Cryptogein negatively regulates CDK activity, leading to the cell cycle arrest and a decrease in the activity of NtmybA2, yet also causes the decrease in cyclin B mRNA levels. A possible involvement of an increase in the production of a repressor protein, NtmybB, in the down-regulation of the B-type cyclin genes can be excluded, because the transcript level of the NtmybB gene rapidly and markedly decreased concurrently with the decrease in the NtCYCB1;3 and NtmybA2 mRNA levels after the addition of the elicitor. In multicellular eukaryotes, phosphorylation and dephosphorylation of Thr14 and Thy15 of the catalytic subunit of CDKs regulate their activity and determine the timing of G2 and mitosis (Dunphy 1994). In fission yeast, WEE1 is involved in the cell cycle arrest at G2 phase induced by UV-mediated DNA damage. DNA damage induces activation of Chk1 kinase, which phosphorylates WEE1. Activated Wee1 leads to the maintenance of phosphorylation of the Tyr15 of Cdc2 kinase and hence the G2 delay (O'Connell et al. 1997). Arabidopsis WEE1 inactivates CDKA;1 through its phosphorylation at the conserved Tyr15 residue (Shimotohno et al. 2006). Expression of the Arabidopsis WEE1 gene was recently shown to be transcriptionally up-regulated by DNA damage or replication inhibitors (De Schutter et al. 2007). In contrast, cryptogein inhibited the accumulation of transcripts of NtWEE1 (Fig. 2), suggesting that WEE1-dependent tyrosine phosphorylation of CDKA is not directly involved in the elicitor-induced cell cycle arrest at G2 phase. Therefore, the mechanism for cryptogein-induced cell cycle arrest is different from the DNA damage-induced pathway. Cryptogein rapidly decreased the CDKB1 protein level in a proteasome-dependent manner (Figs. 1D, 3A). This finding is consistent with the recent report that the amount of CDKB2 protein is regulated not only at the transcriptional level, but also through proteasome-mediated protein degradation in Arabidopsis (Adachi et al. 2006). Cryptogein may accelerate the degradation of CDKB1 protein. During the past several years, many ubiquitination-related components have been identified that are involved in plant–pathogen or plant–insect interactions (Zeng et al. 2006). Several kinds of proteasome subunits are up-regulated by cryptogein in tobacco (Petitot et al. 1997, Etienne et al. 2000, Dahan et al. 2001). However, the molecular machinery that links the ubiquitin–proteasome system and defense responses is mostly unknown in plants. The present results provide evidence for the participation of proteasome-dependent protein degradation in processes by which the pathogen defense signaling pathway becomes established. Cryptogein-induced hypersensitive cell death also appears to require a proteasome-dependent pathway (Fig. 3D) in addition to the cell cycle arrest. It remains to be elucidated whether protein degradation of cell cycle-related factors also plays a pivotal role in induction of cell death. Other CDK-interacting molecules such as KRPs may also play a role in the cell cycle arrest process. Overexpression of the tobacco CDK inhibitor, NtKIS1a, led to reduction in both CDK activity and the cell division rate in Arabidopsis leaves (Jasinski at al. 2002). Another CDK inhibitor, rice EL2, has been shown to be induced by a fungal elicitor (Minami et al. 1996) as well as biotic and abiotic stresses (Peres et al. 2007). In conclusion, we have shown that in the process of cell cycle arrest at G2 phase, cryptogein inactivated A- and B-type CDKs by not only the down-regulation expression of various