TY - JOUR
AU - Buschbeck, Elke, K
AB - Synopsis A key innovation for high resolution eyes is a sophisticated lens that precisely focuses light onto photoreceptors. The eyes of holometabolous larvae range from very simple eyes that merely detect light to eyes that are capable of high spatial resolution. Particularly interesting are the bifocal lenses of Thermonectus marmoratus larvae, which differentially focus light on spectrally-distinct retinas. While functional aspects of insect lenses have been relatively well studied, little work has explored their molecular makeup, especially in regard to more complex eye types. To investigate this question, we took a transcriptomic and proteomic approach to identify the major proteins contributing to the principal bifocal lenses of T. marmoratus larvae. Mass spectrometry revealed 10 major lens proteins. Six of these share sequence homology with cuticular proteins, a large class of proteins that are also major components of corneal lenses from adult compound eyes of Drosophila melanogaster and Anopheles gambiae. Two proteins were identified as house-keeping genes and the final two lack any sequence homologies to known genes. Overall the composition seems to follow a pattern of co-opting transparent and optically dense proteins, similar to what has been described for other animal lenses. To identify cells responsible for the secretion of specific lens proteins, we performed in situ hybridization studies and found some expression differences between distal and proximal corneagenous cells. Since the distal cells likely give rise to the periphery and the proximal cells to the center of the lens, our findings highlight a possible mechanism for establishing structural differences that are in line with the bifocal nature of these lenses. A better understanding of lens composition provides insights into the evolution of proper focusing, which is an important step in the transition between low-resolution and high-resolution eyes. Introduction The evolution of lens formation goes back to the Cambrian explosion, an event that led to extensive phenotypic innovations, including the formation of different eye types. The formation of lenses is an important innovation in the evolution of high resolution eyes from simple ancestors (Nilsson 2009), allowing an increase in resolution and light sensitivity that is not possible for lensless eyes (Nilsson and Pelger 1994). Key attributes of lenses are their ability to refract light, and the ability to resist light damage (Dejong et al. 1989). Previous studies have suggested that many lens proteins are not unique to this tissue, but rather, are co-opted from other networks to serve a new function (Chiou 1984; Horwitz 1992; Piatigorsky 1998). Although evidence of such co-option exists within vertebrates and a few invertebrates (reviewed by Tomarev and Piatigorsky 1996), there is little information about the proteomic architecture of insect lenses generally, and especially of those that are part of highly sophisticated eyes. To address this question, we here examine the optically sophisticated lenses of the larval eyes of Thermonectus marmoratus. Thermonectus marmoratus larvae are effective visual predators, and their principal eyes are composed of multiple layers of photoreceptors, the function of which relies on a highly specialized bifocal lens that forms images on multiple retinas (Stowasser et al. 2010). These larvae contain a total of six eyes on each side of the head (Fig. 1A, B), with two elongated principal eyes (Fig. 1C), which have high levels of spatial resolution in the horizontal plane (Mandapaka et al. 2006), but only two rows of photoreceptors in the vertical plane. Therefore, to sample the environment vertically, larvae must perform a series of scanning movements (Buschbeck et al. 2007). Thermonectus marmoratus utilize their eyes to successfully guide a striking attack on their aquatic prey, such as mosquito larvae. The striking distance can be determined unilaterally (Bland et al. 2014), presumably based on where images are focused on the many layers of photoreceptors (Stowasser and Buschbeck 2014). Such function requires precise coordination of multiple tissues, but how this is achieved developmentally remains unclear. Fig. 1 Open in new tabDownload slide (A) The larvae of the sunburst diving beetle (Thermonectus marmoratus) are visually guided predators with six eyes on each side of the head, two of which are especially prominent. (B) A three-dimensional reconstruction of a principal eye showing its major components. They include corneagenous cells and the distal (DR) and proximal retinas (PR) (striped portions represent rhabdomes). The latter is fan-shaped, so that only two photoreceptor cells are visible in sagittal sections (C). The bifocal lens is needed to properly focus images on each retina. (C) A histological section of one of the principal eyes shows the cellular components of the four (two/side) principal larval eyes. (D) A schematic illustration of a sagittal section further illustrates its cellular composition. Note that the extracellular lens is positioned on top of the transparent portions of the corneagenous cells, which are known to be the source of lens secretion during development (Stecher et al. 2016). These cells are organized so that distal corneagenous cells (DCCs; see example cell in blue) underlie the lens’ periphery, whereas proximal corneagenous cells (PCCs; see example cell in purple) are in contact with the center of the lens. (E) Evidence suggests that each of the T. marmoratus eyes has evolved from a compound-eye ommatidial like ancestor (after Buschbeck 2014). Fig. 1 Open in new tabDownload slide (A) The larvae of the sunburst diving beetle (Thermonectus marmoratus) are visually guided predators with six eyes on each side of the head, two of which are especially prominent. (B) A three-dimensional reconstruction of a principal eye showing its major components. They include corneagenous cells and the distal (DR) and proximal retinas (PR) (striped portions represent rhabdomes). The latter is fan-shaped, so that only two photoreceptor cells are visible in sagittal sections (C). The bifocal lens is needed to properly focus images on each retina. (C) A histological section of one of the principal eyes shows the cellular components of the four (two/side) principal larval eyes. (D) A schematic illustration of a sagittal section further illustrates its cellular composition. Note that the extracellular lens is positioned on top of the transparent portions of the corneagenous cells, which are known to be the source of lens secretion during development (Stecher et al. 2016). These cells are organized so that distal corneagenous cells (DCCs; see example cell in blue) underlie the lens’ periphery, whereas proximal corneagenous cells (PCCs; see example cell in purple) are in contact with the center of the lens. (E) Evidence suggests that each of the T. marmoratus eyes has evolved from a compound-eye ommatidial like ancestor (after Buschbeck 2014). Thus far, morphological analysis of T. marmoratus embryonic development (Stecher et al. 2016) suggests that the bifocal lenses of the principal eyes are secreted by corneagenous cells. The cell bodies of these cells separate the