TY - JOUR
AU1 - Calegari, Bárbara, B
AU2 - Vari, Richard, P
AU3 - Reis, Roberto, E
AB - Abstract A comprehensive phylogeny of species relationships of the Auchenipteridae is reconstructed here with a large-scale taxon sampling based on combined morphological and molecular datasets. The hypothesized phylogeny includes most species of Auchenipteridae (97 of 124 valid species) and multiple members of siluriform families as an outgroup (32 species) to embrace the diversity of forms among related catfishes. As the first large-scale phylogeny of the Auchenipteridae, comparison between taxa included information from both morphology (264 characters) and mitochondrial and nuclear molecular markers (3490 nucleotides) from five genes: coI, 16S, rag2, myh6 and SH3PX3. Trees were generated under two different optimality criteria (Maximum Parsimony and Bayesian Inference). A new classification for the family is presented herein to bring the taxonomy more in line with the new phylogenetic hypothesis. The strict consensus tree corroborates the monophyly of superfamily Doradoidea, family Auchenipteridae and its two subfamilies, Centromochlinae and Auchenipterinae. The new classification scheme proposes nine tribes in Auchenipteridae, based on the monophyly of major groups in both subfamilies. Centromochlus, Glanidium and Tatia are each recovered as paraphyletic. To maintain a monophyletic classification, some species treated as Tatia and Centromochlus are assigned to genera not previously recognized as valid. Amazon basin, Auchenipterinae, Bayesian inference, Centromochlinae, evolution, freshwater, maximum parsimony, Neotropical region, taxonomy INTRODUCTION An overview of the Auchenipteridae Neotropical freshwater fishes comprise the richest vertebrate fauna on the planet, including > 5600 known species (Reis et al., 2003; Albert & Reis, 2011) and current estimates of ≤ 9000 species (Reis et al., 2016). Siluriformes is the most diverse order and the most widespread among Ostariophysi, with 39 families and ~3920 species recognized (Fricke et al., 2019). Auchenipteridae, known as the driftwood catfishes, is a monophyletic group with 124 valid species known to date, arranged in 22 genera (Auchenipterinae with 76 species and Centromochlinae with 48 species; see Table 1). However, several new species still await a formal description (known examples in Gelanoglanis, Glanidium, Spinipterus, Tatia, Trachelyichthys, Trachelyopterus and Tympanopleura). Auchenipteridae vary in body size from miniature Gelanoglanis species, measuring ≤ 30 mm standard length (SL), to large fishes of ~600 mm SL, such as some species of Ageneiosus. Auchenipterid catfishes are widely distributed in South and Central America from Argentina to Panama, occurring in many different freshwater habitats, such as streams, rivers and lakes, and are commonly found among submerged logs. They inhabit mostly freshwater areas, except for some species of Pseudauchenipterus, which can also inhabit brackish water. Auchenipterids are of some economic interest, because a number of species have been used as a food source, mainly species of Ageneiosus. In addition, small species with attractive colour patterns, such as Auchenipterichthtys, Centromochlus, Tatia and Trachelyichthys, in addition to species with voracious predator behaviour, such as Asterophysus batrachus and Trachycorystes trachycorystes, are of commercial interest to aquarists, being exported from Brazil, Peru and Venezuela mainly to the USA, Europe and Asia. Auchenipterids generally have a twilight to nocturnal habit, at which times they usually forage near the water surface. Other species can be found active during the day and yet others can live in multispecies shoals (Burgess, 1989; B.B.C., pers. obs.). Table 1. List of the current names of species of Auchenipteridae and valid names according to the new proposed classification scheme. Current name Valid name Ageneiosus akamai Ageneiosus akamai Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus apiaka Ageneiosus apiaka Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus dentatus Ageneiosus dentatus Kner, 1857 Ageneiosus inermis Ageneiosus inermis (Linnaeus, 1766) Ageneiosus intrusus Ageneiosus intrusus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus lineatus Ageneiosus lineatus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus magoi Ageneiosus magoi Castillo & Brull, 1898 Ageniosus militaris Ageniosus militaris Valenciennes, 1836 Ageneiosus pardalis Ageneiosus pardalis Lütken, 1874 Ageneiosus polystictus Ageneiosus polystictus Steindachner, 1915 Ageneiosus ucayalensis Ageneiosus ucayalensis Castelnau, 1855 Ageneiosus uranophthalmus Ageneiosus uranophthalmus Ribeiro & Rapp Py-Daniel, 2010 Ageneiosus vittatus Ageneiosus vittatus Steindachner, 1908 Asterophysus batrachus Asterophysus batrachus Kner, 1857 Auchenipterichthys coracoideus Auchenipterichthys coracoideus (Eignmann &Allen, 1942) Auchenipterichthys longimanus Auchenipterichthys longimanus (Günther, 1864) Auchenipterichthys punctatus Auchenipterichthys punctatus (Valenciennes, 1840) Auchenipterichthys thoracatus Auchenipterichthys thoracatus (Kner, 1857) Auchenipterus ambyiacus Auchenipterus ambyiacus Fowler, 1915 Auchenipterus brachyurus Auchenipterus brachyurus (Cope, 1878) Auchenipterus brevior Auchenipterus brevior Eigenmann, 1912 Auchenipterus britskii Auchenipterus britskii Ferraris & Vari, 1999 Auchenipterus demerarae Auchenipterus demerarae Eigenmann, 1912 Auchenipterus dentatus Auchenipterus dentatus Valenciennes, 1840 Auchenipterus fordicei Auchenipterus fordicei Eigenmann & Eigenmann, 1888 Auchenipterus menezesi Auchenipterus menezesi Ferraris & Vari, 1999 Auchenipterus nigripinnis Auchenipterus nigripinnis (Boulenger, 1895) Auchenipterus nuchalis Auchenipterus nuchalis (Spix & Agassiz, 1829) Auchenipterus osteomystax Auchenipterus osteomystax (Miranda Ribeiro, 1918) Centromochlus altae Duringlanis altae (Fowler, 1945) Centromochlus bockmanni Tatia bockmanni (Sarmento-Soares & Buckup, 2005) Centromochlus britskii Tatia britskii (Sarmento-Soares & Birindelli, 2015) Centromochlus concolor Tatia concolor Mees, 1974 Centromochlus existimatus Centromochlus existimatus Mees, 1974 Centromochlus ferrarisi Ferrarissoaresia ferrarisi (Birindelli, Sarmento-Soares & Lima, 2015) Centromochlus heckelii Centromochlus heckelii (De Filippi, 1853) Centromochlus macracanthus Balroglanis macracanthus (Soares-Porto, 2000) *Centromochlus megalops Kner, 1857 Centromochlus heckelii (De Filippi, 1853) Centromochlus meridionalis Ferrarissoaresia meridionalis (Sarmento-Soares, Cabeceira, Carvalho, Zuanon & Akama, 2013) Centromochlus orca Tatia orca (Sarmento-Soares, Lazzarotto, Rapp Py-Daniel & Leitão, 2017) Centromochlus perugiae Duringlanis perugiae (Steindachner, 1882) Centromochlus punctatus Tatia punctata Mees, 1974 Centromochlus reticulatus Tatia reticulata Mees, 1974 Centromochlus romani Duringlanis romani (Mees, 1988) Centromochlus schultzi Balroglanis schultzi (Rössel, 1962) Centromochlus simplex Tatia simplex Mees, 1974 *Centromochlus steindachneri Gill, 1870 Centromochlus heckelii (De Filippi, 1853) Entomocorus benjamini Entomocorus benjamini Eingenmann, 1917 Entomocorus gameroi Entomocorus gameroi Mago-Leccia, 1984 Entomocorus melaphareus Entomocorus melaphareus Akama & Ferraris, 2003 Entomocorus radiosus Entomocorus radiosus Reis & Borges, 2006 Epapterus blohmi Epapterus blohmi Vari, Jewett, Taphorn & Gilbert, 1984 Epapterus dispilurus Epapterus dispilurus Cope, 1878 Gelanoglanis nanonocticolus Gelanoglanis nanonocticolus Soares-Porto, Walsh, Nico & Netto, 1999 Gelanoglanis pan Gelanoglanis pan Calegari, Reis & Vari, 2014 Gelanoglanis stroudi Gelanoglanis stroudi Böhlke, 1980 Gelanoglanis travieso Gelanoglanis travieso Rengifo, Lujan, Taphorn & Petry, 2008 Gelanoglanis varii Gelanoglanis varii Calegari & Reis, 2016 Glanidium albescens Glanidium albescens Reinhardt, 1874 Glanidium botocudo Glanidium botocudo Sarmento-Soares & Martins-Pinheiro, 2013 Glanidium catharinensis Glanidium catharinensis Miranda Ribeiro, 1962 Glanidium cesarpintoi Glanidium cesarpintoi Ihering, 1928 Glanidium leopardum Gephyromochlus leopardus (Hoedeman, 1961) Glanidium melanopterum Glanidium melanopterum Miranda Ribeiro, 1918 Glanidium ribeiroi Glanidium ribeiroi Haseman, 1911 Liosomadoras morrowi Liosomadoras morrowi Fowler, 1940 Liosomadoras oncinus Liosomadoras oncinus (Jardine, 1841) Pseudauchenipterus affinis Pseudauchenipterus affinis (Steindachner, 1877) Pseudauchenipterus flavescens Pseudauchenipterus flavescens (Eigenmann & Eingenmann, 1888) Pseudauchenipterus jequitinhonhae Pseudauchenipterus jequitinhonhae (Steindachner, 1877) Pseudauchenipterus nodosus Pseudauchenipterus nodosus (Bloch, 1794) Pseudepapterus cucuhyensis Pseudepapterus cucuhyensis Böhlke, 1951 Pseudepapterus gracilis Pseudepapterus gracilis Ferraris & Vari, 2000 Pseudepapterus hasemani Pseudepapterus hasemani (Steindachner, 1915) Pseudotatia parva Pseudotatia parva Mees, 1974 Spinipterus acsi Spinipterus acsi Akama & Ferraris, 2011 Tatia aulopygia Tatia aulopygia Kner, 1857 Tatia boemia Tatia boemia Koch & Reis, 1996 Tatia brunnea Tatia brunnea Mees, 1974 Tatia carolae Balroglanis carolae (Vari & Ferraris, 2013) Tatia caudosignata Tatia caudosignata Do Nascimiento, Albornoz-Garzón & García-Melo, 2019 Tatia caxiuanensis Tatia caxiuanensis Sarmento-Soares & Martins-Pinheiro, 2008 †Tatia creutzbergi Tatia creutzbergi (Boeseman, 1953) Tatia dunni Tatia dunni (Fowler, 1945) Tatia galaxias Tatia galaxias Mees, 1974 Tatia gyrina Tatia gyrina (Eigenmann & Allen, 1942) Tatia intermedia Tatia intermedia (Steindachner, 1877) Tatia jaracatia Tatia jaracatia Pavanelli & Bifi, 2009 Tatia marthae Tatia marthae Vari & Ferraris, 2013 Tatia meesi Tatia meesi Sarmento-Soares & Martins-Pinheiro, 2008 Tatia melanoleuca Tatia melanoleuca Vari & Calegari, 2014 Tatia musaica Tatia musaica Royero, 1992 Tatia neivai Tatia neivai (Ihering, 1930) Tatia nigra Tatia nigra Sarmento-Soares & Martins-Pinheiro, 2008 Tatia strigata Tatia strigata Soares-Porto, 1995 Tetranematichthys barthemi Tetranematichthys barthemi Peixoto & Wosiacki, 2010 Tetranematichthys quadrifilis Tetranematichthys quadrifilis (Kner, 1857) Tetranematichthys wallacei Tetranematichthys wallacei Vari & Ferraris, 2006 Tocantinsia piresi Tocantinsia piresi (Miranda Ribeiro, 1920) Trachelyichthys decaradiatus Trachelyichthys decaradiatus Mees, 1974 Trachelyichthys exilis Trachelyichthys exilis Greenfield & Glodek, 1977 Trachelyopterichthys anduzei Trachelyopterichthys anduzei Ferraris & Fernadez, 1987 Trachelyopterichthys taeniatus Trachelyopterichthys taeniatus (Kner, 1857) Trachelyopterus albicrux Trachelyopterus albicrux (Berg, 1901) Trachelyopterus amblops Trachelyopterus amblops (Meek & Hildebrand, 1913) Trachelyopterus ceratophysus Trachelyopterus ceratophysus (Kner, 1857) Trachelyopterus coriaceus Trachelyopterus coriaceus Valenciennes, 1840 Trachelyopterus cratensis Trachelyopterus cratensis (Miranda Ribeiro, 1937) Trachelyopterus fisheri Trachelyopterus fisheri (Eignmann, 1916) Trachelyopterus galeatus Trachelyopterus galeatus (Linnaeus, 1766) Trachelyopterus insignis Trachelyopterus insignis (Steindachner, 1878) Trachelyopterus lacustris Trachelyopterus lacustris (Lütken, 1874) Trachelyopterus leopardinus Trachelyopterus leopardinus (Borodin, 1927) Trachelyopterus lucenai Trachelyopterus lucenai Bertoletti, da Silva & Pereira, 1995 Trachelyopterus peloichthys Trachelyopterus peloichthys (Schultz, 1944) Trachelyopterus striatulus Trachelyopterus striatulus (Steindachner, 1877) Trachelyopterus teaguei Trachelyopterus teaguei (Devincenzi, 1942) Trachycorystes menezesi Trachycorystes menezesi Britski & Akama, 2011 Trachycorystes porosus Trachelyopterus porosus (Eigenmann & Eigenmann, 1888) Trachycorystes trachycorystes Trachycorystes trachycorystes (Valenciennes, 1840) Tympanopleura atronasus Tympanopleura atronasus (Eigenmann & Eigenmann, 1888) Tympanopleura brevis Tympanopleura brevis (Steindachner, 1881) Tympanopleura cryptica Tympanopleura cryptica Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura longipinna Tympanopleura longipinna Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura piperata Tympanopleura piperata Eigenmann, 1912 Tympanopleura rondoni Tympanopleura rondoni (Miranda Ribeiro, 1914) Current name Valid name Ageneiosus akamai Ageneiosus akamai Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus apiaka Ageneiosus apiaka Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus dentatus Ageneiosus dentatus Kner, 1857 Ageneiosus inermis Ageneiosus inermis (Linnaeus, 1766) Ageneiosus intrusus Ageneiosus intrusus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus lineatus Ageneiosus lineatus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus magoi Ageneiosus magoi Castillo & Brull, 1898 Ageniosus militaris Ageniosus militaris Valenciennes, 1836 Ageneiosus pardalis Ageneiosus pardalis Lütken, 1874 Ageneiosus polystictus Ageneiosus polystictus Steindachner, 1915 Ageneiosus ucayalensis Ageneiosus ucayalensis Castelnau, 1855 Ageneiosus uranophthalmus Ageneiosus uranophthalmus Ribeiro & Rapp Py-Daniel, 2010 Ageneiosus vittatus Ageneiosus vittatus Steindachner, 1908 Asterophysus batrachus Asterophysus batrachus Kner, 1857 Auchenipterichthys coracoideus Auchenipterichthys coracoideus (Eignmann &Allen, 1942) Auchenipterichthys longimanus Auchenipterichthys longimanus (Günther, 1864) Auchenipterichthys punctatus Auchenipterichthys punctatus (Valenciennes, 1840) Auchenipterichthys thoracatus Auchenipterichthys thoracatus (Kner, 1857) Auchenipterus ambyiacus Auchenipterus ambyiacus Fowler, 1915 Auchenipterus brachyurus Auchenipterus brachyurus (Cope, 1878) Auchenipterus brevior Auchenipterus brevior Eigenmann, 1912 Auchenipterus britskii Auchenipterus britskii Ferraris & Vari, 1999 Auchenipterus demerarae Auchenipterus demerarae Eigenmann, 1912 Auchenipterus dentatus Auchenipterus dentatus Valenciennes, 1840 Auchenipterus fordicei Auchenipterus fordicei Eigenmann & Eigenmann, 1888 Auchenipterus menezesi Auchenipterus menezesi Ferraris & Vari, 1999 Auchenipterus nigripinnis Auchenipterus nigripinnis (Boulenger, 1895) Auchenipterus nuchalis Auchenipterus nuchalis (Spix & Agassiz, 1829) Auchenipterus osteomystax Auchenipterus osteomystax (Miranda Ribeiro, 1918) Centromochlus altae Duringlanis altae (Fowler, 1945) Centromochlus bockmanni Tatia bockmanni (Sarmento-Soares & Buckup, 2005) Centromochlus britskii Tatia britskii (Sarmento-Soares & Birindelli, 2015) Centromochlus concolor Tatia concolor Mees, 1974 Centromochlus existimatus Centromochlus existimatus Mees, 1974 Centromochlus ferrarisi Ferrarissoaresia ferrarisi (Birindelli, Sarmento-Soares & Lima, 2015) Centromochlus heckelii Centromochlus heckelii (De Filippi, 1853) Centromochlus macracanthus Balroglanis macracanthus (Soares-Porto, 2000) *Centromochlus megalops Kner, 1857 Centromochlus heckelii (De Filippi, 1853) Centromochlus meridionalis Ferrarissoaresia meridionalis (Sarmento-Soares, Cabeceira, Carvalho, Zuanon & Akama, 2013) Centromochlus orca Tatia orca (Sarmento-Soares, Lazzarotto, Rapp Py-Daniel & Leitão, 2017) Centromochlus perugiae Duringlanis perugiae (Steindachner, 1882) Centromochlus punctatus Tatia punctata Mees, 1974 Centromochlus reticulatus Tatia reticulata Mees, 1974 Centromochlus romani Duringlanis romani (Mees, 1988) Centromochlus schultzi Balroglanis schultzi (Rössel, 1962) Centromochlus simplex Tatia simplex Mees, 1974 *Centromochlus steindachneri Gill, 1870 Centromochlus heckelii (De Filippi, 1853) Entomocorus benjamini Entomocorus benjamini Eingenmann, 1917 Entomocorus gameroi Entomocorus gameroi Mago-Leccia, 1984 Entomocorus melaphareus Entomocorus melaphareus Akama & Ferraris, 2003 Entomocorus radiosus Entomocorus radiosus Reis & Borges, 2006 Epapterus blohmi Epapterus blohmi Vari, Jewett, Taphorn & Gilbert, 1984 Epapterus dispilurus Epapterus dispilurus Cope, 1878 Gelanoglanis nanonocticolus Gelanoglanis nanonocticolus Soares-Porto, Walsh, Nico & Netto, 1999 Gelanoglanis pan Gelanoglanis pan Calegari, Reis & Vari, 2014 Gelanoglanis stroudi Gelanoglanis stroudi Böhlke, 1980 Gelanoglanis travieso Gelanoglanis travieso Rengifo, Lujan, Taphorn & Petry, 2008 Gelanoglanis varii Gelanoglanis varii Calegari & Reis, 2016 Glanidium albescens Glanidium albescens Reinhardt, 1874 Glanidium botocudo Glanidium botocudo Sarmento-Soares & Martins-Pinheiro, 2013 Glanidium catharinensis Glanidium catharinensis Miranda Ribeiro, 1962 Glanidium cesarpintoi Glanidium cesarpintoi Ihering, 1928 Glanidium leopardum Gephyromochlus leopardus (Hoedeman, 1961) Glanidium melanopterum Glanidium melanopterum Miranda Ribeiro, 1918 Glanidium ribeiroi Glanidium ribeiroi Haseman, 1911 Liosomadoras morrowi Liosomadoras morrowi Fowler, 1940 Liosomadoras oncinus Liosomadoras oncinus (Jardine, 1841) Pseudauchenipterus affinis Pseudauchenipterus affinis (Steindachner, 1877) Pseudauchenipterus flavescens Pseudauchenipterus flavescens (Eigenmann & Eingenmann, 1888) Pseudauchenipterus jequitinhonhae Pseudauchenipterus jequitinhonhae (Steindachner, 1877) Pseudauchenipterus nodosus Pseudauchenipterus nodosus (Bloch, 1794) Pseudepapterus cucuhyensis Pseudepapterus cucuhyensis Böhlke, 1951 Pseudepapterus gracilis Pseudepapterus gracilis Ferraris & Vari, 2000 Pseudepapterus hasemani Pseudepapterus hasemani (Steindachner, 1915) Pseudotatia parva Pseudotatia parva Mees, 1974 Spinipterus acsi Spinipterus acsi Akama & Ferraris, 2011 Tatia aulopygia Tatia aulopygia Kner, 1857 Tatia boemia Tatia boemia Koch & Reis, 1996 Tatia brunnea Tatia brunnea Mees, 1974 Tatia carolae Balroglanis carolae (Vari & Ferraris, 2013) Tatia caudosignata Tatia caudosignata Do Nascimiento, Albornoz-Garzón & García-Melo, 2019 Tatia caxiuanensis Tatia caxiuanensis Sarmento-Soares & Martins-Pinheiro, 2008 †Tatia creutzbergi Tatia creutzbergi (Boeseman, 1953) Tatia dunni Tatia dunni (Fowler, 1945) Tatia galaxias Tatia galaxias Mees, 1974 Tatia gyrina Tatia gyrina (Eigenmann & Allen, 1942) Tatia intermedia Tatia intermedia (Steindachner, 1877) Tatia jaracatia Tatia jaracatia Pavanelli & Bifi, 2009 Tatia marthae Tatia marthae Vari & Ferraris, 2013 Tatia meesi Tatia meesi Sarmento-Soares & Martins-Pinheiro, 2008 Tatia melanoleuca Tatia melanoleuca Vari & Calegari, 2014 Tatia musaica Tatia musaica Royero, 1992 Tatia neivai Tatia neivai (Ihering, 1930) Tatia nigra Tatia nigra Sarmento-Soares & Martins-Pinheiro, 2008 Tatia strigata Tatia strigata Soares-Porto, 1995 Tetranematichthys barthemi Tetranematichthys barthemi Peixoto & Wosiacki, 2010 Tetranematichthys quadrifilis Tetranematichthys quadrifilis (Kner, 1857) Tetranematichthys wallacei Tetranematichthys wallacei Vari & Ferraris, 2006 Tocantinsia piresi Tocantinsia piresi (Miranda Ribeiro, 1920) Trachelyichthys decaradiatus Trachelyichthys decaradiatus Mees, 1974 Trachelyichthys exilis Trachelyichthys exilis Greenfield & Glodek, 1977 Trachelyopterichthys anduzei Trachelyopterichthys anduzei Ferraris & Fernadez, 1987 Trachelyopterichthys taeniatus Trachelyopterichthys taeniatus (Kner, 1857) Trachelyopterus albicrux Trachelyopterus albicrux (Berg, 1901) Trachelyopterus amblops Trachelyopterus amblops (Meek & Hildebrand, 1913) Trachelyopterus ceratophysus Trachelyopterus ceratophysus (Kner, 1857) Trachelyopterus coriaceus Trachelyopterus coriaceus Valenciennes, 1840 Trachelyopterus cratensis Trachelyopterus cratensis (Miranda Ribeiro, 1937) Trachelyopterus fisheri Trachelyopterus fisheri (Eignmann, 1916) Trachelyopterus galeatus Trachelyopterus galeatus (Linnaeus, 1766) Trachelyopterus insignis Trachelyopterus insignis (Steindachner, 1878) Trachelyopterus lacustris Trachelyopterus lacustris (Lütken, 1874) Trachelyopterus leopardinus Trachelyopterus leopardinus (Borodin, 1927) Trachelyopterus lucenai Trachelyopterus lucenai Bertoletti, da Silva & Pereira, 1995 Trachelyopterus peloichthys Trachelyopterus peloichthys (Schultz, 1944) Trachelyopterus striatulus Trachelyopterus striatulus (Steindachner, 1877) Trachelyopterus teaguei Trachelyopterus teaguei (Devincenzi, 1942) Trachycorystes menezesi Trachycorystes menezesi Britski & Akama, 2011 Trachycorystes porosus Trachelyopterus porosus (Eigenmann & Eigenmann, 1888) Trachycorystes trachycorystes Trachycorystes trachycorystes (Valenciennes, 1840) Tympanopleura atronasus Tympanopleura atronasus (Eigenmann & Eigenmann, 1888) Tympanopleura brevis Tympanopleura brevis (Steindachner, 1881) Tympanopleura cryptica Tympanopleura cryptica Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura longipinna Tympanopleura longipinna Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura piperata Tympanopleura piperata Eigenmann, 1912 Tympanopleura rondoni Tympanopleura rondoni (Miranda Ribeiro, 1914) Names in bold indicate generic changes. *New synonymy. †Revalidation. Open in new tab Table 1. List of the current names of species of Auchenipteridae and valid names according to the new proposed classification scheme. Current name Valid name Ageneiosus akamai Ageneiosus akamai Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus apiaka Ageneiosus apiaka Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus dentatus Ageneiosus dentatus Kner, 1857 Ageneiosus inermis Ageneiosus inermis (Linnaeus, 1766) Ageneiosus intrusus Ageneiosus intrusus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus lineatus Ageneiosus lineatus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus magoi Ageneiosus magoi Castillo & Brull, 1898 Ageniosus militaris Ageniosus militaris Valenciennes, 1836 Ageneiosus pardalis Ageneiosus pardalis Lütken, 1874 Ageneiosus polystictus Ageneiosus polystictus Steindachner, 1915 Ageneiosus ucayalensis Ageneiosus ucayalensis Castelnau, 1855 Ageneiosus uranophthalmus Ageneiosus uranophthalmus Ribeiro & Rapp Py-Daniel, 2010 Ageneiosus vittatus Ageneiosus vittatus Steindachner, 1908 Asterophysus batrachus Asterophysus batrachus Kner, 1857 Auchenipterichthys coracoideus Auchenipterichthys coracoideus (Eignmann &Allen, 1942) Auchenipterichthys longimanus Auchenipterichthys longimanus (Günther, 1864) Auchenipterichthys punctatus Auchenipterichthys punctatus (Valenciennes, 1840) Auchenipterichthys thoracatus Auchenipterichthys thoracatus (Kner, 1857) Auchenipterus ambyiacus Auchenipterus ambyiacus Fowler, 1915 Auchenipterus brachyurus Auchenipterus brachyurus (Cope, 1878) Auchenipterus brevior Auchenipterus brevior Eigenmann, 1912 Auchenipterus britskii Auchenipterus britskii Ferraris & Vari, 1999 Auchenipterus demerarae Auchenipterus demerarae Eigenmann, 1912 Auchenipterus dentatus Auchenipterus dentatus Valenciennes, 1840 Auchenipterus fordicei Auchenipterus fordicei Eigenmann & Eigenmann, 1888 Auchenipterus menezesi Auchenipterus menezesi Ferraris & Vari, 1999 Auchenipterus nigripinnis Auchenipterus nigripinnis (Boulenger, 1895) Auchenipterus nuchalis Auchenipterus nuchalis (Spix & Agassiz, 1829) Auchenipterus osteomystax Auchenipterus osteomystax (Miranda Ribeiro, 1918) Centromochlus altae Duringlanis altae (Fowler, 1945) Centromochlus bockmanni Tatia bockmanni (Sarmento-Soares & Buckup, 2005) Centromochlus britskii Tatia britskii (Sarmento-Soares & Birindelli, 2015) Centromochlus concolor Tatia concolor Mees, 1974 Centromochlus existimatus Centromochlus existimatus Mees, 1974 Centromochlus ferrarisi Ferrarissoaresia ferrarisi (Birindelli, Sarmento-Soares & Lima, 2015) Centromochlus heckelii Centromochlus heckelii (De Filippi, 1853) Centromochlus macracanthus Balroglanis macracanthus (Soares-Porto, 2000) *Centromochlus megalops Kner, 1857 Centromochlus heckelii (De Filippi, 1853) Centromochlus meridionalis Ferrarissoaresia meridionalis (Sarmento-Soares, Cabeceira, Carvalho, Zuanon & Akama, 2013) Centromochlus orca Tatia orca (Sarmento-Soares, Lazzarotto, Rapp Py-Daniel & Leitão, 2017) Centromochlus perugiae Duringlanis perugiae (Steindachner, 1882) Centromochlus punctatus Tatia punctata Mees, 1974 Centromochlus reticulatus Tatia reticulata Mees, 1974 Centromochlus romani Duringlanis romani (Mees, 1988) Centromochlus schultzi Balroglanis schultzi (Rössel, 1962) Centromochlus simplex Tatia simplex Mees, 1974 *Centromochlus steindachneri Gill, 1870 Centromochlus heckelii (De Filippi, 1853) Entomocorus benjamini Entomocorus benjamini Eingenmann, 1917 Entomocorus gameroi Entomocorus gameroi Mago-Leccia, 1984 Entomocorus melaphareus Entomocorus melaphareus Akama & Ferraris, 2003 Entomocorus radiosus Entomocorus radiosus Reis & Borges, 2006 Epapterus blohmi Epapterus blohmi Vari, Jewett, Taphorn & Gilbert, 1984 Epapterus dispilurus Epapterus dispilurus Cope, 1878 Gelanoglanis nanonocticolus Gelanoglanis nanonocticolus Soares-Porto, Walsh, Nico & Netto, 1999 Gelanoglanis pan Gelanoglanis pan Calegari, Reis & Vari, 2014 Gelanoglanis stroudi Gelanoglanis stroudi Böhlke, 1980 Gelanoglanis travieso Gelanoglanis travieso Rengifo, Lujan, Taphorn & Petry, 2008 Gelanoglanis varii Gelanoglanis varii Calegari & Reis, 2016 Glanidium albescens Glanidium albescens Reinhardt, 1874 Glanidium botocudo Glanidium botocudo Sarmento-Soares & Martins-Pinheiro, 2013 Glanidium catharinensis Glanidium catharinensis Miranda Ribeiro, 1962 Glanidium cesarpintoi Glanidium cesarpintoi Ihering, 1928 Glanidium leopardum Gephyromochlus leopardus (Hoedeman, 1961) Glanidium melanopterum Glanidium melanopterum Miranda Ribeiro, 1918 Glanidium ribeiroi Glanidium ribeiroi Haseman, 1911 Liosomadoras morrowi Liosomadoras morrowi Fowler, 1940 Liosomadoras oncinus Liosomadoras oncinus (Jardine, 1841) Pseudauchenipterus affinis Pseudauchenipterus affinis (Steindachner, 1877) Pseudauchenipterus flavescens Pseudauchenipterus flavescens (Eigenmann & Eingenmann, 1888) Pseudauchenipterus jequitinhonhae Pseudauchenipterus jequitinhonhae (Steindachner, 1877) Pseudauchenipterus nodosus Pseudauchenipterus nodosus (Bloch, 1794) Pseudepapterus cucuhyensis Pseudepapterus cucuhyensis Böhlke, 1951 Pseudepapterus gracilis Pseudepapterus gracilis Ferraris & Vari, 2000 Pseudepapterus hasemani Pseudepapterus hasemani (Steindachner, 1915) Pseudotatia parva Pseudotatia parva Mees, 1974 Spinipterus acsi Spinipterus acsi Akama & Ferraris, 2011 Tatia aulopygia Tatia aulopygia Kner, 1857 Tatia boemia Tatia boemia Koch & Reis, 1996 Tatia brunnea Tatia brunnea Mees, 1974 Tatia carolae Balroglanis carolae (Vari & Ferraris, 2013) Tatia caudosignata Tatia caudosignata Do Nascimiento, Albornoz-Garzón & García-Melo, 2019 Tatia caxiuanensis Tatia caxiuanensis Sarmento-Soares & Martins-Pinheiro, 2008 †Tatia creutzbergi Tatia creutzbergi (Boeseman, 1953) Tatia dunni Tatia dunni (Fowler, 1945) Tatia galaxias Tatia galaxias Mees, 1974 Tatia gyrina Tatia gyrina (Eigenmann & Allen, 1942) Tatia intermedia Tatia intermedia (Steindachner, 1877) Tatia jaracatia Tatia jaracatia Pavanelli & Bifi, 2009 Tatia marthae Tatia marthae Vari & Ferraris, 2013 Tatia meesi Tatia meesi Sarmento-Soares & Martins-Pinheiro, 2008 Tatia melanoleuca Tatia melanoleuca Vari & Calegari, 2014 Tatia musaica Tatia musaica Royero, 1992 Tatia neivai Tatia neivai (Ihering, 1930) Tatia nigra Tatia nigra Sarmento-Soares & Martins-Pinheiro, 2008 Tatia strigata Tatia strigata Soares-Porto, 1995 Tetranematichthys barthemi Tetranematichthys barthemi Peixoto & Wosiacki, 2010 Tetranematichthys quadrifilis Tetranematichthys quadrifilis (Kner, 1857) Tetranematichthys wallacei Tetranematichthys wallacei Vari & Ferraris, 2006 Tocantinsia piresi Tocantinsia piresi (Miranda Ribeiro, 1920) Trachelyichthys decaradiatus Trachelyichthys decaradiatus Mees, 1974 Trachelyichthys exilis Trachelyichthys exilis Greenfield & Glodek, 1977 Trachelyopterichthys anduzei Trachelyopterichthys anduzei Ferraris & Fernadez, 1987 Trachelyopterichthys taeniatus Trachelyopterichthys taeniatus (Kner, 1857) Trachelyopterus albicrux Trachelyopterus albicrux (Berg, 1901) Trachelyopterus amblops Trachelyopterus amblops (Meek & Hildebrand, 1913) Trachelyopterus ceratophysus Trachelyopterus ceratophysus (Kner, 1857) Trachelyopterus coriaceus Trachelyopterus coriaceus Valenciennes, 1840 Trachelyopterus cratensis Trachelyopterus cratensis (Miranda Ribeiro, 1937) Trachelyopterus fisheri Trachelyopterus fisheri (Eignmann, 1916) Trachelyopterus galeatus Trachelyopterus galeatus (Linnaeus, 1766) Trachelyopterus insignis Trachelyopterus insignis (Steindachner, 1878) Trachelyopterus lacustris Trachelyopterus lacustris (Lütken, 1874) Trachelyopterus leopardinus Trachelyopterus leopardinus (Borodin, 1927) Trachelyopterus lucenai Trachelyopterus lucenai Bertoletti, da Silva & Pereira, 1995 Trachelyopterus peloichthys Trachelyopterus peloichthys (Schultz, 1944) Trachelyopterus striatulus Trachelyopterus striatulus (Steindachner, 1877) Trachelyopterus teaguei Trachelyopterus teaguei (Devincenzi, 1942) Trachycorystes menezesi Trachycorystes menezesi Britski & Akama, 2011 Trachycorystes porosus Trachelyopterus porosus (Eigenmann & Eigenmann, 1888) Trachycorystes trachycorystes Trachycorystes trachycorystes (Valenciennes, 1840) Tympanopleura atronasus Tympanopleura atronasus (Eigenmann & Eigenmann, 1888) Tympanopleura brevis Tympanopleura brevis (Steindachner, 1881) Tympanopleura cryptica Tympanopleura cryptica Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura longipinna Tympanopleura longipinna Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura piperata Tympanopleura piperata Eigenmann, 1912 Tympanopleura rondoni Tympanopleura rondoni (Miranda Ribeiro, 1914) Current name Valid name Ageneiosus akamai Ageneiosus akamai Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus apiaka Ageneiosus apiaka Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus dentatus Ageneiosus dentatus Kner, 1857 Ageneiosus inermis Ageneiosus inermis (Linnaeus, 1766) Ageneiosus intrusus Ageneiosus intrusus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus lineatus Ageneiosus lineatus Ribeiro, Rapp Py-Daniel & Walsh, 2017 Ageneiosus magoi Ageneiosus magoi Castillo & Brull, 1898 Ageniosus militaris Ageniosus militaris Valenciennes, 1836 Ageneiosus pardalis Ageneiosus pardalis Lütken, 1874 Ageneiosus polystictus Ageneiosus polystictus Steindachner, 1915 Ageneiosus ucayalensis Ageneiosus ucayalensis Castelnau, 1855 Ageneiosus uranophthalmus Ageneiosus uranophthalmus Ribeiro & Rapp Py-Daniel, 2010 Ageneiosus vittatus Ageneiosus vittatus Steindachner, 1908 Asterophysus batrachus Asterophysus batrachus Kner, 1857 Auchenipterichthys coracoideus Auchenipterichthys coracoideus (Eignmann &Allen, 1942) Auchenipterichthys longimanus Auchenipterichthys longimanus (Günther, 1864) Auchenipterichthys punctatus Auchenipterichthys punctatus (Valenciennes, 1840) Auchenipterichthys thoracatus Auchenipterichthys thoracatus (Kner, 1857) Auchenipterus ambyiacus Auchenipterus ambyiacus Fowler, 1915 Auchenipterus brachyurus Auchenipterus brachyurus (Cope, 1878) Auchenipterus brevior Auchenipterus brevior Eigenmann, 1912 Auchenipterus britskii Auchenipterus britskii Ferraris & Vari, 1999 Auchenipterus demerarae Auchenipterus demerarae Eigenmann, 1912 Auchenipterus dentatus Auchenipterus dentatus Valenciennes, 1840 Auchenipterus fordicei Auchenipterus fordicei Eigenmann & Eigenmann, 1888 Auchenipterus menezesi Auchenipterus menezesi Ferraris & Vari, 1999 Auchenipterus nigripinnis Auchenipterus nigripinnis (Boulenger, 1895) Auchenipterus nuchalis Auchenipterus nuchalis (Spix & Agassiz, 1829) Auchenipterus osteomystax Auchenipterus osteomystax (Miranda Ribeiro, 1918) Centromochlus altae Duringlanis altae (Fowler, 1945) Centromochlus bockmanni Tatia bockmanni (Sarmento-Soares & Buckup, 2005) Centromochlus britskii Tatia britskii (Sarmento-Soares & Birindelli, 2015) Centromochlus concolor Tatia concolor Mees, 1974 Centromochlus existimatus Centromochlus existimatus Mees, 1974 Centromochlus ferrarisi Ferrarissoaresia ferrarisi (Birindelli, Sarmento-Soares & Lima, 2015) Centromochlus heckelii Centromochlus heckelii (De Filippi, 1853) Centromochlus macracanthus Balroglanis macracanthus (Soares-Porto, 2000) *Centromochlus megalops Kner, 1857 Centromochlus heckelii (De Filippi, 1853) Centromochlus meridionalis Ferrarissoaresia meridionalis (Sarmento-Soares, Cabeceira, Carvalho, Zuanon & Akama, 2013) Centromochlus orca Tatia orca (Sarmento-Soares, Lazzarotto, Rapp Py-Daniel & Leitão, 2017) Centromochlus perugiae Duringlanis perugiae (Steindachner, 1882) Centromochlus punctatus Tatia punctata Mees, 1974 Centromochlus reticulatus Tatia reticulata Mees, 1974 Centromochlus romani Duringlanis romani (Mees, 1988) Centromochlus schultzi Balroglanis schultzi (Rössel, 1962) Centromochlus simplex Tatia simplex Mees, 1974 *Centromochlus steindachneri Gill, 1870 Centromochlus heckelii (De Filippi, 1853) Entomocorus benjamini Entomocorus benjamini Eingenmann, 1917 Entomocorus gameroi Entomocorus gameroi Mago-Leccia, 1984 Entomocorus melaphareus Entomocorus melaphareus Akama & Ferraris, 2003 Entomocorus radiosus Entomocorus radiosus Reis & Borges, 2006 Epapterus blohmi Epapterus blohmi Vari, Jewett, Taphorn & Gilbert, 1984 Epapterus dispilurus Epapterus dispilurus Cope, 1878 Gelanoglanis nanonocticolus Gelanoglanis nanonocticolus Soares-Porto, Walsh, Nico & Netto, 1999 Gelanoglanis pan Gelanoglanis pan Calegari, Reis & Vari, 2014 Gelanoglanis stroudi Gelanoglanis stroudi Böhlke, 1980 Gelanoglanis travieso Gelanoglanis travieso Rengifo, Lujan, Taphorn & Petry, 2008 Gelanoglanis varii Gelanoglanis varii Calegari & Reis, 2016 Glanidium albescens Glanidium albescens Reinhardt, 1874 Glanidium botocudo Glanidium botocudo Sarmento-Soares & Martins-Pinheiro, 2013 Glanidium catharinensis Glanidium catharinensis Miranda Ribeiro, 1962 Glanidium cesarpintoi Glanidium cesarpintoi Ihering, 1928 Glanidium leopardum Gephyromochlus leopardus (Hoedeman, 1961) Glanidium melanopterum Glanidium melanopterum Miranda Ribeiro, 1918 Glanidium ribeiroi Glanidium ribeiroi Haseman, 1911 Liosomadoras morrowi Liosomadoras morrowi Fowler, 1940 Liosomadoras oncinus Liosomadoras oncinus (Jardine, 1841) Pseudauchenipterus affinis Pseudauchenipterus affinis (Steindachner, 1877) Pseudauchenipterus flavescens Pseudauchenipterus flavescens (Eigenmann & Eingenmann, 1888) Pseudauchenipterus jequitinhonhae Pseudauchenipterus jequitinhonhae (Steindachner, 1877) Pseudauchenipterus nodosus Pseudauchenipterus nodosus (Bloch, 1794) Pseudepapterus cucuhyensis Pseudepapterus cucuhyensis Böhlke, 1951 Pseudepapterus gracilis Pseudepapterus gracilis Ferraris & Vari, 2000 Pseudepapterus hasemani Pseudepapterus hasemani (Steindachner, 1915) Pseudotatia parva Pseudotatia parva Mees, 1974 Spinipterus acsi Spinipterus acsi Akama & Ferraris, 2011 Tatia aulopygia Tatia aulopygia Kner, 1857 Tatia boemia Tatia boemia Koch & Reis, 1996 Tatia brunnea Tatia brunnea Mees, 1974 Tatia carolae Balroglanis carolae (Vari & Ferraris, 2013) Tatia caudosignata Tatia caudosignata Do Nascimiento, Albornoz-Garzón & García-Melo, 2019 Tatia caxiuanensis Tatia caxiuanensis Sarmento-Soares & Martins-Pinheiro, 2008 †Tatia creutzbergi Tatia creutzbergi (Boeseman, 1953) Tatia dunni Tatia dunni (Fowler, 1945) Tatia galaxias Tatia galaxias Mees, 1974 Tatia gyrina Tatia gyrina (Eigenmann & Allen, 1942) Tatia intermedia Tatia intermedia (Steindachner, 1877) Tatia jaracatia Tatia jaracatia Pavanelli & Bifi, 2009 Tatia marthae Tatia marthae Vari & Ferraris, 2013 Tatia meesi Tatia meesi Sarmento-Soares & Martins-Pinheiro, 2008 Tatia melanoleuca Tatia melanoleuca Vari & Calegari, 2014 Tatia musaica Tatia musaica Royero, 1992 Tatia neivai Tatia neivai (Ihering, 1930) Tatia nigra Tatia nigra Sarmento-Soares & Martins-Pinheiro, 2008 Tatia strigata Tatia strigata Soares-Porto, 1995 Tetranematichthys barthemi Tetranematichthys barthemi Peixoto & Wosiacki, 2010 Tetranematichthys quadrifilis Tetranematichthys quadrifilis (Kner, 1857) Tetranematichthys wallacei Tetranematichthys wallacei Vari & Ferraris, 2006 Tocantinsia piresi Tocantinsia piresi (Miranda Ribeiro, 1920) Trachelyichthys decaradiatus Trachelyichthys decaradiatus Mees, 1974 Trachelyichthys exilis Trachelyichthys exilis Greenfield & Glodek, 1977 Trachelyopterichthys anduzei Trachelyopterichthys anduzei Ferraris & Fernadez, 1987 Trachelyopterichthys taeniatus Trachelyopterichthys taeniatus (Kner, 1857) Trachelyopterus albicrux Trachelyopterus albicrux (Berg, 1901) Trachelyopterus amblops Trachelyopterus amblops (Meek & Hildebrand, 1913) Trachelyopterus ceratophysus Trachelyopterus ceratophysus (Kner, 1857) Trachelyopterus coriaceus Trachelyopterus coriaceus Valenciennes, 1840 Trachelyopterus cratensis Trachelyopterus cratensis (Miranda Ribeiro, 1937) Trachelyopterus fisheri Trachelyopterus fisheri (Eignmann, 1916) Trachelyopterus galeatus Trachelyopterus galeatus (Linnaeus, 1766) Trachelyopterus insignis Trachelyopterus insignis (Steindachner, 1878) Trachelyopterus lacustris Trachelyopterus lacustris (Lütken, 1874) Trachelyopterus leopardinus Trachelyopterus leopardinus (Borodin, 1927) Trachelyopterus lucenai Trachelyopterus lucenai Bertoletti, da Silva & Pereira, 1995 Trachelyopterus peloichthys Trachelyopterus peloichthys (Schultz, 1944) Trachelyopterus striatulus Trachelyopterus striatulus (Steindachner, 1877) Trachelyopterus teaguei Trachelyopterus teaguei (Devincenzi, 1942) Trachycorystes menezesi Trachycorystes menezesi Britski & Akama, 2011 Trachycorystes porosus Trachelyopterus porosus (Eigenmann & Eigenmann, 1888) Trachycorystes trachycorystes Trachycorystes trachycorystes (Valenciennes, 1840) Tympanopleura atronasus Tympanopleura atronasus (Eigenmann & Eigenmann, 1888) Tympanopleura brevis Tympanopleura brevis (Steindachner, 1881) Tympanopleura cryptica Tympanopleura cryptica Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura longipinna Tympanopleura longipinna Walsh, Ribeiro & Rapp Py-Daniel, 2015 Tympanopleura piperata Tympanopleura piperata Eigenmann, 1912 Tympanopleura rondoni Tympanopleura rondoni (Miranda Ribeiro, 1914) Names in bold indicate generic changes. *New synonymy. †Revalidation. Open in new tab Auchenipteridae have a wide variety of feeding behaviours. Some species feed on fruits and seeds, as observed in Trachycorystes (Goulding, 1980), whereas other species are predators of insects, crustaceans (Menezes, 1949; Burgess, 1989), small fishes, frogs (B.B.C., pers. obs.) and reptiles (Freitas et al., 2011). Among the Neotropical Siluriformes, one of the most interesting and outstanding characteristics of the Auchenipteridae is that they are inseminating fishes with external development (oviparous sensu Nakatani et al., 2001), a distinctive feature otherwise known among catfishes only in Scoloplacidae and Astroblepidae (Spadella et al. 2006, 2012). Ihering (1937) was the first to report the occurrence of what he called internal fertilization in the Auchenipteridae, reporting observations of the reproduction of Trachycorystes striatulus (currently known as Trachelyopterus striatulus). Ihering described the reproduction of this species as very peculiar, with the spermatozoa being introduced into the female oviduct through a copulatory organ (i.e. the anal fin of males modified into an intromittent organ) before the maturation of eggs. Consequently, fertilization occurs during spawning without the presence of males. Although the author did not witness the fertilization itself, the morphology of the gonads and the physiology of the spermatozoa reinforce the hypothesis of internal fertilization in the family. The testes are strongly modified, and the spermatozoa are produced only in the anterior portion, whereas the posterior portion of the testis is modified to produce a gelatinous substance. This substance is insoluble, and males inject it into females at the end of copulation immediately after the spermatozoa have been introduced, forming a barrier in the oviduct. In addition, when their spermatozoa are exposed to the water, they suffer deformation and lose mobility, unlike spermatozoa of fishes with external fertilization (Ihering, 1937). However, additional studies should be conducted to determine the exact moment when the spermatozoa fertilize the eggs. For this reason, Auchenipteridae continue to be referred to as inseminating fishes (Spadella et al., 2012). This peculiar reproductive strategy is directly associated with their marked sexual dimorphism, which can involve many morphological changes in mature males: the shape, size and position of the anal fin; development and fusion of the anal-fin pterygiophores; enlargement, elongation and ossification of the maxillary barbel and the dorsal-fin spine; anterior displacement of the dorsal-fin spine; development of serrae on the anterior surface of the dorsal-fin spine; development of a gonopodium; and development of nuptial dermal tubercles (Britski, 1972; Ferraris, 1988; Royero, 1999; Ferraris & Vari, 1999; Akama, 2004; Ribeiro, 2011; Birindelli, 2014; Calegari et al., 2014). Members of the Auchenipteridae are popularly known as cangati, fidalgo, mandubé, palmito, ximbé, porrudo, cachorro-de-padre, carataí and barriga mole in Brazil; as manduví, novia and pinguinos in other Latin American countries; and as driftwood, woodcat and jaguar catfish in the international community. Evolutionary position and composition of the Doradoidea Despite the current knowledge of the phylogenetic relationships of Siluriformes, the evolutionary history of some groups remains controversial and even unresolved. Nonetheless, the monophyly of the order is widely corroborated by many authors (Fink & Fink, 1981, 1996; Mo, 1991; de Pinna, 1993; Britto, 2002; Diogo, 2004; Sullivan et al., 2006; Arcila et al., 2017; Betancur-R et al., 2017). The most current phylogenies of Siluriformes based on morphological evidence have found a general consensus regarding the early diversification of Diplomystidae within the order, as the sister group to all remaining catfishes (Mo, 1991; Arratia, 1992; de Pinna, 1998; Britto, 2002; Diogo, 2004; Birindelli, 2014). However, the synapomorphic characters of the non-Diplomystidae catfishes still differ among studies (Grande, 1987; Mo, 1991; de Pinna, 1998; Arratia, 1992; Diogo, 2004). In contrast, recent genomic-based phylogenies (Arcila et al., 2017; Betancur-R et al., 2017) have recovered a different position for Diplomystoidei (Diplomystidae) within Siluriformes as sister taxa to all Siluroidei, with both clades sister to Loricarioidei. Notwithstanding, the phylogenies of Mo (1991), Lundberg (1993) and de Pinna (1998) agree upon the close relationship of the families Ariidae, Mochokidae, Doradidae and Auchenipteridae. Those authors suggested that the cosmopolitan Ariidae is the sister group to the Doradoidei (Mochokidae, Doradidae and Auchenipteridae). However, it was Regan (1911) who established the first hypothesis of monophyly for the group formed by the Auchenipteridae and Doradidae (superfamily Doradoidea), proposing its close relationship with the Ariidae based on the absence of the mesocoracoid. In contrast to Regan (1911), the above authors suggested the Mochokidae as the sister group to the clade formed by the Auchenipteridae and Doradidae, a hypothesis strongly corroborated by subsequent authors, including Britto (2002), Diogo (2004) and Birindelli (2014), also based on morphological characters. In addition, molecular results of Sullivan et al. (2006, 2008) include the monophyly of a group formed by Auchenipteridae and Doradidae (Doradoidea), corroborating the earliest morphological studies. Furthermore, Sullivan (2006) presented, as the final hypothesis, a tree comprising the concatenation of different results found in distinct analyses, supporting the Aspredinidae as the sister group to the Doradoidea, in contrast to all morphological hypotheses to date (de Pinna, 1998; Britto, 2002; Diogo, 2004; Birindelli, 2014). Corroborating Sullivan et al. (2006, 2008) and in light of new technologies, the two most recent genomic-based large-scale phylogenies including major groups of Siluriformes (Arcila et al., 2017; Betancur-R et al., 2017) resulted in the sister-group relationship of Auchenipteridae and Doradidae, with the Neotropical Aspredinidae recovered as their sister taxa. Nevertheless, in a molecular phylogeny of the non-Diplomystidae catfishes seeking the sister group to the Ictaluridae, Hardman (2005) alternatively found the Doradoidea to be a separate clade in a more basal position in Siluriformes, a hypothesis incongruent with all previous reported phylogenies. Historical overview of the systematics of Auchenipteridae The Auchenipteridae have an extensive and confusing taxonomic and phylogenetic history. Several studies since the 18th century have generated controversial results regarding the composition of the family and its interrelationships. The taxonomy of auchenipterids had long been linked with diverse catfish families, primarily Doradidae and Pimelodidae. The nomenclatural history of auchenipterids began with Linnaeus (1766) in the 12th edition of Systema Naturae, in which he described Silurus inermis Linnaeus, 1766 and Silurus galeatus Linnaeus, 1766 (currently allocated in Ageneiosus and Trachelyopterus, respectively). Thenceforth, many studies were published on new species and genera and on the classification of large catfish groups. A brief description of the studies that have influenced the history of the Auchenipteridae is below. Bloch (1794) described several new genera and species, including Silurus nodosus Bloch, 1794 (currently valid as Pseudauchenipterus). Later, Bloch & Schneider (1801) lumped Silurus, Mochokidae and other siluroids as an order in the class Heptapterygii. Soon thereafter, Lacepède (1803) described the genus Ageneiosus, allocating the species previously described by Linnaeus and including Silurus nodosus, Silurus galeatus and some species from other families (Mochokidae, Ariidae and Pimelodidae) in the genus Pimelodus. Rafinesque (1815) was the first author to assign a formal group to the catfishes, the Oplophoria, which included two subfamilies, one comprising loricariids and callichthyids and the other comprising the remaining catfishes. Cuvier (1817) proposed the first classification and diagnosis of fishes based on anatomy, placing all catfishes together in an exclusive family called ‘Siluroïdes’, divided into three subgroups, with ‘Silures’ including species of Ageneiosus (Ageneiosus inermis) and Trachelyopterus (Pimelodus galeatus). Spix & Agassiz (1829) classified the catfishes into two subfamilies, one called ‘Siluroidei’, to which they allocated Hypophthalmus, which at that time contained Hypophthalmus nuchalis Spix & Agassiz, 1829 (currently known as Auchenipterus) and the second called ‘Gonyodontes’. Cuvier & Valenciennes (1840) modified the nomenclature again, creating several new genera: Arius for Silurus nodosus; Auchenipterus for Auchenipterus nuchalis and several new species, namely Auchenipterus dentatus Valenciennes, 1840, Auchenipterus furcatus Valenciennes, 1840, Auchenipterus immaculatus Valenciennes, 1840, Auchenipterus maculosus Valenciennes, 1840, Auchenipterus punctatus Valenciennes, 1840 and Auchenipterus trachycorystes Valenciennes, 1840; and Trachelyopterus, including Trachelyopterus coriaceus Valenciennes, 1840. Even so, Müller & Troschel (1849) transferred Silurus nodosus to Auchenipterus. Kner (1857) also increased the known diversity of auchenipterids and described new genera and species, such as Asterophysus batrachus Kner, 1857, Auchenipterus thoracatus Kner, 1857 and Auchenipterus ceratophysus Kner, 1857 (the latter currently placed in Trachelyopterus), Centromochlus aulopygia Kner 1857 and Centromochlus megalops Kner, 1857. Bleeker (1858, 1862–63) greatly contributed to knowledge of the siluroids, describing new genera and assigning suprageneric groups. In his study (Bleeker, 1862–63), he created the Stirp Pseudauchenipterini, subdivided into Pseudauchenipteri (including Auchenipterichthys, Parauchenipterus, Pseudauchenipterus and Trachycorystes), Centromochli (including Centromochlus) and Asterophysi (including Asterophysus). Additionally, Bleeker created the Stirp Pangasini, including the subdivisions Ageneiosii (Ageneiosus, Pseudageneiosus and Tetranematichthys) and Auchenipterini (Auchenipterus). In the same study, Bleeker (1862–63) designated the subfamily Trachelyopteriformes, including the Stirp Trachelyopterini (Trachelyopterus and Trachelyopterichthys). A reclassification of the catfishes (family Siluridae) was conducted by Günther (1864), encompassing many species of Ageneiosus, Asterophysus, Auchenipterus, Centromochlus, Trachelyopterus, Tetranematichthys, other species of the current families Doradidae and Mochokidae and a few species of Ceptosidae, in an exclusive group called Doradina, belonging to the subfamily Stenobranchiae. Eigenmann & Eigenmann (1890) also contributed to the taxonomy of the auchenipterids and, in a revisionary study of the Neotropical siluroids, separated the Auchenipteridae into two groups: Ageneiosinae (an exclusive group for the species of Ageneiosus) and Auchenipterinae. A new classification of the Siluriformes was proposed by Regan (1911), differing from all previous classifications by the inclusion of a great diversity of catfishes and the use of osteological characteristics instead of external morphology alone (de Pinna, 1998). Regan proposed the group Siluroidea, including members of Ageneiosidae and Auchenipteridae in an expanded Doradidae. In the same year, Miranda Ribeiro (1911) recognized some genera as higher level and proposed the Doradidae, Ageneiosidae (Ageneiosus, Pseudageneiosus and Tetranematichthys), Trachycorystidae (Asterophysus, Auchenipterichthys, Centromochlus, Glanidium, Pseudauchenipterus, Tatia, Trachelyopterus, Trachelyopterichthys and Trachycorystes) and Auchenipteridae (Auchenipterus and Epapterus). A few years later, a new configuration of catfishes was proposed by Eigenmann (1925), including 16 subfamilies, among which the Auchenipteridae, Ageneiosidae and Doradidae were considered independent. Some years later, Ihering (1937) corroborated Eigenmann (1925) in considering Ageneiosidae and Doradidae as apart from the Auchenipteridae; in addition, the latter was divided into two subfamilies: Auchenipterinae and Trachycorystinae. Subsequently, controversial considerations of the Auchenipteridae were proposed by many authors, such as Fowler (1940), who included Ageneiosus in the Auchenipteridae; Gosline (1945), who considered Ageneiosidae to be separate from the remaining auchenipterids, all allocated to the Doradidae; Eigenmann & Allen (1942), who transferred five genera recognized by previous authors as Auchenipteridae to the Pimelodidae; and Jordan (1929), Berg (1940), Fowler (1951) and Greenwood et al. (1966), who considered Ageneiosidae, Doradidae and Auchenipteridae to be independent families among the Siluriformes. Chardon (1968) was another author who corroborated this line of consideration and maintained the separation of these three families, although he recognized that only one character could distinguish the Doradidae from the Auchenipteridae: the presence of lateral bony plates. In addition to recognizing the independence of these three families, Chardon (1968) also brought together, for the first time, the Mochokidae, Auchenipteridae, Ageneiosidae and Doradidae into a superfamily called Doradoidea, included in the suborder Bagroidei. His work was based on anatomical studies of the Weberian apparatus, mainly the presence of the elastic spring mechanism (except some species of Ageneiosidae; Walsh, 1990), but also features thought to represent a strong skeletal system, such as the deeply sutured cranial bones and the presence of an additional intermediate nuchal shield, among others (Chardon, 1968: 229). In the same year, based on his father’s previous study (Miranda Ribeiro, 1911) and with little explanation, Miranda Ribeiro (1968) split the auchenipterids into four families, Asterophysidae, Auchenipteridae, Centromochlidae and Trachycorystidae, and maintained the Ageneiosidae as a separate family. Britski (1972) was an important contribution for the first establishment of the internal relationship of the Auchenipteridae and Ageneiosidae and for considering both families to form a natural group within the Siluriformes supported by the presence of sexual dimorphism. He also aimed to define the position of the two families within Doradoidea (sensu Chardon, 1968). Britski developed an extensive and detailed study (not published to date), based on the internal anatomy, osteology, reproductive system, sexual dimorphism and gas bladder features, that revealed important features for the systematics of the family. As a result, he suggested splitting Auchenipteridae into four subfamilies: Asterophysinae, Auchenipterinae, Centromochlinae and Trachycorystinae. However, he included the genera Ageneiosus and Tetranematichthys in the family Ageneiosidae and placed Wertheimeria in Doradidae. Based on a strictly cladistic methodology, Ferraris (1988) conducted what would be the first phylogenetic study of the Auchenipteridae (not published), greatly contributing to the knowledge of the family. His phylogeny was based on 129 morphological characters and proposed Doradidae as a sister group to Auchenipteridae (including members of Ageneiosidae) and Centromochlidae (Centromochlus, Gelanoglanis, Glanidium, Tatia and New Genera A and B). The author divided the Auchenipteridae into two subfamilies: Auchenipterinae (Auchenipterichthys, Pseudauchenipterus and the tribe Auchenipterini, comprising Ageneiosus, Auchenipterus, Entomocorus, Epapterus, Tetranematichthys, Trachelyichthys and Trachelyopterus) and Trachycorystinae (Liosomadoras, Trachelyopterichthys and Trachycorystes). Furthermore, Ferraris (1988) considered the monotypic genera Asterophysus, Pseudotatia and Tocantinsia as incertae sedis within the family. The decision of Ferraris (1988) to recognize two families, Auchenipteridae and Centromochlidae, was based on differences in the reproductive system reflected by the non-enlargement of the urogenital pore of females of centromochlids. De Pinna (1998) agreed with most of the phylogenetic hypothesis of Ferraris (1988), except for the separation of the Auchenipteridae and Centromochlidae into two families, which he stated should be recognized at the subfamily level (de Pinna, 1998). Curran (1989) also proposed a phylogenetic hypothesis for Auchenipteridae and developed his study based on only 24 morphological characters (primarily external morphology), examining 20 taxa. Curran proposed a more inclusive Auchenipteridae, including Centromochlidae. However, Curran did not include Ageneiosidae (Ageneiosus and Tetranematichthys) in his study. Walsh (1990) focused his study on the phylogenetic relationships of Ageneiosidae (not published), describing several osteological characters and important findings. His study corroborates the inclusion of Tetranematichthys in the family and the monophyly of Ageneiosus, and was mainly based on features related to the gas bladder encapsulation. Walsh also suggested Ageneiosus pardalis as sister to all remaining species of Ageneiosus. Soares-Porto (1998) studied the relationships of Centromochlinae, rearranging its species into Centromochlus, Glanidium and Tatia and considering Gelanoglanis as a junior synonymy of Centromochlus. That synonymization was later reconsidered by Soares-Porto et al. (1999), who resurrected the genus. In the same study, Glanidium was proposed as the sister group to the remaining Centromochlinae. Royero (1999) conducted a valuable phylogenetic study (not published) focused on Auchenipteridae but also encompassing members of Ariidae, Mochokidae and Doradidae to establish the relationships among the arioids. Royero deeply investigated and thoroughly discussed 151 morphological charactes, which significantly increased the congruence of the auchenipterid relationships. The author repositioned the Ariidae closest to the Mochokidae, Doradidae, Auchenipteridae and Ageneiosidae, successively. Royero recognized four subfamilies in Auchenipteridae, namely Pseudauchenipterinae, Trachycorystinae, Centromochlinae and Auchenipterinae, and considered Pseudotatia as incertae sedis. Additionally, Royero found the clade formed by Ageneiosus and Tetranematichthys to be the sister group to Trachelyopterus peloichthys Schultz, 1944, a species described in his dissertation as a supposed new genus never formally published. In a comprehensive systematic review of Parauchenipterus and Trachelyopterus, Akama (2004) re-evaluated the morphological characters of previous authors and included important characteristics of sexual dimorphism. Based on his results (not published to date), Parauchenipterus and Trachelyopterus are recognized as monophyletic sister groups. In addition to recognizing the validity of both genera, Akama included in his analyses the new genus of Royero (1999), corroborating that author on the monophyly of this genus, and additionally proposed the allocation of more species (Parauchenipterus amblops, Parauchenipterus fisheri, Parauchenipterus insignis and Parauchenipterus teaguei) in that genus. According to his results, this clade is more closely related to Tetranematichthys and Ageneiosus. Akama considered five species valid in Parauchenipterus (Parauchenipterus ceratophysus, Parauchenipterus galeatus, Parauchenipterus porosus, Parauchenipterus striatulus and a new species from the central Amazon) and two species in Trachelyopterus (Trachelyopterus coriaceus and a new species from the Paraná-Paraguay basin). More recently, Birindelli (2014) published a phylogeny of the Doradoidea, where he conducted an exhaustive and wide compilation of morphological characters, in which he gathered and reviewed a series of characters from previous authors encompassing osteology, sexual dimorphism, myology and the reproductive system. As a result, Birindelli found Doradoidea to be the sister group to Mochokidae, as expected for a morphological phylogeny, corroborating previous studies of the same nature. Additionally, the author recognized two subfamilies in the Auchenipteridae (Centromochlinae and Auchenipterinae), in accordance with the classification proposed by Ferraris (2007) and Soares-Porto (1998). Within Auchenipterinae, Birindelli also found support for two tribes, Auchenipterini (composed of Ageneiosus, Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Tetranematichthys and the new genus of Royero, 1999), a clade also found by other authors (Akama, 2004, except for Epapterus, which was not included in his study; Ribeiro, 2011), and the tribe Trachelyopterini (composed of Auchenipterichthys, Parauchenipterus, Trachelyichthys, Trachelyopterichthys, Trachelyopterus and Trachycorystes). Although Birindelli (2014) has conducted a comprehensive phylogenetic study, the author focused on higher relationships, and in general, the study included few representative species per genus of the Auchenipteridae. After Birindelli completed his study but before its publication, Ribeiro (2011) developed a phylogeny focused on the Ageneiosus group, which later resulted in the publication of two revisions (Walsh et al., 2015; Ribeiro et al., 2017). His phylogeny, still unpublished, included 237 morphological characters and recognized two tribes in Auchenipterinae (Auchenipterini and Trachelyopterini). As a result, his hypothesis corroborated the monophyly of two genera, Ageneiosus s.s. and suggested the revalidation of Tympanopleura. Additionally, the author recommended a series of taxonomic changes, which were recently published in two subsequent revisions. Walsh et al. (2015) revalidated Tympanopleura Eigenmann, 1912 as a genus encompassing Tympanopleura cryptica, Tympanopleura longipinna, Tympanopleura atronasus, Tympanopleura brevis, Tympanopleura piperata and Tympanopleura rondoni, the latter removed from the synonym of Ageneiosus brevis. The last four species were previously included in Ageneiosus and the first two were described as new in the same study. Ribeiro et al. (2017) revised Ageneiosus, recognizing 13 valid species and describing four new ones: Ageneiosus akamai, Ageneiosus apiaka, Ageneiosus intrusus and Ageneiosus lineatus. Additionally, the authors proposed Ageneiosus marmoratus as a junior synonym of Ageneiosus inermis and the revalidation of Ageneiosus dentatus. Akama & Ferraris (2011) have also contributed to the understanding of the diversity of the family by describing a new genus and species of a small fish, Spinipterus acsi, from the Peruvian Amazon. Although Spinipterus is currently monotypic, at least two more species are known to exist and await formal description. State of knowledge of Auchenipteridae and related taxa In summary, throughout the extensive and complex phylogenetic history of the Auchenipteridae, the monophyly of the superfamily Doradoidea has been agreed upon by all recent authors (since the 1980s) and is supported by a series of synapomorphies. Nevertheless, the propositions of the closest relationship of the Doradoidea with the remaining Siluriformes have varied among the different morphological studies, and there is a contrast between morphological and molecular studies. Hypotheses based on morphological traits have suggested that the Doradoidea plus Mochokidae are more closely related to the Ariidae (de Pinna, 1998) or the Malapteruridae (Diogo, 2004) or that they form a clade encompassing exclusively the Doradoidea (Britto, 2002; Birindelli, 2014). In contrast, hypotheses based on genotypic information have appointed the Aspredinidae as the sister group to the Doradoidea (Sullivan et al., 2006, 2008; Arcila et al., 2017; Betancurt-R et al., 2017). Several studies since 1766 that included species descriptions have generated controversy regarding the composition of the family. However, there is a notable contribution of many authors to the taxonomy of the family, with geographical reviews (Mees, 1974, auchenipterids from Suriname) or revisions of genera, as follows: Ageneiosus (Ribeiro et al., 2017), Auchenipterichthys (Ferraris et al., 2005), Auchenipterus (Ferraris & Vari, 1999), Epapterus (Vari & Ferraris, 1998), Liosomadoras (Birindelli & Jansen, 2012), Pseudepapterus (Ferraris & Vari, 2000), Tatia (Mees, 1988; Sarmento-Soares, 2008), Entomocorus (Reis & Borges, 2006), Tetranematichthys (Vari & Ferraris, 2006) and Tympanopleura (Walsh et al., 2015). With respect to family composition, the recognition of the subfamilies Centromochlinae and Auchenipterinae represents well the diversity of forms in Auchenipteridae, a classification accepted by most authors. However, the various disagreements regarding the internal relationships of the family should be noted. The phylogenetic studies of the family, all unpublished except for Curran (1989), Soares-Porto (1998) and Birindelli (2014), contain distinct hypotheses of interrelationships, especially in Auchenipterinae, demonstrating that hypotheses about its evolutionary history are still controversial. The Auchenipteridae have an extensive and confusing taxonomic and phylogenetic history, in part because of the nature of the evidence used to reconstruct the interrelationships of Siluriformes and, more particularly, of the family. Studies so far have used either morphological or molecular evidence and far from complete taxonomic sampling, showing several incongruities and suggesting controversial evolutionary histories that could be reconstructed better if based on a combination of those data and a thorough taxonomic sampling. Seeking to reconstruct the internal relationships of Auchenipteridae and its closest relationship among the Siluroidei, the present phylogenetic study includes as many species of the Auchenipteridae as possible in addition to several representatives of relevant siluroid families to contemplate the greater diversity of forms existing in the suborder, providing a strong comparison among taxa and therefore providing information based on evolutionary evidence from different sources, including morphological and molecular data in a combined approach. The combined dataset aims to generate a hypothesis to establish the interrelationships within the Auchenipteridae, which is crucial for a full understanding of the evolution of the family. A new classification for Auchenipteridae is presented herein to bring the taxonomy more in line with the new phylogenetic hypothesis along with phylogenetic diagnoses, a helpful and easy morphological comparison of each rank and a key for genera of the family. MATERIAL AND METHODS Taxon and character sampling Representatives of all valid genera of Auchenipteridae were included in the phylogenetic analyses. A total of 146 terminals were sampled in the combined analysis, representing 114 auchenipterids (ingroup). The outgroup included 32 specimens from seven siluriform families: Ariidae (three species), Aspredinidae (five species), Cetopsidae (one species), Doradidae (nine species), Diplomystidae (five species), Pimelodidae (two species) and Mochokidae (seven species). The morphological data were accessible from 97 valid taxa of Auchenipteridae (35 centromochlines and 62 auchenipterines), plus 11 putatively new species and six species tentatively identified using the denomination affinis in the name, which were included in the analyses in order to test their generic allocation. The author of each new species, when not of the present authors, is given properly in the Diagnosis section. Outgroup choice was based on the previous higher-level and intrafamilial phylogenetic hypotheses of Siluriformes (de Pinna, 1998; Britto, 2002; Diogo, 2004; Sullivan et al., 2006; ,Vigliotta, 2008; Marceniuk et al., 2012; Arce et al., 2013; Birindelli, 2014). Specimens used for morphological study were provided by many institutions, as follows: the Academy of Natural Sciences, Philadelphia (ANSP); American Museum of Natural History, New York (AMNH); Auburn University Natural History Museum, Auburn (AUM); California Academy of Sciences, San Francisco (CAS); Coleção Zoológica Norte Capixaba, São Mateus (CZNZ); Instituto Nacional de Pesquisas da Amazônia, Manaus (INPA); Field Museum of Natural History, Chicago (FMNH); Florida Museum of Natural History, Gainesville (UF); Laboratório de Biologia e Genética de Peixes da UNESP, Botucatu (LBP); Los Angeles County Museum, Los Angeles (LACM); Museu de Ciências e Tecnologia da Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre (MCP); Museu Nacional, Rio de Janeiro (MNRJ); Museu de Zoologia da Universidade de São Paulo, São Paulo (MZUSP); Muséum National d’Histoire Naturelle, Paris (MNHN); National Museum of Natural History, Smithsonian Institution, Washington (USNM); Natural History Museum, London (BMNH); Núcleo de Pesquisas em Limnologia, Ictiologia e Aqüicultura/Nupélia da Universidade Estadual de Maringá, Maringá (NUP); Royal Ontario Museum, Ontario (ROM); Texas Natural History Collections (TNHC); Universidade Federal do Rio Grande do Sul, Porto Alegre (UFRGS); and Universidade Federal de Rondônia, Porto Velho (UFRO-I). Molecular data A complete list of collection data and GenBank accession numbers for each sample included in the molecular analysis is shown in Table 2. All tissue samples included in this study were collected by the authors and/or collaborators or obtained from fish collections. In addition, all tissue samples have voucher specimens, which were identified by the first author, except for the Aspredinidae (identified by Tiago P. Carvalho). Specimens for which only molecular or morphological data were available were also included in the combined dataset matrix. Table 2. Voucher catalogue number, tissue identifier number and GenBank accession numbers for all sequence samples analysed Family taxon Voucher catalogue number Tissue identifier coI myh6 rag2 SH3PX3 16S Auchenipteridae  Ageneiosus akamai MCP 46990 C-105 MF595206 MF595282 MF595363 MF595443 MF595113  Ageneiosus dentatus INPA 35533 – MF595213 MF595283 MF595365 – MF595116  Ageneiosus inermis UFRO-I 8711 3438 – MF595284 MF595366 MF595445 MF595117  Ageneiosus militaris MCP 28423 – MF595215 MF595286 – MF595447 MF595119  Ageneiosus militaris B MCP 26681 – MF595211 – MF595364 MF595444 MF595114  Ageneiosus polystictus ROM 66265 5010 MF595217 MF595287 MF595368 MF595448 MF595120  Ageneiosus polystictus B ROM 86418 7036 MF595212 – – – MF595115  Ageneiosus ucayalensis MUSM 36932 AP146 MF595219 MF595288 MF595369 MF595449 MF595121  Ageneiosus uranophthalmus UFRO-I 17223 8482 – MF595289 MF595370 – MF595122  Ageneiosus vittatus UFRO-I uncataloged 3497 MF595220 MF595290 MF595371 MF595450 MF595123  Auchenipterichthys coracoideus MCP 46293 – – – MF595378 MF595458 MF595132  Auchenipterichthys longimanus MCP 46593 – MF595227 MF595297 MF595379 MF595459 MF595133  Auchenipterichthys punctatus LBP 4442 24314 – – MF595380 – MF595134  Auchenipterus ambyiacus UFRO-I 9593 4072 MF595223 MF595293 MF595373 MF595453 MF595126  Auchenipterus brachyurus MUSM 36779 AP68 MF595224 MF595294 MF595374 – MF595127  Auchenipterus demerarae ROM 84014 4348 MF595225 MF595295 MF595375 MF595454 MF595128  Auchenipterus dentatus ROM 85886 6312 MF595226 – MF595376 MF595455 MF595129  Auchenipterus nigripinnis MCP 28904 – MF595205 MF595296 – MF595456 MF595130  Auchenipterus osteomystax MCP 45011 – – – MF595377 MF595457 MF595131  Centromochlus heckelii UFRO-I 9594 4106 – MF595299 MF595381 MF595461 MF595136  Centromochlus macracanthus ROM 94568 9743 MF595229 – MF595382 MF595462 MF595137  Centromochlus meridionalis MCP 32975 – MF595230 MF595300 MF595383 MF595509 –  Centromochlus orca MCP 49879 219 MF595280 MF595344 MF595421 – MF595185  Centromochlus perugiae MCP 45749 – MF595231 MF595302 MF595385 – MF595139  Centromochlus perugiae B MUSM 36874 AP129 MF595207 MF595301 MF595384 – MF595138  Centromochlus reticulatus AUM 43534 P4727 MF595233 MF595304 MF595387 MF595464 MF595141  Centromochlus romani LBP 9945 46689 MF595232 MF595303 MF595386 MF595463 MF595140  Centromochlus schultzi MCP 47746 – MF595234 MF595305 – MF595465 MF595142  Entomocorus benjamini MCP 35774 – – – MF595390 – MF595147  Entomocorus radiosus MCP 35903 – MF595238 MF595308 MF595391 – MF595148  Epapterus dispilurus UFRO-I 10937 4841 MF595239 MF595309 MF595392 MF595469 MF595149  Gelanoglanis nanonocticolus ANSP 191344 – MF595241 MF595311 – – MF595152  Gelanoglanis sp. 1 Peru MUSM 46912 – MF595242 MF595312 MF595393 MF595471 MF595153  Gelanoglanis sp. 2 Peru ANSP 178425 – MF595243 MF595313 MF595394 – –  Glanidium leopardum ANSP 189104 7034 MF595246 MF595316 MF595397 – KC555871*a  Glanidium melanopterum LBP 6458 29124 – MF595317 – – –  Glanidium RS 1 MCP 28582 – – MF595318 – – MF595156  Glanidium RS 2 MCP 25462 – MF595247 MF595319 – – –  Liosomadoras oncinus MCP 46029 – MF595249 MF595321 MF595399 MF595474 MF595158  Pseudauchenipterus affinis MCP 48066 – – MF595325 – MF595479 –  Pseudauchenipterus nodosus ROM 66351 5053 MF595254 MF595326 MF595403 MF595478 MF595165  Pseudepapterus cucuhyensis MCP 51618 217 MH285825 – – – –  Pseudepapterus hasemani LBP 9401 42552 MF595255 MF595327 MF595404 – MF595166 ANSP 178311 1573  Spinipterus acsi UFRGS 21671 6598 – – – MF595442 MF595171  Spinipterus sp. ‘oncinha’ INPA, uncataloged – MF595260 MF595331 MF595407 MF595483 MF595172  Tatia aulopygia UFRO 3170 787 MF595268 MF595340 MF595417 – MF595181  Tatia brunnea ROM 94111 9235 – MF595341 MF595418 – MF595182  Tatia carolae USNM 401511 GY11-2–29 MF595269 MF595342 MF595419 – MF595183  Tatia caxiuanensis LBP 9324 43842 MF595270 MF595343 MF595420 – MF595184  Tatia intermedia ROM 86248 6450 MF595272 MF595346 MF595423 MF595491 MF595187  Tatia neivai LBP 7356 34797 MF595273 MF595347 MF595424 MF595188  Tatia nigra MCP 46028 – MF595274 MF595348 MF595425 MF595492 MF595189  Tatia sp. 2 MCP 46589 – MF595271 MF595345 MF595422 MF595186  Tetranematichthys wallacei LBP 4096 23543 MF595275 MF595349 MF595426 MF595493 MF595190  Tocantinsia piresi ANSP 193048 B2107 MF595276 MF595350 MF595427 MF595494 MF595191  Trachelyichthys exilis ANSP 178212 1525 MF595277 MF595351 MF595361 MF595441 MF595192 ANSP 190499 101  Trachelyopterichthys taeniatus MCP 46032 – MF595278 – MF595428 MF595495 MF595194 UFRO-I 8373 1992  Trachelyopterus albicrux MCP 26674 – MF595262 MF595332 MF595409 MF595485 MF595174  Trachelyopterus coriaceus LBP 11054 50662 – MF595333 MF595410 MF595486 MF595175  Trachelyopterus galeatus MHNG 2595.066 GF98028 MF595264 MF595335 DQ492352*b MF595487 MF595177 MHNG 2608.013 GF98029  Trachelyopterus cf. Trachelyopterus galeatus UFRO-I 2069 421 MF595263 MF595334 MF595411 – MF595176  Trachelyopterus lucenai MCP 53164 C-153 MF595265 MF595336 MF595413 MF595488 MF595178 MCP 28976 –  Trachelyopterus porosus LBP 12 3544 MF595266 MF595337 MF595414 MF595489 –  Trachelyopterus striatulus LBP 2373 16060 GU702097*c – – – –  Trachelyopterus teaguei MCP 46981 – – MF595339 MF595416 – MF595180  Trachycorystes trachycorystes MCP 46026 – – – MF595429 MF595496 MF595195  Tympanopleura atronasus UFRO-I 5170 4049 – MF595354 MF595431 MF595498 MF595197  Tympanopleura brevis UFRO-I uncataloged 1002 MF595210 MF595355 MF595432 MF595499 MF595198  Tympanopleura cryptica UFRO-I uncataloged 3978 MF595209 MF595356 MF595500 MF595199  Tympanopleura longipinna UFRO-I uncataloged 10283 MF595214 MF595357 MF595433 MF595501 MF595200  Tympanopleura piperata ROM 86042 6989 MF595216 MF595358 MF595434 MF595502 MF595201  Tympanopleura rondoni MCP 46994 C-128 MF595218 MF595359 MF595435 – MF595202  Tympanopleura sp.1 LBP 10573 49290 – MF595285 MF595367 MF595446 MF595118 Ariidae  Cathorops spixii LBP 2918 18775 MF595235 MF595306 MF595388 MF595466 MF595143  Genidens barbus Uncataloged – MF595244 MF595314 FJ626006*d MF595472 MF595154  Genidens genidens LBP 2338 11301 JQ365364*e MF595315 FJ013211*f MF595473 MF595155 Aspredinidae  Aspredo aspredo ANSP 191475 JGL 205 KC555595*a MF595292 – MF595452 MF595125  Bunocephalus doriae MCP 25223/ UFRGS 16333 –/ TEC2771 MF595228 MF489484*g – MF595460 MF595135  Pseudobunocephalus iheringii MCP 21656 WAS061 MF595256 MF595328 – – MF595167  Pseudobunocephalus rugosus