cell cycle-related genes, but also by protein degradation of CDKB1 and cyclin via the proteasome-dependent pathway. Cell cycle arrest triggered during plant immune responses may be mechanistically distinguished from known checkpoint regulation. Moreover, the present results suggest that proteasome-dependent protein degradation has crucial roles in the control of cryptogein-induced hypersensitive cell death. This experimental system should be a suitable model to elucidate further the molecular links between early signaling events and cell cycle regulation during stress responses in plants. Materials and Methods Plant material The tobacco BY-2 (Nicotiana tabacum L. cv. Bright Yellow 2) cell suspension was maintained by weekly dilution (1/100) of cells in modified Linsmaier and Skoog (LS) medium as described in Nagata et al. (1992). The cell suspension was agitated on a rotary shaker at 100 r.p.m. at 28°C in darkness. Cell cycle synchronization Synchronization of the cell cycle at S phase was performed as described in Nagata et al. (1992). In brief, a stationary culture of the cells was diluted 1/10 in fresh modified LS medium supplemented with 5 μg ml−1 aphidicolin (Wako Pure Chemical). After 24 h of culture, the aphidicolin was removed by extensive washing and the cells were resuspended in fresh medium. Expression and purification of cryptogein Pichia pastoris (strain GS115) bearing the plasmid pLEP3 was used to produce cryptogein. Cryptogein was expressed according to O'Donohue et al. (1996) and was dissolved in distilled water. The cryptogein concentration was determined using UV spectroscopy with an extinction coefficient of 8,306 M−1 cm−1 at 277 nm (O'Donohue et al. 1995). Monitoring of cell cycle progression by determination of the mitotic index and flow cytometric analysis The cell cycle progression was monitored by determination of the mitotic index. After staining of the cells with 4′,6-diamidino-2-phenylindole (DAPI), cells were observed under a epifluorescence microscope and dividing cells were counted. Flow cytometric analysis was performed according to the manufacturer's protocol as follows. A sample of frozen cell pellet was treated with the CyStain UV precise P kit (Partec) to determine the DNA content. To release cell nuclei, the cells were carefully chopped with a sharp razor blade in extraction buffer and filtered prior to addition of staining buffer. The fluorescence intensity was measured by a Ploidy Analyzer (Partec). Isolation of a cDNA encoding tobacco CAK Oligonucleotides were designed to amplify a conserved plant CDK7 sequence from the reverse-transcribed total RNA of tobacco BY-2 cell suspension. These oligonucleotides were as follows: 5′-GAAGGTGTCAATTTCACTGC-3′ and 5′-TTCCGGTCTCTTATGACAGCTTC-3′. A λ-ZAP cDNA library was constructed with cDNA from BY-2 cells (3 d after subculture). The amplified library (approximately 1.8 × 105 plaques) was screened with the fragment amplified as above. We obtained one cDNA clone carrying the partial tobacco CAK sequence (NtCAK). To determine the 5′ and 3′ end of the NtCAK transcript, 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR were conducted using a Marathon cDNA amplification kit (Clontech). Single-stranded cDNA was produced with total RNA extracted from BY-2 cells (3 d after subculture) and used for the RACE-PCR. The following two gene-specific primers were used for the 5′ and 3′ RACE-PCR based on the isolated NtCAK sequence. 