lenses from photoreceptors. Corneagenous cells are organized so that clear portions contribute to the center of each eye tube, separating the extracellular lens from the retina similar to the vitreous of the human eye. Pigment-rich portions and nuclei are at the periphery (Fig. 1D). The secretion of T. marmoratus lenses begins with the exocytosis of vesicles from corneagenous cells (Stecher et al. 2016). In the early stages, these cells are clustered near the distal end of the elongating eye. Near the end of embryonic development, the corneagenous cells have aligned along the tube so that the cells that make up the center of the transparent eye tube have their nuclei positioned relatively proximally near the perimeter, while the nuclei of cells that make up the more peripheral portions are situated more distally. The eye schematic in Fig. 1D illustrates one such proximal (purple) and distal (blue) cell. Thus, the cellular organization is laid out so that distinct cell populations potentially could differentially contribute to separate portions of the lens, which then could facilitate refractive differences within the lens. Such differences in corneagenous cells are interesting, both from an optical and an evolutionary perspective. Optically, for example, measurements suggest that refractive differences exist between the center and the periphery of T. marmoratus lenses (Stowasser et al. 2010). Evolutionarily, T. marmoratus’s bifocality could have arisen from a pre-existing developmental organization that also exists in compound eye ommatidia. This model is based on comparative studies suggesting that larval eyes (stemmata) in holometabolic insects like T. marmoratus’s evolved from a compound eye ancestor (Paulus 1989; Liu and Friedrich 2004; Friedrich 2006; Fig. 1E). Thus, each of the larval beetle eyes could be considered a highly modified and derived ommatidium with a shared developmental origin (Buschbeck 2014). Although literature on lens formation and composition is sparse even for compound eyes, it is well-established in the holometabolic insect model Drosophila melanogaster that the corneagenous cells in adult compound eye consist of multiple cell types (Waddington and Perry 1960; Perry 1968; Cagan and Ready 1989; Stahl et al. 2017). Most notably, these are the centrally-located cone cells (also known as Semper cells) and the more peripherally located pigment cells (Waddington and Perry 1960; Perry 1968; Cagan and Ready 1989). Recent analysis of D. melanogaster adult corneal lenses indicated that they are comprised of four major proteins: drosocrystallin, retinin, Cpr66d, and Cpr72ec (Komori et al. 1992; Janssens and Gehring 1999; Kim et al. 2008; Stahl et al. 2017), and that the genes encoding these proteins are differentially expressed in these different subpopulations of lens-secreting cell types. In addition, three of the four D. melanogaster lens proteins are cuticular in nature, a finding that is similar to studies of compound eye lens composition from Anopheles gambiae (Zhou et al. 2016). Additional data from other arthropods is necessary to determine what commonalities exist in the distribution of lens proteins across this diverse family of animals. The functional complexity of the larval eyes of T. marmoratus renders their lenses particularly interesting. Methods Transcriptomic analysis Thermonectus marmoratus transcriptome data were generated from head tissue dissected from three developmental stages: 1st instar, late 3rd instar, and adult. Heads from 11 1st instars, 5 3rd instars, and 8 adults were each subjected to RNA extraction and isolated using the RNeasy Lipid Tissue Kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instructions. RNA was submitted to Eurofins (KY) for sequencing on an Illumina Hiseq 2000 platform (Illumina, CA, USA) which generated ∼25 million 50 bp single reads per each of three sequencing library. Raw reads were deposited to the NCBI Sequence Read Archive, accession number SRP107801. Sequences were assembled with SeqMan NGen (DNASTAR V. 12.0, Madison, WI, USA) under default assembly parameters to generate a single transcriptome from each developmental stage. This led to N50 contigs of 1567 bp (1st instar), 1570 bp (3rd instar), and 1587 bp (adult), each with an average contig coverage of 15, and an average number of sequences mapping back to each contig being ∼1600. An additional fourth de novo assembly was carried out using the 98,298 contigs created from the assembled three developmental transcriptomes to generate the longest possible open reading frames. A total of 19,890 contigs were assembled, with an N50 of 1821 bp. This combined assembly was used to create an amino acid library by translating the six possible frame shifts using OrfPredictor (Min et al. 2005) for protein identification in the mass spectrometry studies. Proteomic analysis Lens proteins were isolated from 40 acetone-fixed 3rd instar T. marmoratus larval primary eyes that were manually completely removed from the surrounding cuticle and remaining eye tissue. Proteins were extracted following protocols from Komori et al. (1992; Stahl et al. 2017). Lens proteins were solubilized in Laemmli buffer (BioRad), separated on a 10% SDS–PAGE gel, and stained with Coomassie Blue. Gels were then submitted to the University of Cincinnati Proteomics Core, where eight selected bands (Fig. 2) were excised from the gel, reduced and alkylated, digested with trypsin, and identified by MALDI-TOF/TOF and a MASCOT search. Results were evaluated against the head/eye open-reading frame protein library described above. Peptide fingerprints identified by this approach were matched back to the library to identify the proper coding strands from corresponding contigs. To identify full-length amino acid sequences of the lens proteins, rapid amplification of cDNA ends (RACE-PCR) was performed on each of the lens producing genes using the GeneRacer kit with SuperScript III and cloned into the TOPO PCR4 vector (Thermofisher, CA, USA). Full-length amino acid sequences were compared with the 218.0 release of Genbank using Blastp default parameters, as well as Blastx and Delta-blast parameters of Blastp (Altschul et al. 1990; Gish and States 1993; Boratyn et al. 2012). Fig. 2 Open in new tabDownload slide SDS–PAGE gel showing proteins extracted from T. marmoratus lenses and identified using mass spectrophotometry. Ten major proteins within eight bands were found. The left lane represents the molecular weight marker. The lens extract was loaded in two lanes on the right. Boxes indicate individual bands that were excised and subjected to a MALDI-TOF/TOF analysis. Fig. 2 Open in new tabDownload slide SDS–PAGE gel showing proteins extracted from T. marmoratus lenses and identified using mass spectrophotometry. Ten major proteins within eight bands were found. The left lane represents the molecular weight marker. The lens extract was loaded in two lanes on the right. Boxes indicate individual bands that were excised and subjected to a MALDI-TOF/TOF analysis. In situ hybridizations Total RNA from three 1st instar T. marmoratus heads was isolated using the RNeasy Lipid Tissue Kit (Qiagen) according to manufacturer’s instructions. cDNA was synthesized from 1 μg total RNA with Omniscript reverse