ANSP 185102 A5067 MF595257 MF489520*g MF595405 MF595480 MF595168  Pterobunocephalus depressus LBP 14063 58424 MF595258 – – MF595481 MF595169 Cetopsidae  Helogenes marmoratus MCP 46997 – MF595248 MF595320 DQ492421*b MF595506 MF595157 Diplomystidae  Diplomystes camposensis LBP 3106 19770 MF595236 – – MF595467 MF595145  Diplomystes mesembrinus LBP 449 5813/581 MF595237 – MF595389 MF595468 MF595146 Doradidae  Acanthodoras cataphractus ANSP 182251 6060 MF595208 MF595281 MF595362 – MF595112  Anadoras grypus ANSP 179473 – MF595221 MF595291 MF595372 MF595451 MF595124  Franciscodoras marmoratus LBP 272 4193 MF595240 MF595310 – MF595470 MF595151  Megalodoras uranoscopus ANSP 78249 1685 MF595250 MF595322 – MF595475 MF595159  Nemadoras humeralis ANSP 182596 6301 MF595251 MF595323 MF595400 MF595476 MF595162  Oxydoras niger ANSP 181080 6056 KC555672*a MF595324 MF595401 MF595477 MF595163  Rhynchodoras woodsi ANSP 181042 6061 MF595259 MF595330 MF595406 MF595482 MF595170  Trachydoras nattereri ANSP 182593 6313 MF595279 MF595353 MF595430 MF595497 MF595196  Wertheimeria maculata MCP 43855 – KC555709*a – – – KC555963*a Mochokidae  Atopochilus savorgnani CUMV 95141 – – – MF595440 MF595510 –  Euchilichthys dybowskii CUMV 91375 – MF595204 – MF595438 MF595507 MF595150  Chiloglanis disneyi CUMV 93183 – – MF595307 MF595439 MF595508 MF595144  Mochokiella paynei CUMV 91904 – – – MF595437 MF595505 MF595160  Mochokus niloticus CUMV 91385/94765 – – – MF595436 MF595504 MF595161  Synodontis petricola MCP 48136 V MF595261 – MF595408 MF595484 MF595173 Pimelodidae  Pimelodus tetramerus MCP 33091 678 – – – MF595503 MF595164  Pimelodus maculatus MCP 28421 – GU701571*h – JF898777*i – – Family taxon Voucher catalogue number Tissue identifier coI myh6 rag2 SH3PX3 16S Auchenipteridae  Ageneiosus akamai MCP 46990 C-105 MF595206 MF595282 MF595363 MF595443 MF595113  Ageneiosus dentatus INPA 35533 – MF595213 MF595283 MF595365 – MF595116  Ageneiosus inermis UFRO-I 8711 3438 – MF595284 MF595366 MF595445 MF595117  Ageneiosus militaris MCP 28423 – MF595215 MF595286 – MF595447 MF595119  Ageneiosus militaris B MCP 26681 – MF595211 – MF595364 MF595444 MF595114  Ageneiosus polystictus ROM 66265 5010 MF595217 MF595287 MF595368 MF595448 MF595120  Ageneiosus polystictus B ROM 86418 7036 MF595212 – – – MF595115  Ageneiosus ucayalensis MUSM 36932 AP146 MF595219 MF595288 MF595369 MF595449 MF595121  Ageneiosus uranophthalmus UFRO-I 17223 8482 – MF595289 MF595370 – MF595122  Ageneiosus vittatus UFRO-I uncataloged 3497 MF595220 MF595290 MF595371 MF595450 MF595123  Auchenipterichthys coracoideus MCP 46293 – – – MF595378 MF595458 MF595132  Auchenipterichthys longimanus MCP 46593 – MF595227 MF595297 MF595379 MF595459 MF595133  Auchenipterichthys punctatus LBP 4442 24314 – – MF595380 – MF595134  Auchenipterus ambyiacus UFRO-I 9593 4072 MF595223 MF595293 MF595373 MF595453 MF595126  Auchenipterus brachyurus MUSM 36779 AP68 MF595224 MF595294 MF595374 – MF595127  Auchenipterus demerarae ROM 84014 4348 MF595225 MF595295 MF595375 MF595454 MF595128  Auchenipterus dentatus ROM 85886 6312 MF595226 – MF595376 MF595455 MF595129  Auchenipterus nigripinnis MCP 28904 – MF595205 MF595296 – MF595456 MF595130  Auchenipterus osteomystax MCP 45011 – – – MF595377 MF595457 MF595131  Centromochlus heckelii UFRO-I 9594 4106 – MF595299 MF595381 MF595461 MF595136  Centromochlus macracanthus ROM 94568 9743 MF595229 – MF595382 MF595462 MF595137  Centromochlus meridionalis MCP 32975 – MF595230 MF595300 MF595383 MF595509 –  Centromochlus orca MCP 49879 219 MF595280 MF595344 MF595421 – MF595185  Centromochlus perugiae MCP 45749 – MF595231 MF595302 MF595385 – MF595139  Centromochlus perugiae B MUSM 36874 AP129 MF595207 MF595301 MF595384 – MF595138  Centromochlus reticulatus AUM 43534 P4727 MF595233 MF595304 MF595387 MF595464 MF595141  Centromochlus romani LBP 9945 46689 MF595232 MF595303 MF595386 MF595463 MF595140  Centromochlus schultzi MCP 47746 – MF595234 MF595305 – MF595465 MF595142  Entomocorus benjamini MCP 35774 – – – MF595390 – MF595147  Entomocorus radiosus MCP 35903 – MF595238 MF595308 MF595391 – MF595148  Epapterus dispilurus UFRO-I 10937 4841 MF595239 MF595309 MF595392 MF595469 MF595149  Gelanoglanis nanonocticolus ANSP 191344 – MF595241 MF595311 – – MF595152  Gelanoglanis sp. 1 Peru MUSM 46912 – MF595242 MF595312 MF595393 MF595471 MF595153  Gelanoglanis sp. 2 Peru ANSP 178425 – MF595243 MF595313 MF595394 – –  Glanidium leopardum ANSP 189104 7034 MF595246 MF595316 MF595397 – KC555871*a  Glanidium melanopterum LBP 6458 29124 – MF595317 – – –  Glanidium RS 1 MCP 28582 – – MF595318 – – MF595156  Glanidium RS 2 MCP 25462 – MF595247 MF595319 – – –  Liosomadoras oncinus MCP 46029 – MF595249 MF595321 MF595399 MF595474 MF595158  Pseudauchenipterus affinis MCP 48066 – – MF595325 – MF595479 –  Pseudauchenipterus nodosus ROM 66351 5053 MF595254 MF595326 MF595403 MF595478 MF595165  Pseudepapterus cucuhyensis MCP 51618 217 MH285825 – – – –  Pseudepapterus hasemani LBP 9401 42552 MF595255 MF595327 MF595404 – MF595166 ANSP 178311 1573  Spinipterus acsi UFRGS 21671 6598 – – – MF595442 MF595171  Spinipterus sp. ‘oncinha’ INPA, uncataloged – MF595260 MF595331 MF595407 MF595483 MF595172  Tatia aulopygia UFRO 3170 787 MF595268 MF595340 MF595417 – MF595181  Tatia brunnea ROM 94111 9235 – MF595341 MF595418 – MF595182  Tatia carolae USNM 401511 GY11-2–29 MF595269 MF595342 MF595419 – MF595183  Tatia caxiuanensis LBP 9324 43842 MF595270 MF595343 MF595420 – MF595184  Tatia intermedia ROM 86248 6450 MF595272 MF595346 MF595423 MF595491 MF595187  Tatia neivai LBP 7356 34797 MF595273 MF595347 MF595424 MF595188  Tatia nigra MCP 46028 – MF595274 MF595348 MF595425 MF595492 MF595189  Tatia sp. 2 MCP 46589 – MF595271 MF595345 MF595422 MF595186  Tetranematichthys wallacei LBP 4096 23543 MF595275 MF595349 MF595426 MF595493 MF595190  Tocantinsia piresi ANSP 193048 B2107 MF595276 MF595350 MF595427 MF595494 MF595191  Trachelyichthys exilis ANSP 178212 1525 MF595277 MF595351 MF595361 MF595441 MF595192 ANSP 190499 101  Trachelyopterichthys taeniatus MCP 46032 – MF595278 – MF595428 MF595495 MF595194 UFRO-I 8373 1992  Trachelyopterus albicrux MCP 26674 – MF595262 MF595332 MF595409 MF595485 MF595174  Trachelyopterus coriaceus LBP 11054 50662 – MF595333 MF595410 MF595486 MF595175  Trachelyopterus galeatus MHNG 2595.066 GF98028 MF595264 MF595335 DQ492352*b MF595487 MF595177 MHNG 2608.013 GF98029  Trachelyopterus cf. Trachelyopterus galeatus UFRO-I 2069 421 MF595263 MF595334 MF595411 – MF595176  Trachelyopterus lucenai MCP 53164 C-153 MF595265 MF595336 MF595413 MF595488 MF595178 MCP 28976 –  Trachelyopterus porosus LBP 12 3544 MF595266 MF595337 MF595414 MF595489 –  Trachelyopterus striatulus LBP 2373 16060 GU702097*c – – – –  Trachelyopterus teaguei MCP 46981 – – MF595339 MF595416 – MF595180  Trachycorystes trachycorystes MCP 46026 – – – MF595429 MF595496 MF595195  Tympanopleura atronasus UFRO-I 5170 4049 – MF595354 MF595431 MF595498 MF595197  Tympanopleura brevis UFRO-I uncataloged 1002 MF595210 MF595355 MF595432 MF595499 MF595198  Tympanopleura cryptica UFRO-I uncataloged 3978 MF595209 MF595356 MF595500 MF595199  Tympanopleura longipinna UFRO-I uncataloged 10283 MF595214 MF595357 MF595433 MF595501 MF595200  Tympanopleura piperata ROM 86042 6989 MF595216 MF595358 MF595434 MF595502 MF595201  Tympanopleura rondoni MCP 46994 C-128 MF595218 MF595359 MF595435 – MF595202  Tympanopleura sp.1 LBP 10573 49290 – MF595285 MF595367 MF595446 MF595118 Ariidae  Cathorops spixii LBP 2918 18775 MF595235 MF595306 MF595388 MF595466 MF595143  Genidens barbus Uncataloged – MF595244 MF595314 FJ626006*d MF595472 MF595154  Genidens genidens LBP 2338 11301 JQ365364*e MF595315 FJ013211*f MF595473 MF595155 Aspredinidae  Aspredo aspredo ANSP 191475 JGL 205 KC555595*a MF595292 – MF595452 MF595125  Bunocephalus doriae MCP 25223/ UFRGS 16333 –/ TEC2771 MF595228 MF489484*g – MF595460 MF595135  Pseudobunocephalus iheringii MCP 21656 WAS061 MF595256 MF595328 – – MF595167  Pseudobunocephalus rugosus ANSP 185102 A5067 MF595257 MF489520*g MF595405 MF595480 MF595168  Pterobunocephalus depressus LBP 14063 58424 MF595258 – – MF595481 MF595169 Cetopsidae  Helogenes marmoratus MCP 46997 – MF595248 MF595320 DQ492421*b MF595506 MF595157 Diplomystidae  Diplomystes camposensis LBP 3106 19770 MF595236 – – MF595467 MF595145  Diplomystes mesembrinus LBP 449 5813/581 MF595237 – MF595389 MF595468 MF595146 Doradidae  Acanthodoras cataphractus ANSP 182251 6060 MF595208 MF595281 MF595362 – MF595112  Anadoras grypus ANSP 179473 – MF595221 MF595291 MF595372 MF595451 MF595124  Franciscodoras marmoratus LBP 272 4193 MF595240 MF595310 – MF595470 MF595151  Megalodoras uranoscopus ANSP 78249 1685 MF595250 MF595322 – MF595475 MF595159  Nemadoras humeralis ANSP 182596 6301 MF595251 MF595323 MF595400 MF595476 MF595162  Oxydoras niger ANSP 181080 6056 KC555672*a MF595324 MF595401 MF595477 MF595163  Rhynchodoras woodsi ANSP 181042 6061 MF595259 MF595330 MF595406 MF595482 MF595170  Trachydoras nattereri ANSP 182593 6313 MF595279 MF595353 MF595430 MF595497 MF595196  Wertheimeria maculata MCP 43855 – KC555709*a – – – KC555963*a Mochokidae  Atopochilus savorgnani CUMV 95141 – – – MF595440 MF595510 –  Euchilichthys dybowskii CUMV 91375 – MF595204 – MF595438 MF595507 MF595150  Chiloglanis disneyi CUMV 93183 – – MF595307 MF595439 MF595508 MF595144  Mochokiella paynei CUMV 91904 – – – MF595437 MF595505 MF595160  Mochokus niloticus CUMV 91385/94765 – – – MF595436 MF595504 MF595161  Synodontis petricola MCP 48136 V MF595261 – MF595408 MF595484 MF595173 Pimelodidae  Pimelodus tetramerus MCP 33091 678 – – – MF595503 MF595164  Pimelodus maculatus MCP 28421 – GU701571*h – JF898777*i – – All sequences were generated in the present study, except those accession numbers in bold type and followed by an asterisk. *aArce et al. (2013); *bSullivan et al. (2006); *cPereira et al. (2011); *dBetancur-R (2009); *eRibeiro et al. (2012); *fBetancur-R & Armbruster (2009); *gCarvalho et al. (2018); *hPereira et al. (2013); *iLundberg et al. (2011). Open in new tab Table 2. Voucher catalogue number, tissue identifier number and GenBank accession numbers for all sequence samples analysed Family taxon Voucher catalogue number Tissue identifier coI myh6 rag2 SH3PX3 16S Auchenipteridae  Ageneiosus akamai MCP 46990 C-105 MF595206 MF595282 MF595363 MF595443 MF595113  Ageneiosus dentatus INPA 35533 – MF595213 MF595283 MF595365 – MF595116  Ageneiosus inermis UFRO-I 8711 3438 – MF595284 MF595366 MF595445 MF595117  Ageneiosus militaris MCP 28423 – MF595215 MF595286 – MF595447 MF595119  Ageneiosus militaris B MCP 26681 – MF595211 – MF595364 MF595444 MF595114  Ageneiosus polystictus ROM 66265 5010 MF595217 MF595287 MF595368 MF595448 MF595120  Ageneiosus polystictus B ROM 86418 7036 MF595212 – – – MF595115  Ageneiosus ucayalensis MUSM 36932 AP146 MF595219 MF595288 MF595369 MF595449 MF595121  Ageneiosus uranophthalmus UFRO-I 17223 8482 – MF595289 MF595370 – MF595122  Ageneiosus vittatus UFRO-I uncataloged 3497 MF595220 MF595290 MF595371 MF595450 MF595123  Auchenipterichthys coracoideus MCP 46293 – – – MF595378 MF595458 MF595132  Auchenipterichthys longimanus MCP 46593 – MF595227 MF595297 MF595379 MF595459 MF595133  Auchenipterichthys punctatus LBP 4442 24314 – – MF595380 – MF595134  Auchenipterus ambyiacus UFRO-I 9593 4072 MF595223 MF595293 MF595373 MF595453 MF595126  Auchenipterus brachyurus MUSM 36779 AP68 MF595224 MF595294 MF595374 – MF595127  Auchenipterus demerarae ROM 84014 4348 MF595225 MF595295 MF595375 MF595454 MF595128  Auchenipterus dentatus ROM 85886 6312 MF595226 – MF595376 MF595455 MF595129  Auchenipterus nigripinnis MCP 28904 – MF595205 MF595296 – MF595456 MF595130  Auchenipterus osteomystax MCP 45011 – – – MF595377 MF595457 MF595131  Centromochlus heckelii UFRO-I 9594 4106 – MF595299 MF595381 MF595461 MF595136  Centromochlus macracanthus ROM 94568 9743 MF595229 – MF595382 MF595462 MF595137  Centromochlus meridionalis MCP 32975 – MF595230 MF595300 MF595383 MF595509 –  Centromochlus orca MCP 49879 219 MF595280 MF595344 MF595421 – MF595185  Centromochlus perugiae MCP 45749 – MF595231 MF595302 MF595385 – MF595139  Centromochlus perugiae B MUSM 36874 AP129 MF595207 MF595301 MF595384 – MF595138  Centromochlus reticulatus AUM 43534 P4727 MF595233 MF595304 MF595387 MF595464 MF595141  Centromochlus romani LBP 9945 46689 MF595232 MF595303 MF595386 MF595463 MF595140  Centromochlus schultzi MCP 47746 – MF595234 MF595305 – MF595465 MF595142  Entomocorus benjamini MCP 35774 – – – MF595390 – MF595147  Entomocorus radiosus MCP 35903 – MF595238 MF595308 MF595391 – MF595148  Epapterus dispilurus UFRO-I 10937 4841 MF595239 MF595309 MF595392 MF595469 MF595149  Gelanoglanis nanonocticolus ANSP 191344 – MF595241 MF595311 – – MF595152  Gelanoglanis sp. 1 Peru MUSM 46912 – MF595242 MF595312 MF595393 MF595471 MF595153  Gelanoglanis sp. 2 Peru ANSP 178425 – MF595243 MF595313 MF595394 – –  Glanidium leopardum ANSP 189104 7034 MF595246 MF595316 MF595397 – KC555871*a  Glanidium melanopterum LBP 6458 29124 – MF595317 – – –  Glanidium RS 1 MCP 28582 – – MF595318 – – MF595156  Glanidium RS 2 MCP 25462 – MF595247 MF595319 – – –  Liosomadoras oncinus MCP 46029 – MF595249 MF595321 MF595399 MF595474 MF595158  Pseudauchenipterus affinis MCP 48066 – – MF595325 – MF595479 –  Pseudauchenipterus nodosus ROM 66351 5053 MF595254 MF595326 MF595403 MF595478 MF595165  Pseudepapterus cucuhyensis MCP 51618 217 MH285825 – – – –  Pseudepapterus hasemani LBP 9401 42552 MF595255 MF595327 MF595404 – MF595166 ANSP 178311 1573  Spinipterus acsi UFRGS 21671 6598 – – – MF595442 MF595171  Spinipterus sp. ‘oncinha’ INPA, uncataloged – MF595260 MF595331 MF595407 MF595483 MF595172  Tatia aulopygia UFRO 3170 787 MF595268 MF595340 MF595417 – MF595181  Tatia brunnea ROM 94111 9235 – MF595341 MF595418 – MF595182  Tatia carolae USNM 401511 GY11-2–29 MF595269 MF595342 MF595419 – MF595183  Tatia caxiuanensis LBP 9324 43842 MF595270 MF595343 MF595420 – MF595184  Tatia intermedia ROM 86248 6450 MF595272 MF595346 MF595423 MF595491 MF595187  Tatia neivai LBP 7356 34797 MF595273 MF595347 MF595424 MF595188  Tatia nigra MCP 46028 – MF595274 MF595348 MF595425 MF595492 MF595189  Tatia sp. 2 MCP 46589 – MF595271 MF595345 MF595422 MF595186  Tetranematichthys wallacei LBP 4096 23543 MF595275 MF595349 MF595426 MF595493 MF595190  Tocantinsia piresi ANSP 193048 B2107 MF595276 MF595350 MF595427 MF595494 MF595191  Trachelyichthys exilis ANSP 178212 1525 MF595277 MF595351 MF595361 MF595441 MF595192 ANSP 190499 101  Trachelyopterichthys taeniatus MCP 46032 – MF595278 – MF595428 MF595495 MF595194 UFRO-I 8373 1992  Trachelyopterus albicrux MCP 26674 – MF595262 MF595332 MF595409 MF595485 MF595174  Trachelyopterus coriaceus LBP 11054 50662 – MF595333 MF595410 MF595486 MF595175  Trachelyopterus galeatus MHNG 2595.066 GF98028 MF595264 MF595335 DQ492352*b MF595487 MF595177 MHNG 2608.013 GF98029  Trachelyopterus cf. Trachelyopterus galeatus UFRO-I 2069 421 MF595263 MF595334 MF595411 – MF595176  Trachelyopterus lucenai MCP 53164 C-153 MF595265 MF595336 MF595413 MF595488 MF595178 MCP 28976 –  Trachelyopterus porosus LBP 12 3544 MF595266 MF595337 MF595414 MF595489 –  Trachelyopterus striatulus LBP 2373 16060 GU702097*c – – – –  Trachelyopterus teaguei MCP 46981 – – MF595339 MF595416 – MF595180  Trachycorystes trachycorystes MCP 46026 – – – MF595429 MF595496 MF595195  Tympanopleura atronasus UFRO-I 5170 4049 – MF595354 MF595431 MF595498 MF595197  Tympanopleura brevis UFRO-I uncataloged 1002 MF595210 MF595355 MF595432 MF595499 MF595198  Tympanopleura cryptica UFRO-I uncataloged 3978 MF595209 MF595356 MF595500 MF595199  Tympanopleura longipinna UFRO-I uncataloged 10283 MF595214 MF595357 MF595433 MF595501 MF595200  Tympanopleura piperata ROM 86042 6989 MF595216 MF595358 MF595434 MF595502 MF595201  Tympanopleura rondoni MCP 46994 C-128 MF595218 MF595359 MF595435 – MF595202  Tympanopleura sp.1 LBP 10573 49290 – MF595285 MF595367 MF595446 MF595118 Ariidae  Cathorops spixii LBP 2918 18775 MF595235 MF595306 MF595388 MF595466 MF595143  Genidens barbus Uncataloged – MF595244 MF595314 FJ626006*d MF595472 MF595154  Genidens genidens LBP 2338 11301 JQ365364*e MF595315 FJ013211*f MF595473 MF595155 Aspredinidae  Aspredo aspredo ANSP 191475 JGL 205 KC555595*a MF595292 – MF595452 MF595125  Bunocephalus doriae MCP 25223/ UFRGS 16333 –/ TEC2771 MF595228 MF489484*g – MF595460 MF595135  Pseudobunocephalus iheringii MCP 21656 WAS061 MF595256 MF595328 – – MF595167  Pseudobunocephalus rugosus ANSP 185102 A5067 MF595257 MF489520*g MF595405 MF595480 MF595168  Pterobunocephalus depressus LBP 14063 58424 MF595258 – – MF595481 MF595169 Cetopsidae  Helogenes marmoratus MCP 46997 – MF595248 MF595320 DQ492421*b MF595506 MF595157 Diplomystidae  Diplomystes camposensis LBP 3106 19770 MF595236 – – MF595467 MF595145  Diplomystes mesembrinus LBP 449 5813/581 MF595237 – MF595389 MF595468 MF595146 Doradidae  Acanthodoras cataphractus ANSP 182251 6060 MF595208 MF595281 MF595362 – MF595112  Anadoras grypus ANSP 179473 – MF595221 MF595291 MF595372 MF595451 MF595124  Franciscodoras marmoratus LBP 272 4193 MF595240 MF595310 – MF595470 MF595151  Megalodoras uranoscopus ANSP 78249 1685 MF595250 MF595322 – MF595475 MF595159  Nemadoras humeralis ANSP 182596 6301 MF595251 MF595323 MF595400 MF595476 MF595162  Oxydoras niger ANSP 181080 6056 KC555672*a MF595324 MF595401 MF595477 MF595163  Rhynchodoras woodsi ANSP 181042 6061 MF595259 MF595330 MF595406 MF595482 MF595170  Trachydoras nattereri ANSP 182593 6313 MF595279 MF595353 MF595430 MF595497 MF595196  Wertheimeria maculata MCP 43855 – KC555709*a – – – KC555963*a Mochokidae  Atopochilus savorgnani CUMV 95141 – – – MF595440 MF595510 –  Euchilichthys dybowskii CUMV 91375 – MF595204 – MF595438 MF595507 MF595150  Chiloglanis disneyi CUMV 93183 – – MF595307 MF595439 MF595508 MF595144  Mochokiella paynei CUMV 91904 – – – MF595437 MF595505 MF595160  Mochokus niloticus CUMV 91385/94765 – – – MF595436 MF595504 MF595161  Synodontis petricola MCP 48136 V MF595261 – MF595408 MF595484 MF595173 Pimelodidae  Pimelodus tetramerus MCP 33091 678 – – – MF595503 MF595164  Pimelodus maculatus MCP 28421 – GU701571*h – JF898777*i – – Family taxon Voucher catalogue number Tissue identifier coI myh6 rag2 SH3PX3 16S Auchenipteridae  Ageneiosus akamai MCP 46990 C-105 MF595206 MF595282 MF595363 MF595443 MF595113  Ageneiosus dentatus INPA 35533 – MF595213 MF595283 MF595365 – MF595116  Ageneiosus inermis UFRO-I 8711 3438 – MF595284 MF595366 MF595445 MF595117  Ageneiosus militaris MCP 28423 – MF595215 MF595286 – MF595447 MF595119  Ageneiosus militaris B MCP 26681 – MF595211 – MF595364 MF595444 MF595114  Ageneiosus polystictus ROM 66265 5010 MF595217 MF595287 MF595368 MF595448 MF595120  Ageneiosus polystictus B ROM 86418 7036 MF595212 – – – MF595115  Ageneiosus ucayalensis MUSM 36932 AP146 MF595219 MF595288 MF595369 MF595449 MF595121  Ageneiosus uranophthalmus UFRO-I 17223 8482 – MF595289 MF595370 – MF595122  Ageneiosus vittatus UFRO-I uncataloged 3497 MF595220 MF595290 MF595371 MF595450 MF595123  Auchenipterichthys coracoideus MCP 46293 – – – MF595378 MF595458 MF595132  Auchenipterichthys longimanus MCP 46593 – MF595227 MF595297 MF595379 MF595459 MF595133  Auchenipterichthys punctatus LBP 4442 24314 – – MF595380 – MF595134  Auchenipterus ambyiacus UFRO-I 9593 4072 MF595223 MF595293 MF595373 MF595453 MF595126  Auchenipterus brachyurus MUSM 36779 AP68 MF595224 MF595294 MF595374 – MF595127  Auchenipterus demerarae ROM 84014 4348 MF595225 MF595295 MF595375 MF595454 MF595128  Auchenipterus dentatus ROM 85886 6312 MF595226 – MF595376 MF595455 MF595129  Auchenipterus nigripinnis MCP 28904 – MF595205 MF595296 – MF595456 MF595130  Auchenipterus osteomystax MCP 45011 – – – MF595377 MF595457 MF595131  Centromochlus heckelii UFRO-I 9594 4106 – MF595299 MF595381 MF595461 MF595136  Centromochlus macracanthus ROM 94568 9743 MF595229 – MF595382 MF595462 MF595137  Centromochlus meridionalis MCP 32975 – MF595230 MF595300 MF595383 MF595509 –  Centromochlus orca MCP 49879 219 MF595280 MF595344 MF595421 – MF595185  Centromochlus perugiae MCP 45749 – MF595231 MF595302 MF595385 – MF595139  Centromochlus perugiae B MUSM 36874 AP129 MF595207 MF595301 MF595384 – MF595138  Centromochlus reticulatus AUM 43534 P4727 MF595233 MF595304 MF595387 MF595464 MF595141  Centromochlus romani LBP 9945 46689 MF595232 MF595303 MF595386 MF595463 MF595140  Centromochlus schultzi MCP 47746 – MF595234 MF595305 – MF595465 MF595142  Entomocorus benjamini MCP 35774 – – – MF595390 – MF595147  Entomocorus radiosus MCP 35903 – MF595238 MF595308 MF595391 – MF595148  Epapterus dispilurus UFRO-I 10937 4841 MF595239 MF595309 MF595392 MF595469 MF595149  Gelanoglanis nanonocticolus ANSP 191344 – MF595241 MF595311 – – MF595152  Gelanoglanis sp. 1 Peru MUSM 46912 – MF595242 MF595312 MF595393 MF595471 MF595153  Gelanoglanis sp. 2 Peru ANSP 178425 – MF595243 MF595313 MF595394 – –  Glanidium leopardum ANSP 189104 7034 MF595246 MF595316 MF595397 – KC555871*a  Glanidium melanopterum LBP 6458 29124 – MF595317 – – –  Glanidium RS 1 MCP 28582 – – MF595318 – – MF595156  Glanidium RS 2 MCP 25462 – MF595247 MF595319 – – –  Liosomadoras oncinus MCP 46029 – MF595249 MF595321 MF595399 MF595474 MF595158  Pseudauchenipterus affinis MCP 48066 – – MF595325 – MF595479 –  Pseudauchenipterus nodosus ROM 66351 5053 MF595254 MF595326 MF595403 MF595478 MF595165  Pseudepapterus cucuhyensis MCP 51618 217 MH285825 – – – –  Pseudepapterus hasemani LBP 9401 42552 MF595255 MF595327 MF595404 – MF595166 ANSP 178311 1573  Spinipterus acsi UFRGS 21671 6598 – – – MF595442 MF595171  Spinipterus sp. ‘oncinha’ INPA, uncataloged – MF595260 MF595331 MF595407 MF595483 MF595172  Tatia aulopygia UFRO 3170 787 MF595268 MF595340 MF595417 – MF595181  Tatia brunnea ROM 94111 9235 – MF595341 MF595418 – MF595182  Tatia carolae USNM 401511 GY11-2–29 MF595269 MF595342 MF595419 – MF595183  Tatia caxiuanensis LBP 9324 43842 MF595270 MF595343 MF595420 – MF595184  Tatia intermedia ROM 86248 6450 MF595272 MF595346 MF595423 MF595491 MF595187  Tatia neivai LBP 7356 34797 MF595273 MF595347 MF595424 MF595188  Tatia nigra MCP 46028 – MF595274 MF595348 MF595425 MF595492 MF595189  Tatia sp. 2 MCP 46589 – MF595271 MF595345 MF595422 MF595186  Tetranematichthys wallacei LBP 4096 23543 MF595275 MF595349 MF595426 MF595493 MF595190  Tocantinsia piresi ANSP 193048 B2107 MF595276 MF595350 MF595427 MF595494 MF595191  Trachelyichthys exilis ANSP 178212 1525 MF595277 MF595351 MF595361 MF595441 MF595192 ANSP 190499 101  Trachelyopterichthys taeniatus MCP 46032 – MF595278 – MF595428 MF595495 MF595194 UFRO-I 8373 1992  Trachelyopterus albicrux MCP 26674 – MF595262 MF595332 MF595409 MF595485 MF595174  Trachelyopterus coriaceus LBP 11054 50662 – MF595333 MF595410 MF595486 MF595175  Trachelyopterus galeatus MHNG 2595.066 GF98028 MF595264 MF595335 DQ492352*b MF595487 MF595177 MHNG 2608.013 GF98029  Trachelyopterus cf. Trachelyopterus galeatus UFRO-I 2069 421 MF595263 MF595334 MF595411 – MF595176  Trachelyopterus lucenai MCP 53164 C-153 MF595265 MF595336 MF595413 MF595488 MF595178 MCP 28976 –  Trachelyopterus porosus LBP 12 3544 MF595266 MF595337 MF595414 MF595489 –  Trachelyopterus striatulus LBP 2373 16060 GU702097*c – – – –  Trachelyopterus teaguei MCP 46981 – – MF595339 MF595416 – MF595180  Trachycorystes trachycorystes MCP 46026 – – – MF595429 MF595496 MF595195  Tympanopleura atronasus UFRO-I 5170 4049 – MF595354 MF595431 MF595498 MF595197  Tympanopleura brevis UFRO-I uncataloged 1002 MF595210 MF595355 MF595432 MF595499 MF595198  Tympanopleura cryptica UFRO-I uncataloged 3978 MF595209 MF595356 MF595500 MF595199  Tympanopleura longipinna UFRO-I uncataloged 10283 MF595214 MF595357 MF595433 MF595501 MF595200  Tympanopleura piperata ROM 86042 6989 MF595216 MF595358 MF595434 MF595502 MF595201  Tympanopleura rondoni MCP 46994 C-128 MF595218 MF595359 MF595435 – MF595202  Tympanopleura sp.1 LBP 10573 49290 – MF595285 MF595367 MF595446 MF595118 Ariidae  Cathorops spixii LBP 2918 18775 MF595235 MF595306 MF595388 MF595466 MF595143  Genidens barbus Uncataloged – MF595244 MF595314 FJ626006*d MF595472 MF595154  Genidens genidens LBP 2338 11301 JQ365364*e MF595315 FJ013211*f MF595473 MF595155 Aspredinidae  Aspredo aspredo ANSP 191475 JGL 205 KC555595*a MF595292 – MF595452 MF595125  Bunocephalus doriae MCP 25223/ UFRGS 16333 –/ TEC2771 MF595228 MF489484*g – MF595460 MF595135  Pseudobunocephalus iheringii MCP 21656 WAS061 MF595256 MF595328 – – MF595167  Pseudobunocephalus rugosus ANSP 185102 A5067 MF595257 MF489520*g MF595405 MF595480 MF595168  Pterobunocephalus depressus LBP 14063 58424 MF595258 – – MF595481 MF595169 Cetopsidae  Helogenes marmoratus MCP 46997 – MF595248 MF595320 DQ492421*b MF595506 MF595157 Diplomystidae  Diplomystes camposensis LBP 3106 19770 MF595236 – – MF595467 MF595145  Diplomystes mesembrinus LBP 449 5813/581 MF595237 – MF595389 MF595468 MF595146 Doradidae  Acanthodoras cataphractus ANSP 182251 6060 MF595208 MF595281 MF595362 – MF595112  Anadoras grypus ANSP 179473 – MF595221 MF595291 MF595372 MF595451 MF595124  Franciscodoras marmoratus LBP 272 4193 MF595240 MF595310 – MF595470 MF595151  Megalodoras uranoscopus ANSP 78249 1685 MF595250 MF595322 – MF595475 MF595159  Nemadoras humeralis ANSP 182596 6301 MF595251 MF595323 MF595400 MF595476 MF595162  Oxydoras niger ANSP 181080 6056 KC555672*a MF595324 MF595401 MF595477 MF595163  Rhynchodoras woodsi ANSP 181042 6061 MF595259 MF595330 MF595406 MF595482 MF595170  Trachydoras nattereri ANSP 182593 6313 MF595279 MF595353 MF595430 MF595497 MF595196  Wertheimeria maculata MCP 43855 – KC555709*a – – – KC555963*a Mochokidae  Atopochilus savorgnani CUMV 95141 – – – MF595440 MF595510 –  Euchilichthys dybowskii CUMV 91375 – MF595204 – MF595438 MF595507 MF595150  Chiloglanis disneyi CUMV 93183 – – MF595307 MF595439 MF595508 MF595144  Mochokiella paynei CUMV 91904 – – – MF595437 MF595505 MF595160  Mochokus niloticus CUMV 91385/94765 – – – MF595436 MF595504 MF595161  Synodontis petricola MCP 48136 V MF595261 – MF595408 MF595484 MF595173 Pimelodidae  Pimelodus tetramerus MCP 33091 678 – – – MF595503 MF595164  Pimelodus maculatus MCP 28421 – GU701571*h – JF898777*i – – All sequences were generated in the present study, except those accession numbers in bold type and followed by an asterisk. *aArce et al. (2013); *bSullivan et al. (2006); *cPereira et al. (2011); *dBetancur-R (2009); *eRibeiro et al. (2012); *fBetancur-R & Armbruster (2009); *gCarvalho et al. (2018); *hPereira et al. (2013); *iLundberg et al. (2011). Open in new tab Morphological data The osteological nomenclature follows Lundberg & Baskin (1969), including modifications by Bockmann (1998), Britto (2002) and Birindelli (2014). The taxonomic nomenclature used in this study follows the most current classification, summarized by Ferraris (2007), with the necessary updates. To examine characters involving bones and cartilage, the specimens were cleared and double-stained according to a modified protocol of Taylor & van Dyke (1985). When specimens were fragile, bones were stained with Alizarin Red dissolved in 98% ethanol. Skeletons (sk) of larger specimens were also prepared using dermestid beetles. Specimens not available for osteological preparations were submitted to radiography and high-resolution X-ray computed tomography (CT scan) whenever possible. In the morphological Character descriptions section, characters appear numbered from one to 264 (although in the combined data matrix they span from 3490 to 3753) to facilitate presentation and discussion. The numbers of the combined data matrix are also shown in square brackets in the character descriptions. All morphological material examined is listed in the Supporting Information (Appendix S1). Marker selection The molecular markers included in this study were chosen based on previous phylogenies of fishes, including Sullivan et al. (2000, 2006, 2008), Lovejoy & Collette (2001), Hardman (2002, 2004), Lavoué & Sullivan (2004), López et al. (2004), Li et al. (2007), Cramer et al. (2011) and Arce et al. (2013). Polymerase chain reaction (PCR) was used to obtain five fragments: two mitochondrial markers, the large subunit ribosomal RNA gene (16S) and cytochrome oxidase I (coI); and three nuclear markers, nuclear recombinase activating gene-2 (rag2), SH3 and PX3 domain containing three genes (SH3PX3) and myosin, heavy chain 6, cardiac muscle, alpha (myh6). A summary of the primers used and the corresponding authors is presented in Table 3. A specific primer pair for the fragment of rag2 gene was designed for auchenipterids in this study (rag2-AucheF, rag2-AucheR; by B.B.C.). Almost all molecular data used in this study are newly sequenced, with the exceptions shown in Table 2. Table 3. Loci examined with corresponding primer names and sequence, polymerase chain reaction (PCR) steps and author designer Marker/cocktail Primer Primer sequence 5′–3′ PCR steps Reference 16S AR CGCCTGTTTATCAAAAACAT 1st Palumbi et al. (1991) 16S BR CCGGTCTGAACTCAGATCACGT 1st Palumbi et al. (1991) coI LCO1490 GGTCAACAAATCATAAAGATATTGG 1st Folmer et al. (1994) coI HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 1st Folmer et al. (1994) coI /FishF1_t1 VF2_t1 1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 1st Ivanova et al. (2007) coI /FishF1_t1 FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 1st Ivanova et al. (2007) coI /FishR1_t1 FishR2_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 1st Ivanova et al. (2007) coI /FishR1_t1 FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAyCARAA 1st Ivanova et al. (2007) rag2 MGF1 TGyTATCTCCCACCTCTGCGyTACC 1st Hardman (2004) rag2 MHR1 TCATCCTCCTCATCKTCCTCwTTGTA 1st Hardman (2004) rag2 AucheF GCCAGGAGAAAGAKyTGG 1st This study rag2 AucheR ATTCTTGGCTGCATGyCT 1st This study Myh6 F459 CATMTTyTCCATCTCAGATAATGC 1st Li et al. (2007) Myh6 R1325 ATTCTCACCACCATCCAGTTGAA 1st Li et al. (2007) Myh6 F507 GGAGAATCARTCkGTGCTCATCA 2nd Li et al. (2007) Myh6 R1322 CTCACCACCATCCAGTTGAACAT 2nd Li et al. (2007) SH3PX3 F461 GTATGGTSGGCAGGAACYTGAA 1st Li et al. (2007) SH3PX3 R1303 CAAACAKCTCYCCGATGTTCTC 1st Li et al. (2007) SH3PX3 F532 GACGTTCCCATGATGGCWAAAAT 2nd Li et al. (2007) SH3PX3 R1299 CATCTCYCCGATGTTCTCGTA 2nd Li et al. (2007) Marker/cocktail Primer Primer sequence 5′–3′ PCR steps Reference 16S AR CGCCTGTTTATCAAAAACAT 1st Palumbi et al. (1991) 16S BR CCGGTCTGAACTCAGATCACGT 1st Palumbi et al. (1991) coI LCO1490 GGTCAACAAATCATAAAGATATTGG 1st Folmer et al. (1994) coI HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 1st Folmer et al. (1994) coI /FishF1_t1 VF2_t1 1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 1st Ivanova et al. (2007) coI /FishF1_t1 FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 1st Ivanova et al. (2007) coI /FishR1_t1 FishR2_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 1st Ivanova et al. (2007) coI /FishR1_t1 FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAyCARAA 1st Ivanova et al. (2007) rag2 MGF1 TGyTATCTCCCACCTCTGCGyTACC 1st Hardman (2004) rag2 MHR1 TCATCCTCCTCATCKTCCTCwTTGTA 1st Hardman (2004) rag2 AucheF GCCAGGAGAAAGAKyTGG 1st This study rag2 AucheR ATTCTTGGCTGCATGyCT 1st This study Myh6 F459 CATMTTyTCCATCTCAGATAATGC 1st Li et al. (2007) Myh6 R1325 ATTCTCACCACCATCCAGTTGAA 1st Li et al. (2007) Myh6 F507 GGAGAATCARTCkGTGCTCATCA 2nd Li et al. (2007) Myh6 R1322 CTCACCACCATCCAGTTGAACAT 2nd Li et al. (2007) SH3PX3 F461 GTATGGTSGGCAGGAACYTGAA 1st Li et al. (2007) SH3PX3 R1303 CAAACAKCTCYCCGATGTTCTC 1st Li et al. (2007) SH3PX3 F532 GACGTTCCCATGATGGCWAAAAT 2nd Li et al. (2007) SH3PX3 R1299 CATCTCYCCGATGTTCTCGTA 2nd Li et al. (2007) Open in new tab Table 3. Loci examined with corresponding primer names and sequence, polymerase chain reaction (PCR) steps and author designer Marker/cocktail Primer Primer sequence 5′–3′ PCR steps Reference 16S AR CGCCTGTTTATCAAAAACAT 1st Palumbi et al. (1991) 16S BR CCGGTCTGAACTCAGATCACGT 1st Palumbi et al. (1991) coI LCO1490 GGTCAACAAATCATAAAGATATTGG 1st Folmer et al. (1994) coI HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 1st Folmer et al. (1994) coI /FishF1_t1 VF2_t1 1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 1st Ivanova et al. (2007) coI /FishF1_t1 FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 1st Ivanova et al. (2007) coI /FishR1_t1 FishR2_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 1st Ivanova et al. (2007) coI /FishR1_t1 FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAyCARAA 1st Ivanova et al. (2007) rag2 MGF1 TGyTATCTCCCACCTCTGCGyTACC 1st Hardman (2004) rag2 MHR1 TCATCCTCCTCATCKTCCTCwTTGTA 1st Hardman (2004) rag2 AucheF GCCAGGAGAAAGAKyTGG 1st This study rag2 AucheR ATTCTTGGCTGCATGyCT 1st This study Myh6 F459 CATMTTyTCCATCTCAGATAATGC 1st Li et al. (2007) Myh6 R1325 ATTCTCACCACCATCCAGTTGAA 1st Li et al. (2007) Myh6 F507 GGAGAATCARTCkGTGCTCATCA 2nd Li et al. (2007) Myh6 R1322 CTCACCACCATCCAGTTGAACAT 2nd Li et al. (2007) SH3PX3 F461 GTATGGTSGGCAGGAACYTGAA 1st Li et al. (2007) SH3PX3 R1303 CAAACAKCTCYCCGATGTTCTC 1st Li et al. (2007) SH3PX3 F532 GACGTTCCCATGATGGCWAAAAT 2nd Li et al. (2007) SH3PX3 R1299 CATCTCYCCGATGTTCTCGTA 2nd Li et al. (2007) Marker/cocktail Primer Primer sequence 5′–3′ PCR steps Reference 16S AR CGCCTGTTTATCAAAAACAT 1st Palumbi et al. (1991) 16S BR CCGGTCTGAACTCAGATCACGT 1st Palumbi et al. (1991) coI LCO1490 GGTCAACAAATCATAAAGATATTGG 1st Folmer et al. (1994) coI HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 1st Folmer et al. (1994) coI /FishF1_t1 VF2_t1 1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 1st Ivanova et al. (2007) coI /FishF1_t1 FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 1st Ivanova et al. (2007) coI /FishR1_t1 FishR2_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 1st Ivanova et al. (2007) coI /FishR1_t1 FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAyCARAA 1st Ivanova et al. (2007) rag2 MGF1 TGyTATCTCCCACCTCTGCGyTACC 1st Hardman (2004) rag2 MHR1 TCATCCTCCTCATCKTCCTCwTTGTA 1st Hardman (2004) rag2 AucheF GCCAGGAGAAAGAKyTGG 1st This study rag2 AucheR ATTCTTGGCTGCATGyCT 1st This study Myh6 F459 CATMTTyTCCATCTCAGATAATGC 1st Li et al. (2007) Myh6 R1325 ATTCTCACCACCATCCAGTTGAA 1st Li et al. (2007) Myh6 F507 GGAGAATCARTCkGTGCTCATCA 2nd Li et al. (2007) Myh6 R1322 CTCACCACCATCCAGTTGAACAT 2nd Li et al. (2007) SH3PX3 F461 GTATGGTSGGCAGGAACYTGAA 1st Li et al. (2007) SH3PX3 R1303 CAAACAKCTCYCCGATGTTCTC 1st Li et al. (2007) SH3PX3 F532 GACGTTCCCATGATGGCWAAAAT 2nd Li et al. (2007) SH3PX3 R1299 CATCTCYCCGATGTTCTCGTA 2nd Li et al. (2007) Open in new tab DNA extraction, amplification and sequencing Genomic DNA was extracted from muscle tissue and, less often, from fin rays. Tissues were preserved in 98–99.8% ethanol and stored in a freezer at ~−20 °C. Total genomic DNA was isolated using the DNeasy Blood & Tissues Kit (Qiagen) or PureLink Genomic DNA Mini Kit (Invitrogen). All PCRs were performed in 25 µL reactions using 1.25 µL of 10 µM of each primer, 12.5 µL of water, 8 µL of Master Mix Kit (Qiagen) or HotStarTaq Master Mix Kit (Qiagen; 3 µM MgCl2 buffer and 400 µM of each dNTP) and 2 µL (10–50 ng) of DNA extract for mitochondrial genes; or 6 µL of water, 12.5 µL of Master Mix and 4 µL (10–50 ng) of DNA extract for nuclear genes. The first reaction of nested PCRs, used for SH3PX3 and myh6, was performed in 12.5 µL reactions using half quantities of all reagents. The first-choice primers used to amplify the ~614 bp fragment of coI were LCO1490 (forward) and HCO2198 (reverse; Folmer et al., 1994) using the following PCR protocol: an initial denaturation step of 3 min at 95 °C; followed by a first cycle for ten times of denaturation at 95 °C for 60 s, annealing at touchdown temperatures of 50, 48, 46, 44 and 42 °C, for 5 s each, except at 50° and 42 °C for 20 s, and extension at 72°C for 180 s; and 25 repetitions of a second cycle of annealing at 42 °C for 30 s and extension at 72 °C for 180 s; followed by a final extension of 5 min at 72 °C; and storage at 4 °C. Whenever amplifications failed, a second touchdown temperature protocol was used, as follows: initial denaturation at 95 °C for 60 s; 40 repetitions of the cycle of 94 °C for 30 s, 50 °C for 20 s, 48 °C for 5 s, 46 °C for 5 s, 44 °C for 5 s, 42 °C for 5 s, 40 °C for 20 s and 72 °C for 180 s; and final extension at 72 °C for 5 min. Additionally, the alternative primer cocktail used to amplify the 657 bp fragment of coI was COI-3, composed of FishF2_t1 and VF2_t1 (forward) and FishR2_t1 and FR1d_t1 (reverse; Ivanova et al., 2007) using the following PCR conditions: 95 °C for 3 min; 35 cycles of 94 °C for 30 s, 52 °C for 40 s, 72 °C for 1 min; and a final extension at 72 °C for 5 min. The thermocycler conditions for 16S were an initial denaturation step of 3 min at 94 °C; 35 cycles of denaturation at 94 °C for 60 s, annealing temperature at 48 °C for 60 s and extension at 72 °C for 180 s; followed by a final extension of 5 min at 72 °C, and storage at 4 °C. For those samples that were difficult to amplify, an annealing temperature of 40 °C was used with the same protocol. The thermocycler conditions for rag2 primarily followed Lovejoy (2010): an initial denaturation for 1 min at 95 °C; two cycles of denaturation at 95°C for 30 s, touchdown annealing temperatures of 58 °C for 20 s, 56 °C for 5 s, 54 °C for 5 s, 52 °C for 20 s and extension at 72 °C for 3 min; and 32 repetitions of a second cycle with an annealing temperature at 50 °C for 20 s; followed by a final extension of 3 min at 72 °C; and storage at 4 °C. For those samples that were difficult to amplify, a specific primer was designed for the family (rag2-Auche), used with the following thermocycler conditions: initial denaturation step of 15 min at 95 °C; 40 cycles of denaturation at 95 °C for 30 s, annealing temperature at 54 °C for 30 s and extension at 72 °C for 90 s; followed by a final extension of 10 min at 72 °C, and storage at 4 °C. As an alternative, the same PCR protocol as that for the first rag2 primers was used. Amplification of myh6 was performed in a two-stage, nested PCR using 1 µL of the first PCR product, following Li et al. (2007). The thermocycler conditions for the first PCR were an initial denaturation step of 15 min at 95 °C; 30 cycles of denaturation at 95 °C for 60 s, annealing temperature at 53 °C for 60 s and extension at 72 °C for 180 s; followed by a final extension of 10 min at 72 °C, and storage at 4 °C; for the second PCR, the same protocol was used but with an annealing temperature of 62 °C for 60 s. Amplification of SH3PX3 was also performed in a two-stage, nested PCR using 1 µL of the first PCR product, following Li et al. (2007). The thermocycler conditions for the first PCR were an initial denaturation of 15 min at 95 °C; 40 cycles of denaturation at 94 °C for 30 s, annealing temperature at 55 °C for 45 s and extension at 72 °C for 90 s; followed by a final extension of 10 min at 72 °C, and storage at 4 °C; for the second PCR, the same protocol was used but with an annealing temperature of 60 °C for 45 s, or for few samples at 62 °C for 45 s. When the PCRs used the HotStarTaq Master Mix Kit (Qiagen), two steps of the protocols were modified following the Qiagen recommended protocol: the denaturation step was settled to 15 min, and the final extension was 10 min. After the PCR, the amplicons were stained with a mix of Blue Juice (diluted at 1:2 in milique-H2O) plus gel red (1 µL diluted to 1 mL of the prepared Blue Juice mix), and then tested separated by horizontal gel electrophoresis on a 4% agarose gel. Results of the amplicons were visualized and registered by photography with an ultraviolet camera. The PCR amplicons were purified and sequenced in both directions using three distinct sequencing services: Macrogen Inc., High Throughput Genomics Center (HTSeq) and Functional Biosciences, Inc. Matrices and sequence alignments The search for morphological characters was carried out based on previous phylogenies of Siluriformes, mainly those on Auchenipteridae (Britski, 1972; Royero, 1987, 1999; Ferraris, 1988; Curran, 1989; Walsh, 1990; de Pinna, 1996, 1998; Soares-Porto, 1998; Britto, 2002; Akama, 2004; Diogo, 2004; Vigliotta, 2008; Ribeiro, 2011; Marceniuk et al., 2012; Birindelli, 2014). All characters were re-evaluated, and some were redefined based on the inclusion of greater morphological diversity among the ingroup members. The description and delineation of characters follow Sereno (2007), with modifications. Altogether, 264 morphological characters were coded and are presented in the Supporting Information (Appendix S2). A list of synapomorphy for each clade is presented in the Supporting Information (Appendix S3). The morphological data matrix was organized and coded using Microsoft Excel and subsequently transposed to Mesquite v.3.31 (Maddison & Maddison, 2017). In the parsimony analyses, the inapplicable characters were coded as ‘–’, those where observation was not possible were considered missing and coded as ‘?’, and all possible states for polymorphic characters were noted with the symbol ‘&’. In the Bayesian analysis, inapplicable, missing and polymorphic data were coded as ‘?’ and not as a fifth state. The chromatograms of molecular data were visualized and edited using Geneious R9 v.9.1.2 (http://www.geneious.com;Kearse et al., 2012). The sequences were aligned in this same software using automatic assembly in the implemented MUSCLE with the default parameters, and each contig pair was visually checked and edited before consensus sequences were extracted. The alignment of 16S was completed using Simultaneous Alignment and Tree Estimation (SATÉ-Gui, Yu et al. v.2.2.7, 2013; Liu et al., 2009); the loop region was alignable and, for this reason, was maintained in the sequences. The codon positions of the protein-codifying genes were tested based on amino acid translation, and aligned sequences included in the analyses were open reading frames, starting in the first position. For species represented by more than one individual, if no differences were found between sequences, only one was kept in the analysis. Sequences disagreeing or highly incongruent with co-species were excluded from the dataset, and new sequences were generated in replacement. For the combined dataset, morphological and molecular characters were concatenated into a single matrix (a total of 3754 characters), but the phylogenetic signal of each different partition and the integrity of sequences were tested separately according to the same nucleotide substitution models as the combined dataset. Phylogenetic analysis Parsimony analysis Hypotheses regarding relationships and monophyly were proposed according to the cladistic paradigm first proposed by Hennig (1950, 1966) and subsequently developed, with relationship hypotheses being based exclusively on the possession of derived characters shared by the members of each hierarchical group. Maximum Parsimony (MP) was used as the optimality criterion because it provides synapomorphies to justify the diagnosis of each taxon. The MP analysis was implemented using TNT v1.5 (Goloboff et al., 2003, 2008). In the parsimony analysis, the gaps were considered missing data. The indel/substitution cost ratio was set at 1:1 to establish the transformation cost matrix used to calculate the length of the tree (Arroyave & Stiassny, 2011). Heuristic searches were applied to find the optimal trees using the Traditional Search and New Technologies Searches methodologies. The analyses initially performed with Traditional Search were used to save trees in memory to advance in the search using New Technologies, including algorithms such as sectorial searches (default), ratchet (400 iterations), tree-fusion (six rounds) and tree-drift (30 rounds). Subsequently, the analyses were performed using the best previous trees saved in memory, increasing the number of iterations of ratchet to 600, 800, 1000, 1500, and above to stabilize the number of optimal trees. After all replicates (10 000 ratchet), a second round of searches, using the best trees saved in memory, was performed. The different topologies found in the most parsimonious fundamental cladograms were summarized in a strict consensus tree. Support values for the consensus tree were calculated using the Goodman–Bremer index (Bremer, 1988), which considers the numbers of extra steps necessary to collapse a branch. The reversals and convergences were considered as equally possible in the heuristic algorithm searches used (Swofford & Maddison, 1987). The multistate characters were codified as unweighted and unordered, owing to the lack of information about the sequence of morphological features among the character states explicitly part of an ontogenetic series. A member of Diplomystidae was used as the rooting point, chosen based on previous phylogenies indicating this family to be the sister group to Siluroids (Arcila et al., 2017; Betancur-R et al., 2017). Bayesian Inference analysis The combined dataset was also subjected to phylogenetic analysis using Bayesian Inference (BI) (Guindon & Gascuel, 2003; Ronquist & Huelsenbeck, 2003). Analyses based on Bayesian methods were conducted using the software MrBayes v.3.2.6 (Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003; Altekar et al., 2004). The morphological characters and the five molecular markers were treated as separate dataset partitions. The likelihood model Markov k (Mk), implemented in MrBayes v.3.1 (Lewis, 2001; Nylander et al., 2004), was used for discrete morphological data, assuming equal rates of character change. Nucleotide substitution models were investigated and selected for each gene partition corresponding to a three-codon position using the Bayesian information criterion (BIC) implemented in PartitionFinder (v2.1.1.Gui; Lanfear et al., 2012). The BIC parameters were assigned to all codon positions but not for 16S fragment (shown in Table 4) and morphology. Bayesian analyses were performed in MrBayes v.3.2.6 using the CIPRES supercomputing cluster (Miller et al., 2010), and four chains were run. These chains were each programmed to run for 100 000 000 generations, with sampling occurring every 1000 generations. To ensure sampling from a stationary posterior distribution, all analyses were examined for convergence by visualizing the plot of generation vs. the log-probability and by examining the values of estimated sample size (ESS) and potential scale reduction factor (PSRF) using Tracer v.1.6 (Rambaut et al., 2014). Trees generated during the first 25% of the generations were discarded as burn-in. Table 4. Summary statistics for each gene partition and best-fitting model Locus Codon Character number range in matrix Length (bp) Number of variable sites Percentage of variable sites Number of parsimony- informative sites Best-fitting model (Bayesian information criterion) coI 1 1–657 219 60 27.4 44 GTR+I+G coI 2 219 6 2.7 3 HKY+I+G coI 3 219 218 99.5 214 TRN+G myh6 1 658–1417 254 33 12.9 22 GTR+I+G myh6 2 254 13 5.1 9 F81+I myh6 3 254 188 74.0 134 HKY+G rag2 1 1418–2221 268 109 40.6 67 K80+G rag2 2 268 67 25.0 32 TIMEF+I+G rag2 3 268 219 81.7 159 HKY+G SH3PX3 1 2222–2900 227 48 21.1 33 K81+I+G SH3PX3 2 227 26 11.4 14 TVM+I+G SH3PX3 3 227 189 83.2 170 TIM+G 16S – 2901–3490 590 223 37.8 181 GTR+I+G Total 3490 3490 1399 40.1 1082 Locus Codon Character number range in matrix Length (bp) Number of variable sites Percentage of variable sites Number of parsimony- informative sites Best-fitting model (Bayesian information criterion) coI 1 1–657 219 60 27.4 44 GTR+I+G coI 2 219 6 2.7 3 HKY+I+G coI 3 219 218 99.5 214 TRN+G myh6 1 658–1417 254 33 12.9 22 GTR+I+G myh6 2 254 13 5.1 9 F81+I myh6 3 254 188 74.0 134 HKY+G rag2 1 1418–2221 268 109 40.6 67 K80+G rag2 2 268 67 25.0 32 TIMEF+I+G rag2 3 268 219 81.7 159 HKY+G SH3PX3 1 2222–2900 227 48 21.1 33 K81+I+G SH3PX3 2 227 26 11.4 14 TVM+I+G SH3PX3 3 227 189 83.2 170 TIM+G 16S – 2901–3490 590 223 37.8 181 GTR+I+G Total 3490 3490 1399 40.1 1082 Open in new tab Table 4. Summary statistics for each gene partition and best-fitting model Locus Codon Character number range in matrix Length (bp) Number of variable sites Percentage of variable sites Number of parsimony- informative sites Best-fitting model (Bayesian information criterion) coI 1 1–657 219 60 27.4 44 GTR+I+G coI 2 219 6 2.7 3 HKY+I+G coI 3 219 218 99.5 214 TRN+G myh6 1 658–1417 254 33 12.9 22 GTR+I+G myh6 2 254 13 5.1 9 F81+I myh6 3 254 188 74.0 134 HKY+G rag2 1 1418–2221 268 109 40.6 67 K80+G rag2 2 268 67 25.0 32 TIMEF+I+G rag2 3 268 219 81.7 159 HKY+G SH3PX3 1 2222–2900 227 48 21.1 33 K81+I+G SH3PX3 2 227 26 11.4 14 TVM+I+G SH3PX3 3 227 189 83.2 170 TIM+G 16S – 2901–3490 590 223 37.8 181 GTR+I+G Total 3490 3490 1399 40.1 1082 Locus Codon Character number range in matrix Length (bp) Number of variable sites Percentage of variable sites Number of parsimony- informative sites Best-fitting model (Bayesian information criterion) coI 1 1–657 219 60 27.4 44 GTR+I+G coI 2 219 6 2.7 3 HKY+I+G coI 3 219 218 99.5 214 TRN+G myh6 1 658–1417 254 33 12.9 22 GTR+I+G myh6 2 254 13 5.1 9 F81+I myh6 3 254 188 74.0 134 HKY+G rag2 1 1418–2221 268 109 40.6 67 K80+G rag2 2 268 67 25.0 32 TIMEF+I+G rag2 3 268 219 81.7 159 HKY+G SH3PX3 1 2222–2900 227 48 21.1 33 K81+I+G SH3PX3 2 227 26 11.4 14 TVM+I+G SH3PX3 3 227 189 83.2 170 TIM+G 16S – 2901–3490 590 223 37.8 181 GTR+I+G Total 3490 3490 1399 40.1 1082 Open in new tab RESULTS Character descriptions External morphology 1. [3490] Orbit, margin: (0) free; (1) continuous (Vigliotta, 2008: char. 91). In the plesiomorphic condition found in Diplomystidae, Ariidae, Pimelodidae (Arratia, 1987; Vigliotta, 2008) and the mochokids Atopochilus and Euchilichthys, the margin of the eye is surrounded by a groove that separates the eye from the skin, which is referred to as a free orbital margin. Among the taxa examined, Auchenipteridae, Aspredinidae, Doradidae, Helogenes marmoratus Günther, 1863 and Mochokidae have eyes covered by a continuous membrane that is conjoined to the skin, leaving no free zone between the eye and the skin. 2. [3491] Eye, size: (0) relatively small, occupying up to half of head depth; (1) very large, occupying almost entire head depth. Among Auchenipteridae, the eye can be relatively small, usually smaller than half head depth and restricted to the dorsal half of the head. In this condition, the eye does not reach the horizontal line through the pectoral-fin origin, except in Ageneiosus and Tetranematichthys, in which the eye is positioned more laterally, but still occupying up to half the head depth, and proportionally small relative to the head configuration. Furthermore, in the plesiomorphic condition the eye generally is not visible in ventral view, and when visible, such as in some species of Tatia, it is only slightly visible, much < 50% of the orbit. In Auchenipterus, Centromochlus heckelii, Centromochlus existimatus, Centromochlus macracanthus, Centromochlus schultzi, Tatia carolae, Entomocorus, Epapterus, Pseudepapterus cucuhyensis and Tympanopleura, the eye is large or extremely large in the case of some Centromochlus and Tympanopleura, lateroventrally oriented and occupying almost the entire head depth, reaching to or surpassing the horizontal line through the pectoral-fin origin in lateral view (never reaching that point in Tatia). 3. [3492] Mouth, mandibular arch, ventral surface, direction: (0) lateral margins of mandibulae diverging laterally; (1) lateral margins of mandibulae running approximately in parallel. Most Auchenipteridae have large mouths; usually, the mandible is as wide as the premaxillary arch and participates in the anterolateral border of the head. In this condition, the posteroventral portion of the mandible forms a curve of semicircular shape, with the lateral margins broadening laterally, diverging from each other. In Centromochlus existimatus, Centromochlus heckelii, Centromochlus schultzi, Tatia carolae and Centromochlus macracanthus, the mandibular arch is narrower and digit-like, with the lateral margins of mandibulae parallel each other and always smaller than the premaxillary arch. 4. [3493] Adipose fin: (0) present; (1) absent (Ferraris, 1988: char. O2; Akama, 2004: char. 186; Ribeiro, 2011: char. 234; Birindelli, 2014: char. 4). The possesion of an adipose fin is plesiomorphic within Ostariophysi (Fink & Fink, 1981). Among the taxa examined, the adipose fin is absent in the auchenipterids Epapterus, Trachelyichthys, Trachelyopterichthys, Trachelyopterus coriaceus and all members of the Aspredinidae. 5. [3494] Adipose fin, pre-adipose ridge: (0) absent; (1) present (Birindelli, 2014: char. 5, modified). Most auchenipterids have a short adipose fin lacking any ridge anteriorly, but the adipose fin of Gelanoglanis nanonocticolus and Gelanoglanis varii and the doradids Rhinodoras and Megalodoras is preceded by a thin, long skin ridge. Taxa without an adipose fin were coded as inapplicable for this character. 6. [3495] Branchiostegal membranes, contact: (0) united to isthmus and close together; (1) separate from each other and free from isthmus; (2) united to isthmus and far apart; (3) united to each other and free from isthmus (Birindelli, 2014: char. 6). In Diplomystidae, the branchiostegal membranes are united to the isthmus, but close together (state 0). Pimelodidae is the only catfish family examined where the branchiostegal membranes are separate from each other and free from the isthmus (state 1). The branchiostegal membranes of Auchenipteridae, Aspredinidae, Mochokidae and Doradidae are united to the isthmus and far apart, positioned next to or at the lateral margin of head (state 2). In Ariidae and Helogenes marmoratus, the branchiostegal membranes are united to each other and free from the isthmus (state 3). 7. [3496] Head, surface, dermal tubercles in nuptial males: (0) absent; (1) present (Akama, 2004: char. 178; Birindelli, 2014: char. 26). Nuptial males of catfishes usually do not possess any dermal tubercles, but Auchenipterus, Entomocorus, Epapterus and Pseudepapterus do develop soft tubercles on the dorsal surface of the head. Despite the presence of such breeding ornamentation, the shape of the tubercles could be informative and should be investigated further. 8. [3497] Tympanic area, long epidermal papillae: (0) absent; (1) present (Royero, 1999: char. 148; Akama, 2004: char. 183; Birindelli, 2014: char. 29). Among taxa examined, epidermal papillae were absent on the tympanic area. Only species of Pseudauchenipterus and Ageneiosus pardalis have epidermal papillae along the tympanic area. In case of the former species, the epidermal papillae are probably related to the tolerance of the species to a higher salinity level (Akama, 2004). 9. [3498] Axillary slit: (0) present; (1) absent. The axillary slit is present in most catfishes examined, except for Aspredinidae other than Aspredo aspredo (Linnaeus, 1758), the mochokid Atopocheilus and auchenipterids Centromochlus meridionalis, Liosomadoras oncinus, Trachelyopterus teaguei, Trachelyopterus lucenai and Trachycorystes menezesi. Most members of the Auchenipteridae have a tiny axillary slit that is very difficult to observe even under a stereomicroscope. The axillary slit is usually rounded and located between the last inner pectoral fin ray and the posterior process of the cleithrum. Liosomadoras oncinus has an axillary slit as a juvenile but lacks it as an adult. Barbels 10. [3499] Maxillary barbel, length: (0) long, extending beyond anterior margin of orbit; (1) short, not surpassing anterior margin of orbit (Ferraris, 1988: char. J14; Royero, 1999: char. 117; Akama, 2004: char. 62; Birindelli, 2014: char. 10; modified). The maxillary barbel in most Siluriformes is long, surpassing the anterior margin of the orbital. In Ageneiosus, Tympanopleura and Tetranematichthys, the maxillary barbel is extremely reduced and thin, and it is harboured and covered in a sulcus slightly below the posterior portion of the upper lip. 11. [3500] Maxillary barbel, fimbriae: (0) absent; (1) present. Among all members of Siluriformes examined, only Nemadoras humeralis (Kner, 1855) and Trachydoras nattereri (Steindachner, 1881) share the presence of fimbriae on the ventral surface of the maxillary barbel. 12. [3501] Head, suborbital groove: (0) absent; (1) present (Ferraris, 1998: char. J16; Curran, 1989: char. 2; Royero, 1999: char. 116; Akama, 2004: char. 61; Birindelli, 2014: char. 14). The suborbital groove for the maxillary barbel is usually absent. Auchenipterids have a deep suborbital groove, which lodges the maxillary bone and part of the maxillary barbel. Despite the presence of a groove to accommodate the maxillary barbel in Ageneiosus and Tympanopleura, the sulcus is located in the posterolateral region of lips, anterior to the orbit. 13. [3502] Maxillary barbel, soft papillae: (0) absent; (1) present. In Siluriformes, the maxillary barbel is usually smooth, except in Gelanoglanis, which has conspicuous soft, rounded papillae along the entire length of the dorsal surface of the maxillary barbel (see Calegari et al., 2014: fig. 5), in both juvenile and adult specimens. This character is not considered an ornamentation of mature males or coding in ossified barbel such as that found in Tetranematichthys, some Auchenipterus and Entomocorus. Although this structure was not observed in other members of Auchenipteridae, Ferraris & Vari (1999) identified and reported fleshy elaborations of the barbel in two specimens of Pseudepapterus. For this reason, the genus is considered to be polymorphic for this character. 14. [3503] Mental barbel: (0) absent; (1) present. The mental barbel is absent in Diplomystidae and in the auchenipterids Ageneiosus and Tympanopleura. The mochokids Atopochilus, Chiloglanis and Euchilichthys also were considered to lack a distinct mental barbel, because they have the mental barbel incorporated into the oral disc (see Vigliotta, 2008: fig. 27C). Most other Siluriformes possess a mental barbel. 15. [3504] Mental barbel, number: (0) one pair; (1) two pairs (Birindelli, 2014: char. 16; modified). The auchenipterids Gelanoglanis and Tetranematichthys have one pair of inner mental barbels. In all other Siluriformes examined, there are two pairs of mental barbels. Species lacking mental barbels were coded as inapplicable for this character. 16. [3505] Mental barbel, fimbriae: (0) absent; (1) present (Birindelli, 2014: char. 17). Among most taxa examined, the mental barbel lacks any fimbriae, although the mochokids with lips not developed as an oral disc and the doradids Nemadoras humeralis and Trachycodoras nattereri have fimbriae in the mental barbels. Birindelli (2014) did not consider the fimbriae to be present in these taxa, but considered them to have delicate papillae and, thus, to have smooth mental barbels. However, Nemadoras humeralis and Trachycodoras nattereri have a barbel structure similar to that of the remaining members but with shorter fimbriae. For this reason, these taxa were coded with the derived condition. Species lacking mental barbels were coded as inapplicable for this character. 17. [3506] Mental barbel, fimbriae, arrangement: (0) one row; (1) two rows (Birindelli, 2014: char. 18). Among taxa with fimbriae on the mental barbels, Nemadoras humeralis, Mochokus niloticus Joannis, 1835 and Mochokiella paynei Howes, 1980 have the fimbriae distributed in one row, and Synodontis and Trachydoras nattereri in two rows. All remaining catfishes examined with no fimbriae on the mental barbels or even the lack of these barbels were coded as inapplicable for this character. 18. [3507] Mental barbel, ornamentation: (0) absent; (1) present. Siluriformes have smooth mental barbels, but a fleshy, digitiform and tridimensional elaborate process on the distal portion of the mental barbel is present in Tetranematichthys wallacei. Although Tetranematichthys quadrifilis was not examined in the present study, Vari & Ferraris (2006) reported that such an elaborate structure is also present in this species and suggested that it represents a possible synapomorphy for the genus. Taxa without mental barbels were coded as inapplicable for this character. 19. [3508] Mental barbel, relative length: (0) outer barbel longer than inner; (1) outer and inner barbels of approximately the same length (Birindelli, 2014: char. 19). In most Siluriformes, the outer pair of mental barbels is longer than the inner pair when extended (Fig. 1C, D). However, in Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Pseudauchenipterus (except Pseudauchenipterus jequitinhonhae), Centromochlus heckelii, Centromochlus existimatus, Centromochlus perugiae, Centromochlus romani, the doradids Nemadoras humeralis and Trachydoras nattereri and Helogenes the two pairs of mental barbels are of approximately the same length (Fig. 1A, B). Taxa without mental barbels were coded as inapplicable for this character. 20. [3509] Mental barbel, outer pair, length: (0) short, not reaching posterior margin of coracoid process; (1) long, surpassing posterior margin of coracoid process (Curran, 1989: char. 6; Akama, 2004: char. 64; Birindelli, 2014: char. 20). In most Siluriformes, the outer mental barbel is relatively short, never reaching the posterior margin of the coracoid process. In Auchenipterus, Epapterus, Pseudepapterus, Pseudauchenipterus nodosus, Trachelyichthys, Trachelyopterus coriaceus, Trachelyopterus striatulus, Trachelyopterus porosus, Mochokus, Mochokiella, Helogenes and Pimelodidae, the mental barbel is elongated and surpasses that process. Birindelli (2014) coded Ariidae as having a long mental barbel, although the two species of Genidens and Cathoropis spixii examined herein have short mental barbels. Ariidae might be polymorphic for this character. Taxa without mental barbels were coded as inapplicable for this character. 21. [3510] Base of mental barbels, relative position: (0) base of inner mental barbels anterior to base of outer mental barbels; (1) base of both inner and outer barbels adjacent (Ferraris, 1988: char. J18; Curran, 1989: char. 13; Walsh, 1990: char. 12; Royero, 1999: char. 119; Akama, 2004: char. 65; Birindelli, 2014: char. 21). In most catfishes, the insertion of the outer mental barbel is posterior to that of the inner mental barbel (Fig. 1). In the derived condition, however, inner and outer mental barbels are inserted along the same transverse line, more near to the lips. The derived condition is present in the auchenipterids Auchenipterus, Entomocorus, Epapterus, Pseudepapterus and in the Ariidae, some species of Mochokidae, Pimelodidae, Helogenes and Doradidae examined here. Based on the figures of Birindelli (2014), which illustrate the states of the barbels, his interpretation of this character was distinct from the present observations. Taxa without mental barbels were coded as inapplicable for this character. Figure 1. Open in new tabDownload slide Ventral profile of head. A, Centromochlus heckelii, MCP 24171. B, Duringlanis perugiae, MCP 45749. C, Balroglanis carolae, ROM 62534. D, Tatia strigata, MCP 46595. Figure 1. Open in new tabDownload slide Ventral profile of head. A, Centromochlus heckelii, MCP 24171. B, Duringlanis perugiae, MCP 45749. C, Balroglanis carolae, ROM 62534. D, Tatia strigata, MCP 46595. Lateral sensorial system 22. [3511] Nasal, ossification: (0) present; (1) absent. The nasal bone is present in most Siluriformes (Arratia & Gayet, 1995). In Pseudobunocephalus iheringi, Pseudobunocephalus rugosus (Eigenmann & Kennedy, 1903), Rhynchodoras woodsi Glodek, 1976 and Gelanoglanis, the nasal bone is absent, but the supraorbital canal remains ossified, except in Gelanoganis, in which it is unossified. 23. [3512] Nasal bone, shape: (0) tubular; (1) plate-like, laterally expanded (Soares-Porto, 1998: char. 5; Sousa, 2010: char. 20; Ribeiro, 2011: char. 50; Birindelli, 2014: char. 94). In most auchenipterids, the nasal bone is tubular and anteroposteriorly oriented, whereas in some species of Tatia, Trachelyopterus, Trachelyopterichthys, Trachycorystes and Spinipterus sp. ‘oncinha’, the nasal bone is laterally expanded and shaped as a plate. Tatia intermedia has the tubular condition, although the nasal bone in adult specimens is not visible in dorsal view because the mesethmoid is strongly expanded laterally and covers the nasal. 24. [3513] Nasal, anterior portion, shape: (0) not bifurcated; (1) bifurcated (Ferraris, 1988: char. N15; Walsh, 1990: char. 2; Royero, 1999: char. 107; Akama, 2004: char. 92; Ribeiro, 2011: char. 51). Most Siluriformes have a tubular nasal bone (Arratia, 2003a) and carry an aperture for the lateral line ramus of the sensory canal system on the mid-portion of its lateral margin. However, Ageneiosus, Tympanopleura, Tetranematichthys, Trachelyopterus insignis and Trachycorystes trachycorystes have the derived state, in which this opening of the ramus of the lateral line is ossified and forms a long, anterolaterally oriented bifurcation. Auchenipterus also has a tubular nasal bone with the aperture of the lateral ramus slightly bifurcated, where the aperture forms an independent short, laterally oriented ramification that is less pronounced than in Ageneiosus, Tympanopleura and Tetratematichthys. In the last genus, the two ramifications are always separate from one another. 25. [3514] Antorbital, participation in orbital margin: (0) does not participate; (1) participates (Birindelli, 2014: char. 97). The antorbital is usually termed the first infraorbital, lacrimal or lacrimal-antorbital (e.g. Bockmann, 1994: char. 769, fig. 4; Lundberg et al., 1991: 843–845; Bockmann, 1998; Britto, 2002: char. 61). The antorbital is a complex structure that involves the first (or most anterior) ossified tubule of the infraorbital sensory canal series (i.e. the antorbital tubule) plus a strong laminar bony structure. Both structures have independent origins. Antorbital is used herein according to the homology proposed by Arratia & Huaquin (1995: 25, 26) based on evidence that the first ossified plate of the infraorbital series of Siluriformes is indeed the same as the antorbital of other Teleostei, i.e. the first infraorbital bone (= lacrimal) is absent in Siluriformes. Thus, antorbital is used herein only to indicate the ossification, without the antorbital tubule. In the plesiomorphic condition present in some Siluriforms, the antorbital has a short ventral process or no process, and the bone is located anterior to and distant from the orbital margin. However, in most Auchenipteridae, the antorbital participates in the anterior margin of the orbit, and in most genera, the presence of a ventral projection surrounds the orbital margin, reaching approximately to the middle of its width. 26. [3515] Antorbital, dorsal projection: (0) present; (1) absent. In Auchenipteridae, the dorsal portion of the antorbital bears a narrow, elongate projection that is dorsally extended or sometimes posterodorsally inclined. Epapterus, Entomocorus, Pseudepapterus, Auchenipterus and Spinipterus lack this process, and in those taxa, the dorsal margin of the bone is straight, not expanded. 27. [3516] Antorbital, ventral projection: (0) absent; (1) present (Ferraris, 1988: char. I2; Walsh, 1990: char. 13; Soares-Porto, 1998: char. 14; Akama, 2004: char. 29; Birindelli, 2014: char. 98; modified). Gelanoglanis, Asterophysus and most siluriforms examined do not have the ventral process of the antorbital. However, members of the Auchenipteridae have a tubular projection on the antorbital that is sometimes elongated, ventrally straight and posteriorly curved and, in other cases, restricted to the ossified sensory canal. This projection is usually curved around the orbital margin. The extension of this projection occasionally reaches to the line through the middle of the orbital diameter along its ventral portion. 28. [3517] Antorbital and lateral ethmoid, articulation: (0) lateral ethmoid contacting only mesial portion of antorbital; (1) lateral ethmoid contacting posterior and mesial portions of antorbital; (2) lateral ethmoid contacting posterior portion of antorbital. The position of the articulation between the antorbital and the lateral ethmoid is variable among the auchenipterids. In Gelanoglanis, Pseudauchenipterus and some Ageneiosus, the lateral ethmoid contacts the antorbital mesially. In most species examined, the lateral ethmoid contacts the posterior portion of the antorbital bone, which is anterolaterally positioned, whereas in remaining Ageneiosus, Auchenipterus, Asterophysus, Epapterus, Pseudepapterus, Trachelyopterichthys, Trachelyichthys, Tympanopleura, Mochokidae and Wertheimeria, the lateral ethmoid contacts the antorbital in its posterior and mesial portion. 29. [3518] Antorbital and lateral ethmoid, type of contact: (0) contact by ligament; (1) synchondral articulation; (2) sutural articulation to each other (Royero, 1999: char. 106; modified). Within auchenipterids, in Ageneiosus uranophthalmus, Gelanoglanis, and some Tympanopleura, the antorbital and the lateral ethmoid are distant from each other, and the contact occurs through ligament. In Pseudauchenipterus, Tetranematichthys and most Ageneiosus, these bones contact each other through cartilage, whereas in most members of Auchenipteridae, the antorbital and the lateral ethmoid contact each other directly through a suture. This condition is also present in Centromochlus, in which the articulation is between the anterolateral expansion of the lateral ethmoid and the mesial process of the antorbital, which is ventrally oriented. 30. [3519] Ossified suborbital tubules, numbers in adults: (0) six or more; (1) five; (2) four; (3) three; (4) two; (5) one; (6) none (Birindelli, 2014: char. 102; modified). The infraorbital series is composed of bony plates that bear the ossified tubules of the infraorbital sensory canal (e.g. Arratia & Huaquin, 1995: char. 17, fig. 6; Fink & Fink, 1981: 315; Lundberg et al., 1991: 850; Bockmann, 1998: 125–127). Thus, the ossified infraorbital canals are formed independently from the infraorbital bones during ontogeny. The infraorbital bones are integrally absent in Siluriformes and Gymnotiformes (except for Loricariidae and Callichthydae, Britto, 2002: char. 63; and Sternopygidae, Lundberg & Mago-Lecia, 1986) when the homology is compared with the homonym elements in Ostariophysi (Bockmann, 1998). According to the terminology proposed by Bockmann (1998: 126), the ossified tubules of the infraorbital series comprise the antorbital tubule (= first ossified tubule) and the remaining subsequent suborbital tubules, which together compose the principal infraorbital canal. Accordingly, the homology of the present character is different from that considered by Birindelli (2014) owing to the exclusion in the present study of the antorbital tubule and of suborbital tubules that are genuinely unossified. The auchenipterids can have suborbital tubules that are not ossified (state 6), a condition found in Gelanoglanis and some small-sized Tatia, or that are distinctly ossified, as in the remaining members of the family. Centromochlus perugiae is polymorphic for this character, because the number of ossified suborbital tubules can be one or two; Entomocorus gameroi is also polymorphic, having more ossified suborbital tubules. Among catfishes, Diplomystidae have six ossified suborbital tubules, whereas Aspredinidae, some Mochokidae and Asprenidae, most Doradidae and Pimelodidae have three. 31. [3520] Antorbital and ossified suborbital tubules, spines: (0) absent; (1) present (Royero, 1999: char. 102; Akama, 2004: char. 100; Sousa, 2010: char. 25; Birindelli, 2014: char. 106). Most auchenipterids have smooth ossified suborbital tubules, without spines. In Liosomadoras, Tatia caxiuanensis, Trachelyopterichthys, Trachycorystes trachycorystes and Spinipterus, the suborbital tubules, primarily the antorbital, bear short or enlarged spines. 32. [3521] Temporal canal, passageway: (0) passing from pterotic to posttemporal–supracleithrum; (1) passing from pterotic through epiotic to posttemporal–supracleithrum (Royero, 1999: char. 94; Akama, 2004: char. 104; Birindelli, 2014: char. 108). In most auchenipterids, the temporal canal (otic canal plus postotic canal) generally passes via the pterotic, close to its margin, and runs directly to the posttemporal–supracleithrum. In some species, of Auchenipterus, Entomocorus, Epapterus and Pseudepapterus, but the temporal canal enters the pterotic, passing through the most elongated ventral portion of the epioccipital, and enters the posttemporal–supracleithrum. 33. [3522] Pterotic, temporal canal, position: (0) temporal canal positioned near lateral margin of the pterotic; (1) temporal canal positioned approximately in the middle of the pterotic. In Ageneiosus, larger species of Auchenipterus, Epapterus, Pseudepapterus, Tympanopleura (except for Tympanopleura brevis and Tympanopleura cryptica) and Trachelyopterus teaguei, the temporal canal is positioned near the lateral margin of the pterotic. This condition is also found in Diplomystidae, Mochokidae and some Doradidae. However, in most auchenipterids, the temporal canal passes close to the middle of the pterotic. 34. [3523] Mandibular ramus: (0) present; (1) absent (Royero, 1999: char. 97; Akama, 2004: char. 102; Birindelli, 2014: char. 111). Most examined taxa possess the mandibular ramus of the laterosensory canal system. In the derived condition, the preopercular canal terminates on the ventral portion of the preopercle near the end of the dentary and the anguloarticular, and the mandibular portion of the laterosensorial canal system is absent. This condition is found in Aspredinidae (except in Aspredo aspredo), and according to de Pinna (1996) and Birindelli (2014) also in Chiloglanidinae mochokids, sisoroids and the erithistid Conta. 