5′-ATGCTCCAATGCTTGCTGTGC-3′ and 5′-CATGGAGACAGATCTTGAGGC-3′. The RACE-PCR products were amplified using Ex Taq polymerase (Takara) and sequenced. RNA extraction and Northern analysis Total RNA was extracted from each frozen cell sample using TRIzol reagent, according to the manufacturer's instructions (Invitrogen). Denatured total RNA (15 μg) was electrophoresed in 2% agarose gels containing 5.5% formaldehyde and transferred to Hybond-N membrane (Amersham-Pharmacia Biotech). Hybridization was performed at 65°C in phosphate buffer [500 mM Na-phosphate, pH 7.2, 1 mM EDTA, 1% bovine serum albumin (BSA), 7% SDS] with random-primed [α-32P]cDNA probes from tobacco. The following probes were used: NtCYCA;1 (Ito et al. 1997), NtmybA2 and NtmybB (Ito et al. 2001), a fragment amplified from mRNA by reverse transcription–PCR using primers ATGGATAACAATAGTGTTGGTGTTCC and GAAAGTCCACAAGCAGCCTTG; NtCYCB1;1 (0.4 kb, accession No.Z37978), CAAGTGTGTTGTCGGAGCAAG and GTATCATGTCAACAGATCTATTTGGC; NtCYCB1;2 (0.4 kb, accession No. D50737), GCTGATATTTTCTCTGTAATGGCTTC and GGCTTTGGTTTAACAGCAGC; NtCYCB1;3 (0.37 kb, accession No. D89635), TCTCATTTAGATGTAAAGCCAGATA and CGATTCATCATTGCCTTGAG; NtWEE1 (0.33 kb, accession No. AJ715532), complete cDNA coding lesion; NtCDKA;3 (885 bp, accession No. D50738), NtCDKB1;1 (912 bp, accession No. AF289465) and NtCAK (1 kb, accession No. AB293452). Hybridization signals were visualized with a Typhoon 9210 (Amersham-Pharmacia Biotech). Protein extraction and histone H1 kinase assays Tobacco BY-2 cell pellets were ground in liquid nitrogen into a fine powder in extraction buffer (25 mM Tris–HCl, pH 7.6, 75 mM NaCl, 15 mM MgCl2, 15 mM EGTA, 0.1% NP-40, 1 mM phenylmethylsulfonyl fluoride, 10 μg ml−1 leupeptin, 50 μg ml−1N-tosyl-l-phenylalanine chloromethyl ketone, 1 μg ml−1 pepstatin A, 10 μg ml−1 aprotinin, 5 μg ml−1 antipain, 10 μg ml−1 soybean trypsin inhibitor, 0.1 mM benzamidine, 1 mM NaF, 60 mM β-glycerophosphate and 0.1 mM sodium orthovanadate) and cleared subsequently by centrifugation. Protein concentrations were determined with Bio-Rad (USA) Protein Assay Dye Reagent using BSA as a standard. For immunoprecipitation experiments, protein extracts (100 μg) were pre-incubated for 1 h at 4°C on a rotating platform with 5 μl of 50% (v/v) protein A–Sepharose (Amersham Biosciences). After centrifugation, the supernatants were incubated for 2 h at 4°C with 4 μg of Nicta; CDKB1-specific antibody (Sorrell et al. 2001), and then for 2 h with 40 μl of 50% (v/v) protein A–Sepharose beads. The immunoprecipitates were washed three times with bead buffer [50 mM Tris–HCl, pH 7.5, 5 mM NaF, 250 mM NaCl, 0.1% (w/w) NP-40, 0.1 mM Na3VO4, 5 mM EDTA and 5 mM EGTA, pH 8.0] containing 10 μg μl−1 leupeptin, 0.1 mM benzamidine and 10 μg μl−1 aprotinin, and once with kinase buffer (25 mM HEPES-NaOH, pH 7.5, 10 mM magnesium acetate). Binding of p13suc1 was achieved by adding 20 ml of 50% (v/v) p13suc1–agarose beads (Upstate) to the protein extracts for 2 h at 4°C. Kinase assays were performed on proteins immobilized on protein A–Sepharose beads or p13suc1–agarose beads (Harashima et al. 2007). The reaction was initiated by adding 10 μl of kinase buffer containing 2 μg of histone H1 (Calbiochem) as a substrate, 0.01 mM ATP and 370 kBq of [γ-32P]ATP (Amersham). After incubation for 30 min at 30°C, the reaction was stopped by the addition of sample buffer for SDS–PAGE, boiled for 5 min, and loaded onto a 10% polyacrylamide gel. Phosphorylated proteins were detected with a Typhoon 9210 (Amersham-Pharmacia Biotech). Western blotting Proteins were separated by 10% SDS–PAGE and blotted onto nitrocellulose membrane. Blots were blocked overnight in Tris-buffered