transcriptase and oligo (dT) primers (Qiagen). Gene-specific cDNAs were subsequently generated in a PCR amplification using primers listed in Table 1 (35 cycles of 94 °C, 1 min; 60 °C, 1 min; 72 °C, 1 min). PCR products of correct sizes were purified using the Qiaquick PCR purification kit (Qiagen). RNA probes were generated following manufacturer’s instructions using the SP6/T7 DIG RNA Labeling Kit (Roche Applied Sciences, IN, USA). Antisense probes were generated for each of the 10 genes of interest using T7 antisense primers, and a control sense probe was generated using lens3-T7 sense primers (Table 1). Probes were precipitated with lithium chloride/ethanol overnight at −80 °C, and the pellet was resuspended in RNase-free ddH2O and quantified by spectrophotometry using a Nanodrop-1000 (ThermoFisher Scientific, MA, USA). In situ hybridizations were performed on first instar larvae following previously described protocols (Maksimovic et al. 2009). Signal was developed using an alkaline phosphatase enzymatic reaction (NBT/BCIP, Thermofisher Scientific). The development time for each of the lens genes was ∼1–5 h, while the sense control was developed for ∼15 h. Imaging was performed using an Olympus BX51 upright compound microscope (Olympus, Tokyo, Japan) with a Retiga 2000R camera (Qimaging, Surrey, Canada). The images were processed using Qcapturex64 (Qimaging). Table 1 Protein names and primer sequences utilized in in situ probe synthesis Protein number 5′-Primers 3′-Primers Tm-lens1 CCATGGCCTTAGTCATGGTT TAATACGACTCACTATAGGG AGAAGCATCGTCGTAAAGCTG Tm-lens2 ATTCGCCTACTCTGCTCCAA TAATACGACTCACTATAGGG CTGCTTGTCCCAAATGTTCC Tm-lens3 CCCAGATCACTCACCGAGTC TAATACGACTCACTATAGGG Sense control TTGGTTCTTCTATTTTCAGGATGA TAATACGACTCACTATAGGG Sense control CCCAGATCACTCACCGAGTC TTGGTTCTTCTATTTTCAGGATGA Tm-lens4 ATCATGCATTCGGGAATTGT TAATACGACTCACTATAGGG TGTCCAAGTGCGACTTCTTG Tm-lens5 CCTTATTGGCCGTAGCTCTG TAATACGACTCACTATAGGG ATGAGCAGCCTTAGCGTGAG Tm-lens6 CTGCTCCAGCCCTCTCTTAC TAATACGACTCACTATAGGGG CTAGCTCCCAGACCAGAGA Tm-lens7 GACCAAGGTTGGATGGAAGA TAATACGACTCACTATAGGGG TGAGTGTTCCCCATCCTGT Tm-lens8 CGCAAGTGCGGTAGATGATA TAATACGACTCACTATAGGG TGGGTAAGGTTGGGGTACTG Tm-lens9 TGTTGTTGTTTTCGCTTTGG TAATACGACTCACTATAGGG TCAGCAACTGCTTGATGAGC Tm-lens10 GCCAAGAAAGCGCAGATAGT TAATACGACTCACTATAGGG AATGACGGGATGGATACTGC Protein number 5′-Primers 3′-Primers Tm-lens1 CCATGGCCTTAGTCATGGTT TAATACGACTCACTATAGGG AGAAGCATCGTCGTAAAGCTG Tm-lens2 ATTCGCCTACTCTGCTCCAA TAATACGACTCACTATAGGG CTGCTTGTCCCAAATGTTCC Tm-lens3 CCCAGATCACTCACCGAGTC TAATACGACTCACTATAGGG Sense control TTGGTTCTTCTATTTTCAGGATGA TAATACGACTCACTATAGGG Sense control CCCAGATCACTCACCGAGTC TTGGTTCTTCTATTTTCAGGATGA Tm-lens4 ATCATGCATTCGGGAATTGT TAATACGACTCACTATAGGG TGTCCAAGTGCGACTTCTTG Tm-lens5 CCTTATTGGCCGTAGCTCTG TAATACGACTCACTATAGGG ATGAGCAGCCTTAGCGTGAG Tm-lens6 CTGCTCCAGCCCTCTCTTAC TAATACGACTCACTATAGGGG CTAGCTCCCAGACCAGAGA Tm-lens7 GACCAAGGTTGGATGGAAGA TAATACGACTCACTATAGGGG TGAGTGTTCCCCATCCTGT Tm-lens8 CGCAAGTGCGGTAGATGATA TAATACGACTCACTATAGGG TGGGTAAGGTTGGGGTACTG Tm-lens9 TGTTGTTGTTTTCGCTTTGG TAATACGACTCACTATAGGG TCAGCAACTGCTTGATGAGC Tm-lens10 GCCAAGAAAGCGCAGATAGT TAATACGACTCACTATAGGG AATGACGGGATGGATACTGC Table 1 Protein names and primer sequences utilized in in situ probe synthesis Protein number 5′-Primers 3′-Primers Tm-lens1 CCATGGCCTTAGTCATGGTT TAATACGACTCACTATAGGG AGAAGCATCGTCGTAAAGCTG Tm-lens2 ATTCGCCTACTCTGCTCCAA TAATACGACTCACTATAGGG CTGCTTGTCCCAAATGTTCC Tm-lens3 CCCAGATCACTCACCGAGTC TAATACGACTCACTATAGGG Sense control TTGGTTCTTCTATTTTCAGGATGA TAATACGACTCACTATAGGG Sense control CCCAGATCACTCACCGAGTC TTGGTTCTTCTATTTTCAGGATGA Tm-lens4 ATCATGCATTCGGGAATTGT TAATACGACTCACTATAGGG TGTCCAAGTGCGACTTCTTG Tm-lens5 CCTTATTGGCCGTAGCTCTG TAATACGACTCACTATAGGG ATGAGCAGCCTTAGCGTGAG Tm-lens6 CTGCTCCAGCCCTCTCTTAC TAATACGACTCACTATAGGGG CTAGCTCCCAGACCAGAGA Tm-lens7 GACCAAGGTTGGATGGAAGA TAATACGACTCACTATAGGGG TGAGTGTTCCCCATCCTGT Tm-lens8 CGCAAGTGCGGTAGATGATA TAATACGACTCACTATAGGG TGGGTAAGGTTGGGGTACTG Tm-lens9 TGTTGTTGTTTTCGCTTTGG TAATACGACTCACTATAGGG TCAGCAACTGCTTGATGAGC Tm-lens10 GCCAAGAAAGCGCAGATAGT TAATACGACTCACTATAGGG AATGACGGGATGGATACTGC Protein number 5′-Primers 3′-Primers Tm-lens1 CCATGGCCTTAGTCATGGTT TAATACGACTCACTATAGGG AGAAGCATCGTCGTAAAGCTG Tm-lens2 ATTCGCCTACTCTGCTCCAA TAATACGACTCACTATAGGG CTGCTTGTCCCAAATGTTCC Tm-lens3 CCCAGATCACTCACCGAGTC TAATACGACTCACTATAGGG Sense control TTGGTTCTTCTATTTTCAGGATGA TAATACGACTCACTATAGGG Sense control CCCAGATCACTCACCGAGTC TTGGTTCTTCTATTTTCAGGATGA Tm-lens4 ATCATGCATTCGGGAATTGT TAATACGACTCACTATAGGG TGTCCAAGTGCGACTTCTTG Tm-lens5 CCTTATTGGCCGTAGCTCTG TAATACGACTCACTATAGGG ATGAGCAGCCTTAGCGTGAG Tm-lens6 CTGCTCCAGCCCTCTCTTAC TAATACGACTCACTATAGGGG CTAGCTCCCAGACCAGAGA Tm-lens7 GACCAAGGTTGGATGGAAGA TAATACGACTCACTATAGGGG TGAGTGTTCCCCATCCTGT Tm-lens8 CGCAAGTGCGGTAGATGATA TAATACGACTCACTATAGGG TGGGTAAGGTTGGGGTACTG Tm-lens9 TGTTGTTGTTTTCGCTTTGG TAATACGACTCACTATAGGG TCAGCAACTGCTTGATGAGC Tm-lens10 GCCAAGAAAGCGCAGATAGT TAATACGACTCACTATAGGG AATGACGGGATGGATACTGC Results Generation of head transcriptomes from T. marmoratus As a new experimental system, sequence information was needed for identifying proteins present in T. marmoratus lenses. Toward this end, we performed RNAseq analysis from larval and adult head (including eye) tissue, and de novo transcriptomes generated from each developmental stage were merged to generate the longest possible open reading frames (see the “Methods” section for details). The combined transcriptome had 19,890 contigs, with an N50 of 1821 bp. A peptide library consisting of all six reading frames was subsequently used as a head/eye peptide library for lens protein identification. Bifocal lens protein identification Bifocal lenses from the principal eyes of T. marmoratus 3rd instar larvae were manually dissected, and solubilized proteins were separated by SDS–PAGE. This revealed two major bands with molecular weights ∼67 and ∼72 kDa, as well as six bands of lower intensity ranging from ∼22 to 225 kDa (Fig. 2). Each band was excised and subjected to a MALDI-TOF/TOF mass spectrometry analysis (Karas and Hillenkamp 1988). Using the head/eye peptide library from above, we performed peptide fingerprint analysis from the MALDI-TOF using MASCOT (Perkins et al. 1999). The peptide fingerprints identified the coding strand from each corresponding contig. Full-length cDNAs were generated using RACE PCR, and the open reading frame was confirmed to contain the peptides identified by mass spectrophotometry (red sequence, Supplementary Table S1). This analysis resulted in 10 proteins (Tm-lens1-10) that are likely key contributors to the refractive properties of the bifocal T. marmoratus lenses (see Supplementary Table S1 for Genbank accession numbers). Consistent with this possibility, transcripts for all identified lens proteins were present in both the 1st and 3rd instar head/eye transcriptomes. Six of the 10 proteins showed sequence homology with cuticular proteins via Blastp analysis (Altschul et al. 1990; Supplementary Table S1). Tm-lens3 was present in six of the eight bands, including the two prevalent Bands, four and five (Fig. 2A), suggesting that this protein is highly abundant and can form heteromeric complexes with other lens proteins. Using the cuticular protein predictor from Ioannidou et al. (2014), we identified Tm-lens3 