35. [3524] Mandibular ramus, passageway: (0) passing inside lower jaw; (1) passing outside lower jaw (Ferraris, 1988: char. I10; Birindelli, 2014: char. 112). In most Siluriformes, the mandibular ramus of the laterosensory canal reaches the preopercle and passes inside the dentary. In Gelanoglanis, the mandibular ramus is unossified and free from the dentary, passing outside and immediately below the dentary. In the aspredinid Aspredo aspredo, the mandibular ramus also passes outside the dentary, but in this case it is ossified in various tubules. 36. [3525] Lateral line, shape: (0) straight; (1) sinusoidal; (2) sinusoidal anteriorly and straight posteriorly (Ferraris, 1988: char. I12; Akama, 2004: char. 97; Birindelli, 2014: char. 115). In most Auchenipteridae, the lateral line is straight or nearly straight, never forming conspicuous curves. In Ageneiosus, Auchenipterichthys, Auchenipterus, Epapterus, Pseudauchenipterus, Pseudepapterus and Tympanopleura, the lateral line is sinusoidal, forming long, divergent curves. Other auchenipterids, such as Tocantinsia, Trachycorystes, Trachelyichthys and Trachelyopterichthys, have a sinusoidal lateral line on the anterior half of the body and a straight line on the posterior half. Birindelli (2014) reported the following genera as having a sinusoidal lateral line: Entomocorus, Liosomadoras, Tetranematichthys and Trachelyopterus. However, the present results indicate that those taxa have lateral line tubules that are individually oriented and slightly perpendicular along the lateral line axis, sometimes bearing ventral ramifications that suggest a cracked shape, but the lateral line as a whole is visibly straight. 37. [3526] Lateral line, posterior extension, location of terminus: (0) surpassing beginning of caudal fin; (1) approaching end of caudal-fin peduncle; (2) ending well before caudal-fin peduncle, approximately at end of anal fin (Royero, 1999: char. 100; Akama, 2004: char. 87; modified). In most Auchenipteridae, the terminus of the lateral line surpasses posteriorly the origin of the caudal-fin skeleton or the origin of caudal rays, and in most cases, it is extensive, reaching at least half the length of the caudal-fin rays. In some auchenipterid species of Centromochlus perugiae, Centromochlus romani, Centromochlus reticulatus, Centromochlus simplex and some species of Tatia, and the aspredinid Aspredo and Pseudobunocephalus, the lateral line nearly reaches or reaches to the caudal skeleton but never surpasses that point. Moreover, in Gelanoglanis, the lateral line is incomplete, and the terminus reaches only the end of the anal-fin rays. 38. [3527] Lateral line, posterior terminus, ramification: (0) unbranched; (1) branched into two divergent rami (Ferraris, 1988: char. I11; Royero, 1999: char. 101; Akama, 2004: char. 88; Birindelli, 2014: char. 116). The branching pattern of the posterior end of the lateral line into two principal divergent rami is a common feature within Auchenipteridae, and the level of divergence and the orientation between the rami vary among genera. In the plesiomorphic condition, the posterior end of the lateral line is simple and unbranched. Within auchenipterids, the plesiomorphic condition is found in all members of Centromochlinae and in Entomocorus, Liosomadoras, Pseudepapterus, Pseudotatia, Trachelyichthys and Trachelyopterichthys. Spinipterus acsi was originally described with the posterior end of the lateral line simple (Akama & Ferraris, 2011), but further examination of the holotype and an additional non-type specimen (Calegari et al., 2018) showed that the lateral line bifurcates after the caudal-fin origin, with the dorsal ramus more evident than the ventral one. The ventral ramus of the terminus of the lateral line is usually difficult to observe in specimens preserved in alcohol. 39. [3528] Midlateral scutes: (0) absent; (1) present (Birindelli, 2014: char. 118; modified). In Auchenipteridae and the remaining catfishes examined here, the scutes are absent. In all doradids, the lateral line tubules are developed into a longitudinal mid-row of bony scutes. In addition, according to Birindelli (2014), among the doradids, Doras micropoeus, Doraops, Hassar, Kalyptodoras, Nemadoras hemipeltis, Tenellus leporhinus and Wertheimeria have weakly developed midlateral scutes. 40. [3529] Midlateral scutes, retrorse thorn: (0) absent; (1) present (Birindelli, 2014: char. 119). All Doradidae examined have retrorse thorns on their midlateral scutes, except for Wertheimeria, which lacks thorns. Wertheimeria maculata Steindachner, 1877 generally has three scutes on the anterior portion of the body, and the remaining portion of the lateral line is tubule shaped and unossified, similar to those found in auchenipterids. 41. [3530] Midlateral scutes, orientation: (0) approximately perpendicular along body axis; (1) oblique along body axis (Birindelli, 2014: char. 120). Most doradids have scutes oriented perpendicularly to the body axis. Among the Doradidae examined, only Nemadoras and Trachydoras have midlateral scutes that are oriented obliquely relative to the body axis. According to Birindelli (2014), the derived condition is also present in Anduzedoras, Doras, Hassar, Hemidoras, Leptodoras, Ossancora and Tenellus, taxa not examined in the present study. Neurocranium 42. [3531] Dorsal cranium surface, bones, structure: (0) compact; (1) trabeculate; (2) alveolate (Britski, 1972: char. 12; Royero, 1999: char. 30; Ribeiro, 2011: char. 1; Birindelli, 2014: char. 223; modified). In most Auchenipteridae, the bones of the dorsal cranial surface are compact and structurally smooth, sometimes bearing strong superficial grooves, but never bearing unossified parts (Liosomodoras oncinus, Tetranematichthys, Glanidium and Wertheimeria maculata). In Ageneiosus, Tympanopleura atronasus and Tympanopleura rondoni, the bones of the cephalic shield are trabeculate and sponge-like, with deep longitudinal grooves and striae. In contrast, in Pseudauchenipterus, Pseudepapterus, Epapterus, four species of Auchenipterus (Auchenipterus nigripinnis, Auchenipterus osteomystax, Auchenipterus nuchalis and Auchenipterus brachyurus) and members of Aspredinidae, the bones of the cephalic shield are alveolate, not forming large grooves between the spaces, mostly on the anterior bones of the head. Previous authors codified Tetranematichthys as having trabeculate bones, the same condition found in Ageneiosus. However, the trabeculate bones of Ageneiosus seem not to be homologous with the strongly ossified and compact cranial bones, with grooves only under the surface of the bone found in Tetranematichthys. For this reason, in the present study Tetranematichthys was coded with the plesiomorphic condition. 43. [3532] Mesethmoid, shape in dorsal view: (0) expanded anterolaterally with notch on anterior and posterior portions; (1) expanded anterolaterally with notch only on posterior portion; (2) without anterolateral expansion, quadrate to rectangular; (3) elongate and narrow (Royero, 1999: char. 9, 10; Britto, 2002: char. 1; Akama, 2004: char. 30; Ribeiro, 2011: char. 4; Birindelli, 2014: char. 52; modified). In Auchenipteridae, the shape of the mesethmoid is highly variable among the genera because the shape of the head varies greatly in width, length and depth. In Ageneiosus, Tetranematichthys and Tympanopleura, the anterolateral portion of the mesethmoid is expanded, reaching to near the anterolateral margin of the head, and the posterior portion of the bone is narrower and with anterior and posterior constrictions, with the latter forming the anterior portion of the anterior fontanel. Moreover, Asterophysus, Auchenipterus, Entomocorus, Epapterus, Pseudotatia, Pseudepapterus, Pseudauchenipterus, Trachelyichthys and Trachelyopterichthys have a mesethmoid similar to the plesiomorphic condition, but the middle and posterior portions of the bone are tightly compressed laterally and longer than wide, and only the posterior portion bears a constriction, similar to the plesiomorphic condition (Fig. 2A, C). In the genera Auchenipterichthys, Tatia, Centromochlus, Glanidium Liosomadoras, Tocantinsia, Trachelyopterus, Spinipterus and Trachycorystes, the mesethmoid has a quadrangular to rectangular shape, usually more restricted to the anterior portion of the head. In Auchenipterichthys, Centromochlus existimatus and Centromochlus macracanthus, the quadrangular mesethmoid also bears a constriction on its posterior portion, but the remaining species with the same shape lack the constriction (Fig. 2D). In Gelanoglanis, the mesethmoid is elongated and extremely narrow, longer than wide, and the anterior portion of the bone is approximately straight in the dorsal view. 44. [3533] Mesethmoid, length: (0) elongate, length of at least approximately twice its width; (1) short, length approximately equal to width (Birindelli, 2014: char. 53). Among auchenipterids, Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Tetranematichthys and Gelanoglanis have an elongated mesethmoid, with the length at least twice, sometimes three times, its width. However, in most Auchenipteridae, the mesethmoid is short, and its length is approximately equal to its width. Birindelli (2014) also considered two character states, short and elongate, but under different discretization. 45. [3534] Mesethmoid, anteroventral portion, contact with premaxilla: (0) contacting; (1) not contacting (Ribeiro, 2011: char. 7) The most common condition in Auchenipteridae is that where the mesethmoid ventrally contacts the premaxilla. In some cases, there is a gap between the mesethmoid and the premaxilla, as in Ageneiosus and Tympanopleura (except for Tympanopleura cryptica) and Tetranematichthys, where the premaxilla is oriented anteroventrally relative to the mesethmoid, and the premaxilla and mesethmoid do not contact each other mesially. Furthermore, Gelanoglanis has the premaxilla laterally displaced, not contacting the mesethmoid anteromesially, and Pseudepapterus has the same condition, but the reduced premaxilla is located more posterolaterally to the mesethmoid. 46. [3535] Head, anterior region, composition: (0) formed by skin-covered mesethmoid and premaxillae; (1) possession of fleshy region anterior to mesethmoid and premaxillae. Most Siluriformes and members of Auchenipteridae have a skin-covered mesethmoid, but no fleshy snout. In the case of Ageneiosus, Pseudauchenipterus and Tympanopleura, the lateral expansion of the mesethmoid reaches the posterior portion of the premaxillae, but the anteromedial portion of the snout does not contact the mesethmoid owing to recoil of the latter bone, leaving the anterior margin of the snout covered only by skin. Gelanoglanis alternatively has a highly modified morphology of the cranium, with an arched mesethmoid and lateral displacement of the premaxillae. In the derived condition, Gelanoglanis has a fleshy region anterior to the mesethmoid in the anterior portion of the head. The restructuring of the head is complemented by a thick layer of soft tissue over the anterior portion of the snout (see Calegari et al., 2014). 47. [3536] Premaxillae, position in dorsal view: (0) underneath mesethmoid; (1) in front of mesethmoid; (2) lateral to mesethmoid. In most Auchenipteridae, the premaxilla is positioned under the mesethmoid. In Ageneiosus, Asterophysus, Pseudauchenipterus, Tocantinsia, Tympanopleura, Tetranematichthys, Trachelyopterus, Trachelyopterichthys, Trachycorystes and Helogenes marmoratus, most of the premaxillae is located in front of the mesethmoid and is completely visible in dorsal view. Gelanoglanis has the premaxillae positioned laterally to the mesethmoid, and the two bones do not contact each other. 48. [3537] Mesethmoid, anteroventral portion, process: (0) present, developed into laminar keel; (1) present, developed into uncinate process; (2) absent (Birindelli, 2014: char. 55, modified). In Auchenipteridae, except Gelanoglanis, the mesethmoid is flattened, without a process on its ventral portion. In most species, the mesethmoid is fused to, or ventrally covered by, the vomer and the premaxillae. In Gelanoglanis, the mesethmoid is elongated and bears a long, thin longitudinal laminar keel that is ventrally developed into a compressed process. In Trachydoras, Atopocheilus and Euchilichthys, the mesethmoid is ventrally developed, and this expansion forms an uncinate process on the anterior portion. Birindelli (2014) coded the presence of this process also in Oxydoras; however, the present observations of Oxydoras niger (Valenciennes, 1821) revealed no process, and it was thus coded with the plesiomorphic condition. 49. [3538] Mesethmoid and nasal bones, union: (0) separated; (1) in contact with one another. In most Auchenipteridae, the mesethmoid is distinctly separated from the nasal bone. The contralateral nasal bones are positioned laterally to the mesethmoid, but never contact it. Species of Tatia are variable for this character, and some species have the mesethmoid and nasal bones closely in contact with one another. 50. [3539] Anterior cranial fontanel: (0) present; (1) absent. The anterior cranial fontanel is defined here as a fontanel between the frontals, either entering or not entering the mesethmoid anteriorly, and is sometimes divided into an anterior and a posterior portion by an epiphyseal bar. All Siluriformes examined have an anterior cranial fontanel, typically located at the point of contact between the mesethmoid and the frontals, except for Gelanoglanis (excluding Gelanoglanis pan), which lacks a cranial fontanel. 51. [3540] Anterior cranial fontanel, epiphyseal bar: (0) absent; (1) present (Royero, 1999: char. 3; Akama, 2004: char. 12, 13, 14; Birindelli, 2014: char. 57; modified). In most Siluriformes, the typical configuration of the anterior cranial fontanel is a large, singular opening. Within auchenipterids examined, the derived condition in which the aperture of the anterior cranial fontanel is divided by an epiphyseal bar is present in Ageneiosus inermis, Auchenipterichthys thoracatus, Auchenipterus ambyiacus, Centromochlus heckelii, Centromochlus existimatus, Centromochlus meridionalis, Glanidium cesarpintoi, Liosomadoras, Tocantinsia, Trachelyopterichthys, some Trachelyopterus, Trachycorystes menezesi and Tympanopleura atronasus (Fig. 2B). This division of the anterior fontanel is made by a bony bridge that is deeper than the superficial border of the frontals and is formed by contralateral extensions of the frontals. 52. [3541] Anterior cranial fontanel, location: (0) on mesethmoid and frontals; (1) restricted to frontals. In Siluriformes, the anterior cranial fontanel is typically located between the mesethmoid and frontal bones (Fig. 2). A few species have the derived condition, in which the anterior cranial fontanel is restricted to the frontal, immediately after the posterior margin of the mesethmoid, as found in Centromochlus heckelii, Centromochlus meridionalis, Centromochlus perugiae, Centromochlus simplex, Gelanoglanis pan and Spinipterus. 53. [3542] Anterior cranial fontanel, shape: (0) elongated; (1) rounded; (2) elliptical (Royero, 1999: char. 4; Ferraris, 1988: char. N6; Birindelli, 2014: char. 56; modified). In Auchenipteridae, the shape of the superficial aperture of the anterior cranial fontanel may be very elongated and narrow, beginning from the mesethmoid and extending up to the middle or almost to the end of the frontals. This condition is present in Ageneiosus, Auchenipterus ambyiacus, Entomocorus, Epapterus, Pseudepapterus, Pseudauchenipterus (except Pseudauchenipterus nodosus), Tetranematichthys, Tympanopleura, Trachelyopterus insignis and Trachelyopterus teaguei. The remaining species of auchenipterids have an elliptical anterior fontanel, except for a few species that have a rounded fontanel (C. simplex, Gelanoglanis pan, some species of Tatia, Trachelyichthys and Spinipterus). 54. [3543] Anterior cranial fontanel, anterior portion, cartilage: (0) absent; (1) present. In the plesiomorphic condition, the anterior cranial fontanel is opened. In the derived condition, the anterior fontanel has an expanded cartilage on its anterior portion, which in part ventrally covers the aperture, which is present in Ageneiosus vittatus, Ageneiosus dentatus, Asterophysus, Entomocorus, Epapterus, Auchenipterus nuchalis, Auchenipterus osteomystax, Auchenipterichthys longimanus, Auchenipterichthys punctatus, Pseudauchenipterus, Pseudepapterus, Tetranematichthys, Trachelyopterichthys and Tympanopleura cryptica. 55. [3544] Cranial fontanel, posterior margin, longitudinal sulcus: (0) absent; (1) present (Royero, 1999: char. 5; Akama, 2004: char. 15; Ribeiro, 2011: char. 19; modified). In most examined taxa, the posterior border of the cranial fontanel is delimited well by the contralateral frontals, which meet and form a flat cephalic shield. In Ageneiosus, Tympanopleura rondoni and Pseudepapterus, the end of the posterior margin of the cranial fontanel is followed by a deep, elongated longitudinal sulcus, approaching the anterior margin of the parieto-supraoccipital or even surpassing this limit. Ariidae and some species of Doradidae also have the derived state. 56. [3545] Posterior cranial fontanel: (0) present; (1) absent (Marceniuk et al., 2012: char. 27; Vigliotta, 2008: char. 6; Birindelli, 2014: char. 58; modified). The posterior cranial fontanel is defined here as a fontanel between the frontals, either entering or not entering the parieto-supraoccipital, which is independent and posteriorly located relative to the anterior fontanel. The anterior and posterior cranial fontanelles are usually separated by a contact between the contralateral frontals. This connection of the frontals is not homologous with the epiphyseal bar that divides the anterior fontanel in two openings, and configures a deeper bony bridge located more ventrally than the surface of the anterior fontanel. In Auchenipteridae, the cranial morphology is highly diverse, with an unusual configuration where the parieto-supraoccipital rarely participates in the posterior cranial fontanel, which is usually restricted to the frontals. The posterior cranial fontanel is found in the auchenipterids Auchenipterus, Epapterus and Pseudepapterus cucuhyensis, most aspredinids examined, the doradid Rhynchodoras woodsi, Helogenes and Diplomystidae (Fig. 2C). The conceptualization of the anterior and posterior cranial fontanelles used herein is restricted to the catfishes examined, and a large-scale study is needed to establish the homology of this character in a broader context. 57. [3546] Lateral ethmoid, participation in dorsal region of cranium: (0) slightly exposed, equivalent to approximately one-third of frontal length; (1) greatly exposed, surpassing one-half length of frontal; (2) not exposed. The lateral ethmoid contributes little to the formation of the surface of the cephalic shield in most catfish examined herein. Among auchenipterids, Ageneiosus, Auchenipterichthys, Centromochlus macracanthus, Centromochlus shultzi, Entomocorus, most species of Glanidium, Spinipterus, Tocantinsia, Trachelyopterichthys, Trachelyopterus galeatus, Trachelyopterus lucenai, Trachycorystes and Tympanopleura have the lateral ethmoid only slightly exposed (Fig. 2A). In contrast, in Auchenipterus, Epapterus, Pseudepapterus, some Mochokidae and Pimelodidae, the lateral ethmoid is greatly exposed in the dorsal region of the cranium and anterodorsally expanded, contributing similarly to the frontal in the formation of the cephalic shield (Fig. 2C). Most of auchenipterids do not have the lateral ethmoid participating in the dorsal surface of the head. 58. [3547] Lateral ethmoid, anterior margin, anterior cartilage: (0) short, not extended; (1) long, extended. In most Auchenipteridae, the anterior margin of the lateral ethmoid has a short cartilaginous extension that contacts the mesethmoid and vomer. In most species, the cartilage is approximately square or tapers anteriorly. In Ageneiosus, Auchenipterus, Gelanoglanis pan, Gelanoglanis varii, Pseudepapterus, Pseudauchenipterus, Pseudotatia, Tympanopleura and Tetranematichthys, the lateral ethmoid has a greater extension of cartilage along the entire anterior margin. Furthermore, in Ageneiosus and Tympanopleura the cartilage joins the lateral ethmoid with the mesethmoid and premaxillae, whereas in Auchenipterus the cartilage joins the above bones plus the vomer owing to the closer proximity between the lateral ethmoid and the premaxilla. This cartilage seems to serve as a protection for the olfactory lamellae, because the lamellae are situated immediately above the lateral ethmoid cartilage. 59. [3548] Lateral ethmoid, anterior expansion of cartilage, shape: (0) cylindrical; (1) conical; (2) square. In Ageneiosus, Gelanoglanis pan, Gelanoglanis varii, Pseudauchenipterus, Tetranematichthys and Tympanopleura, the cartilage on the anterior margin of the lateral ethmoid is cylindrical, approximately the same width throughout its length (Fig. 3A). In contrast, in most Auchenipterus and Pseudepapterus the cartilage is approximately conical, tapering towards the snout tip and ending very thin at the opening of the anterior nostril (Fig. 3B). Yet, in Asterophysus, Pseudotatia and some Mochokids, this cartilage is square. For those species without an extended cartilage, the character was coded as inapplicable. 60. [3549] Lateral ethmoid, transverse keel in dorsal view: (0) absent; (1) present. In most Auchenipteridae, the lateral ethmoid is straight, and its anterior portion is sloped anteroventrally and lacks any keel. In Epapterus and Pseudepapterus, this bone is almost straight along its length and bears a conspicuous transverse keel in dorsal view. 61. [3550] Lateral ethmoid and frontal, fenestra between bones: (0) present; (1) absent (de Pinna, 1993: char. 68; Britto, 2002: char. 6; Marceniuk et al., 2012: char. 3; Birindelli, 2014: char. 60). Among the catfish families examined, the fenestra between the lateral ethmoid and the frontal is present in Ariidae, Diplomystidae and Helogenes, and within Auchenipteridae, in Pseudauchenipterus and Trachycorystes trachycorystes. Although Birindelli (2014) coded Mochokidae and Pimelodidae as having the fenestra, in the present study both families were considered to lack the fenestra. In Pseudauchenipterus, the contact between lateral ethmoid and frontalis minor, in the lateral-most portion, at times, do not contact each other at all. The contact between those bones in Ariidae is by a distinct, narrow bone bridge. 62. [3551] Sphenotic, anterolateral process: (0) absent; (1) present (Royero, 1999: char. 12; Akama, 2004: char. 31; Birindelli, 2014: char. 62; modified). In most auchenipterids, the sphenotic has approximately symmetric edges, without any projections. In Ageneiosus, Tympanopleura and Tetranematichthys, the sphenotic has an anterior projection that is greatly elongated and tubular, through which passes the sensory canal of the infraorbital series. 63. [3552] Sphenotic, posterolateral portion, shape: (0) straight; (1) slightly concave; (2) distinctly concave (Royero, 1999: char. 20; Akama, 2004: char. 34; Birindelli, 2014: char. 63; modified). In some Auchenipteridae, the posterolateral margin of the sphenotic is almost straight, but never concave. In contrast, most Ageneiosus and Centromochlus, Gelanoglanis, Pseudotatia, Liosomadoras morrowi, some species of Tatia, Trachelyichthys decaradiatus, Trachelyopterus lucenai, Trachelyopterus porosus and Trachycorystes, the posterolateral margin of the sphenotic is slightly concave, concealing the articulation between the hyomandibula and the sphenotic. Conversely, in Ageneiosus pardalis, Ageneiosus vittatus, Auchenipterus, Centromochlus reticulatus, Entomocorus, Epapterus, Pseudauchenipterus, Pseudepapterus, Tympanopleura, Tetranematichthys, Trachelyopterichthys and Spinipterus, the margin of the sphenotic is strongly concave, usually exposing that articulation. 64. [3553] Frontal, lateral margin: (0) participating in orbital margin; (1) not participating in orbital margin (Ferraris, 1988: char. N8; Royero, 1999: char. 1; Britto, 2002: char. 5; Akama, 2004: char. 17; Birindelli, 2014: char. 64). In most catfish families, the frontal, lateral ethmoid and sphenotic compose the dorsal orbital rim, and the antorbital also participates in the margin anterodorsally (Fig. 2A, D). However, in Auchenipterichthys, Auchenipterus, Epapterus, Liosomadoras, Pseudauchenipterus, Pseudepapterus, Tetranematichthys, Trachelyopterichthys, Trachelyopterus, Trachycorystes menezesi and Spinipterus, the frontal does not participate in the orbital margin (Fig. 2B, C). The same condition is found in Ageneiosus and Tympanopleura, but the frontal is located dorsally from the orbital margin and far from the orbit, which is positioned laterally on the head. 65. [3554] Parieto-supraoccipital, pterotic and sphenotic, fenestra between bones: (0) absent; (1) present (Birindelli, 2014: char. 67). In most auchenipterids, the bones of the cranium are well sutured to each other. In Asterophysus, Trachelyopterus amblops and Trachelyopterus coriaceus, and in Auchenipterus brevior, Auchenipterus fordicei and Auchenipterus dentatus, there is a small fenestra between the parieto-supraoccipital, pterotic and sphenotic bones. 66. [3555] Epioccipital, exposition: (0) partly exposed, with only anterior portion participating in cephalic shield; (1) exposed, participating in cephalic shield; (2) not exposed, not participating in cephalic shield (Ribeiro, 2011: char. 35; Birindelli, 2014: char. 84; modified). In the plesiomorphic condition, the epioccipital is exposed on the dorsal portion of the neurocranium and always contacts the pterotic and the posttemporal–supracleithrum. Auchenipterus, Epapterus, Tetranematichthys, Diplomystidae, Aspredinidae, Cathorops spixii (Agassiz, 1829) and Helogenes marmoratus have the epioccipital partly exposed, with only the anterior portion of the bone exposed and participating in the cephalic shield (Fig. 2C). In these cases, the largest portion of the epioccipital is positioned more internally and covered by a thin skin. In most Auchenipteridae, however, the epioccipital is positioned posterodorsally or dorsolaterally to the posttemporal–supracleithrum, and entirely exposed on the cephalic shield (Fig. 2B, D). In Tympanopleura, which have the epioccipital exposed, the dorsal process of the posttemporal–supracleithrum covers up to the middle of the epioccipital, rendering the two bones difficult to distinguish in some cases. Moreover, in Ageneiosus and Pseudepapterus, some Ariidae and Mochokidae, and Pimelodidae, the epioccipital is not exposed or visible dorsolaterally as the remaining bones of the cephalic shield but is covered by skin and adipose tissue. In this condition, the epioccipital is located more posteriorly to the posttemporal–supracleithrum. 67. [3556] Temporal fossa: (0) absent; (1) present (de Pinna, 1996: char. 24; Marceniuk et al, 2012; char. 36). The temporal fossa is absent in most taxa examined. In some Siluriformes, such as the Aspredinidae, Cathorops spixii, Synodontis petricola Matthes, 1959 and Nemadoras humeralis, the temporal fossa is present and delimited by the parieto-supraoccipital, pterotic and posttemporal–supracleithrum. However, in some members of Auchenipteridae, the temporal fossa assumes the same position but is delimited by the parieto-supraoccipital, pterotic and epioccipital owing to the position of the last bone, which is completely exposed and occupies a most dorsal portion relative to the posttemporal–supracleithrum. 68. [3557] Parieto-supraoccipital, posterior process: (0) present; (1) absent (Royero, 1999: char. 22; Diogo, 2004: char. 131; Birindelli, 2014: char. 68). Most Siluriformes have a posterior process on the parieto-supraoccipital, with an extension forming a tip on the posteromedial portion of that bone. In the Auchenipteridae, the parieto-supraoccipital lacks such a process, and the posterior portion of the bone is truncated. This posterior process is also absent in Mochokidae, the aspredinid Pterobunocephalus, and Doradidae. According to Diogo (2004), it is also absent in Malapteruridae. 69. [3558] Sphenotic and parieto-supraoccipital, contact: (0) present; (1) absent (Ferraris, 1988: char. N10; Royero, 1999: char. 2, 18; Britto, 2002: char. 7; Akama, 2004: char. 19, 26; Diogo, 2004: char. 97; de Pinna et al., 2007: char. 37; Birindelli, 2014: char. 69). In most Auchenipteridae, the sphenotic contacts the anterolateral border of parieto-supraoccipital (Fig. 2A). However, in Auchenipterus and Pseudepapterus, the sphenotic is separated from the parieto-supraoccipital by the frontal (Fig. 2C). 70. [3559] Frontal, sphenotic, and parieto-supraoccipital, accessory dermal ossification between these bones: (0) absent; (1) present (Ferraris, 1988: char. N13; Akama, 2004: char. 22; Birindelli, 2014: char. 70). Most Auchenipteridae lack an accessory dermal ossification between the frontal, sphenotic and parieto-supraoccipital. However, Ferraris (1988) and Birindelli (2014) noted the presence of such accessory ossification in Entomocorus, corroborated herein. 71. [3560] Posttemporal–supracleithrum, dorsal portion, shape: (0) simple, not divided into two rami; (1) bifurcated, divided into two rami (Ribeiro, 2011: char. 21). In most species of Auchenipteridae, the posttemporal–supracleithrum is slightly oblique, and its dorsal margin is straight and not divided into two rami. In the derived condition presented in Ageneiosus, Tympanopleura and Trachelyopterus insignis, the dorsal portion of the posttemporal–supracleithrum is strongly bifurcated. 72. [3561] Posttemporal–supracleithrum, posterior process, orientation: (0) ventrally oriented; (1) posteroventrally oriented (Ribeiro, 2011: char. 23). In the plesiomorphic condition, the posttemporal–supracleithrum is more ventrally oriented or fairly vertical to the body axis, as found in a few representatives of Ageneiosus, Auchenipterus, some Glanidium, Liosomadoras, Pseudauchenipterus (except Pseudauchenipterus nodosus), Pseudepapterus, Tetranematichthys, Trachycorystes, Tocantinsia, Tympanopleura and most Trachelyopterus. However, in most Auchenipteridae the posterior portion of the posttemporal–supracleithrum is posteroventrally oriented. 73. [3562] Epioccipital, posterior process: (0) absent; (1) present (Ferraris, 1988: char. N4; de Pinna, 1993: char. 85; de Pinna, 1996: char. 29; Royero, 1999: char. 50; Britto, 2002: char. 50; Akama, 2004: char. 7; Marceniuk et al., 2012: char. 40; Birindelli, 2014: char. 85; modified). Some taxa examined lack the posterior process of the epioccipital, including Franciscodoras marmoratus (Lütken, 1874), Wertheimeria maculata, Mochokidae and Diplomystidae. Notwithstanding, the epioccipital of most Siluriformes has a posterior process, usually visible in lateral view. However, in some cases this process can be difficult to detect because the process is covered by nuchal plates, as in case of some doradids and the auchenipterids Centromochlus and Spinipterus. 74. [3563] Epioccipital, posterior process, shape: (0) forming simple spine; (1) bifurcated; (2) laminar; (3) pointed. The posterior process of the epioccipital can vary in shape among Auchenipteridae. In Asterophysus, Auchenipterichthys, Entomocorus, Gelanoglanis, Centromochlus macracanthus, Centromochlus schultzi and Trachelyopterichthys, the process forms a long, thin spine (Fig. 2A). In Auchenipterus, Epapterus, Pseudauchenipterus, Tetranematichthys, Trachelyichthys and Trachelyopterus, the long process is bifurcated, ending in a thin, pointed shape (Fig. 2C); these groups are distinguished from Ageneiosus, Pseudepapterus and Tympanopleura because the latter have a very elongated laminar bone, but the medial branch is wider and sutured to the compound vertebrae. In contrast, in most species of Centromochlus, Glanidium, Liosomadoras, Spinipterus, Tatia, Pseudotatia, Trachycorystes and Tocantinsia, the posterior process of the epioccipital is pointed and very short, with a wide base formed by the lateral border of the epioccipital (Fig. 2D). Especially in Centromochlus romani and Centromochlus simplex, the process is greatly reduced and covered by the nuchal plate. Those taxa lacking a posterior process on the epioccipital were coded as inapplicable. 75. [3564] Epioccipital, posterior process, size: (0) elongated, surpassing at least half the length of the middle nuchal plate; (1) short, not reaching to that point. The posterior process of the epioccipital varies in size independently of its shape, which is most clearly observable in species with a spine-shaped process. Most auchenipterids have an elongated process that surpasses half the length of the middle nuchal plate, usually reaching to the origin of the dorsal fin. Within Auchenipteridae, Centromochlus, Glanidium, Tatia, Pseudotatia, Liosomadoras, Tocantinsia, Trachycorystes and Spinipterus have a short process, not reaching to half the length of the middle nuchal plate. Taxa lacking the posterior process of the epioccipital were coded as inapplicable. 76. [3565] Epioccipital, posterior process, composition: (0) mainly ligamentous, more than half the length formed by ligament; (1) mainly ossified, more than half the length formed by bone (Ferraris, 1988: char. N4; de Pinna, 1993: char. 85; de Pinna, 1996: char. 29; Royero, 1999: char. 50; Britto, 2002: char. 50; Akama, 2004: char. 7; Sousa, 2010: char. 19; Marceniuk et al., 2012: char. 40; Birindelli, 2014: char. 85; modified). The posterior process of epioccipital is mainly ligamentous in Centromochlinae, Pseudotatia, Liosomadoras, Tocantinsia, Trachycorystes and Spinipterus. The remaining auchenipterids have this process mainly ossified. Taxa lacking the posterior process on the epioccipital were coded as inapplicable. 77. [3566] Epioccipital, connection between posterior process and parapophyses of compound centrum: (0) not connected; (1) connected by suture (Ferraris, 1988: char. N5, 7, V10; Curran, 1989: char. 3; Walsh, 1990: char. 19; Royero, 1999: char. 51, 52, 53, 54; Akama, 2004: char. 8, 9, 10, 11; Birindelli, 2014: char. 87). In the plesiomorphic condition, the posterior process of the epioccipital is thinner and does not reach to the lateral portion of the fifth and sixth vertebrae, and its extension does not contact the parapophyses. In contrast, Ageneiosus, Auchenipterus, Epapterus, Pseudepapterus, Tetranematichthys, Tympanopleura, Trachelyichthys, Trachelyopterus coriaceus, Ariidae, Helogenes and Trachydoras nattereri have this process enlarged, and it contact the parapophyses of the fifth and sixth vertebrae in a strong suture. Taxa lacking the posterior process were coded as inapplicable. 78. [3567] Extrascapular: (0) present; (1) absent (Arratia, 1992: char. 43; Britto, 2002: char. 51; Birindelli, 2014: char. 88). The extrascapular is a small ossification located dorsally to the posttemporal–supracleithrum and ventrally to the parieto-supraoccipital. In species with a temporal fossa, the extrascapular is positioned immediately after the fossa. This bone is present in Diplomystidae, Ariidae, Helogenes marmoratus, Pimelodidae and Aspredinidae. In Aspredinidae, the extrascapular is tiny and difficult to observe. According to an extensive study by Pastana (2014) of the anatomy and homology of the canals and pores of the lateral sensorial system in Characiformes, the extrascapular was the only bony plate associated with the presence of the temporal and supratemporal canals. However, Siluriformes lack a supratemporal canal (Arratia & Gayet, 1995), and the postotic canal in this group is located on the pterotic and posttemporal–supracleithrum. Pastana’s (2014) notes are relevant to the controversy regarding the homology of the extrascapular, which definitely needs further investigation in Siluriformes. 79. [3568] Cranium and posttemporal–supracleithrum, connection: (0) via ligament; (1) via bony suture (de Pinna, 1993: char. 26; Royero, 1999: char. 16; Britto, 2002: char. 38; Arratia, 2003a: char. 130; Diogo, 2004: char. 155; Birindelli, 2014: char. 89). In Diplomystidae and Aspredinidae, the posttemporal–supracleithrum is connected to the cranium via a ligament. In all remaining taxa examined, the posttemporal–supracleithrum is strongly sutured to the neurocranium. In Ariidae, the connection condition is slightly different, because only the tip of the dorsal portion of the posttemporal–supracleithrum is connected to the cranium. 