saline (TBS) with 5% milk at 4°C. CDKA- and CDKB1-specific antibodies (Sorrell et al. 2001) were diluted 1 : 2,000 in TBS, Triton X (0.05%) and incubated for at least 1 h at room temperature. Antigen–antibody complexes were detected using horseradish peroxidase-conjugated protein A diluted 1 : 2,000 (Amersham) with a chemiluminescence system (Amersham-Pharmacia Biotech). Cell death assay A 1 ml aliquot of the cell suspension was incubated with 0.05% Evans blue (Sigma) for 15 min and then washed to remove unabsorbed dye. The selective staining of dead cells with Evans blue depends upon extrusion of the dye from living cells via the intact plasma membrane. The dye passes through the damaged membrane of dead cells and accumulates as a blue protoplasmic stain (Turner and Novacky 1974). Dye that had been absorbed by dead cells was extracted in 50% methanol with 1% SDS for 1 h at 60°C and quantified by absorbance at 595 nm. We also measured the fresh weight by using 10 ml of the same culture, and the value measured by Evans blue was divided by the fresh weight to average the cell volume. Observation of CYCB2;2–GFP fusion protein Transgenic BY-2 cells expressing CYCB2;2–GFP were generated as described previously (Lee et al. 2003). In order to overexpress CYCB2;2–GFP, β-estradiol (1 μM) was applied to activate the inducible promoter during cell cycle synchronization with aphidicolin (Zuo et al. 2000). After release from the aphidicolin block, β-estradiol was added to the culture again. A drop of cell suspension was transferred on a slide, carefully covered with a coverslip and observed with an upright fluorescence microscope (Zeiss). Fluorescent intensities were quantified from each picture by using the measure function in the ‘analyze’ tool palette in ImageJ (http://rsb.info.nih.gov/ij/). Intensity values were collected from in focus cells using the polygon selection tool. Funding This work was supported the Japan Society for the Promotion of Science [Grant-in-Aid for the Research for the Future Program and Scientific Research to K.K.]; Ministry of Education, Science, Culture, Sports, and Technology, Japan [Grants-in-Aid for Scientific Research in Priority Areas (No. 13039015 and No. 17051027) to K.K.]; the Japan Society for the Promotion of Science [Scientific Research Grant (No. 06801) to Y.K.]. Acknowledgments The authors thank Dr. Masaki Ito for generous gifts of cDNA clones for NtmybA2 and NtmybB, Professor Jean-Claude Pernollet for providing us with the cryptogein gene, and Dr. Shinya Takahashi for critical reading of the manuscript. Abbreviations Abbreviations BSA bovine serum albumin BY-2 Bright Yellow-2 CAK CDK-activating kinase CDK cyclin-dependent kinase GFP green fluorescent protein MSA M-specific activator PCD programmed cell death RACE rapid amplification of cDNA ends TBS Tris-buffered saline References Adachi S,  Uchimiya H,  Umeda M.  Expression of B2-type cyclin-dependent kinase is controlled by protein degradation in Arabidopsis thaliana,  Plant Cell Physiol. ,  2006, vol.  47 (pg.  1683- 1686) Google Scholar CrossRef Search ADS PubMed  Arabidopsis Genome Initiative Analysis of the genome sequence of the flowering plant Arabidopsis thaliana,  Nature ,  2000, vol.  408 (pg.  796- 815) CrossRef Search ADS PubMed  Araki S,  Ito M,  Soyano T,  Nishihama R,  Machida Y.  Mitotic cyclins stimulate the activity of c-Myb-like factors for transactivation of G2/M phase-specific genes in tobacco,  J. Biol. Chem. ,  2004, vol.  279 (pg.  32979- 32988) Google Scholar CrossRef Search ADS PubMed  Berry L,  Gould KL.  