as the only member of the RR-2 subfamily isolated from T. marmoratus lenses, based on the highly conserved Riebers and Riddiford consensus sequence (Rebers and Riddiford 1988). In contrast, Tm-lens10 shared similarity to the RR-1 cuticular subfamily (Ioannidou et al. 2014), and Tm-lens6, a peptide identified in Bands 5 and 8 (Fig. 2A), is a member of the Cuticular Protein Family (CPF; Andersen et al. 1997; Togawa et al. 2007). Two additional cuticular protein-related lens proteins (Tm-lens2 and Tm-lens5,) lacked known conserved domains, preventing further classification. Tm-lens8 shared strongest similarity with a skin secretory protein from the mountain pine beetle which shares homology with a vertebrate-related gene (Supplementary Table S1). It also shares some similarity with other transmembrane and cuticular-related lens proteins. Of the four non-cuticle-related proteins (Tm-lens1, Tm-lens4, Tm-lens7, and Tm-lens9), only Tm-lens7 shared significant sequence homology with proteins of other insects. Specifically, Tm-lens7 showed similarity to a trypsin-like serine protease protein, eupolytin, from the cockroach Eupolyphaga sinensis. Interestingly, trypsin-like serine proteases were previously isolated within the vitreous of human eyes, and are associated with crystallin lens autodegradation (Gupta et al. 2010; van Deemter et al. 2013). Another potential regulatory protein identified was Tm-lens9, a protein found within Bands 6 and 8 (Fig. 2A). One of the top 10 blast hits (Supplementary Table S1) shared sequence homology to a signal recognition particle docking protein that is instrumental for the translocation of secretory proteins through the endoplasmic reticulum (Rapiejko and Gilmore 1992). This proline-rich protein showed some relation to several proteins whereas the two final two proteins that we identified in this study, Tm-lens1 (Bands 1–3) and Tm-lens4 (Bands 2–3) showed no homology to previously reported gene products, leaving their function unknown. Cell-selective expression patterns within the large tubular principal eyes of T. marmoratus To identify which cells in the principal larval eyes of T. marmoratus express the different Tm-Lens encoding genes, we performed in situ hybridization studies. This confirmed that all 10 genes were expressed within the corneagenous cells (Figs. 3–5), which were previously identified as the source of lens secretion (Stecher et al. 2016). Staining is illustrated for centrally located sagittal sections to allow visualization of dorsally and ventrally positioned corneagenous cells as well as photoreceptor cells. For each lens protein-encoding gene, comparable staining was observed in more medial and lateral sections, suggesting even expression around the outer region of entire eye-tubes. In many cases, staining also was observed inside the lens. However, for the following reasons it is unlikely that this lens staining relates to the specific lens proteins, but rather represents an artifact. First, the lenses are extracellular structures, so the RNA would need to be translocated from the corneagenous cells to this extracellular area. Secondly, it has been previously noted that in situ labeling can lead to artificial staining of cuticle (Fechtel et al. 1989; Vannini et al. 2014). Consistent with this, in another project in the laboratory, we observed similar lens (but not corneagenous cell) staining using completely unrelated in situ probes for the opsins (Maksimovic et al. 2009). All in situ hybridizations showed clear staining patterns when compared with the sense control (Fig. 3E), even when the enzymatic reaction was left for an extended time period for the latter (∼15 h instead of the ∼1–5 h that was used for the anti-sense staining; Fig. 3E). Note that at this extended time frame, artifactual staining of the distal retina (DR) is also apparent in the control staining. Fig. 3 Open in new tabDownload slide This figure illustrates in situ labeling of mRNAs for lens proteins that are expressed at similar levels in distal (DCC) and proximal (PCC) cone cells. For Tm-lens3 and Tm-lens1, staining is also observed in the transparent portions of the eye tube. (A) Schematic representation of the expression patterns of these lens protein-encoding genes. The striped shading indicates that some, but not all genes analyzed led to staining in that area. (B) Tm-lens3 in situ labeling is very prominent in the entire eye tube. (C) Tm-lens1 in situ labeling overlaps with that of Tm-lens3, but staining is less intense. (D) Tm-lens4 in situ labeling is also observed in distal and PCCs, but not within the core of the eye tube. (E) A sense control for Tm-lens3 shows light staining artifacts in the distal retina (DR) when stained overnight (∼15 h). Stainings for B–D were <5 h. Fig. 3 Open in new tabDownload slide This figure illustrates in situ labeling of mRNAs for lens proteins that are expressed at similar levels in distal (DCC) and proximal (PCC) cone cells. For Tm-lens3 and Tm-lens1, staining is also observed in the transparent portions of the eye tube. (A) Schematic representation of the expression patterns of these lens protein-encoding genes. The striped shading indicates that some, but not all genes analyzed led to staining in that area. (B) Tm-lens3 in situ labeling is very prominent in the entire eye tube. (C) Tm-lens1 in situ labeling overlaps with that of Tm-lens3, but staining is less intense. (D) Tm-lens4 in situ labeling is also observed in distal and PCCs, but not within the core of the eye tube. (E) A sense control for Tm-lens3 shows light staining artifacts in the distal retina (DR) when stained overnight (∼15 h). Stainings for B–D were <5 h. Fig. 4 Open in new tabDownload slide In situ labeling of mRNAs for lens proteins that are expressed exclusively or more strongly in the DCCs. (A) Schematic representation of the expression patterns of these lens genes. The striped shading indicates that some, but not all of the genes are expressed in that area. The darker distal areas indicate more intense staining. These genes have in common that they are most strongly expressed in the DCCs. (B) Tm-lens10 in situ labeling indicates expression only in the most DCCs. (C and D) Tm-lens8 in situ labeling can be more (C) or less (D) restricted to distal cells. (E) Tm-lens2 generally showed low levels of in situ labeling, but was most strongly detected in DCCs. Fig. 4 Open in new tabDownload slide In situ labeling of mRNAs for lens proteins that are expressed exclusively or more strongly in the DCCs. (A) Schematic representation of the expression patterns of these lens genes. The striped shading indicates that some, but not all of the genes are expressed in that area. The darker distal areas indicate more intense staining. These genes have in common that they are most strongly expressed in the DCCs. (B) Tm-lens10 in situ labeling indicates expression only in the most DCCs. (C and D) Tm-lens8 in situ labeling can be more (C) or less (D) restricted to distal cells. (E) Tm-lens2 generally showed low levels of in situ labeling, but was most strongly detected in DCCs. Fig. 5 Open in new tabDownload slide In situ labeling of mRNAs for lens proteins that are expressed in all corneagenous cells, but with slightly more extensive staining in the proximal (vs. distal) corneagenous cells. (A) Schematic representation of the expression patterns of Tm-lens5-7 and 9. The striped shading indicates that not all four genes are expressed in that area. (B) Tm-lens9 in situ labeling is visible in all corneagenous cells, with slightly more extensive staining in the proximal, relative to distal, corneagenous cells. (C) T.m-lens5 in situ labeling shows similar, but weaker staining patterns as Tm-lens9. (D) Tm-lens7 shows labeling in the center portion of the most PCCs. (E) Tm-lens6 in situ labeling is similar to Tm-lens7 but with additional staining in distal retinula cells. Fig. 5 Open in new tabDownload slide In situ labeling of mRNAs for lens proteins that are expressed in all corneagenous cells, but with slightly more extensive staining in the proximal (vs. distal) corneagenous cells. (A) Schematic representation of the expression patterns of Tm-lens5-7 and 9. The striped shading indicates that not all four genes are expressed in that area. (B) Tm-lens9 in situ labeling is visible in all corneagenous cells, with slightly more extensive staining in the proximal, relative to distal, corneagenous cells. (C) T.m-lens5 in situ labeling shows similar, but weaker staining patterns as Tm-lens9. (D) Tm-lens7 shows labeling in the center portion of the most PCCs. (E) Tm-lens6 in situ labeling is similar to Tm-lens7 but with additional staining in distal retinula cells. Figure 3 illustrates three lens protein encoding genes (Tm-lens1, 3, and 4) that are expressed throughout the entire population of corneagenous cells, with approximately similar levels of expression in distally and proximally located cells (Fig. 3A). Tm-lens3 appears to be the most abundant of these transcripts based on the rapid and strong development of staining localized only to corneagenous cells (Fig. 3B). Transcripts were not observed within the two layers of neuronal retinular tissue. We observed comparable levels of expression in distal and proximal corneagenous cells for Tm-lens1 (Fig. 3C) and Tm-lens4 (Fig. 3D), but the enzymatic reaction took longer to observe this expression. Tm-lens1 expression was also observed in the core portions of the eye tube whereas Tm-lens4 was restricted to the nuclei-rich periphery of the eye tube. In contrast to uniform expression, a subset of lens protein-encoding genes was expressed more strongly in, or restricted to, the distally positioned corneagenous cells relative to the proximal cells (Fig. 4A, Tm-lens2, 8, and 10). In the case of Tm-lens10, it primarily showed expression in the distally located corneagenous cells (Fig. 4B), with some expression reaching proximally. All staining for this gene was limited to the peripheral eye tube, near their nuclei. In some of our experiments, Tm-lens8 showed a similar staining pattern as Tm-lens10, except that staining extended further toward the center of the eye tube (Fig. 4C). In some preparations only the most distal cells show staining, whereas in other samples staining reached further proximally. In all cases proximal cells showed lighter staining than distal cells (Fig. 4D). Compared with Tm-lens8 and 10, Tm-lens2 showed the weakest expression. Finally, a subset of lens protein-encoding genes showed expression in distal and proximal corneagenous cells, with additional weak expression in the proximal portions of the core of the eye tube (Fig. 5A). Four genes showed this general pattern of gene expression: Tm-lens5-7 and Tm-lens9. Staining differences between the distal and the proximal region were subtle, but consistent. Note that in each case, staining of the proximal corneagenous cells extended into the eye tube, whereas staining of the distal cells was restricted to more peripheral regions (Fig. 5B–E). Among these transcripts, Tm-lens9 staining led to the strongest enzymatic response, possibly indicating higher levels of gene expression (Fig. 5B). Staining requiring longer developing times suggested that Tm-lens5 (Fig. 5C) and Tm-lens7 (Fig. 5D) were expressed at lower levels. Longer developing times also resulted in higher levels of background staining, making it difficult to determine whether the retinal labeling of these genes was specific. However, such expression was clear for Tm-lens 6 (Fig. 4E), indicating that at least one of the protein-encoding genes described here is expressed in both corneagenous and DR cells. Discussion Animal eyes, especially those of invertebrates, are functionally diverse, yet often include a corneal lens that allows them to precisely focus light on their photoreceptors (Land and Nilsson 2012). Little is known about how refractive power is established and regulated at the molecular level, in part because comparative genetic and behavioral data are largely unavailable. In this study, we explored how the sophisticated lens of a non-model system is constructed by performing transcriptome analysis coupled with mass spectrometry. Specifically, we identified the proteins present in the only extant bifocal lens found in nature (Stowasser et al. 2010), that of larval diving beetles, T. marmoratus. In situ studies confirmed that the genes encoding these proteins were specifically expressed in several subsets of corneagenous cells that lie in close proximity to the lens and have previously been described to secrete the lens (Stecher et al. 2016). The proteinaceous makeup of T. marmoratus lenses Relatively little is known about lens composition in arthropods, but some data exist for the adult corneal lenses of two dipteran species, A. gambiae (Komori et al. 1992; Vannini et al. 2014; Zhou et al. 2016) and D. melanogaster (Cagan and Ready 1989; Komori et al. 1992; Kim et al. 2008; Stahl et al. 2017). These data indicate that cuticular proteins are an important component of these lenses. Our data corroborate these findings, as >50% of the proteins present in the lenses of T. marmoratus larvae share homology with cuticular proteins. Moreover, we find that the most abundant contributor to Thermonectus larval lenses, Tm-lens3, is a member of the RR-2 family of cuticular proteins, similar to three of the four main lens proteins identified in D. melanogaster (Komori et al. 1992; Janssens and Gehring 1999; Stahl et al. 2017). Based on the relatively high expression of Tm-lens3 and some of the Drosophila RR-2 proteins (e.g., Drosocrystallin), it is possible that this protein family is particularly conducive to play key refractive roles in a wide range of insects. As a member of the RR-1 family, Tm-lens10 is also a member of a well-documented subfamily of cuticular proteins. Interestingly, a large percentage of lens proteins in A. gambiae are members of the RR-1 subfamily (Zhou et al. 2016). Finally, Tm-lens6 shares homology with members of the CPF family of cuticular proteins, similar to mosquitoes, in which two of the four CPF members (CPF3 and CPF4) were identified as lens proteins (Togawa et al. 2007; Zhou et al. 2016). It is important to note that Tm-lens6 is the only T. marmoratus lens protein encoding gene whose expression was not restricted to the corneagenous cells, but was also detected in the DR. In this way, it mirrors the two D. melanogaster lens proteins Cpr72ec and Cpr66d, which are expressed in both photoreceptors and corneagenous cells (Stahl et al. 