TY - JOUR
AU - 
AB - AGCCACG GUGAAAAAGUUC UCGGUGC gRNA Synthesis Protocol STEP 1: Find all 23bp genomic sites of the form 5’-N NGG-3’ near your intended target site (ideally ±50bp). These may reside on the + or – strand. PAM 5’!NNNNN NNNNN NNNNN NNNNN NGG!3’ STEP 2: Using NCBI blast, select sequences for which none or very few sequences of the form 5’-NNNNN NNBBB BBBBB BBBBB NGG-3’ exist at any other location in the human genome (here the B’s represent the actual bases at the target genomic location). Option A Option B STEP 3: Incorporate 19bp of the selected target sequence as STEP 3: Incorporate 19bp of the selected target sequence as highlighted here: 5’-NNNNN NNNNN NNNNN NNNNN NGG-3’ into the highlighted here: 5’-NNNNN NNNNN NNNNN NNNNN NGG-3’ into two DNA fragment as indicated below: 60mer oligonucleotides as indicated below (sequences are 5’ to 3’, and the regions marked in green and red are reverse complements of each TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACC other): AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATA CGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAG Insert_F: ATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCA TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNN GTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAG NNNNNNN Insert_R: TATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNN NNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACNNNNNNNNNNNNN CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGC NNNNNNC TTTCTTGTACAAAGTTGGCATTA Step 4: Anneal the two oligos and extend these to make a 100bp double stranded DNA fragment using Phusion polymerase (http:// www.neb.com/nebecomm/products/productm0530.asp). Step 4: This 455bp fragment bears all components 
TI - Genome editing in human pluripotent stem cells
JF - StemBook
DO - 10.3824/stembook.1.94.1
DA - 2014-01-01
UR - https://www.deepdyve.com/lp/unpaywall/genome-editing-in-human-pluripotent-stem-cells-yM7M0MkUrS
DP - DeepDyve
ER -