80. [3569] Posterior portion of posttemporal–supracleithrum and lamina formed by parapophysis of Weberian complex, suture: (0) absent, or slightly contacting; (1) present, connected by long bony suture (de Pinna, 1996: char. 27; Britto, 2002: char. 44; Birindelli, 2014: char. 90). The posttemporal–supracleithrum is a tridimensional, complex structure and probably involves many evolutionary processes. According to de Pinna (1996), the plesiomorphic condition for the posttemporal–supracleithrum in the Siluriformes is difficult to surmise because this structure includes a number of independent characters. The posttemporal–supracleithrum can vary in position and orientation on the neurocranium in Siluriformes. However, in the supposed derived condition, the posttemporal–supracleithrum assumes a more dorsal and posterior position relative to the parieto-supraoccipital. This condition, present only in Aspredinidae, caused the posterior process of the posttemporal–supracleithrum to occupy the dorsal portion of the parapophyses lamina of the Weberian complex, more specifically the fourth and fifth vertebrae, with the posterior process strongly sutured to the parapophyses. In the other condition, the posterior process is anterior to the parapophyses lamina of the Weberian complex and does not contact or only slightly contacts the anterior portion of the complex, and is never sutured. 81. [3570] Transcapular process, direction: (0) transverse to body axis; (1) at angle of ~45° relative to body axis (Royero, 1999: char. 47; Akama, 2004: char. 44; Birindelli, 2014: char. 92). The transcapular process is usually transverse to the body axis in most Siluriformes. Alternatively, Ageneiosus, Auchenipterus, Entomocorus, Epapterus, Liosomadoras morrowi, Pseudepapterus, Spinipterus, Tatia intermedia, Tetranematichtys, most Trachelyichthys, Trachelyopterus galeatus, Trachelyopterus lucenai, Trachycorystes trachycorystes and Tympanopleura have the derived condition, in which the transcapular process is at an angle of ~45° relative to the body axis. 82. [3571] Transcapular process, shape: (0) blunt, not extended ventrally; (1) ventrally extended into bony lamina (Eigenmann, 1925: char. 287; Higuchi, 1992: char. 29, 30, 41; Birindelli, 2014: char. 93). Most Siluriformes lack any ventral extension on the transcapular process, but some Doradidae (Nemadoras, Oxydoras, Rhynchodoras, Trachydoras and Franciscodoras) have a large transcapular process with a ventral, elongated laminar projection in its lateral portion. Birindelli (2014) considered Rhynchodoras and Franciscodoras to lack the ventral extension, but the derived condition was observed in both taxa. 83. [3572] Vomer, configuration: (0) present as independent bone; (1) present, but fused to mesethmoid; (2) absent (Ferraris, 1988: char. N11; Birindelli, 2014: char. 72). The vomer is present in most Siluriformes on the anterior portion of the ventral surface of the neurocranium (Fig. 4A, C). Although Ferraris (1988), Soares-Porto et al. (1999), Rengifo et al. (2008) and Birindelli (2014) asserted the absence of the vomer as a synapomorphy for Gelanoglanis, a different condition is observed; the vomer is present but fused to the mesethmoid in all species of Gelanoglanis. The fusion of the vomer to the mesethmoid can probably be explained as a consequence of the different cranial morphology in Gelanoglanis, which is very laterally compressed compared with the remaining auchenipterids (Fig. 4B). This head shape configuration is a result of the arched and narrow mesethmoid, which is easily visible in dorsal view because it is positioned dorsally to the vomer instead of slightly anteriorly, as in the remaining members of the family. The mesethmoid of Gelanoglanis is similar to that of Pseudepapterus in dorsal view, with a ventral laminar keel oriented along the axis of the head that is strongly fused to the anterior portion of the vomer. In ventral view, the vomer is the anteriormost structure of the neurocranium because the premaxillae are markedly displaced laterally. The vomer fused to the mesethmoid in Gelanoglanis has a very short posterior portion where it is articulated to the parasphenoid and has the same shape as in the centromochlines, with an anterolateral projection. The vomer almost completely forms the roof of the oral cavity because the snout is narrow, and the vomer occupies the anterior region. This distinct condition found in Gelanoglanis is different from that in Aspredinidae, in which the vomer was completely lost. For this reason, the character coding for the presence of the vomer was modified to include the distinct condition present in Gelanoglanis. However, a more comprehensive study with an ontogenetic series should be completed. Among catfishes examined, only Aspredinidae lack the vomer. 84. [3573] Vomer, anterior portion, shape: (0) anteriorly enlarged, without projections; (1) with distinct anterolateral projections (Ferraris, 1988: char. N18; Arratia, 1992: char. 50; Higuchi, 1992: char. 14; Soares-Porto, 1998: char. 11; Walsh, 1990: char. 3; Akama, 2004: char. 24; Birindelli, 2014: char. 73; modified). Among Auchenipteridae, Ageneiosus, Tetranematichthys and Tympanopleura (except Tympanopleura brevis and Tympanopleura piperata) have the anterior portion of the vomer enlarged and rounded, and it never bears lateral projections (Fig. 4A). In Auchenipteridae, the vomer is positioned very anteriorly in the head and ventrally to the mesethmoid and usually also to the premaxilla. In this configuration, the vomer is strongly sutured to the premaxilla, and it is sometimes difficult to distinguish the lateral limits of the anterior portion of the vomer. In most Auchenipteridae, the anterior portion of the vomer bears lateral projections with rounded tips, somewhat T-shaped (Fig. 4C). 85. [3574] Vomer, teeth: (0) present; (1) absent (de Pinna, 1993: char. 60; Royero, 1999: char. 32; Britto, 2002: char. 31; de Pinna et al., 2007: char. 37; Marceniuk et al., 2012: char. 53; Birindelli, 2014: char. 74). Among the taxa examined, only Diplomystidae possess vomerine teeth. All Auchenipteridae lack teeth on the vomer. 86. [3575] Vomer, accessory tooth plate: (0) absent; (1) present (de Pinna, 1993: char. 72; Royero, 1999: char. 32; Britto, 2002: char. 32; Akama, 2004: char. 52; Marceniuk et al., 2012: char. 56; Birindelli, 2014: char. 75). Most Siluriformes and all members of Auchenipteridae lack the dentigerous plate on the vomer. In Ariidae, Helogenes marmoratus and, according to the above authors, also in Claroteidae, Pangasiidae and Schilbeidae, an accessory tooth plate is attached to the vomer. 87. [3576] Parasphenoid, anterior half, ventral keel: (0) absent; (1) present (Ferraris, 1988: char. N17; Akama, 2004: char. 23; Birindelli, 2014: char. 78; modified). Among taxa examined, the parasphenoid is enlarged in the posterior half and narrow in the anterior half. Most taxa examined have the narrower portion of the parasphenoid like a flat cylinder or digit-like, but never laterally compressed forming a deep, ventral keel. In the derived state, found in Centromochlus heckelii and Centromochlus existimatus, the parasphenoid forms a prominent deep keel composed by the compressed lateral walls. Birindelli (2014) described this character as the presence/absence of a cranial keel. 88. [3577] Parasphenoid, narrow anterior portion, length: (0) short, < 50% of bone; (1) elongate, > 50% of bone. The parasphenoid usually has a configuration where the posterior portion of the bone is enlarged and wide, and the anterior portion narrows in a long, rod-like bone. In most Auchenipteridae, the parasphenoid is relatively enlarged and flat along its length, and the anterior half of the bone is short. In this condition, < 50% of the parasphenoid is formed by the anterior, narrow portion, generally not reaching to the vertical through the prootic. In the derived state, found in Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Centromochlus (except Centromochlus meridionalis), Tatia (except Tatia creutzbergi and Tatia gyrina), some mochokid species and Pimelodus, the parasphenoid forms an elongate and narrow anterior, rod-like portion, occupying > 50% of the bone length. 89. [3578] Basioccipital, lateral expansion: (0) absent; (1) present (Royero, 1999: char. 46; Vigliotta, 2008: char. 13; Marceniuk et al., 2012: char. 75; Birindelli, 2014: char. 80; modified). In the plesiomorphic condition, the basioccipital has no expansion on its lateral margin; its width is approximately the same along the length. In the derived condition, shared by Auchenipteridae, Ariidae, some Mochokidae and Doradidae, the basioccipital is laterally expanded, forming arms, distinctively wider than its lateral margins. Lundberg (1993) suggested this distinct lateral expansion of the basioccipital as synapomorphic for the arioids, which includes the above families plus the fossil Titanoglanis (see also comments by Vigliotta, 2008; Birindelli, 2014). In some taxa with the plesiomorphic condition, the basioccipital can be slightly wider in the posterior portion, but far from having a distinctive arm or process. Although Birindelli (2014) coded this derived condition also for Aspredinidae, in the present study no lateral expansion was observed among the aspredinids; instead, the basioccipital was laterally straight as in remaining catfishes. 90. [3579] Exoccipital and neural arch of complex vertebra, connection: (0) connected by cartilage; (1) connected by bony suture (Ferraris, 1988: char. V1; Akama, 2004: char. 45; Birindelli, 2014: char. 82). In most Siluriformes, the neural arch of the complex centrum barely contacts the posterior margin of the exoccipital, except for its anteromesial portion, which contacts by means of cartilage. In Doradoidea, the exoccipital is strongly sutured to the neural arch along its entire length. This character is visible only in lateral view. 91. [3580] Trigeminofacial and optic foramina, aperture: (0) united; (1) separated (Mo, 1991: char. 19; Britto, 2002: char. 52; Birindelli, 2014: char. 79). The plesiomorphic condition, found in Diplomystidae, is the union of the trigeminofacial and optic foramina into a single aperture. However, in most Auchenipteridae, the border between the prootic and the pterosphenotic holds the trigeminofacial foramen, with the aperture oriented transversely to the lateral portion of the head owing to the lowering of the sphenotic to a different level relative to the remaining bones of the neurocranium. Auchenipterids have a separate optic foramen that is smaller and anterior to the trigeminofacial foramen, and usually located on the border between the pterosphenoid, orbitosphenoid and frontal. Based on the condition observed in Epapterus blohmi (one cleared and double-stained, USNM 260638) and probably representative of the other members of Auchenipteridae, the trigeminofacial nerve has three large nerves that pass through the foramen and run towards the mandibular arch. Of the two trigeminofacial nerves that run to the mandibular arch, one overtakes the hyomandibula, where it ramifies into two rami, which run to the preopercle and then quadrate and pass through the articulation with the anguloarticular, passing to the posterior portion of the dentary and reaching the anterior tip. The second nerve is the largest and runs through the dorsal portion of the dentary to its anterior portion, where it divides into two rami to innervate the outer and inner mandibular barbels. The third nerve runs directly to the anterior portion of the maxilla and innervates the maxillary barbel. One specimen examined of Tatia brunnea has both conditions in the same individual, a single fenestra on one side and a double fenestra with the bones sutured, nearly separating the apertures. This individual is possibly a sub-adult, with the suture remaining open owing to incomplete ontogeny. 92. [3581] Foramen trigeminofacial, exposure: (0) exposed; (1) not exposed, covered by parasphenoid. In the plesiomorphic condition, the trigeminofacial foramen is visible in ventral view owing to the configuration of the bones on the cranial roof. In auchenipterids, Ageneiosus, Auchenipterichthys, Auchenipterus ambyiacus and Auchenipterus brachyurus, Glanidium, Liosomadoras, Tetranematichthys, Tympanopleura (except Tympanopleura cryptica and Tympanopleura brevis), Tocantinsia, Trachelyichthys (except Trachelyichthys decaradiatus), Trachelyopterus (except Trachelyopterus amblops) and Spinipterus have the bones of the neurocranium with a different configuration, where the posterolateral portion of the parasphenoid and the posteroventral process of the sphenotic cover the aperture of the trigeminofacial foramen in ventral view, partly occluding it. Figure 2. Open in new tabDownload slide Dorsal view of head. A, Entomocorus gameroi, INHS 30016. B, Liosomadoras oncinus, MCP 46029. C, Auchenipterus nuchalis, MCP 19108. D, Centromochlus existimatus, MCP 29838. Abbreviations: ACF, anterior cranial fontanel; AC-LE, anterior cartilage of lateral ethmoid; ANP, anterior nuchal plate; ANT, antorbital; D-SP, dorsal-fin spinelet; EPO, epoccipital; FRO, frontal; LE, lateral ethmoid; MES, mesethmoid; MNP, middle-nuchal plate; NA, nasal; PCF, posterior cranial fontanel; PMA, premaxilla; PNP, posterior nuchal plate; PP-EPO, posterior process of epioccipital; P-SCL, posttemporal–supracleithrum; P-SOC, parieto-supraoccipital; PTO, pterotic; SPH, sphenotic; SPN, spinelet. Scale bars: 5 mm (A, B, D); C: 1 cm. Figure 2. Open in new tabDownload slide Dorsal view of head. A, Entomocorus gameroi, INHS 30016. B, Liosomadoras oncinus, MCP 46029. C, Auchenipterus nuchalis, MCP 19108. D, Centromochlus existimatus, MCP 29838. Abbreviations: ACF, anterior cranial fontanel; AC-LE, anterior cartilage of lateral ethmoid; ANP, anterior nuchal plate; ANT, antorbital; D-SP, dorsal-fin spinelet; EPO, epoccipital; FRO, frontal; LE, lateral ethmoid; MES, mesethmoid; MNP, middle-nuchal plate; NA, nasal; PCF, posterior cranial fontanel; PMA, premaxilla; PNP, posterior nuchal plate; PP-EPO, posterior process of epioccipital; P-SCL, posttemporal–supracleithrum; P-SOC, parieto-supraoccipital; PTO, pterotic; SPH, sphenotic; SPN, spinelet. Scale bars: 5 mm (A, B, D); C: 1 cm. Figure 3. Open in new tabDownload slide Dorsal view of cranium. A, Tetranematichthys wallacei, MCP 27174. B, Auchenipterus nuchalis, MCP 19708. Abbreviation: LEAC, lateral ethmoid anterior cartilage. Scale bars: 5 mm. Figure 3. Open in new tabDownload slide Dorsal view of cranium. A, Tetranematichthys wallacei, MCP 27174. B, Auchenipterus nuchalis, MCP 19708. Abbreviation: LEAC, lateral ethmoid anterior cartilage. Scale bars: 5 mm. Figure 4. Open in new tabDownload slide Ventral view of vomer. A, Tetranematichthys wallacei, MCP 27174; scale bar: 2 mm. B, Gelanoglanis pan, MZUSP 96032; scale bar: 1 mm. C, Tatia nigra, MCP 46028; scale bar: 1 mm. Abbreviations: MES, mesethmoid; PRE, premaxilla; PSP, parasphenoid; VO, vomer. Figure 4. Open in new tabDownload slide Ventral view of vomer. A, Tetranematichthys wallacei, MCP 27174; scale bar: 2 mm. B, Gelanoglanis pan, MZUSP 96032; scale bar: 1 mm. C, Tatia nigra, MCP 46028; scale bar: 1 mm. Abbreviations: MES, mesethmoid; PRE, premaxilla; PSP, parasphenoid; VO, vomer. Mandibular arch 93. [3582] Premaxilla, size: (0) well developed; (1) reduced. In most taxa examined, the premaxilla is well developed and clearly visible in ventral view. In Pseudepapterus, the premaxilla is almost undetectable to the eye and extremely reduced to a tiny and very slender bone, which is located not on the border of the mesethmoid but slightly below the lateral mesethmoid wing. 94. [3583] Premaxilla, shape: (0) plate-like, width distinctly greater than depth; (1) conical with dorsal apex, depth distinctly greater than width; (2) shaped like block, depth and width approximately equal; (3) vertically laminar (Ferraris, 1988: char. J9, 20; Royero, 1999: char. 57; Akama, 2004: char. 51; Birindelli, 2014: char. 125; modified). The plesiomorphic condition in Siluriformes is that the premaxilla is plate-like and flattened. The doradids, Nemadoras, Oxydoras, Trachydoras and Rhincodoras, have a narrow premaxilla, cone shaped with a dorsal apex and its depth greater than width. In contrast, in most Mochokidae the premaxilla is block shaped, with the depth and width approximately equal and without a dorsal projection. Furthermore, Helogenes and Gelanoglanis have a very thin laminar premaxilla that is oriented vertically to the head. 95. [3584] Premaxilla, curvature: (0) almost straight; (1) curved. In most of the outgroup and some species of Auchenipteridae, including Auchenipterichthys, Entomocorus, Gelanoglanis, Glanidium catharinensis and Glanidium cesarpintoi, the premaxilla is straight, with the bone positioned at the anteriormost portion of the head. In the remaining taxa, the premaxilla is curved, forming a conspicuous angle and consequently occupying an anterolateral position on the head. 96. [3585] Premaxilla, posteromedial portion, bony expansion: (0) absent; (1) present (Ribeiro, 2011: char. 71). In most Siluriformes, the posteromedial portion of the premaxilla has approximately the same length throughout its width. In most Ageneiosus, Auchenipterus fordicei, Tympanopleura brevis, Tympanopleura cryptica and Trachycorystes, the posteromedial face of the premaxilla has a long, laminar expansion that sometimes forms a distinct pointed process. 97. [3586] Premaxilla, distal portion, extension: (0) absent; (1) present (Ferraris, 1988: char. J21; Akama, 2004: char. 54; Birindelli, 2014: char. 127; modified). In the plesiomorphic condition, the premaxilla has a mostly consistent width along its length, with no projections on the distal portion of the premaxilla. In the auchenipterids Ageneiosus, Auchenipterus, Epapterus, Pseudepapterus cucuhyensis, Gelanoglanis, Tympanopleura and Tetranematichthys, the distal portion of the premaxilla has a thin, elongate extension. 98. [3587] Premaxilla, posteromesial portion, process: (0) absent; (1) present (Ribeiro, 2011: char. 74). In most Siluriformes, the posterior portion of the premaxilla is straight, with the same depth throughout its length. Within auchenipterids, Ageneiosus, Centromochlus existimatus, Centromochlus perugiae, Tympanopleura, Tetranematichthys and Trachelyopterichthys have the posteromesial portion of the premaxilla with a large, somewhat pointed process, which sustains the posterior portion of the antorbital. 99. [3588] Premaxilla, teeth: (0) present; (1) absent (Ferraris, 1988: char. J8; Higuchi, 1992: char. 42; Sabaj, 2002: char. 13; Birindelli, 2014: char. 128). In all examined taxa, except the auchenipterids Epapterus and Pseudepapterus and the doradids Nemadoras, Oxydoras and Trachydoras, the premaxilla has teeth. 100. [3589] Premaxilla, tooth, shape: (0) curved; (1) straight; (2) sinuous, S-shaped (Vigliotta, 2008: char. 37; Birindelli, 2014: char. 129; modified). Most examined taxa have the premaxillary tooth curved in the distal portion. Among the auchenipterids examined, the teeth are straight only in Entomocorus, Gelanoglanis, Glanidium cesarpintoi, Liosomadoras, some species of Tatia, Trachelyopterichthys, Tocantinsia, Trachycorystes trachycorystes and Spinipterus. Mochokidae (except Mochokus and Mochokiella) is the only family with the derived condition of S-shaped teeth. Taxa without premaxillary teeth were coded as inapplicable for this character. 101. [3590] Maxilla, size: (0) short; (1) elongate, rod-like (Ferraris, 1988: char. J11; Vigliotta, 2008: char. 33; Ribeiro, 2011: char. 81; Birindelli, 2014: char. 131). In most examined taxa, the maxilla is short, always shorter than the autopalatine. In Auchenipterus, Epapterus, Entomocorus, Gelanoglanis, Pseudepapterus, Pseudotatia, Centromochlus (except Centromochlus reticulatus, Centromochlus simplex and Centromochlus perugiae), Tatia carolae, Trachelyopterus amblops, Trachelyopterus insignis and Tympanopleura brevis, the maxilla is elongate in adults. In those species with the derived condition, the rod-shaped maxilla is larger than the autopalatine, sometimes reaching to the anterior margin of the orbit. Nuptial males, which have an altered condition of an enlarged, ossified maxillary barbel, were excluded from the evaluation of the present feature. 102. [3591] Maxilla, dorsal articulation, expansion: (0) present; (1) absent. Among siluriforms with double maxillary condyles for articulation to the cranium, both articulations commonly have the same length. Alternatively, in Auchenipterus, Epapterus, Pseudepapterus and Diplomystidae, the dorsal condyle is expanded in a laminar ossification, which is approximately twice as large as the ventral condyle. 103. [3592] Maxilla, teeth: (0) present; (0) absent (Arratia, 1992: char. 1; de Pinna, 1993: char. 53; Britto, 2002: char. 148; Diogo, 2004: char. 259; de Pinna et al., 2007: char. 3, Birindelli, 2014: char. 133; modified). Among the examined taxa, only Diplomystidae have teeth along the maxilla. 104. [3593] Maxilla, size in mature males: (0) similar to females and non-nuptial males; (1) elongate, distinctly longer than in females and non-nuptial males (Ferraris, 1988: char. J13; Akama, 2004: char. 171; Ribeiro, 2011: char. 82; Birindelli, 2014: char. 134; modified). The maxilla of males is usually of the same size as in females, even in the reproductive season. However, the elongation of the maxillary bone in nuptial males is a distinctive feature of some Auchenipteridae (Akama, 2004). Among them, in nuptial males of Ageneiosus, Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Tympanopleura, Tetranematichthys, Trachelyopterus teaguei, Trachelyopterus insignis and Trachelyopterus amblops, the maxilla is much longer than that of females and non-nuptial males. 105. [3594] Maxilla, tubercles in nuptial males: (0) absent: (1) present (Ferraris, 1988: char. J15; Walsh, 1990: char. 22; Royero, 1999: char. 129, 130; Akama, 2004: char. 172; Birindelli, 2014: char. 135). Among the species examined, strongly ossified tubercles on the maxilla of nuptial males occur in Ageneiosus, Tympanopleura, Tetranematichthys and Trachelyopterus insignis. The number, distribution and shape of the tubercles vary among those taxa. 106. [3595] Coronomeckelian bone: (0) present; (1) absent (Arratia, 1992: char. 47; de Pinna, 1993: char. 23; Diogo, 2004: char. 424; Vigliotta, 2008: char. 26; Birindelli, 2014: char. 136). The coronomeckelian bone is a small, ossified element present mesially on the medial portion of the mandibular arch (see Vigliotta, 2008: fig. 7a). The coronomeckelian is positioned anteriorly to the anguloarticular and is block-like, bearing a tiny ossified process on its dorsal portion. Among the taxa examined, the coronomeckelian bone is absent in some species of Aspredinidae (according to Birindelli, 2014) and Mochokidae. However, all species of Aspredinidae observed herein, except for Pterobunocephalus, have a coronomeckelian bone. Furthermore, this bone is also absent in Hoplomizontinae and Xyliphius (Friel, 1994). Previous authors (Mo, 1991; de Pinna, 1993; Diogo, 2004; Birindelli, 2014) have also observed the absence of this bone in Astroblepidae, Callichthyidae, Loricariidae, Malapteruridae and Scoloplacidae. However, contrary to the above authors, Vigliotta (2008) observed a reduced coronomeckelian bone in mochokid species of Synodontis but coded the reduction of this bone as an absence. In the present study, Synodontis ornatipinnis Boulenger, 1899, Synodontis petricola, Mochokus, Mochokiella and Chiloglanis lack the coronomeckelian bone. Furthermore, Helogenes has a greatly reduced coronomeckelian bone that is very distinctive relative to other Siluriformes. 107. [3596] Coronomeckelian bone, position: (0) horizontal; (1) oblique. The coronomeckelian bone in most Siluriformes is located anterior to the anguloarticular and is positioned horizontally and slightly above the mandibular ramus, in the same direction as the horizontal Meckel’s cartilage. In the Centromochlinae (except Centromochlus existimatus, Centromochlus heckelii, Centromochlus perugiae, Centromochlus meridionalis, Centromochlus schultzi, Tatia intermedia, Tatia sp. 4 and Glanidium), Liosomadoras and the outgroup Pimelodidae, Atopocheilus and Euchilichthys, the coronomeckelian bone is obliquely positioned, beside the ascending process, and is located more dorsally relative to the anguloarticular lamina. Taxa without a coronomeckelian bone were coded as inapplicable for this character. 108. [3597] Coronomeckelian bone, configuration: (0) conspicuously separated from anguloarticular; (1) strongly sutured and continuous with anguloarticular. The coronomeckelian in most Siluriformes is a bony element that is conspicuously separated from the laminar anguloarticular bone (Fig. 5C). Auchenipteridae and Doradidae are variable for this character and, in some taxa, the coronomeckelian bone is continuous with the bony lamina of the anguloarticular, which are sutured to each other (Fig. 5A, B, D, E). Taxa lacking the coronomeckelian bone were coded as inapplicable for this character. 109. [3598] Meckel’s cartilage, ascending process: (0) present; (1) absent (Mo, 1991: char. 35; de Pinna, 1993: char. 22; Britto, 2002: char. 155; Diogo, 2004: char. 419; Vigliotta, 2008: char. 244; Birindelli, 2014: char. 138). In the plesiomorphic condition of catfishes, Meckel’s cartilage is composed of two rami: a branch running horizontally in the middle of the dentary (horizontal Meckel’s cartilage) and a branch running vertically on the posterodorsal portion of the dentary (i.e. ascending Meckel’s cartilage), which is near the articulation with the coronoid process and lateral to the coronomeckelian bone. Among the taxa examined, only Mochokidae, Helogenes marmoratus and the auchenipterids Asterophysus, Centromochlus existimatus and Centromochlus heckelii lack the ascending process of Meckel’s cartilage, a derived condition within Siluriformes (Fig. 5B). 110. [3599] Meckel’s cartilage, ascending process, extension: (0) absent; (1) present, greatly surpassing dorsal margin of dentary. In the plesiomorphic condition, the ascending process lacks an extension. Among the taxa examined, Entomocorus and some species of Ageneiosus, Auchenipterichthys, Tympanopleura and Trachycorystes menezesi have an elongate dorsal projection on the ascending process of Meckel’s cartilage, starting from the middle of the dentary and greatly surpassing its dorsal margin. Taxa without an ascending process of Meckel’s cartilage were coded as inapplicable for this character. 111. [3600] Mandible, coronoid process: (0) present; (1) absent (de Pinna, 1993: char. 50; Britto, 2002: char. 151; Diogo, 2004: char. 400; Vigliotta, 2008: char. 27; Birindelli, 2014: char. 139). The coronoid process is a bony elevation formed by the confluence of the dentary and the anguloarticular (retroanguloarticular in remaining Otophysi) that holds innumerous tendons and muscles of the adductor mandibulae complex in its dorsomedial surface connecting the mandible to the palatoquadrate, suspensorium and opercular bony structures. Additionally, the coronoid process is involved in the connection of the mandible to the neurocranium through the attachment of the dorsal extension of the muscle malaris onto the neurocranium, which is considered a synapomorphy to the Siluriphysi (Datovo & Vari, 2014). In Auchenipteridae, the coronoid process is well developed in most species. Among the taxa examined, the coronoid process is absent in Mochokidae and in the auchenipterids Asterophysus, Centromochlus existimatus and Centromochlus heckelii (Fig. 5B). 112. [3601] Mandible, anguloarticular, coronoid process, size: (0) approximately same size as posterior portion of dentary; (1) deeper than posterior portion of dentary; (2) shallower than posterior portion of dentary. In most catfishes, the anguloarticular portion that participates of the conformation of the coronoid process is approximately the same size as the dentary portion of the process, with the dorsal border of both bones ending approximately at the same line (Fig. 5C). In some taxa with the derived condition, the anguloarticular portion of the coronoid process is deeper or surpasses the dorsal margin of the posterior portion of the dentary (dentary portion of the coronoid process), as in Ariidae, Pimelodidae, some species of Aspredinidae, Trachelyopterus, Spinipterus and Auchenipterus (Fig. 5E). In contrast, in Entomocorus, Epapterus, Gelanoglanis and most species of Ageneiosus, Tympanopleura piperata, Tympanopleura cryptica and Doradidae, the anguloarticular portion of the coronoid process is smaller than the posterior portion of the dentary. 113. [3602] Mandible, anguloarticular, coronoid process, shape: (0) developed as a thin, conspicuous process; (1) developed as a large, laminar process (Britto, 2002: char. 153; modified). Some taxa have a very conspicuous coronoid process in the anguloarticular portion, developed as a deep, thin, dorsal projection of bone configuring the plesiomorphic condition. In some species of Centromochlinae with the plesiomorphic condition, the coronoid process is not much elongated but still forms a distinct point. In the derived condition, the coronoid process is developed into a large lamina that is somewhat elevated and curved but never pointed, and found in Centromochlinae (except Glanidium, a few species of Tatia and Centromochlus meridionalis), Ageneiosus (except Ageneiosus dentatus), Auchenipterichthys, Pseudauchenipterus, Trachelyichthys, Tympanopleura atronasus and Tympanopleura rondoni. 114. [3603] Dentary, posterodorsal portion, shape: (0) elevated; (1) straight. In most catfishes, the posterodorsal portion of the dentary is elevated, forming a dorsal apex. In Asterophysus, Centromochlus existimatus, Centromochlus heckelii, Mochokidae and most Aspredinidae, the dorsal margin of the dentary is entirely straight, without any distinctive elevation along its length. 115. [3604] Dentary, pair of ventral processes: (0) absent; (1) present (Ferraris, 1988: char. J17; Akama, 2004: char. 53; Marceniuk et al., 2012: char. 108; Birindelli, 2014: char. 142). In the plesiomorphic condition, the ventral margin of dentary lacks any process. A conspicuous ventral process on the ventral margin of the anterior portion of the dentary is present in some Auchenipteridae (Auchenipterus, Epapterus, Pseudepapterus and Spinipterus acsi) and may be associated with the mental barbels (Ferraris, 1988; Akama, 2004; Birindelli, 2014). In contrast to the observations of Birindelli (2014), no ventral process linked to the mental barbels was found in the species of Entomocorus or Genidens examined here. 116. [3605] Dentary, teeth: (0) present; (1) absent (Sabaj, 2002: char. 14; Birindelli, 2014: char. 143; modified). The plesiomorphic condition within Siluriformes is the possession of teeth on the dentary. The auchenipterids Epapterus and Pseudepapterus and the doradids Oxydoras and Trachydoras lack dentary teeth. 117. [3606] Dentary, symphysis, ventral process: (0) absent; (1) present (Britto, 2002: char. 162; Birindelli, 2014: char. 145). Among the taxa examined, the Ariidae, Helogenes, some Doradidae, and the auchenipterids Asterophysus, Auchenipterus, Pseudauchenipterus (except Pseudauchenipterus flavescens), Tympanopleura brevis, Tympanopleura rondoni, Ageneiosus lineatus, Ageneiosus dentatus and Trachycorystes trachycorystes have an anteroventral process on the dentary symphysis (Fig. 5E). 118. [3607] Dentary, symphysis, orientation: (0) straight; (1) dorsally projected. Most catfishes have straight contralateral dentaries on the symphysis. Among the taxa examined, only Asterophysus and Tocantinsia have the medial portion of the dentary dorsally arched on the symphysis, forming a curved elevation on its anterior portion and rendering the mandible prognathous relative to the premaxilla. Figure 5. Open in new tabDownload slide Medial view of the lower jaw. A, Tympanopleura brevis, MCP 30617. B, Centromochlus existimatus, MCP 29838. C, Tatia strigata, MCP 46595. D, Pseudauchenipterus affinis, MZUSP 51720. E, Auchenipterus nuchalis, MCP 19708. Abbreviations: AA, anguloarticular; AMC, ascending process of Meckel’s cartilage; CMB, coronomeckelian bone; DEN, dentary; DVP, dentary ventral process; MC, Meckel’s cartilage. Scale bars: 5 mm. Figure 5. Open in new tabDownload slide Medial view of the lower jaw. A, Tympanopleura brevis, MCP 30617. B, Centromochlus existimatus, MCP 29838. C, Tatia strigata, MCP 46595. D, Pseudauchenipterus affinis, MZUSP 51720. E, Auchenipterus nuchalis, MCP 19708. Abbreviations: AA, anguloarticular; AMC, ascending process of Meckel’s cartilage; CMB, coronomeckelian bone; DEN, dentary; DVP, dentary ventral process; MC, Meckel’s cartilage. Scale bars: 5 mm. Suspensorium and opercular series 119. [3608] Autopalatine, anterior portion, condyle, number: (0) two; (1) one (Arratia, 1992: char. 9; Britto, 2002: char. 171; Birindelli, 2014: char. 146). In the plesiomorphic condition of Diplomystidae, the anterior portion of the autopalatine is bifurcated and developed into two large condyles. The anterior portion of the autopalatine bears a unique condyle covered with cartilage in most taxa examined, configuring the derived condition. 120. [3609] Autopalatine, posterior condyle, cartilage: (0) large; (1) small (de Pinna, 1993: char. 21; Diogo, 2004: char. 283; Vigliotta, 2008: char. 41; Birindelli, 2014: char. 152; modified). In most Siluriformes, the autopalatine has an anterior and a posterior condyle, each covered by a cartilage. In most catfishes, the cartilages of both condyles are large and approximately of the same size. Ageneiosus, Tympanopleura, Auchenipterus, Entomocorus, some species of Tatia and Mochokidae have a reduced cartilage on the posterior condyle, which is almost completely restricted to the mesial portion of the condylar facet and not conspicuously expanded to the lateral surface. 121. [3610] Autopalatine, mesial portion, expansion: (0) absent; (1) present. Within auchenipterids, in Ageneiosus and Tympanopleura, and in Helogenes, the mesial portion of the autopalatine is distinctly expanded to articulate with the lateral ethmoid anterolateral cartilage. In remaining taxa, the autopalatine and the lateral ethmoid are also in contact, but the autopalatine is not expanded and is positioned more ventrally. 122. [3611] Autopalatine, posterior portion, shape: (0) mesially curved; (1) straight. In Diplomystes, Ageneiosus (except Ageneiosus intrusus and Ageneiosus dentatus) and Tympanopleura (except Tympanopleura atronasus and Tympanopleura cryptica), the posterior portion of the autopalatine is curved mesially. In most catfishes, the autopalatine is approximately straight throughout its length. 123. [3612] Autopalatine and premaxilla, relative position: (0) distant from each other; (1) autopalatine close to posterior portion of premaxilla; (2) autopalatine close to medial portion of premaxilla. Among Auchenipteridae, Entomocorus, Epapterus, Gelanoglanis stroudi, Gelanoglanis travieso, Pseudepapterus and some species of Auchenipterus, the autopalatine is distantly positioned relative to the premaxilla, and the anterior cartilage of the condyle is positioned laterally to the premaxilla. In most Siluriformes, the autopalatine is positioned close to the posterior portion of the premaxilla, and the anterior portion of the autopalatine overlaps the premaxilla. In Ageneiosus, Tympanopleura and Tetranematichthys, the autopalatine is close to the middle of the premaxilla. 124. [3613] Hyomandibula, posterodorsal process: (0) absent; (1) present, weakly developed; (2) present, well developed (Royero, 1999: char. 61; Akama, 2004: char. 56; Birindelli, 2014: char. 159). The dorsal portion of the hyomandibula can have two distinct processes, the anterior and the posterior. The presence of an anterior process on the hyomandibula is a plesiomorphy, being the common condition in most catfishes. The posterodorsal process of the hyomandibula helps its articulation to the neurocranium, and it is usually similar in shape to the anterior process, but smaller in size. In Auchenipteridae, most Auchenipterus, Entomocorus, Epapterus, Gelanoglanis, Pseudauchenipterus flavescens, Pseudepapterus and Spinipterus lack the posterodorsal process of hyomandibula. This process is present and weakly developed in Auchenipterichthys punctatus, some Auchenipterus, Tetranematichthys, Tocantinsia, Trachelyopterichthys, Trachycorystes menezesi, Tympanopleura atronasus and most species of the genera Centromochlus, Pseudauchenipterus and Tatia, whereas it is well developed in Ageneiosus (except Ageneiosus inermis), most Auchenipterichthys, Glanidium, Liosomadoras, Pseudotatia, Trachelyopterus, Trachycorystes trachycorystes and a few Centromochlus and Tatia. 125. [3614] Hyomandibula, posterodorsal process, shape: (0) wide, length equal to depth; (1) thin, length shorter than depth. The hyomandibular posterodorsal process is relatively wide, with the distal portion rounded in most catfishes examined. This process is longer and thinner, somewhat spine shaped in Ageneiosus militaris, Ageneiosus pardalis, Auchenipterichthys (except Auchenipterichthys punctatus), Glanidium, Liosomadoras, Tympanopleura atronasus, most Trachelyopterus and some Centromochlus and Tatia. Those taxa lacking the hyomandibular posterodorsal process were coded as inapplicable for this character. 