2017). In both cases, expression within the corneagenous cells is higher than in the photoreceptor layer, and it remains untested whether photoreceptors can contribute to lens secretion. However, given the often neuroprotective nature of crystallins in vertebrates, it is possible that some insect crystallins are expressed in photoreceptors as a protective measure (Fort and Lampi 2011). Three additional lens protein-encoding genes showed some sequence homology to cuticular proteins of other insects using the Blastp algorithm (Altschul et al. 1990); however, the sequences did not contain any previously identified cuticular subfamily domain. Combined, these data suggest that cuticular proteins of many subtypes can contribute to lens formation and function. Of the four non-cuticular proteins we identified, Tm-lens1 and Tm-lens4 do not share sequence homology to previously annotated gene products, and hence their nature remains unclear. Our sequence analysis of Tm-lens7 and Tm-lens9 raise the possibility that they could serve important roles beyond a contribution to the refractory properties of the lens. Tm-lens7, for example, encodes a trypsin-like serine protease conserved domain. In humans, trypsin serine proteases have been shown to break down human betaA3-crystallins at least in the context of cataracts (Gupta et al. 2010). This protein could therefore potentially be important in Thermonectus during the reformation of lenses that necessarily occurs during ecdysis between larval stages (Werner and Buschbeck 2015) or during metamorphosis. Tm-lens9, on the other hand, showed some homology with a signal recognition particle-docking protein FtsY, a regulatory factor necessary for the secretion of translocated proteins as a member of the translocon complex (Rapiejko and Gilmore 1992). Although only distantly related, and primarily utilized for translocation to the endoplasmic reticulum, it is conceivable that this protein is essential for life-stage related changes in the lens, or for maintenance that requires protein renewal. While these possibilities are intriguing, it is also possible that these non-cuticular proteins are simply housekeeping genes that have been co-opted based on their refractive power when crystallized, as appears to be the case for a subset of lens proteins across the animal kingdom (reviewed by Tomarev and Piatigorsky 1996). Notably T. marmoratus larvae are aquatic predators, and the liquid environment leads to less refractive power from the corneal surface than for lenses that function in air (Land and Nilsson 2012). While the principal eyes have a relatively long focal length (Stowasser and Buschbeck 2014), it is conceivable that their aquatic ancestry leads to the recruitment of particularly high refractive lens proteins. Taken together, these results suggest that T. marmoratus lenses are largely cuticular in nature and, as previously suggested (reviewed by Tomarev and Piatigorsky 1996), invertebrate lenses can be formed by a variety of gene products some of which may have been co-opted from their roles in other housekeeping functions. Comparisons to other studies makes it clear that cuticular proteins play a major role, and while there is overlap in the cuticular subfamilies that are represented among Drosophila, Anopheles, and Thermonectus lenses, it remains unclear to what extent such proteins might be conserved at least among close relatives. In this respect, cuticular proteins evolve extremely rapidly (Cornman 2009), making it difficult to establish reliable homologies. Even if the proteins themselves diverge, or altogether different proteins are recruited in different species, an important unanswered question is whether regulatory mechanisms for these proteins are conserved. For example, Sox and Pax factors have been shown to regulate lens gene expression in both vertebrates and invertebrates (Králová et al. 2002; Carosa et al. 2002; Blanco et al. 2005; Jonasova and Kozmik 2008; Dziedzic et al. 2009; Vopalensky and Kozmik 2009). Thus, as genomic resources become available for T. marmoratus, it will be interesting to investigate if any of the T. marmoratus lens proteins carry cis-regulatory elements similar to those associated with other known crystallin enhancers. Regional refractive differences of the bifocal lens could relate to differences in protein composition The expression patterns observed in 1st instar T. marmoratus larvae provide a molecular basis to explain how the bifocal lens might have evolved: by adjusting the nature and concentration of specific proteins across different regions of the lens. Optical evidence suggests that there are key refractive differences between the core and peripheral aspects of these lenses (Stowasser et al. 2010). For this reason, it is particularly interesting that our expression analysis suggests there are some expression differences between the more distally located cells that presumably give rise to the lens periphery, and the more proximately located cells that presumably give rise to the center of the lens (Fig. 1D). Differences in refractive power between the lens core and periphery are not a novelty of T. marmoratus. For instance, regional differences that contribute to refractive gradients have been described in both vertebrates and invertebrates as a means to compensate for spherical and chromatic aberration (Blest and Land 1977; Kroger et al. 1999; Malkki and Kroger 2005; Sweeney et al. 2007). Regional differences in lens composition may also exist within the compound eye of D. melanogaster in which distinct subsets of lens protein-encoding genes are more highly expressed in central vs. peripheral lens-secreting cells (Semper and primary pigment cells vs. interommatidial pigment cells; Stahl et al. 2017). Although the functional significance of this differential distribution has not been determined, the common expression differences in cells that give rise to the core vs. the periphery of the lens raise the possibility that a precursor to the optically complex T. marmoratus lens may have already existed in the ancestral eyes of adult holometabolous insects, consistent with the hypothesis that larval stemmata of holometabolous insects evolved from a compound eye ancestor (reviewed by Buschbeck 2014). Deeper insights on the evolutionary relationships could be discovered by investigating the proliferation and differentiation pathways of Thermonectus corneagenous populations by comparing them with those of D. melanogaster (Higashijima et al. 1992; Fu and Noll 1997; Hayashi et al. 2008; Charlton-Perkins et al. 2011). In summary, our data suggest that the bifocal T. marmoratus lens could be formed by a mixture of proteins that somewhat differ between the center and the periphery. Generating antibodies against at least some of the key proteins will be necessary to investigate if this is indeed the case. Nevertheless, some circumstantial evidence for this possibility comes from a variety of artifactual staining of the lens itself (e.g., see Fig. 5B), which often resulted in different staining patterns between its core and periphery. Our results also suggest that for each of the described expression patterns of lens protein encoding genes, there is redundancy, with multiple genes expressed in comparable patterns. This potentially could allow for compensatory effects in case of a loss due to a mutation of one of the lens proteins. At this point it is unclear if any compensatory effects exist in insect eyes and how development gives rise to properly focused eyes. Therefore, in addition to shedding some light on how the peculiar bifocal Thermonectus lenses are constructed, our study provides the basis for molecular manipulations that can shed light on these very important questions. Supplementary data Supplementary data available at ICB online. Acknowledgments We would like to thank David Terrell for assistance with the lens protein isolations, and University of Cincinnati Proteomics Core for the mass spectrophotometry analysis. We are grateful to the rest of Buschbeck laboratory for analysis input. Funding This work was supported by the National Institutes of Health [R01-EY017907 to T.A.C.] and the National Science Foundation [IOS-1456757 to E.K.B., T.A.C.]