Meijer L,  Guidet S,  Vogel L.  Regulation of Cdc2 activity by phosphorylation at T14/Y15,  Progression in Cell Cycle Research ,  1996, vol.  Vol. 2  New York Plenum Press(pg.  99- 105) Binet M,  Humbert C,  Lecourieux D,  Vantard M,  Pugin A.  Disruption of microtubular cytoskeleton induced by cryptogein, an elicitor of hypersensitive response in tobacco cells,  Plant Physiol. ,  2001, vol.  125 (pg.  564- 572) Google Scholar CrossRef Search ADS PubMed  Dahan J,  Etienne P,  Petitot A,  Houot V,  Blein J,  Suty L.  Cryptogein affects expression of alpha3, alpha6 and beta1 20S proteasome subunits encoding genes in tobacco,  J. Exp. Bot. ,  2001, vol.  56 (pg.  1947- 1948) Google Scholar CrossRef Search ADS   De Schutter K,  Joubes J,  Cools T,  Verkest A,  Corellou F,  Babiychuk E, et al.  Arabidopsis WEE1 kinase controls cell cycle arrest in response to activation of the DNA integrity checkpoint,  Plant Cell ,  2007, vol.  19 (pg.  211- 225) Google Scholar CrossRef Search ADS PubMed  Dewitte W,  Murray J.  The plant cell cycle,  Annu. Rev. Plant Biol. ,  2003, vol.  54 (pg.  235- 264) Google Scholar CrossRef Search ADS PubMed  Dunphy WG.  The decision to enter mitosis,  Trends Cell Biol. ,  1994, vol.  4 (pg.  202- 207) Google Scholar CrossRef Search ADS PubMed  Etienne P,  Petitot A,  Houot V,  Blein J,  Suty L.  Induction of tcI 7, a gene encoding a beta-subunit of proteasome, in tobacco plants treated with elicitins, salicylic acid or hydrogen peroxide,  FEBS Lett. ,  2000, vol.  466 (pg.  213- 218) Google Scholar CrossRef Search ADS PubMed  Featherstone C,  Russell P.  Fission yeast p107 wee1 mitotic inhibitor is a tyrosine/serine kinase,  Nature ,  1991, vol.  28 (pg.  808- 811) Google Scholar CrossRef Search ADS   Genschik P,  Criqui M,  Parmentier Y,  Derevier A,  Fleck J.  Cell cycle-dependent proteolysis in plants. Identification of the destruction box pathway and metaphase arrest produced by the proteasome inhibitor MG132,  Plant Cell ,  1998, vol.  10 (pg.  2063- 2076) Google Scholar PubMed  Giménez-Abián JF,  Weingartner M,  Binarova P,  Clarke DJ,  Anthony RG,  Calderini O, et al.  A topoisomerase II-dependent checkpoint in G2-phase plant cells can be bypassed by ectopic expression of mitotic cyclin B2,  Cell Cycle ,  2002, vol.  1 (pg.  187- 192) Google Scholar CrossRef Search ADS PubMed  Gómez-Gómez L,  Felix G,  Boller T.  A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana,  Plant J. ,  1999, vol.  18 (pg.  277- 284) Google Scholar CrossRef Search ADS PubMed  Gonzalez N,  Hernould M,  Delmas F,  Gevaudant F,  Duffe P,  Causse M, et al.  Molecular characterization of a WEE1 gene homologue in tomato (Lycopersicon esculentum Mill.),  Plant Mol. Biol. ,  2004, vol.  56 (pg.  849- 861) Google Scholar CrossRef Search ADS PubMed  Harashima H,  Shinmyo A,  Sekine M.  Phosphorylation of threonine 161 in plant cyclin-dependent kinase A is required for cell division by activation of its associated kinase,  Plant J. ,  2007, vol.  52 (pg.  435- 448) Google Scholar CrossRef Search ADS PubMed  Hata S.  cDNA cloning of a novel cdc2+/CDC28-related protein kinase from rice,  FEBS Lett. ,  1991, vol.  279 (pg.  149- 152) Google Scholar CrossRef Search ADS PubMed  Higaki T,  Goh T,  Hayashi T,  Kutsuna N,  Kadota Y,  Hasezawa S, et al.  Elicitor-induced cytoskeletal rearrangement relates to vacuolar dynamics and execution of cell death: in vivo imaging of hypersensitive cell death in tobacco BY-2 cells,  Plant Cell Physiol. ,  2007, vol.  48 (pg.  1414- 1425) Google Scholar CrossRef Search ADS PubMed  Ito M,  Araki S,  Matsunaga S,  Itoh T,  Nishihama R,  Machida Y, et al.  