126. [3615] Hyomandibula, adductor crest: (0) absent or indistinguishable; (1) present (Lundberg, 1970: char. 61; modified). The adductor crest in Siluriformes is a bony ridge present on the posterior portion of the lateral face of the hyomandibular, a vertical bony ridge where the pars epistegalis of the adductor mandibulae muscle is inserted (Datovo & Vari, 2014; e.g. CA3 of Lundberg, 1970: fig. 68). The shape of the hyomandibula and the configuration of the suspensorium complex are variable among the Siluriformes, rendering it difficult at times to distinguish the adductor crest from the levator crest, especially when both form a continuous prominent curve along the hyomandibula. Certain catfishes, such as Diplomystidae, Ariidae, some species of Mochokidae, Pimelodidae and Doradidae, lack a distinct adductor crest. 127. [3616] Hyomandibula, adductor crest, development: (0) weakly developed; (1) well developed. The adductor crest of the hyomandibula in most catfishes is poorly developed, visible as a strong scar on the bone, but rarely forming a laminar elevated crest. Conversely, in some taxa, the adductor crest is developed into a vertical bony keel, distinctively large. Taxa without an adductor crest were coded as inapplicable for this character. 128. [3617] Hyomandibular, levator operculi crest: (0) absent; (1) present (Lundberg, 1970: char. 64; Birindelli, 2014: char. 157; modified). Dorsal to the hyomandibular condyle, a distinctive large bony crest can be present on the posterodorsal portion of the hyomandibula, where the muscle levator operculi is inserted. The presence of such a crest is variable among the auchenipterids. 129. [3618] Hyomandibula, opercular condyle, size: (0) short, with no distinct base; (1) elongate, with distinct base (Royero, 1999: char. 63; Akama, 2004: char. 58; Birindelli, 2014: char. 160; modified). In most taxa examined, the hyomandibular opercular condyle is short and lacks a distinct base, with the base length smaller than its width. The posterior margin of the hyomandibula bears a condyle that articulates with the opercle. This condyle is more evident in the aspredinids, Helogenes, and the auchenipterids Auchenipterus and Epapterus, which have a relatively elongate and distinct base to the condyle, surpassing the posterior margin of the suspensorium. Birindelli (2014) coded Entomocorus and Pseudepapterus as bearing an elongate condyle, but this condition was not observed in the present study. 130. [3619] Hyomandibula, articulation to neurocranium: (0) via sphenotic, pterotic and prootic; (1) via sphenotic and pterotic; (2) via prootic and sphenotic, (3) via sphenotic only (Mo, 1991: char. 21; Arratia, 1992: char. 35; Royero, 1999: char. 56; Britto, 2002: char. 181; Vigliotta, 2008: char. 10; Birindelli, 2014: char. 162; modified). The bones involved in the articulation of the hyomandibula to the neurocranium vary among Auchenipteridae. The plesiomorphic condition is present only in the outgroup. Among auchenipterids, the hyomandibula can be articulated to the neurocranium via the sphenotic and pterotic, a condition found in Ageneiosus, Auchenipterichthys, Liosomadoras, Pseudauchenipterus, Pseudotatia, Spinipterus acsi, a few Tatia, Tetranematichthys, Trachelyichthys (except Trachelyichthys exilis), Trachelyopterichthys, Trachycorystes menezesi, Tympanopleura and most species of the genera Centromochlus, Glanidium and Trachelyopterus. Only Asterophysus has the hyomandibula articulated via the prootic and sphenotic, whereas in most of the family this articulation occurs via the sphenotic only. 131. [3620] Hyomandibula and metapterygoid, contact: (0) in contact with each other; (1) separated (Arratia, 1992: char. 25; Britto, 2002: char. 189; Birindelli, 2014: char. 164). In almost all catfishes, the hyomandibula articulates to the metapterygoid anteriorly (Fig. 6B). However, the dorsal or posterodorsal expansion of the quadrate in some cases, in addition to the elongation of the hyomandibula in others, may cause the hyomandibula and metapterygoid to lose contact. This derived condition is found in the auchenipterids Ageneiosus, Tatia (except Tatia carolae), Tympanopleura, Tetranematichthys and Centromochlus existimatus, Centromochlus heckelii, Centromochlus reticulatus, Centromochlus simplex, the doradids Nemadoras, Oxydoras, Rhinchodoras and Trachydoras and the aspredinid Pseudobunocephalus (Fig. 6A). Birindelli (2014) coded Aspredinidae as having no contact between the hyomandibula and the metapterygoid. Although Birindelli observed different species of Bunocephalus and Pseudobunocephalus, the contact between these elements was confirmed in Bunocephalus doriae Boulenger, 1902. However, according to Friel (2008: fig. 1), Pseudobunocephalus lundbergi also lacks contact between the hyomandibula and the metapterygoid, with the latter element extremely reduced in size. Thus, Aspredinidae seem to be highly variable for this feature, even at the intrageneric level. Furthermore, Aspredo aspredo was coded as inapplicable for this character because it lacks the metapterygoid, and Pterobunocephalus depressus (Haseman, 1911) was coded as polymorphic. 132. [3621] Sesamoid bone 1 (= entopterygoid; anterior pterygoid element), shape: (0) very elongated and flattened; (1) curved and irregular in shape; (2) large, plate-like; (3) extremely reduced, spherical to ovoid (Vigliotta, 2008: char. 44; modified). The homology of pterygoid elements among catfishes remains unclear relative to the remaining members of Teleostei. The homology of these elements has been extensively discussed, as has the origin attributed to these structures in Siluriformes: whether they originated from a dermal bone, chondro-bone or tendon-bone. The anterior displacement of the metapterygoid in Siluriformes relative to other Teleostei, and the laminar expansion of the hyomandibula, might explain the existence of so many different hypotheses regarding the homology of the suspensorium elements in catfishes (for more details, see Britto, 2002: char. 186). In this context, according to Regan (1911), Kindred (1919), Alexander (1965), Gosline (1975), Arratia (1990, 1992) and Arratia & Schultze (1991), and corroborated by Britto (2002), the endopterygoid (= entopterygoid of Arratia, 1992 and Birindelli, 2014; sesamoid 1 of Diogo et al., 2001 and Britto, 2002; and anterior pterygoid element of Vigliotta, 2008) and the ectopterygoid (sesamoid bone 2 of Diogo et al., 2001) would be in the equivalent position of the metapterygoid in other Teleostei, which could cause misinterpretation of their homology. Another homology hypothesis is the fusion of the endopterygoid and ectopterygoid to the metapterygoid (Howes & Teugels, 1989). However, the origin of both pterygoid elements in catfishes is a common assertion among most of the above authors, in which these structures are ossifications derived from the mineralization of the ligament between the metapterygoid and the neurocranium (Britto, 2002; Vigliotta, 2008) and positioned in the ventromedial portion of the palate, rather than derived from the dermal membrane. In most Auchenipteridae, the sesamoid bone 1 is relatively small compared with the metapterygoid and has an irregular shape, curved, with the medial portion rounded or truncated, in some cases bearing one or two small processes, and with the lateral portion tapering to a tip. However, especially in Gelanoglanis, the mochokid Synodontis and the aspredinid Pseudobunocephalus, sesamoid bone 1 is extremely reduced and rounded to ovoid. Furthermore, in Ageneiosus, Tympanopleura, Tetranematichthys, Helogenes marmoratus, the Doradidae and some species of Aspredinidae, sesamoid 1 is approximately rectangular to plate-like, and is positioned near to or in contact with the metapterygoid in Ageneiosus and Tympanopleura. A more extreme condition can be found in Auchenipterus, Epapterus, Pseudepapterus, some Mochokidae and Diplomystidae, in which sesamoid 1 is very elongate, thin and flattened and positioned transversely to the body axis. According to Arratia (1990, 1992), sesamoid bone 1 is occasionally present in Diplomystes. Notwithstanding, Arratia (1990, 1992) noted that the presence of the tendon-bone entopterygoid is a synapomorphy for the siluriforms (the condition is reversed in the loricarioids). Mochokiella paynei was coded as inapplicable because sesamoid bone 1 is absent. 133. [3622] Sesamoid bone 2 (= ectopterygoid): (0) present; (1) absent (Ferraris, 1988: char. J4; Arratia, 1992: char. 18; Britto, 2002: char. 188; Birindelli, 2014: char. 166). The sesamoid bone 2 or ectopterygoid is an ossicle derived from the mineralization of a ligament (tendon-bone) and is positioned between sesamoid 1 (= entopterygoid) and the autopalatine. The anterior end of sesamoid bone 2 is in contact with the posterior autopalatine cartilage. In some species of Diplomystes, this articulation is very strong, and sesamoid bone 2 is plate-like, fused to the ventral portion of the autopalatine. Among the taxa examined, Pimelodidae, Ariidae, Diplomystidae, Pseudobunocephalus rugosus and Oxydoras niger have a sesamoid bone 2. 134. [3623] Suprapreopercle: (0) present; (1) absent (Lundberg, 1970: char. 70; Britski, 1972: char. 21; Britto, 2002: char. 196; Birindelli, 2014: char. 167). The suprapreopercle is an ossicle located dorsally to the preopercle and ventrally to the pterotic. Sometimes, the suprapreopercle is restricted to a tubular ossification that involves the preopercle–mandibular ramus of the sensorial canal. The suprapreopercle and the preopercle–mandibular ramus seem to have independent origins, because the features of the suprapreopercle are independent of the presence of a preopercle canal in the temporal region (Pastana, 2014). The suprapreopercle is present in all auchenipterids, except Centromochlus perugiae, Gelanoglanis stroudi, Gelanoglanis travieso, and Spinipterus acsi, and in all outgroup families except Diplomystidae, Helogenes and Wertheimeria. In Gelanoglanis, the tubular preopercle–mandibular ramus of the sensorial canal is present, but the ossification is not. 135. [3624] Suprapreopercle, size: (0) short, its length never surpassing twice width; (1) elongate, much longer than wide. The suprapreopercle can vary in size from elongate to short. In the plesiomorphic condition, the suprapreopercle is short, usually rectangular in shape, and its length never exceeds twice its width. In the derived condition, the suprapreopercle is elongate and tubular, and its length is three times or more its width, as found in Ageneiosus, Asterophysus, most Auchenipterus, Centromochlus meridionalis, Centromochlus reticulatus, Entomocorus, Epapterus, Gelanoglanis pan, Gelanoglanis varii, Glanidium cesarpintoi, Liosomadoras, Pseudauchenipterus flavescens, Pseudotatia, some Tatia, Tetranematichthys, Trachelyichthys, Tympanopleura, some Trachelyopterus and Trachycorystes menezesi. 136. [3625] Subpreopercle: (0) present; (1) absent (Britto, 2002: char. 197; Birindelli, 2014: char. 168). The subpreopercle is a tiny ossification of the sensorial canal located between the preopercle and the mandibular complex. All auchenipterids have the subpreopercle, located below the hyomandibula and mesially to the preopercle. Among the taxa examined, the subpreopercle is absent in Mochokidae and Ariidae. 137. [3626] Interopercle, shape: (0) large, ovoid, surpassing half of quadrate length; (1) large, elongated; (2) small ovoid, never reaching half of quadrate length. The opercular series of Siluriformes comprises the opercle, preopercle and interopercle, with the subopercle absent (Fink & Fink, 1981). The interopercle is located anteriorly to the opercle and is attached to it by connective tissue (Britto, 2002). In Siluriformes, the interopercle has a wide variation in size and shape. The interopercle is located ventromedially in the suspensorium complex and between the opercle and the mandibula, and in the auchenipterids, it is anterior to the subpreopercle ossicle and usually medially overlapping a portion of the preopercle plus the hyomandibula. In Auchenipterichthys, Gelanoglanis, Trachelyopterichthys, Diplomystidae, Ariidae (except Cathorops spixii), Pimelodidae, Aspredinidae (except Aspredo), Doradidae (except Trachydoras) and Mochokiella, the interopercle is a large, flat bone, with approximately the same width as the quadrate or at least surpassing half its length. In Auchenipteridae, the shape of the interopercle is highly variable; it can be elongated (Fig. 6A), as in most Auchenipterini species, or it may be small and ovoid, with its length never surpassing half the quadrate length. The latter condition is found in some species of Centromochlus and Tatia, Glanidium, Pseudauchenipterus and Liosomadoras (Fig. 6C). Figure 6. Open in new tabDownload slide Lateral view of suspensorium. A, Tympanopleura brevis, MCP 30617. B, Auchenipterus nuchalis, MCP 19708. C, Pseudauchenipterus affinis, MZUSP 51720. D, Asterophysus batrachus, ANSP 158294. Abbreviations: AA, anguloarticular; DEN, dentary; HYO, hyomandibula; IOP, interopercle; MET, metaperygoid; OP, opercle; POP, preopercle; QUA, quadrate; SES 1, sesamoid 1; SPOP, subpreopercle. Scale bars: 1 mm (A–C); 2 mm (D). Figure 6. Open in new tabDownload slide Lateral view of suspensorium. A, Tympanopleura brevis, MCP 30617. B, Auchenipterus nuchalis, MCP 19708. C, Pseudauchenipterus affinis, MZUSP 51720. D, Asterophysus batrachus, ANSP 158294. Abbreviations: AA, anguloarticular; DEN, dentary; HYO, hyomandibula; IOP, interopercle; MET, metaperygoid; OP, opercle; POP, preopercle; QUA, quadrate; SES 1, sesamoid 1; SPOP, subpreopercle. Scale bars: 1 mm (A–C); 2 mm (D). Hyoid arch 138. [3627] Urohyal, ventral surface, lateral laminar wings: (0) present; (1) absent (Mo, 1991: char. 39; de Pinna, 1993: char. 239; Royero, 1999: char. 146; Britto, 2002: char. 81; Vigliotta, 2008: char. 46; Diogo, 2004: char. 388; Birindelli, 2014: char. 169). The anterior portion of the urohyal is articulated to the ventral hypohyal, with the lateral margins of the posteroventral portion expanded into laminar flanges forming large wings in most catfishes. In Diplomystidae, these laminar expansions are very conspicuous. In Auchenipteridae, Doradidae, and the aspredinids Aspredo aspredo and Pseudobunocephalus, the laminar expansions are absent. This character should be examined in ventral view, because dorsally the urohyal has a cylindrical projection, somewhat elongate and, in auchenipterids, can also bear small wings that could be confused with the ventral ones. 139. [3628] Urohyal, ventral surface, posterior portion, length: (0) elongate, at least twice the length of the main body of the urohyal; (1) short, approximately the same length as the main body of the urohyal; (2) absent. The urohyal is a short bony element and generally bears a very conspicuous posterior projection developed in a vertical bony lamina, visible only in ventral view in cleared and stained specimens. Among Siluriformes, the size of this posterior projection is variable, and in most catfishes, it is short, equivalent in length to the urohyal or, in most cases, never surpassing half the length of the anterior ceratohyal. However, in the auchenipterids Ageneiosus, Auchenipterus, Auchenipterichthys longimanus, Centromochlus heckelii, Centromochlus existimatus, Epapterus, Pseudepapterus, Tympanopleura, Tetranematichthys, Diplomystidae, Ariidae and some species of Doradidae, the posterior projection is very elongated, surpassing at least half the length of the anterior ceratohyal and reaching approximately three times the size of the urohyal (Fig. 7A–C). 140. [3629] Urohyal, ventral surface, posterior portion, width: (0) compact; (1) laminar. The posterior portion of the ventral surface of the urohyal in most catfishes is relatively large, usually a robust, somewhat cylindrical bony structure, or laterally expanded (Fig. 7B). However, in Epapterus, Pseudepapterus cucuhyensis, Tetranematichthys, Tympanopleura brevis, and Tympanopleura cryptica, the posterior portion is narrow and laminar dorsoventrally, not developed laterally (Fig. 7A, C). 141. [3630] Urohyal, ventral surface, posterior portion, shape: (0) simple; (1) bifurcated. The posterior portion of the ventral surface of the urohyal can be restricted to a simple bone, not bifurcated (Fig. 7A, C) or, as found in most catfishes, bifurcated distally in species of Ageneiosus, Tympanopleura (except Tympanopleura brevis and Tympanopleura cryptica) and Tetranematichthys (Fig. 7B). 142. [3631] Urohyal, dorsal surface, lateral projections: (0) absent; (1) present. In most catfishes, the urohyal dorsal surface is slightly expanded posteriorly, becoming somewhat triangular to spearhead shaped, having no conspicuous lateral projections (Fig. 8A–C). In Tetranematichthys, there are conspicuous projections on the lateral margins of the urohyal, forming wings (Fig. 8B). 143. [3632] Urohyal, ventral surface, lateral projections: (0) absent; (1) present. In most siluriforms, the ventral surface of the urohyal is devoid of lateral processes (Fig. 7A–C). In Ariidae, the urohyal has a large lateral process on its ventral surface, forming a tripod (Fig. 7D). 144. [3633] Dorsal hypohyal: (0) present; (1) absent (Mo, 1991: char. 43; Britto, 2002: char. 75; Birindelli, 2014: char. 171). The dorsal hypohyal is present in all taxa examined except the Aspredinidae, which lack this element. 145. [3634] Ventral hypohyal and anterior ceratohyal, ventral connection: (0) synchondral; (1) bony suture (Ferraris, 1988: char. G8; Walsh 1990: char. 10; Akama, 2004: char. 83; Birindelli, 2014: char. 175). In most catfishes, the posterior portion of the ventral hypohyal and the anterior ceratohyal are synchondrally articulated (Fig. 7D). In Ageneiosus, Tympanopleura and Tetranematichthys, these bones are connected by means of a strong bony suture, visible in ventral view (Fig. 7A–C). Figure 7. Open in new tabDownload slide Ventral view of hyoid arches. A, Tympanopleura brevis, MCP 30617. B, Ageneiosus uranophthalmus, MCP 35507; arrow, bifurcation of urohyal. C, Tetranematichthys wallacei, MCP 27174. D, Genidens genidens, MCP 8317; arrow, lateral process of urohyal. Abbreviations: AC, anterior ceratohyal; BB, basibranchial; BR, branchiostegal rays; CB, ceratobranchial; CTP, ceratobranchial tooth plate; HB, hypobranchial; PC, posterior ceratohyal; PTP, pharyngobranchial tooth plate; UH, urohyal; VH, ventral hypohyal. Scale bars: 2 mm (A, C); 10 mm (B); 5 mm (D). Figure 7. Open in new tabDownload slide Ventral view of hyoid arches. A, Tympanopleura brevis, MCP 30617. B, Ageneiosus uranophthalmus, MCP 35507; arrow, bifurcation of urohyal. C, Tetranematichthys wallacei, MCP 27174. D, Genidens genidens, MCP 8317; arrow, lateral process of urohyal. Abbreviations: AC, anterior ceratohyal; BB, basibranchial; BR, branchiostegal rays; CB, ceratobranchial; CTP, ceratobranchial tooth plate; HB, hypobranchial; PC, posterior ceratohyal; PTP, pharyngobranchial tooth plate; UH, urohyal; VH, ventral hypohyal. Scale bars: 2 mm (A, C); 10 mm (B); 5 mm (D). Figure 8. Open in new tabDownload slide Dorsal view of hyoid arches. A, Tympanopleura brevis, MCP 30617. B, Tetranematichthys wallacei, MCP 27174. C, Auchenipterus nuchalis, MCP 19708. Abbreviations: DH, dorsal hypohyal; EB, epibranchial; EB3P, epibrachial 3 process; PB, pharyngobranchial; UH, urohyal; VH, ventral hypohyal. Scale bars: 2 mm (A, B); 5 mm (C). Figure 8. Open in new tabDownload slide Dorsal view of hyoid arches. A, Tympanopleura brevis, MCP 30617. B, Tetranematichthys wallacei, MCP 27174. C, Auchenipterus nuchalis, MCP 19708. Abbreviations: DH, dorsal hypohyal; EB, epibranchial; EB3P, epibrachial 3 process; PB, pharyngobranchial; UH, urohyal; VH, ventral hypohyal. Scale bars: 2 mm (A, B); 5 mm (C). Branchial arches 146. [3635] First two branchial arches, gill rakers, number of rows: (0) two; (1) one; (2) none (Britski, 1972: char. 24; de Pinna, 1993: char. 176; Royero, 1999: char. 113; Britto, 2002: char. 129; Akama, 2004: char. 85; modified; Birindelli, 2014: char. 181). The branchial arches of the Otophysi usually bear two rows of gill rakers (Britto, 2002). Notwithstanding, certain catfish families have only one row of gill rakers in the first two branchial arches. Furthermore, in Gelanoglanis and Pseudobunocephalus, the gill rakers are entirely absent from those arches. In Trachelyichthys, Trachelyopterichthys and in some species of Aspredinidae, the gill rakers are extremely reduced in size and barely ossified, almost imperceptible even under a stereomicroscope, but they are present. 147. [3636] Third and fourth branchial arches, gill rakers, number of rows: (0) two; (1) one; (2) none (Britski, 1972: char. 24; de Pinna, 1993: char. 176; Royero, 1999: char. 113; Britto, 2002: char. 129; Akama, 2004: char. 85; Birindelli, 2014: char. 182). In most catfishes, the third and fourth branchial arches have the same number of gill-raker rows as in the first two arches. However, Synodontis and most species of Centromochlus have only one row of gill rakers on the third and fourth branchial arches. Gelanoglanis and Pseudobunocephalus lack gill rakers on those arches. In Trachelyichthys and Trachelyopterichthys, the third and fourth gill rakers are present in two rows and are reduced in size, as described for the previous character. 148. [3637] Gill rakers, size across branchial arches: (0) gill rakers of all branchial arches of same size; (1) gill rakers of first branchial arch distinctly longer than those in remaining arches. The gill rakers are approximately the same size across all branchial arches in most catfishes. However, in Ageneiosus, Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Pseudauchenipterus, Tympanopleura and the outgroup, except for Diplomystidae, Aspredinidae and some Mochokidae, the first branchial arch bears very elongate gill rakers, distinctly longer than those in the remaining branchial arches, with the gill rakers in arches 2–4 decreasing slightly in size. 149. [3638] Upper gill rakers, size: (0) moderate, length approximately half of gill filaments; (1) reduced, length less than one-fifth of gill filaments; (2) long, length two-thirds of gill filaments (Britski, 1972: char. 24; Ferraris, 1988: char. G4; Walsh, 1990: char. 27; Royero, 1999: char. 111; Akama, 2004: char. 84, 86; Birindelli, 2014: char. 181, modified). The gill rakers in most catfishes are of moderate size, reaching to but not surpassing half the length of the gill filaments. However, the gill rakers of most auchenipterids are reduced in size, less than one-fifth the length of the gill filaments. Conversely, Auchenipterus, Entomocorus, Epapterus, Pseudepapterus and Tympanopleura cryptica have elongate gill rakers, approximately two-thirds the length of the gill filaments. This character was modified and the size restricted to only the gill rakers located on the upper portion of the branchial arch because the size of the gill rakers can vary in some species. 150. [3639] Upper gill rakers, shape: (0) conical; (1) base greatly wide, thin tip; (2) filamentous. The gill rakers of auchenipterids are variable in shape and seem to be related to the diet. In most auchenipterids, the upper gill rakers are conical, similar to a short tooth (Fig. 9A). However, in Ageneiosus, Pseudauchenipterus and Tetranematichthys, the gill rakers are shaped somewhat like shark teeth, with a wide base (but not serrated) and with the distal portion being thinner and pointed, sometimes slightly curved (Fig. 9B). Furthermore, the gill rakers of Auchenipterus, Entomocorus, Epapterus and Pseudepapterus are very elongate and filamentous, although ossified (Fig. 9C). 151. [3640] Gill rakers, spines: (0) absent; (1) present (Royero, 1999: char. 112; Birindelli, 2014: char. 184). Siluriformes usually have smooth gill rakers, but some species of Ageneiosus and Tympanopleura, and Tetranematichthys have hard, spine-shaped processes on the gill rakers. Although in Ageneiosus the spiny processes are present on different sides of the gill rakers, in Tetranematichthys the spines are found on the dorsal and ventral surfaces (Fig. 9A, B). In the latter case, the spines give the impression of bifurcated gill rakers, as already noted by Royero (1999). In addition, the present observations corroborate those of Royero (1999), who coded the presence of spines also to Ageneiosus through Ageneiosus magoi, which was not examined here. In contrast, Birindelli (2014) considered the spines to be absent in Ageneiosus based on the taxa he observed. 152. [3641] Gill filaments, ossification: (0) not ossified; (1) ossified (Britto, 2002: char. 126). In the plesiomorphic condition, as in the auchenipterids Asterophysus, Auchenipterus brevior, some species of Centromochlus and Gelanoglanis, the gill filaments are unossified (Britto, 2002; fig. 66B). In most catfishes examined, the gill filaments are partly ossified (Britto, 2002; fig. 66A). The level of ossification is variable, sometimes restricted to the proximal portion and very subtle, as in most Centromochlinae, or the ossification may extend almost to the mid-length of the filament. 153. [3642] Second and third basibranchials, size: (0) moderate to large; (1) reduced (Ferraris, 1988: char. G6; Akama, 2004: char. 81; Birindelli, 2014: char. 187). Most catfishes have the second and third basibranchials large and normally developed. Particularly in Asterophysus, Ageneiosus, Gelanoglanis and Tympanopleura, these bones are much reduced in size. 154. [3643] Fourth basibranchial, posterior process: (0) absent; (1) present (Birindelli, 2014: char. 188). Among the taxa examined, only the Doradidae and Euchilichthys have a distinctly thin, elongated process on the posterior portion of the fourth basibranchial. Birindelli (2014) mentioned this process as ventral in the character title, but in the discussion and in the figure legend it is referred to as the posterior process, an anatomical description more in line with the position of this element, a term adopted herein. 155. [3644] Third and fourth basibranchial, accessory cartilage: (0) absent; (1) present (Ferraris, 1988: char. G2; de Pinna, 1993: char. 184; de Pinna, 1996: char. 41; Britto, 2002: char. 90; Akama, 2004: char. 79; Birindelli, 2014: char. 190). In Auchenipteridae, a relatively extensive, rounded accessory cartilage is present between the third and the fourth basibranchials in some species of Ageneiosus, Auchenipterichthys, Auchenipterus fordicei, Centromochlus perugiae, Pseudauchenipterus flavescens, Pseudepapterus hasemani, Tetranematichthys, Trachelyichthys and Trachelyopterichthys. This cartilage is also present in Mochokidae, but absent in the remaining species examined. 156. [3645] First hypobranchial, shape: (0) discoid; (1) funnel shaped, with constriction at mid-portion and medial margin narrower than lateral margin; (2) both distal portions of approximately same width, rectangular to hourglass shaped; (3) elongated, cylindrical (Higuchi, 1992: char. A46; Birindelli, 2014: char. 191, modified). Most catfishes have the first hypobranchial discoid or somewhat ovoid, usually bearing an anterior pointed process (state 0; Fig. 8C). The first hypobranchial in the auchenipterids varies in shape. In some groups, it is funnel shaped, with the lateral margin more than twice the width of the medial one (state 1; Fig. 8A). In the second derived condition, the first hypobranchial is rectangular to hourglass shaped, usually with a conspicuous constriction on the medial portion of both anterior and posterior margins, but in some cases curved on the posterior margin and somewhat straight on the anterior. In this condition, both tips, medial and lateral, are large and of approximately the same width (state 2; Fig. 8B). Asterophysus and Gelanoglanis are the only taxa in Auchenipteridae having the first hypobranchial very long and cylindrical (state 3). This character was distinctly coded as compared with Birindelli (2014), because the inclusion of many taxa introduced a greater variation of shapes. 157. [3646] Second hypobranchial: (0) ossified; (1) cartilaginous (de Pinna, 1996: char. 38; Britto, 2002: char. 92; de Pinna et al., 2007: char. 38; Birindelli, 2014: char. 192). In Siluriformes, the second hypobranchial is partly or totally ossified. Among taxa examined, the second hypobranchial is entirely cartilaginous in Gelanoglanis stroudi, Gelanoglanis travieso, Trachelyichthys, some Aspredinidae and Helogenes marmoratus. 158. [3647] First epibranchial, shape: (0) medial portion enlarged, wider than lateral portion; (1) uniformly cylindrical (Ferraris, 1988: char. G3; Walsh, 1990: char. 8; Royero, 1999: char. 109; Akama, 2004: char. 7; Birindelli, 2014: char. 195). The epibranchials are located on the dorsal portion of the branchial arch and contact the pharyngobranchial elements medially. In Diplomystidae and the auchenipterids Ageneiosus, Tympanopleura (except Tympanopleura brevis and Tympanopleura cryptica) and Tetranematichthys, the medial portion of the first epibranchial, which contacts the third pharyngobranchial, is larger than its lateral portion. In most Siluriformes, the first epibranchial is usually cylindrical, with approximately the same width throughout its length. 159. [3648] Third epibranchial, posterior process, size: (0) short, shorter than epibranchial portion mesial to the process bifurcation point; (1) long, approximately of the same length as the epibranchial portion mesial to the bifurcation point. The third epibranchial of catfishes bears a distinct process on the posterior portion that causes this element to appear bifurcated. Some taxa have a short posterior process, shorter than the epibranchial portion mesial to the bifurcation point (Fig. 8B). However, the process is usually approximately the same length as the third epibranchial portion mesial to the process bifurcation point, which is not covered by gill filaments in Ageneiosus vitattus, Auchenipterus, Auchenipterichthys longimanus, Auchenipterichthys thoracatus, Epapterus, Gelanoglanis, Pseudauchenipterus (except Pseudauchenipterus affinis), Pseudepapterus, Pseudotatia, Spinipterus acsi, Trachycorystes trachycorystes, Tympanopleura atronasus and most Trachelyopterus and Trachelyichthys (Fig. 8C). Pseudobunocephalus was coded as inapplicable because it lacks a posterior process. 160. [3649] Third epibranchial, posterior process, distal portion, shape: (0) rounded to square; (1) pointed. The distal portion of the posterior process of the third epibranchial is usually rounded to square, and its base is wide (Fig. 8C). In Ageneiosus (except Ageneiosus inermis and Ageneiosus militaris), Auchenipterus ambyiacus, Auchenipterus brachyurus, Centromochlus (except Centromochlus macracanthus and Centromochlus meridionalis), Gelanoglanis Entomocorus, Pseudauchenipterus, Pseudepapterus, Pseudotatia and some species of the genera Tatia, Trachelyichthys, Trachelyopterus and Tympanopleura brevis, the process tapers and ends in a sharp point, and its base is relatively thin (Fig. 8A). 161. [3650] First pharyngobranchial: (0) present; (1) absent (Mo, 1991: char. 47; de Pinna, 1993: char. 140; Britto, 2002: char. 116; de Pinna et al., 2007: char. 75; Marceniuk et al., 2012: char. 182; Birindelli, 2014: char. 197). Among Siluriformes, only Ariidae and Diplomystidae possess the first pharyngobranchial. 162. [3651] Second pharyngobranchial: (0) present; (1) absent (de Pinna, 1993: char. 185; Britto, 2002: char. 118; de Pinna et al., 2007: char. 65; Birindelli, 2014: char. 198). Among Siluriformes, only Diplomystidae have the second pharyngobranchial. 163. [3652] Upper pharyngobranchial tooth plate, shape: (0) rounded to ovoid, slightly longer than wider; (1) elongate, length at least three times its width (Britski, 1972: char. 25; Ferraris, 1988: char. G5; Akama, 2004: char. 80; Birindelli, 2014: char. 199; modified). In most auchenipterids, the upper pharyngobranchial tooth plate is rounded to ovoid. It is attached to the fourth pharyngobranchial and also contacts the third pharyngobranchial. In the auchenipterids Asterophysus, Auchenipterus ambyiacus, Auchenipterus brachyurus, Epapterus, Gelanoglanis, Liosomadoras, Pseudepapterus and some species of Trachelyopterus, the upper pharyngobranchial tooth plate is elongated, and its length is approximately three times its width. 164. [3653] Upper pharyngobranchial tooth plate, anterior process: (0) present; (1) absent. Among catfishes, a pointed anterior process on the upper pharyngobranchial tooth plate is variably present. Among outgroups examined, the Aspredinidae, the Doradidae (except for Anadoras grypus (Cope, 1872)), Helogenes and Mochokiella lack the anterior process. Among the auchenipterids, this process is absent in Ageneiosus, Asterophysus, Epapterus, Pseudepapterus, Pseudotatia, Trachycorystes trachycorystes, Tatia sp. 1, Tympanopleura and some species of the genera Auchenipterichthys, Auchenipterus and Centromochlus. Figure 9. Open in new tabDownload slide Shape of gill rakers. A, Tympanopleura atronasus, MCP 36338. B, Tetranematichthys wallacei, MCP 27174. C, Epapterus dispilurus, MCP 40991. Scale bars: 200 µm (A); 500 µm (B, C). Figure 9. Open in new tabDownload slide Shape of gill rakers. A, Tympanopleura atronasus, MCP 36338. B, Tetranematichthys wallacei, MCP 27174. C, Epapterus dispilurus, MCP 40991. Scale bars: 200 µm (A); 500 µm (B, C). Vertebrae, Weberian apparatus and associated structures 165. [3654] Transformator process of tripus, posterior portion, shape: (0) straight; (1) ventromedially folded; (2) ventrally curved (Britski, 1972: char. 19; Ferraris, 1988: char. V2; Royero, 1999: char. 73; Akama, 2004: char. 69; Birindelli, 2014: char. 203; modified). The parapophysis of the third vertebra and its corresponding rib are hypothesized to be the origin of the tripus (Rosen & Greenwood, 1970; Arratia, 1987; Britto, 2002). In most Otophysi, the tripus has a posterior process modified into a hook (Britto, 2002), which is termed the transformator process of the tripus. In most Siluriformes, it is usually straight to slightly concave ventrally and, according to the above authors, weakly attached to the gas bladder. However, in Auchenipteridae and Doradidae, the posterior margin of the transformator process is ventromedially folded and strongly attached to the gas bladder. In most mochokids, the transformator process is semicircular, hood-like and ventrally curved. Conversely, the mochokid Synodontis have the transformator process straight or very slightly curved ventrally, but visibly do not configure the folded condition. 166. [3655] Os suspensorium, size: (0) moderate; (1) reduced (Ferraris, 1988: char. V4; Royero, 1999: char. 70; Britto, 2002: char. 213; Akama, 2004: char. 70; Birindelli, 2014: char. 204). The ventral margin of the os suspensorium is composed of a narrow nodule that usually has a strong connection to the compound vertebral centrum. In most Siluriformes, the os suspensorium is of moderate size and firmly attached to the compound centrum (Fig. 10B). Conversely, in most Doradoidea, Pseudobunocephalus and Euchilichthys, the os suspensorium is also connected to the compound centrum but is much smaller (Fig. 10A). 167. [3656] Os suspensorium, shape: (0) flat and rectangular; (1) round or angled (Vigliotta, 2008: char. 83; modified). The os suspensorium is variable in shape among the siluriforms, sometimes elongated and forming a rectangular, flattened bone that is not articulated to or in contact with the vertebra, or in other cases with the ventral region rounded to angled and sometimes attached to the vertebra. 168. [3657] Compound centrum, anterior parapophysis and transcapular process, connection: (0) sutured together; (1) free from each other (Birindelli, 2014: char. 205; modified). The parapophysis of the compound centrum usually has two rami. The anterior ramus is large and elongated and sutured to the posterolateral portion of the transcapular process in all Siluriformes examined except the Auchenipteridae, Doradidae, Mochokidae (except Chiloglanis) and Ariidae. In these taxa, there is no contact between the anterior parapophysis of the compound centrum and the transcapular process. 169. [3658] Compound centrum, anterior parapophysis, shape: (0) laminar bone, not developed into a modified process; (1) developed into a modified process called the Müllerian ramus (Vigliotta, 2008: char. 76; Birindelli, 2014: char. 205; modified). The anterior ramus of the parapophyses of the compound centrum in most catfishes is a large laminar bone, which is usually attached to the ventrolateral portion of the transcapular process. However, the Ariidae bear a laminar anterior parapophysis that is not sutured to the transcapular process. In contrast, Auchenipteridae, Doradidae and Mochokidae have a distinct parapophysis of the compound centrum, where the distal portion is modified into a flexible structure with a rod-like base bearing a discoid bony element (the Müllerian ramus) on its lateral portion (Fig. 10). The Müllerian ramus in combination with its protractor muscle forms the elastic spring apparatus (Müller, 1842a, b) capable of producing sound via the contraction and retraction of the muscle responsible for distending and vibrating the gas bladder. This very elaborate structure seems to represent a complex evolutionary process that probably involves many events within the evolutionary history. 