. Funding was also provided by the Society for Integrative and Comparative Biology and from the Company of Biologists. References Altschul SF , Gish W , Miller W , Myers EW , Lipman DJ. 1990 . Basic local alignment search tool . J Mol Biol 215 : 403 – 10 . Google Scholar Crossref Search ADS PubMed WorldCat Andersen SO , Rafn K , Roepstorff P. 1997 . Sequence studies of proteins from larval and pupal cuticle of the yellow meal worm, Tenebrio molitor . Insect Biochem Mol Biol 27 : 121 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat Blanco J , Girard F , Kamachi Y , Kondoh H , Gehring WJ. 2005 . Functional analysis of the chicken delta 1-crystallin enhancer activity in Drosophila reveals remarkable evolutionary conservation between chicken and fly . Development 132 : 1895 – 905 . Google Scholar Crossref Search ADS PubMed WorldCat Bland K , Revetta N , Stowasser A , Buschbeck EK . 2014 . Unilateral range finding in diving beetle larvae . J Exp Biol 217 : 327 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat Blest AD , Land MF. 1977 . Physiological optics of Dinopis subrufus L. Koch: a fish-lens in a spider . Proc R Soc Lond B Biol Sci 196 : 197 – 222 . Google Scholar Crossref Search ADS PubMed WorldCat Boratyn GM , Schaffer AA , Agarwala R , Altschul SF , Lipman DJ , Madden TL. 2012 . Domain enhanced lookup time accelerated BLAST . Biol Direct 7 : 12 . Google Scholar Crossref Search ADS PubMed WorldCat Buschbeck EK. 2014 . Escaping compound eye ancestry: the evolution of single-chamber eyes in holometabolous larvae . J Exp Biol 217 : 2818 – 24 . Google Scholar Crossref Search ADS PubMed WorldCat Buschbeck EK , Sbita SJ , Morgan RC. 2007 . Scanning behavior by larvae of the predacious diving beetle, Thermonectus marmoratus (Coleoptera: Dytiscidae) enlarges visual field prior to prey capture . J Comp Physiol A 193: 973 – 82 . WorldCat Cagan RL , Ready DF. 1989 . The emergence of order in the Drosophila pupal retina . Dev Biol 136 : 346 – 62 . Google Scholar Crossref Search ADS PubMed WorldCat Carosa E , Kozmik Z , Rall JE , Piatigorsky J. 2002 . Structure and expression of the scallop Ω-crystallin gene evidence for convergent evolution of promoter sequence . Biol Chem 277 : 656 – 64 . Google Scholar Crossref Search ADS WorldCat Charlton-Perkins M , Whitaker SL , Fei YY , Xie BT , Li-Kroeger D , Gebelein B , Cook T. 2011 . Prospero and Pax2 combinatorially control neural cell fate decisions by modulating Ras- and Notch-dependent signaling . Neural Dev 6 : 20. Google Scholar Crossref Search ADS PubMed WorldCat Chiou SH. 1984 . Physicochemical characterization of a crystallin from the squid lens and its comparison with vertebrate lens crystallins . J Biol Chem 95 : 75 – 82 . WorldCat Cornman RS. 2009 . Molecular evolution of Drosophila cuticular protein genes . PLoS One 4 : e8345. Google Scholar Crossref Search ADS PubMed WorldCat Dejong WW , Hendriks W , Mulders JWM , Bloemendal H. 1989 . Evolution of eye lens crystallins—the stress connection . Trends Biochem Sci 14 : 365 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat Dziedzic K , Heaphy J , Prescott H , Kavaler J. 2009 . The transcription factor D-Pax2 regulates crystallin production during eye development in Drosophila melanogaster . Dev Dyn 238 : 2530 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Fechtel K , Fristrom DK , Fristrom JW. 1989 . Prepupal differentiation in Drosophila: distinct cell types elaborate a shared structure, the pupal cuticle, but accumulate transcripts in unique patterns . Development 106 : 649 – 56 . Google Scholar PubMed WorldCat Fort PE , Lampi KJ. 2011 . New focus on alpha-crystallins in retinal neurodegenerative diseases . Exp Eye Res 92 : 98 – 103 . Google Scholar Crossref Search ADS PubMed WorldCat Friedrich M. 2006 . Ancient mechanisms of visual sense organ development based on comparison of the gene networks controlling larval eye, ocellus, and compound eye specification in Drosophila . Arthropod Struct Dev 35 : 357 – 78 . Google Scholar Crossref Search ADS PubMed WorldCat Fu WM , Noll M. 1997 . The Pax2 homolog sparkling is required for development cone and pigment cells in the Drosophila eye . Genes Dev 11 : 2066 – 78 . Google Scholar Crossref Search ADS PubMed WorldCat Gish W , States DJ. 1993 . Identification of protein coding regions by database similarity search . Nat Genet 3 : 266 – 72 . Google Scholar Crossref Search ADS PubMed WorldCat Gupta R , Chen J , Srivastava OP. 2010 . A serine-type protease activity of human lens betaA3-crystallin is responsible for its autodegradation . Mol Vis 16 : 2242 – 52 . Google Scholar PubMed WorldCat Hayashi T , Xu CY , Carthew RW. 2008 . Cell-type-specific transcription of prospero is controlled by combinatorial signaling in the Drosophila eye . Development 135 : 2787 – 96 . Google Scholar Crossref Search ADS PubMed WorldCat Higashijima SI , Kojima T , Michiue T , Ishimaru S , Emori Y , Saigo K. 1992 . Dual Bar homeo box genes of Drosophila required in 2 photoreceptor cells, R1 and R6, and primary pigment-cells for normal eye development . Genes Dev 6 : 50 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat Horwitz J. 1992 . Alpha-crystallin can function as a molecular chaperone . Proc Natl Acad Sci U S A 89 : 10449 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat Ioannidou ZS , Theodoropoulou MC , Papandreou NC , Willis JH , Hamodrakas SJ. 2014 . CutProtFam-Pred: detection and classification of putative structural cuticular proteins from sequence alone, based on profile Hidden Markov Models . Insect Biochem Mol Biol 52 : 51 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Janssens H , Gehring WJ. 1999 . Isolation and characterization of drosocrystallin, a lens crystallin gene of Drosophila melanogaster . Dev Biol 207 : 204 – 14 . Google Scholar Crossref Search ADS PubMed WorldCat Jonasova K , Kozmik Z. 2008 . Eye evolution: lens and cornea as an upgrade of animal visual system . Semin Cell Dev Biol 19 : 71 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat Karas M , Hillenkamp F. 1988 . Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons . Anal Chem 60 : 2299 – 301 . Google Scholar Crossref Search ADS PubMed WorldCat Kim E , Choi Y , Lee S , Seo Y , Yoon J , Baek K. 2008 . Characterization of the Drosophila melanogaster retinin gene encoding a cornea-specific protein . Insect Mol Biol 17 : 537 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat Komori N , Usukura J , Matsumoto H. 1992 . Drosocrystallin, a major 52 kDa glycoprotein of the Drosophila melanogaster corneal lens. Purification, biochemical characterization, and subcellular localization . J Cell Sci 102 : 191 – 201 . Google Scholar PubMed WorldCat Králová J , Czerny T , Španielová H , Ratajová V , Kozmik Z. 2002 . Complex regulatory element within the γE-and γF-crystallin enhancers mediates Pax6 regulation and is required for induction by retinoic acid . Gene 286 : 271 – 82 . Google Scholar Crossref Search ADS PubMed WorldCat Kroger RHH , Campbell MCW , Fernald RD , Wagner HJ. 1999 . Multifocal lenses compensate for chromatic defocus in vertebrate eyes . J Comp Physiol A 184 : 361 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Land MF , Nilsson D-E. 2012 . Animal eyes. Oxford: Oxford University Press . Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Liu ZY , Friedrich M. 2004 . The Tribolium homologue of glass and the evolution of insect larval eyes . Dev Biol 269 : 36 – 54 . Google Scholar Crossref Search ADS PubMed WorldCat Maksimovic S , Cook TA , Buschbeck EK. 2009 . Spatial distribution of opsin-encoding mRNAs in the tiered larval retinas of the sunburst diving beetle Thermonectus marmoratus (Coleoptera: Dytiscidae) . J Exp Biol 212 : 3781 – 94 . Google Scholar Crossref Search ADS PubMed WorldCat Malkki PE , Kroger RHH. 2005 . Visualization of chromatic correction of fish lenses by multiple focal lengths . J Opt A Pure Appl Opt 7 : 691 – 700 . Google Scholar Crossref Search ADS WorldCat Mandapaka K , Morgan RC , Buschbeck EK. 2006 . Twenty-eight retinas but only twelve eyes: an anatomical analysis of the larval visual system of the diving beetle Thermonectus marmoratus (Coleoptera: Dytiscidae) . J Comp Neurol 497 : 166 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat Min XJ , Butler G , Storms R , Tsang A. 2005 . OrfPredictor: predicting protein-coding regions in EST-derived sequences . Nucleic Acids Res 33 : W677 – 80 . Google Scholar Crossref Search ADS PubMed WorldCat Nilsson DE . 2009 . The evolution of eyes and visually guided behaviour . Phil Trans R Soc B 364 : 2833 – 47 . Google Scholar Crossref Search ADS PubMed WorldCat Nilsson DE , Pelger S. 1994 . A pessimistic estimate of the time required for an eye to evolve . Proc R Soc Lond B Biol Sci 256 : 53 – 8 . Google Scholar Crossref Search ADS WorldCat Paulus H. 1989 . Das Homologisieren in der Feinstrukturforschung: das Bolwig-Organ der höheren Dipteren und seine Homologisierung mit Stemmata und Ommatidien eines ursprünglichen Fazettenauges der Mandibulata . Zool Beitr NF 32 : 437 – 78 . WorldCat Perkins DN , Pappin DJC , Creasy DM , Cottrell JS. 1999 . Probability-based protein identification by searching sequence databases using mass spectrometry data . Electrophoresis 20 : 3551 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat Perry MM. 1968 . Further studies on the development of the eye of Drosophila melanogaster. II. The interommatidial bristles . J Morphol 124 : 249 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat Piatigorsky J. 1998 . Multifunctional lens crystallins and corneal enzymes: more than meets the eye . Ann N Y Acad Sci 842 : 7 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat Rapiejko PJ , Gilmore R. 1992 . Protein translocation across the ER requires a functional GTP binding site in the alpha subunit of the signal recognition particle receptor . J Cell Biol 117 : 493 – 503 . Google Scholar Crossref Search ADS PubMed WorldCat Rebers JE , Riddiford LM. 1988 . Structure and expression of a Manduca sexta larval cuticle gene homologous to Drosophila cuticle genes . J Mol Biol 203 : 411 – 23 . Google Scholar Crossref Search ADS PubMed WorldCat Stahl AL , Charlton-Perkins M , Buschbeck EK , Cook TA. 2017 . The cuticular nature of corneal lenses in Drosophila melanogaster . Dev Genes Evol (doi:10.1007/s00427-017-0582-7; Epub May 5, 2017). WorldCat Stecher N , Stowasser A , Stahl A , Buschbeck EK. 2016 . Embryonic development of the larval eyes of the sunburst diving beetle, Thermonectus marmoratus (Insecta: Dytiscidae): a morphological study . Evol Dev 18 : 216 – 28 . Google Scholar Crossref Search ADS PubMed WorldCat Stowasser A , Buschbeck EK. 2014 . Multitasking in an eye: the unusual organization of the Thermonectus marmoratus principal larval eyes allows for far and near vision and might aid in depth perception . J Exp Biol 217 : 2509 – 16 . Google Scholar Crossref Search ADS PubMed WorldCat Stowasser A , Rapaport A , Layne JE , Morgan RC , Buschbeck EK. 2010 . Biological bifocal lenses with image separation . Curr Biol 20 : 1482 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat Sweeney AM , Des Marais DL , Ban YEA , Johnsen S. 2007 . Evolution of graded refractive index in squid lenses . J R Soc Interface 4 : 685 – 98 . Google Scholar Crossref Search ADS PubMed WorldCat Togawa T , Dunn WA , Emmons AC , Willis JH. 2007 . CPF and CPFL, two related gene families encoding cuticular proteins of Anopheles gambiae and other insects . Insect Biochem Mol Biol 37 : 675 – 88 . Google Scholar Crossref Search ADS PubMed WorldCat Tomarev SI , Piatigorsky J. 1996 . Lens crystallins of invertebrates: diversity and recruitment from detoxification enzymes and novel proteins . FEBS J 235 : 449 – 65 . WorldCat van Deemter M , Kuijer R , Pas HH , van der Worp RJ , Hooymans JMM , Los LI. 2013 . Trypsin-mediated enzymatic degradation of type II collagen in the human vitreous . Mol Vis 19 : 1591 – 9 . Google Scholar PubMed WorldCat Vannini L , Augustine Dunn W , Reed TW , Willis JH. 2014 . Changes in transcript abundance for cuticular proteins and other genes three hours after a blood meal in Anopheles gambiae . Insect Biochem Mol Biol 44 : 33 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat Vopalensky P , Kozmik Z. 2009 . Eye evolution: common use and independent recruitment of genetic components . Phil Trans R Soc B 364 : 2819 – 32 . Google Scholar Crossref Search ADS PubMed WorldCat Waddington CH , Perry MM. 1960 . The ultra-structure of the developing eye of Drosophila . Proc R Soc Lond B Biol Sci 153 : 155 – 78 . Google Scholar Crossref Search ADS WorldCat Werner S , Buschbeck EK. 2015 . Rapid and step-wise eye growth in molting diving beetle larvae . J Comp Physiol A Neuroethol Sens Neural Behav Physiol 201 : 1091 – 102 . Google Scholar Crossref Search ADS PubMed WorldCat Zhou Y , Badgett MJ , Bowen JH , Vannini L , Orlando R , Willis JH. 2016 . Distribution of cuticular proteins in different structures of adult Anopheles gambiae . Insect Biochem Mol Biol 75 : 45 – 57 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes From the symposium “Low Spatial Resolution Vision–Function and Evolution” presented at the annual meeting of the Society for Integrative and Comparative Biology, January 4–8, 2017 at New Orleans, Louisiana. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.
TI - A Complex Lens for a Complex Eye
JF - Integrative and Comparative Biology
DO - 10.1093/icb/icx116
DA - 2017-11-01
UR - https://www.deepdyve.com/lp/oxford-university-press/a-complex-lens-for-a-complex-eye-yu5MLH7klf
SP - 1071
VL - 57
IS - 5
DP - DeepDyve
ER -