G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors,  Plant Cell ,  2001, vol.  13 (pg.  1891- 1905) Google Scholar CrossRef Search ADS PubMed  Ito M,  Iwase M,  Kodama H,  Lavisse P,  Komamine A,  Nishihama R, et al.  A novel cis-acting element in promoters of plant B-type cyclin genes activates M phase-specific transcription,  Plant Cell ,  1998, vol.  10 (pg.  331- 341) Google Scholar PubMed  Ito M,  Marie-Claire C,  Sakabe M,  Ohno T,  Hata S,  Kouchi H, et al.  Cell-cycle-regulated transcription of A- and B-type plant cyclin genes in synchronous cultures,  Plant J. ,  1997, vol.  11 (pg.  983- 992) Google Scholar CrossRef Search ADS PubMed  Jasinski S,  Riou-Khamlichi C,  Roche O,  Perennes C,  Bergounioux C,  Glab N.  The CDK inhibitor NtKIS1a is involved in plant development, endoreduplication and restores normal development of cyclin D3; 1-overexpressing plants,  J. Cell Sci. ,  2002, vol.  115 (pg.  973- 982) Google Scholar PubMed  Jin P,  Gu Y,  Morgan DO.  Role of inhibitory CDC2 phosphorylation in radiation induced G2 arrest in human cells,  J. Cell Biol. ,  1996, vol.  134 (pg.  963- 970) Google Scholar CrossRef Search ADS PubMed  John P,  Mews M,  Moore R.  Cyclin/Cdk complexes: their involvement in cell cycle progression and mitotic division,  Protoplasma ,  2001, vol.  216 (pg.  119- 142) Google Scholar CrossRef Search ADS PubMed  Kadota Y,  Furuichi T,  Ogasawara Y,  Goh T,  Higashi K,  Muto S, et al.  Identification of putative voltage-dependent Ca2+-permeable channels involved in cryptogein-induced Ca2+ transients and defense responses in tobacco BY-2 cells,  Biochem. Biophys. Res. Commun. ,  2004, vol.  317 (pg.  823- 830) Google Scholar CrossRef Search ADS PubMed  Kadota Y,  Kuchitsu K.  Nagata T,  Matsuoka K,  Inze D.  Regulation of elicitor-induced defense responses by Ca2+ channels and cell cycle in tobacco BY-2 cells,  Tobacco BY-2 Cells: From Cellular Dynamics to Omics. Biotechnology in Agriculture and Forestry ,  2006, vol.  Vol. 58  Berlin Springer(pg.  207- 221) Kadota Y,  Watanabe T,  Fujii S,  Higashi K,  Sano T,  Nagata T, et al.  Crosstalk between elicitor-induced cell death and cell cycle regulation in tobacco BY-2 cells,  Plant J. ,  2004, vol.  40 (pg.  131- 142) Google Scholar CrossRef Search ADS PubMed  Kadota Y,  Watanabe T,  Fujii S,  Maeda Y,  Ohno R,  Higashi K, et al.  Cell cycle dependence of elicitor-induced signal transduction in tobacco BY-2 cells,  Plant Cell Physiol. ,  2005, vol.  46 (pg.  156- 165) Google Scholar CrossRef Search ADS PubMed  Kaldis P.  The cdk-activating kinase (CAK): from yeast to mammals,  Cell Mol. Life Sci. ,  1999, vol.  55 (pg.  284- 296) Google Scholar CrossRef Search ADS PubMed  Kumagai A,  Dunphy WG.  The cdc25 protein contains an intrinsic phosphatase activity,  Cell ,  1991, vol.  67 (pg.  189- 196) Google Scholar CrossRef Search ADS PubMed  Lee J,  Das A,  Yamaguchi M,  Hashimoto J,  Tsutsumi N,  Uchimiya H, et al.  Cell cycle function of a rice B2-type cyclin interacting with a B-type cyclin-dependent kinase,  Plant J. ,  2003, vol.  34 (pg.  417- 425) Google Scholar CrossRef Search ADS PubMed  Longmann E,  Wu SC,  Schroder E,  Somssich IE,  Hahlbrock K.  Gene activation by UV light, fungal elicitor or fungal infection in Petroselinum crispum is correlated with repression of cell cycle related genes,  Plant J. ,  1995, vol.  8 (pg.  865- 876) Google Scholar CrossRef Search ADS PubMed  May M,  Vernoux T,  Leaver C,  Van Montagu M,  Inze D.  Glutathione homeostasis in plants: implications for environmental sensing and plant development,  J. Exp. Bot. ,  1998, vol.  49 (pg.  649- 667) Minami E,  Kuchitsu K,  He D-Y,  Kouchi H,  Midoh N,  Ohtsuki Y, et al.  Two novel genes rapidly and transiently activated in suspension-cultured rice cells by treatment with N-acetylchitoheptaose, a biotic elicitor for phytoalexin production,  Plant Cell Physiol. ,  1996, vol.  37 (pg.  563- 567) Google Scholar CrossRef Search ADS PubMed  Mironov V,  De Veylder L,  Van Montagu M,  Inze D.  Cyclin-dependent kinases and cell division in plants—the nexus,  Plant Cell ,  1999, vol.  11 (pg.  509- 522) Google Scholar PubMed  Morgan DO.  Cyclin-dependent kinases: engines, clocks, and microprocessors,  Annu. Rev. Cell Dev. Biol. ,  1997, vol.  13 (pg.  261- 291) Google Scholar CrossRef Search ADS PubMed  Nagata T,  Nemoto Y,  Hasezawa S.  Tobacco BY-2 cell line as the ‘HeLa’ cell in the cell biology of higher plants,  Int. Rev. Cytol. ,  1992, vol.  132 (pg.  1- 30) Nurse P.  Universal control mechanism regulating onset of M-phase,  Nature ,  1990, vol.  344 (pg.  503- 508) Google Scholar CrossRef Search ADS PubMed  O'Connell M,  Raleigh J,  Verkade H,  Nurse P.  Chk1 is a wee1 kinase in the G2 DNA damage checkpoint inhibiting cdc2 by Y15 phosphorylation,  EMBO J. ,  1997, vol.  16 (pg.  545- 554) Google Scholar CrossRef Search ADS PubMed  O'Connor P,  Ferris D,  Pagano M,  Draetta G,  Pines J,  Hunter T, et al.  G2 delay induced by nitrogen mustard in human cells affects cyclin A/cdk2 and cyclin B1/cdc2 kinase complexes differently,  J. Biol. Chem. ,  1993, vol.  268 (pg.  8298- 8308) Google Scholar PubMed  O'Donohue M,  Boissy G,  Huet J,  Nespoulous C,  Brunie S,  Pernollet J.  Overexpression in Pichia pastoris and crystallization of an elicitor protein secreted by the phytopathogenic fungus, Phytophthora cryptogea,  Protein Expr. Purif. ,  1996, vol.  8 (pg.  254- 261) Google Scholar CrossRef Search ADS PubMed  O'Donohue M,  Gousseau H,  Huet J,  Tepfer D,  Pernollet JC.  Chemical synthesis, expression and mutagenesis of a gene encoding beta-cryptogein, an elicitin produced by Phytophthora cryptogea,  Plant Mol. Biol. ,  1995, vol.  27 (pg.  577- 586) Google Scholar CrossRef Search ADS PubMed  Peres A,  Churchman ML,  Hariharan S,  Himanen K,  Verkest A,  Vandepoele K, et al.  Novel plant-specific cyclin-dependent kinase inhibitors induced by biotic and abiotic stresses,  J. Biol. Chem. ,  2007, vol.  282 (pg.  25588- 25596) Google Scholar CrossRef Search ADS PubMed  Petitot A,  Blein J,  Pugin A,  Suty L.  Cloning of two plant cDNAs encoding a beta-type proteasome subunit and a transformer-2-like SR-related protein: early induction of the corresponding genes in tobacco cells treated with cryptogein,  Plant Mol. Biol. ,  1997, vol.  35 (pg.  261- 269) Google Scholar CrossRef Search ADS PubMed  Reichheld J-P,  Vernoux T,  Lardon F,  Montagu MV,  Inze D.  Specific checkpoints regulate plant cell cycle progression in response to oxidative stress,  Plant J. ,  1999, vol.  17 (pg.  647- 656) Google Scholar CrossRef Search ADS   Ricci P,  Bonnet P,  Huet J,  Sallantin M,  Beauvais-Cante F,  Bruneteau M, et al.  Structure and activity of proteins from pathogenic fungi Phytophthora eliciting necrosis and acquired resistance in tobacco,  Eur. J. Biochem. ,  1989, vol.  183 (pg.  555- 563) Google Scholar CrossRef Search ADS PubMed  Sano T,  Higaki T,  Handa K,  Kadota Y,  Kuchitsu K,  Hasezawa S, et al.  Calcium ions are involved in the delay of plant cell cycle progression by abiotic stresses,  FEBS Lett. ,  2006, vol.  580 (pg.  597- 602) Google Scholar CrossRef Search ADS PubMed  Shimotohno A,  Matsubayashi S,  Yamaguchi M,  Uchimiya H,  Umeda M.  Differential phosphorylation activities of CDK-activating kinases in Arabidopsis thaliana,  FEBS Lett. ,  2003, vol.  534 (pg.  69- 74) Google Scholar CrossRef Search ADS PubMed  Shimotohno A,  Ohno R,  Bisova K,  Sakaguchi N,  Huang J,  Koncz C, et al.  Diverse phosphoregulatory mechanisms controlling cyclin-dependent kinase-activating kinases in Arabidopsis,  Plant J. ,  2006, vol.  47 (pg.  701- 710) Google Scholar CrossRef Search ADS PubMed  Sorrell D,  Menges M,  Healy J,  Deveaux Y,  Amano C,  Su Y, et al.  Cell cycle regulation of cyclin-dependent kinases in tobacco cultivar Bright Yellow-2 cells,  Plant Physiol. ,  2001, vol.  126 (pg.  1214- 1223) Google Scholar CrossRef Search ADS PubMed  Suzuki K,  Nishiuchi T,  Nakayama Y,  Ito M,  Shinshi H.  Elicitor-induced down-regulation of cell cycle-related genes in tobacco cells,  Plant Cell Environ. ,  2006, vol.  29 (pg.  183- 191) Google Scholar CrossRef Search ADS PubMed  Turner J,  Novacky A.  The quantitative relation between plant and bacterial cells involved in the hypersensitive reaction,  Phytopathology ,  1974, vol.  64 (pg.  885- 890) Google Scholar CrossRef Search ADS   Umeda M,  Bhalerao RP,  Schell J,  Uchimiya H,  Koncz C.  A distinct cyclin-dependent kinase-activating kinase of Arabidopsis thaliana,  Proc. Natl Acad. Sci. USA ,  1998, vol.  95 (pg.  5021- 5026) Google Scholar CrossRef Search ADS   Umeda M,  Shimotohno A,  Yamaguchi M.  Control of cell division and transcription by cyclin-dependent kinase-activating kinases in plants,  Plant Cell Physiol. ,  2005, vol.  46 (pg.  1437- 1442) Google Scholar CrossRef Search ADS PubMed  van Vugt M,  Bras A,  Medema RH.  Restarting the cell cycle when the checkpoint comes to a halt,  Cancer Res. ,  2005, vol.  65 (pg.  7037- 7040) Google Scholar CrossRef Search ADS PubMed  Vousden K,  Lu X.  Live or let die: the cell's response to p53,  Nat. Rev. Cancer ,  2002, vol.  2 (pg.  594- 604) Google Scholar CrossRef Search ADS PubMed  Xiong Y,  Hannon G,  Zhang H,  Casso D,  Kobayashi R,  Beach D.  p21 is a universal inhibitor of cyclin kinases,  Nature ,  1993, vol.  366 (pg.  701- 704) Google Scholar CrossRef Search ADS PubMed  Yoshiyama K,  Conklin PA,  Huefner ND,  Britt AB.  Suppressor of gamma response 1 (SOG1) encodes a putative transcription factor governing multiple responses to DNA damage,  Proc. Natl Acad Sci. USA ,  2009, vol.  106 (pg.  12843- 12848) Google Scholar CrossRef Search ADS   Zeng LR,  Vega-Sánchez ME,  Zhu T,  Wang GL.  Ubiquitination-mediated protein degradation and modification: an emerging theme in plant–microbe interactions,  Cell Res. ,  2006, vol.  16 (pg.  413- 426) Google Scholar CrossRef Search ADS PubMed  Zuo J,  Niu Q,  Chua N.  Technical advance: an estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants,  Plant J. ,  2000, vol.  24 (pg.  265- 273) Google Scholar CrossRef Search ADS PubMed  © The Author 2011. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com
TI - Cryptogein-Induced Cell Cycle Arrest at G2 Phase is Associated with Inhibition of Cyclin-Dependent Kinases, Suppression of Expression of Cell Cycle-Related Genes and Protein Degradation in Synchronized Tobacco BY-2 Cells
JF - Plant and Cell Physiology
DO - 10.1093/pcp/pcr042
DA - 2011-05-10
UR - https://www.deepdyve.com/lp/oxford-university-press/cryptogein-induced-cell-cycle-arrest-at-g2-phase-is-associated-with-zOh0uvzcdL
SP - 922
EP - 932
VL - 52
IS - 5
DP - DeepDyve
ER -