170. [3659] Müllerian ramus, depth: (0) deep discoid; (1) shallow disc. In Auchenipteridae and Doradidae, the anterior parapophysis of the compound centrum is modified into a Müllerian ramus, with the distal process as a deep or thick discoid element (Fig. 10). However, the Mochokidae also have the Müllerian ramus enlarged, but as a shallow discoid, laminar bone. The taxa in which the anterior parapophysis of the compound centrum is not modified into a Müllerian ramus were coded as inapplicable for this character (see character 169). 171. [3660] Müllerian ramus, distal portion, shape: (0) flattened disc; (1) protruded posteriorly (Ferraris, 1988: char. V8; Soares-Porto, 1998: char. 16; Royero, 1999: char. 67; Akama, 2004: char. 68; Birindelli, 2014: char. 206). Among taxa with a Müllerian ramus, the distal portion is a flattened disc that contacts the anterior surface of the swimbladder (Ferraris, 1988: char. V8). Only Centromochlus heckelii and Centromochlus existimatus have the Müllerian ramus protruded posteriorly, forming a deep and hollow bag, which inwardly contacts the anterior surface of the swimbladder. 172. [3661] Müllerian ramus, size: (0) large; (1) reduced. Among taxa examined, the lateral discoid process is large, much larger compared with the tripus. However, a rare condition of a reduced discoid process, smaller compared with the tripus, is present in Ageneiosus, Gelanoglanis, Pseudepapterus and Atopocheilus. Although the discoid process of Gelanoglanis is relatively long, it is much reduced in size, smaller than the tripus. The taxa in which the anterior parapophysis of the compound centrum was not modified into a Müllerian ramus were coded as inapplicable for this character (see character 167). 173. [3662] Müllerian ramus, orientation: (0) horizontally oriented; (1) vertically oriented. Orientation of the discoid Müllerian ramus is variable among Siluriformes that possess it. In the Doradidae, except Franciscodoras and Trachydoras, the flat side of the disc is oriented horizontally and facing ventrally. In auchenipterids, the disc is oriented vertically, with the flat surfaces contacting the gas bladder facing posteromesially. The taxa in which the anterior parapophysis of the compound centrum is not modified into a Müllerian ramus were coded as inapplicable for this character (see character 169). 174. [3663] Gas bladder, wall: (0) not ossified; (1) ossified (Ribeiro, 2011: char. 204; modified). The lateral and ventral walls of the gas bladder in most catfishes are non-ossified, or not encapsulated in adults. In Ageneiosus (except for Ageneiosus lineatus), Tympanopleura piperata and Tympanopleura cryptica, the gas bladder wall is strongly ossified (encapsulated), with its anterior portion firmly attached to the posterior face of the Müllerian ramus. This observation corroborates the classification of Ribeiro (2011) for this character, except for Ageneiosus lineatus, in which no ossification was observed. 175. [3664] Compound centrum, posterior parapophysis: (0) present; (1) absent (Vigliotta, 2008: char. 79; Birindelli, 2014: char. 210). The parapophysis of the compound centrum has large anterior and posterior rami. Almost all catfishes have the posterior ramus (posterior parapophysis), which is usually laminar and large but at times similar in shape to the parapophysis of the fifth vertebra. However, in Auchenipteridae and Doradidae, the posterior ramus is absent. 176. [3665] Fifth vertebra, parapophysis, size: (0) large, distinctly larger than parapophysis of sixth vertebra; (1) moderate, approximately same size as parapophysis of sixth vertebra; (2) small, distinctly smaller than parapophysis of sixth vertebra; (3) absent (de Pinna, 1996: char. 57, 62; Britto, 2002: char. 233; Diogo, 2004: char. 138; Vigliotta, 2008: char. 80; Birindelli, 2014: char. 211; modified). In the plesiomorphic condition, present in the auchenipterids Ageneiosus, Entomocorus, Epapterus, Pseudepapterus, Tympanopleura, Tetranematichthys, Trachelyichthys (except Trachelyichthys sp. 1), Tatia carolae, Tatia creutzbergi and Trachelyopterus coriaceus, the parapophysis of the fifth vertebra is very large, distinctly larger than the next one. However, in most auchenipterids, the parapophysis of the fifth vertebra is moderate in size, similar to the parapophysis of the subsequent vertebra. Notwithstanding, Asterophysus, Auchenipterichthys, Pseudauchenipterus, Gelanoglanis, Trachelyopterichthys, Centromochlus existimatus, Centromochlus heckelii, Auchenipterus osteomystax, Tatia intermedia, some species of Glanidium and some species of Trachelyopterus have a small parapophysis on the fifth vertebra. Among the auchenipterids examined, the parapophysis of the fifth vertebra is absent in Trachelyopterus amblops, Trachelyopterus lucenai, Trachelyopterus teaguei, Trachelyopterus striatulus and Trachelyopterus porosus. Birindelli (2014) did not report an expanded parapophysis on the fifth vertebra for Auchenipteridae. The present character was coded by comparing the parapophysis of the fifth vertebra with the sixth vertebra only, owing to variation in size between the sixth and the subsequent vertebrae. Commonly in siluriforms, the parapophysis of the sixth vertebra is larger than the subsequent ones, which usually decrease slightly in size towards the caudal peduncle. 177. [3666] Compound centrum, postzygapophysis, extension: (0) absent; (1) extending to end of fifth vertebra; (2) extending to end of sixth vertebra; (3) extending to end of seventh vertebra; (4) extending to end of eighth vertebra (Britto, 2002: char. 222, modified). The vertebral centra of the Weberian apparatus in Siluriformes are fused to each other, forming a compound centrum, which is sutured to the fifth vertebra. The opposite condition can be found in the remaining Otophysi, in which the vertebral centra are separated by cartilage and not sutured to each other (Britto, 2002). The compound centrum of catfishes bears a pair of processes on the posterior end of the centrum, the postzygapophysis, which joins the neural prezygapophysis (processes on the anterior portion of the centrum) of the subsequent posterior vertebra. This feature is variable in auchenipterids, and the ventral postzygapophysis of the compound centrum extends to the suture with the prezygapophysis of the sixth (Britto, 2002: fig. 100b), seventh (Britto, 2002: fig. 101) or eighth vertebral centrum. In addition, the postzygapophysis can be much smaller, reaching to the prezygapophysis of the fifth vertebra, as found in Aspredinidae and the doradids Franciscodoras and Wertheimeria, or they can be absent, as in Diplomystidae, Cathorops and Helogenes. 178. [3667] Compound centrum, composition: (0) including up to fourth vertebra; (1) including up to fifth vertebra; (2) including up to sixth vertebra; (3) including up to seventh vertebra; (4) including up to eighth vertebra (Arratia, 1992: char. 40; de Pinna, 1993: char. 208; Marceniuk et al., 2012: char. 204; Vigliotta, 2008: char. 82; Birindelli, 2014: char. 217). The compound centrum is composed of vertebral centra articulated to each other by a deep suture or fused. In the plesiomorphic condition, found in Diplomystidae and Cetopsidae, the compound centrum is composed of the second to fourth vertebrae, with the fifth vertebra free from the complex. In Diplomystidae, the first vertebral centrum is present and separated from the compound centrum; Arratia (1987) hypothesized this to be the primitive condition within the siluriforms. However, the number of vertebrae included in the compound centrum is variable in Siluriformes, especially in Auchenipteridae. Thus, in the present study, this variation was accounted for by coding the last vertebra included in the compound centrum. In most auchenipterids, the compound centrum includes the seventh vertebra, but the composition is variable within the family and can include the fifth, sixth, seventh or eighth vertebra. Birindelli (2014) coded Ageneiosus, Asterophysus, Liosomadoras and Tetranematichthys as including up to the seventh vertebra in the compound centrum, but in the present analysis only up to the sixth vertebra are included in those taxa. Additionally, disagreement with the codification of Birindelli (2014) occurred in the doradids Acanthodoras, Oxydoras and Megalodoras. The Doradoidea have a conspicuous ventral lamina usually covering or, in some cases, enclosing a portion of the compound centrum. Nevertheless, the expansion of this ventral laminar bone is independent from the fusion of the compound centrum, and the latter cannot be evaluated because the expansion of the end of this ventral laminar bone in some species sometimes makes it either shorter or longer than the compound centrum. 179. [3668] Anterior ribs and parapophyses, articulation: (0) articulated to ventral surface of parapophysis; (1) articulated to posterodorsal surface of parapophysis; (2) articulated to posteroventral surface of parapophysis (Ferraris, 1988: char. V12; Vigliotta, 2008: char. 84; Birindelli, 2014: char. 219; modified). The ribs on the anterior portion of the trunk are articulated to the distal portion of the parapophysis of the corresponding vertebral centra. The articulation can be to the ventral surface of the parapophysis, as found in the outgroup, except doradids, or through the posterodorsal surface of the parapophysis, as found in some Ageneiosus, Auchenipterichthys, Auchenipterus nigripinnis, some Centromochlus, Gelanoglanis stroudi, Gelanoglanis pan, Glanidium ribeiroi, Liosomadoras, Tatia (except Tatia boemia, Tatia caxiuanensis and Tatia intermedia), some species of Trachelyopterus, Tympanopleura brevis and Spinipterus. Nonetheless, most auchenipterids have the anterior ribs articulated to the posteroventral surface of the parapophysis. 180. [3669] Ribs, proximal extremity, shape: (0) straight; (1) twisted (Ferraris, 1988: char. V12; de Pinna, 1993: char. 198; Britto, 2002: char. 239; Vigliotta, 2008: char. 84; Birindelli, 2014: char. 220). The proximal portion of the anterior ribs, which are articulated to the vertebral parapophyses, is usually rounded but varies in shape between straight, as in Diplomystes, Asterophysus, Auchenipterus, Entomocorus, Epapterus, Gelanoglanis, Tocantinsia, Trachelyichthys, Trachelyopterichthys, some Tatia, Trachelyopterus teaguei, Trachycorystes menezesi and Tympanopleura brevis, and twisted, as in most catfishes, with the proximal portion recurved to follow the articular surface on the parapophysis. Figure 10. Open in new tabDownload slide Compound centrum and associated structures. A, Tetranematichthys wallacei, MCP 27174. B, Auchenipterus nuchalis, MCP 19708. Abbreviations: MR, Müllerian ramus; OS, os suspensorium; PP-EPO, posterior process of epioccipital; P5V, parapophysis of fifth vertebra; TP, transcapular process; TRI, tripus. Scale bars: 2 mm. Figure 10. Open in new tabDownload slide Compound centrum and associated structures. A, Tetranematichthys wallacei, MCP 27174. B, Auchenipterus nuchalis, MCP 19708. Abbreviations: MR, Müllerian ramus; OS, os suspensorium; PP-EPO, posterior process of epioccipital; P5V, parapophysis of fifth vertebra; TP, transcapular process; TRI, tripus. Scale bars: 2 mm. Dorsal fin and associated elements 181. [3670] Anterior nuchal plate: (0) present; (1) absent (Britski, 1972: char. 27; Ferraris, 1988: char. D1; Walsh, 1990: char. 4; Soares-Porto, 1998: char. 9; Royero, 1999: char. 26; Akama, 2004: char. 32, 40; Vigliotta, 2008: char. 19; Birindelli, 2014: char. 228). The anterior nuchal plate is a dorsal expansion of the supraneural, and its presence varies among catfishes. The absence of the anterior nuchal plate was previously discussed by Birindelli (2014) and can involve two different events. In some groups, the anterior nuchal plate is fused to the middle nuchal plate or, according to Birindelli et al. (2007), it can reduce and disappear during ontogeny. The anterior nuchal plate is absent in the auchenipterids Ageneiosus, most Centromochlus (except Centromochlus existimatus, Centromochlus heckelii and Centromochlus perugiae), Gelanoglanis, Pseudepapterus, Tatia carolae, Tatia musaica, Tatia meesi, Tympanopleura and Tetranematichthys. Additionally, Ariidae, Helogenes marmoratus, Aspredinidae, Euchilichthys, Chiloglanis, Nemadoras and Rhincodoras, among the outgroups, were coded as missing the anterior nuchal plate. Contrary to the present study, Birindelli (2014) coded Epapterus and Glanidium cesarpintoi with the derived condition. In Epapterus, the anterior nuchal plate is much reduced in size and circular in shape, surrounded by the middle nuchal plate. In Glanidium cesarpintoi, the anterior nuchal plate is clearly evident and large, as in the remaining Auchenipteridae. 182. [3671] Anterior nuchal plate and parieto-supraoccipital, contact: (0) separated, not in contact; (1) in contact, sutured (Chardon, 1968: char. 229; Mo, 1991: char. 90; Royero, 1999: char. 25, 27; Britto, 2002: char. 282; Akama, 2004: char. 40; Birindelli, 2014: char. 229, modified). In Diplomystidae, the anterior nuchal plate is located far from and not contacting the parieto-supraoccipital. However, the anterior nuchal plate in some Siluriformes contacts the parieto-supraoccipital through a strong suture. In the Auchenipteridae, Doradidae, Mochokidae and Pimelodidae examined herein, the anterior nuchal plate is strongly sutured along the entire posterior border of the parieto-supraoccipital. Those taxa where the anterior nuchal plate is absent were coded as inapplicable for this character. 183. [3672] Middle nuchal plate and parieto-supraoccipital, contact: (0) separated, not in contact; (1) in contact, sutured (Britski, 1972: char. 27; Ferraris, 1988: char. D3; Walsh, 1990: char. 4; Royero, 1999: char. 23; Vigliotta, 2008: char. 20; Akama, 2004: char. 35, 126; Birindelli, 2014: char. 231). Most auchenipterids have a large anterior nuchal plate, which consequently, precludes the middle nuchal plate from contacting the parieto-supraoccipital. The contact occurs in a few taxa in which the anterior nuchal plate is absent or reduced in size and a concomitant anterolateral expansion of the middle nuchal plate has occurred, which forms a configuration that allows such contact. This latter configuration of the derived condition is found in Asterophysus batrachus, Entomocorus, Epapterus, Glanidium ribeiroi, Pseudotatia parva and Synodontis. Contrary to the present study, Birindelli (2014) considered Pseudotatia to have no contact between the middle nuchal plate and the parieto-supraoccipital. Additionally, Ageneiosus, most Centromochlus, Gelanoglanis, G. ribeiroi, Pseudepapterus, Tatia carolae, Tatia musaica, Tatia meesi, Tympanopleura, Tetranematichthys, the Ariidae, Mochokidae, Pimelodidade and Doradidae also have contact between the middle nuchal plate and the parieto-supraoccipital. Helogenes marmoratus was coded as inapplicable for this character because the middle nuchal plate is absent. 184. [3673] Posterior nuchal plate, width: (0) narrow, narrower than base of dorsal-fin spine; (1) broad, approximately as wide as or wider than base of dorsal-fin spine. The width of the posterior nuchal plate varies among the auchenipterids. The posterior nuchal plate can be narrower than the base of the dorsal-fin spine. Alternatively, the posterior nuchal plate can be wide, having approximately the same width or wider than the base of the dorsal-fin spine. Helogenes marmoratus was coded as inapplicable for this character because the posterior nuchal plate is absent. 185. [3674] First and second dorsal-fin pterygiophores and their corresponding neural spines, contact: (0) not sutured; (1) sutured (Britski, 1972: char. 26; Royero, 1999: char. 75; Britto, 2002: char. 286; Akama, 2004: char. 125; Birindelli, 2014: char. 234). Diplomystidae, Aspredinidae and Helogenes have the first and second dorsal-fin pterygiophores not sutured to the neural spines, with those structures usually in contact via a ligament instead (Birindelli, 2014). In most catfishes examined, the first and second dorsal-fin pterygiophores are sutured to their corresponding neural spines. 186. [3675] Dorsal fin, free pterygiophores, number: (0) seven; (1) six; (2) five; (3) four; (4) three; (5) two (Ribeiro, 2011: char. 159, modified). The plesiomorphic condition in catfishes is to have seven (Diplomystidae) or usually a higher number (Ariidae, Pimelodidae, most Mochokidae) of pterygiophores supporting the soft dorsal-fin rays. However, among auchenipterids, this characteristic is variable and informative. Most species of Auchenipteridae and the Doradidae have five pterygiophores supporting the soft dorsal-fin rays. Notwithstanding, Gelanoglanis, Spinipterus, Glanidium cesarpintoi, Trachelyopterichthys anduzei and most species of Tatia and some of Trachelyopterus have four pterygiophores supporting the soft dorsal-fin rays. Exceptionally, in the auchenipterid Trachelyopterichthys taeniatus, Trachelyichthys exilis, Pseudepapterus cucuhyensis and Aspredinidae (except Pseudobunocephalus iheringii (Boulenger, 1891), there are three pterygiophores; and uniquely, in Epapterus there are only two, and six in Pseudotatia. 187. [3676] Dorsal fin, proximal radials, joined: (0) second and remaining proximal radials separated from first radial; (1) second and third proximal radials joined to first radial; (2) only second proximal radial joined to first radial. The proximal radials in siluriforms are fused to medial ones (Schaefer, 1987) and herein refered to as the proximal radial. Nevertheless, the first proximal radial is considered to be fused to the supraneural of the dorsal fin (Schaefer, 1987) and to support the spinelet and the first unbranched dorsal-fin ray (usually modified into a spine). The configuration of the dorsal-fin skeleton in the plesiomorphic condition present in Diplomystidae, Pimelodidae and Cetopsidae is that all pterygiophores support branched rays (i.e. second proximal radial and thereafter) free from the first proximal radial complex. In some species of Mochokidae, the second and third proximal radials are fused to the first one. Notwithstanding, Auchenipteridae, Ariidae, Aspredinidae, Doradidae and remaining Mochokidae have the second proximal radial sutured to the first one. 188. [3677] Dorsal fin, posteriormost pterygiophore: (0) supporting ray; (1) not supporting ray. Most Siluriformes have the posteriormost pterygiophore of the dorsal fin supporting one ray, or less commonly two rays, in which the last one is smaller and unbranched (see next character). A rarest condition of not supporting any rays is present in Centromochlus (except Centromochlus meridionalis), Entomocorus, some Glanidium, some Tatia, Pseudotatia, Trachelyichthys sp. 1, Trachelyopterus coriaceus and the Mochokid Euchilichthys dybowskii (Vaillant, 1892). The complexity of the configuration of the dorsal-fin skeleton makes it difficult to trace the evolutionary scenario of distinct events, whether the posteriormost pterygiophore only lacks its corresponding ray (state 0) rather than the last pterygiophore being fused to the penultimate, when a ray is present (alternative hypothesis to state 0), or the last pterygiophore and its corresponding ray are, in fact, both absent (state 1). To understand properly the homology of the pterygiophores assuming any condition of loss, presence or fusion, an ontogenetic study is necessary. 189. [3678] Dorsal fin, number of soft rays: (0) seven; (1) six; (2) five; (3) four; (4) three. The number of soft rays, i.e. not considering the first unbranched ray, which can be modified into a spine, is variable among Siluriformes, but considerably consistent within the groups, demonstrating this to be evolutionarily informative. The plesiomorphic condition is seven soft rays, a condition found in members of Diplomystidae, Ariidae and some Mochokidae. Pimelodidae, Doradidae and Auchenipterinae have six soft dorsal-fin rays (except some species of Trachelyopterus and Trachelyichthys), whereas members of Centromochlinae usually have five, except for some species of Tatia, mostly those of small body size with four, and Glanidium ribeiroi with six. Exceptionally, Auchenipterus has seven soft rays and Epapterus, three. 190. [3679] Dorsal fin, last pterygiophore, ventral bony projection: (0) present; (1) absent (Ribeiro, 2011: char. 160). The last dorsal-fin pterygiophore in auchenipterids is usually similar to the more anterior ones, somewhat quadrangular but smaller in size. In the auchenipterids Pseudauchenipterus, Pseudepapterus cucuhyensis and Tetranematichthys and in Diplomystidae, Ariidae, Pimelodidae and the doradids Anadoras grypus and Megalodoras uranoscopus (Eigenmann & Eigenmann, 1888), the last pterygiophore has a ventral bony projection that is more slender than the remaining portion of the structure. Ribeiro (2011) coded Epapterus dispilurus as having the ventral projection, which was not observed in the individuals examined herein. 191. [3680] Dorsal fin, last pterygiophore, posterior bony projection: (0) absent; (1) present. Among catfishes, the last dorsal-fin pterygiophore has approximately the same depth throughout its length. However, the last dorsal-fin pterygiophore can bear a posterior bony projection, usually surpassing the origin of the last ray. This posterior projection is thinner than the remaining portion of the element. The latter condition is found in the auchenipterids Ageneiosus, Auchenipterus, Auchenipterichthys (except for Auchenipterichthys punctatus), Epapterus, most species of Centromochlus and Tatia, Pseudepapterus, Pseudauchenipterus, Spinipterus sp. ‘oncinha’, Tetranematichthys, Tocantinsia, Trachelyopterus and Tympanopleura, and in Pimelodus, Atopochilus and Nemadoras. 192. [3681] Dorsal fin, spinelet: (0) present; (1) absent (Britto, 2002: char. 288; Birindelli, 2014: char. 235). The spinelet is the first dorsal-fin ray, which in most catfishes is modified into a small element and, in some groups, serves as a locking mechanism for the second dorsal-fin ray, which is usually modified into a spine. Among the taxa examined, the dorsal-fin spinelet is absent in the Aspredinidae, Helogenes, Gelanoglanis nanonocticolus and Gelanoglanis varii. 193. [3682] Dorsal fin, spinelet, ventral process, size: (0) short, reaching ventrally to 20% of pterygiophore height; (1) long, reaching ventrally to middle of pterygiophore (Ferraris, 1988: char. D7; de Pinna, 1993: char. 233; de Pinna, 1996: char. 88; Britto, 2002: char. 289; Royero, 1999: char. 76; Birindelli, 2014: char. 236). Among the taxa examined, Ariidae, Diplomystidae, Pimelodidae and, exceptionally, the auchenipterids Pseudepapterus and Entomocorus gameroi have a short ventral process on the spinelet. Those taxa without the dorsal-fin spinelet were coded as inapplicable for this character. 194. [3683] Dorsal fin, spinelet, ventral process, shape: (0) straight; (1) posteriorly curved. The auchenipterids Liosomadoras oncinus, Pseudauchenipterus affinis, Pseudauchenipterus jequitinhonhae, Tocantinsia, Trachycorystes, Trachelyopterichthys and the Diplomystidae, Pimelodidae, Ariidae and some Mochokidae have a straight ventral process in the dorsal-fin spinelet. However, in most catfishes examined, the ventral process is curved posteriorly, forming a semicircle. Those taxa without the dorsal-fin spinelet were coded as inapplicable for this character. 195. [3684] Dorsal fin, spine: (0) present; (1) absent. Among the taxa examined, only in Gelanoglanis nanonocticolus, Gelanoglanis varii, Helogenes and the Aspredinidae, the second dorsal-fin ray is not modified into a spine. 196. [3685] Dorsal fin, spine, size: (0) moderate, less than one-third of SL; (1) short, less than one-sixth of SL; (2) long, greater than one-third of SL (Britski, 1972: char. 27; Ferraris, 1988: char. D13; Curran, 1989: char. 14; Soares-Porto, 1998: char. 23; Akama, 2004: char. 127; Birindelli, 2014: char. 238; modified). The dorsal-fin spine of most Auchenipteridae is of moderate length, never reaching one-third of the SL. Among the species examined, Asterophysus, Epapterus, Pseudepapterus and Spinipterus have a very short spine. In contrast, Centromochlus heckelii, Centromochlus existimatus, Tatia intermedia, the mochokid Synodontis ornatipinnis and the doradids Nemadoras humeralis and Trachydoras nattereri have a long spine, surpassing one-third of the SL. Those taxa without a dorsal-fin spine were coded as inapplicable for this character. 197. [3686] Dorsal fin, spine of nuptial males, size: (0) same size as females and non-nuptial males; (1) longer than females and non-nuptial males (Royero, 1999: char. 126; Akama, 2004: char. 162; Birindelli, 2014: char. 239). Nuptial males of Siluriformes have the dorsal-fin spine of the same size as females, except Ageneiosus, Auchenipterus, Auchenipterichthys, Entomocorus, Epapterus, Liosomadoras, Pseudauchenipterus nodosus, Pseudepapterus, Tetranematichthys, Tympanopleura, Trachelyichthys, Trachelyopterichthys and Trachelyopterus, which are modified in size and longer than in non-nuptial males and females. Those species for which a nuptial male was unavailable or for which there was no literature information were coded as unknown. Additionally, those taxa without a dorsal-fin spine were coded as inapplicable for this character. 198. [3687] Dorsal fin, spine of nuptial males, curvature: (0) straight; (1) strongly arched (Akama, 2004: char. 165; Birindelli, 2014: char. 240). The plesiomorphic condition and common shape for nuptial male Siluriformes is a straight dorsal-fin spine. In the auchenipterids Ageneiosus, Tetranematichthys, Tympanopleura, Trachelyopterus insignis, Trachelyopterus amblops and Trachelyopterus teaguei, the dorsal-fin spine is noticeably arched during the reproductive season. The changes in shape, size and ornamentation of the dorsal-fin spine of males seem to be linked directly to the amplexus behaviour during spawning. Those species for which a nuptial male was unavailable or for which there was no literature information were coded as unknown. Those taxa without a dorsal-fin spine were coded as inapplicable for this character. 199. [3688] Dorsal fin, spine of nuptial males, displacement when erect: (0) not sloping anteriorly, forming angle of ~90° relative to body axis; (1) sloping anteriorly, forming angle > 90° relative to body axis (Ferraris, 1988: char. D12; Royero, 1999: char. 127; Akama, 2004: char. 167; Birindelli, 2014: char. 241; modified). Most nuptial males of auchenipterids lack the ability to angle the dorsal-fin spine anteriorly. However, nuptial males of Ageneiosus, Auchenipterus, Entomocorus, Epapterus, Pseudepapterus, Tetranematichthys, Tympanopleura and Trachelyopterus have a strongly modified dorsal-fin spine during the reproductive season. In those taxa, the dorsal-fin spine is angled anteriorly, with the distal tip pointing anteriorly. Those species for which a nuptial male was unavailable or for which there was no literature information were coded as unknown. Those taxa without a dorsal-fin spine were coded as inapplicable for this character. 200. [3689] Dorsal fin, spine, anterior margin, serration: (0) absent; (1) present (Royero, 1999: char. 80; Akama, 2004: char. 129; Vigliotta, 2008: char. 62; Birindelli, 2014: char. 242; modified). In the plesiomorphic condition, the anterior margin of the dorsal-fin spine is smooth, without serrae. However, most Auchenipteridae have conspicuous serrae along the anterior margin of the spine. The auchenipterids Auchenipterus, Centromochlus existimatus, Centromochlus meridionalis, Entomocorus, Epapterus, Gelanoglanis, some Pseudauchenipterus, Pseudepapterus, Trachelyichthys decaradiatus, Trachelyichthys sp. 1, and the outgroups Diplomystidae, Mochokidae (except Mochokus), Pimelodus maculatus Lacepède, 1803, Anadoras grypus and Megalodoras uranoscopus have a smooth anterior margin of the dorsal-fin spine, without any serrae. This character was coded distinctly from Akama (2004), Vigliotta (2008) and Birindelli (2014), who considered rudimentary serration as absent, and it was assumed as present even if weakly developed, such as in Trachelyopterus coriaceus, Trachelyopterus galeatus and C. romani. Those taxa without a dorsal-fin spine were coded as inapplicable for this character. 201. [3690] Dorsal-fin spine, anterior margin, serration, number of rows: (0) one; (1) two; (2) three. Auchenipterids usually have one mid-row of serrae along the entire anterior margin of the dorsal-fin spine. Although the serrae on the distal portion of the spine are always arranged in one row, serrae on the proximal portion are arranged in two anterolateral rows in Trachelyopterichthys, Trachycorystes trachycorystes and Cathorops spixii, or three rows in Spinipterus and Liosomadoras, in which one row is located at the mid-line and two rows are positioned at the lateral margins. This character was coded disregarding nuptial males, which may develop serrae arranged in one or two rows centrally on the anterior margin of the spine (e.g. Ageneiosus and Trachelyopterus). Those taxa without a dorsal-fin spine or without serrae on the spine were coded as inapplicable for this character. 202. [3691] Dorsal-fin spine, anterior margin, proximal portion, irregular serration: (0) absent; (1) present. Among taxa with serrae on the anterior margin of the dorsal-fin spine, only Asterophysus, Auchenipterichthys, and Trachelyichthys have a patch of round serrae irregularly arranged in the proximal portion of the spine, not forming a distinctive row. This character was coded disregarding nuptial males, which may develop serrae arranged in one or two rows centrally on the anterior margin of the spine (e.g. Ageneiosus and Trachelyopterus). Those taxa without a dorsal-fin spine or without serrae on the spine were coded as inapplicable for this character. 203. [3692] Dorsal fin, spine, anterior margin, serration, shape: (0) rounded, (1) pointed. In the taxa with serrae on the anterior margin of the dorsal-fin spine, the serrae are generally short and distally blunt. However, among the auchenipterids, Asterophysus batrachus, Centromochlus romani, Centromochlus perugiae, Centromochlus reticulatus, Liosomadoras, some Tatia, Trachelyichthys exilis, Trachelyopterus amblops and Trachelyopterus teaguei, and the Doradidae and Mochokus have larger, stronger, pointed serrae. Those taxa without a dorsal-fin spine or without serrae on the spine were coded as inapplicable for this character. 204. [3693] Dorsal fin, spine, posterior margin, serration: (0) present; (1) absent (Royero, 1999: char. 79; Akama, 2004: char. 130; Sousa, 2010: char. 57; Birindelli, 2014: char. 245). Among the Auchenipteridae, Ageneiosus (except for Ageneiosus vittatus and Ageneiosus dentatus), Asterophysus, Centromochlus perugiae, Centromochlus reticulatus, Centromochlus aff. C. simplex, Epapterus, Gelanoglanis travieso, Glanidium cesarpintoi, Pseudepapterus, Pseudotatia, Tatia (except Tatia carolae and Tatia intermedia), Tocantinsia, Trachelyopterichthys, Trachelyopterus amblops, Trachelyopterus insignis, Trachycorystes trachycorystes and Spinipterus lack serrae along the posterior margin of the dorsal-fin spine. Those taxa without a dorsal-fin spine were coded as inapplicable for this character. Pectoral girdle 205. [3694] Pectoral girdle, anterior margin, shape: (0) arched; (1) truncated; (2) acute tip (Soares-Porto, 1998: char. 18; Birindelli, 2014: char. 249; modified). In most catfishes, the anterior margin of the pectoral girdle is arched in ventral aspect, with the anterior border somewhat rounded. In auchenipterids, Ageneiosus (except Ageneiosus vittatus and Ageneiosus lineatus) and Tympanopleura rondoni have the anterior margin of the pectoral girdle truncated. In Asterophysus, Auchenipterus, Centromochlus (except Centromochlus simplex), Entomocorus, Gelanoglanis, Glanidium (except Glanidium catharinensis), Pseudauchenipterus, Pseudotatia, Tatia (except Tatia intermedia and Tatia sp. 4), Trachelyopterus insignis, Trachycorystes menezesi, Spinipterus acsi and Trachelyichthys decaradiatus, the margin of the pectoral girdle is anteriorly pointed, giving the girdle a triangular shape. 206. [3695] Pectoral girdle, symphysis, length: (0) moderate, less than half its width; (1) very short, mesial tip of pectoral girdle barely in contact; (2) long, at least equivalent to half the width of the pectoral girdle. The length of the ventral symphysis between contralateral bones of the pectoral girdle is usually shorter than half its width. Among Auchenipteridae, this plesiomorphic condition is found in Ageneiosus, Auchenipterus, Epapterus, Glanidium catharinensis, Pseudauchenipterus, Pseudepapterus, Tympanopleura, Tetranematichthys, Tocantinsia, Trachelyichthys, Trachelyopterichthys, Trachycorystes trachycorystes and Trachelyopterus striatulus. A very distinct condition is found in Asterophysus batrachus, where the cleithrum and the coracoid are very thin and barely in contact at the ventral midline. In most Auchenipteridae, and in the Ariidae, Pimelodidae and Doradidae (except Megalodoras uranoscopus and Wertheimeria maculata), the pectoral girdle symphysis is long, with its length being at least twice its width. 207. [3696] Pectoral girdle, contralateral bones, contact: (0) strongly in contact; (1) barely in contact. In the plesiomorphic condition, the contralateral bones of pectoral girdle are articulated in an elongate, strong symphysis ventromedially. In the derived condition, found in Asterophysus batrachus, the pectoral girdle is barely joined through weak contact only by the tip of both bones, and without a posteriorly laminar expansion. 208. [3697] Mesocoracoid: (0) separated from main body of scapulo-coracoid, forming conspicuous arch; (1) totally fused and nearly indistinguishable from main body of scapulo-coracoid (Ferraris, 1988: char. P1; Royero, 1999: char. 82; Britto, 2002: char. 247; Akama, 2004: char. 105; Diogo, 2004: char. 185; Vigliotta, 2008: char. 55; Marceniuk et al., 2012: char. 219; Birindelli, 2014: char. 250; modified). The mesocoracoid is plesiomorphically present in catfishes and more easily observed in dorsal view. The mesocoracoid is a thin arch located on the posterodorsal portion of the pectoral girdle that joins the dorsolateral portion of the cleithrum and the scapulo-coracoid. In the plesiomorphic condition, found in Diplomystidae, Mochokidae, Pimelodidae and Helogenes marmoratus, the anterior portion of the mesocoracoid arch is usually near the proximal radials, and the posterior end is attached to the mesial margin of the posterior process of the scapulo-coracoid. In contrast, the condition found in most Auchenipteridae is the mesocoracoid totally fused to the dorsolateral laminar portion of the scapulo-coracoid, and almost indistinguishable from the scapulo-coracoid in some taxa. However, in Auchenipterus and Pseudepapterus, the mesocoracoid is observable as a tenuous line along the border of the mesocoracoid. It connects the lateral portion of the cleithrum to the scapulo-coracoid as a continuous laminar bone that runs lateromedially to the posterior process of the scapulo-coracoid and is fused laterally to its transverse lamina. The very distinct configuration of the pectoral girdle in dorsal view, which supports a very elongated and wide laminar crest fused to the mesocoracoid, renders it very difficult to observe. Nevertheless, in Ageneiosus lineatus, Ageneiosus dentatus and Tympanopleura atronasus, the mesocoracoid is a separate arch from the main body of the scapulo-coracoid. This plesiomorphic condition provides strong evidence for the hypothesis of the fusion of the mesocoracoid in Auchenipteridae and the remaining taxa. Birindelli (2014) and other previous authors, in contrast to Diogo (2004), assumed the absence of the mesocoracoid in Auchenipteridae, Doradoidea and Aspredinidae. In the present study, the mesocoracoid was considered not as a separate bone structure but totally fused to the scapulo-coracoid in the auchenipterids (except for Tympanopleura atronasus, Ageneiosus lineatus and Ageneiosus dentatus). Given that a distinct, arch-shaped mesocoracoid was not observed in the Ariidae, Aspredinidae or Doradidae, the derived condition was considered to include both conditions, the lack of the mesocoracoid and the total fusion, for these groups. The absence of the mesocoracoid was considered as a non-exclusive synapomorphy for Doradoidea by Birindelli (2014). 209. [3698] Pectoral fin, third proximal radial: (0) present; (1) absent (Ferraris, 1988: char. P10; Akama, 2004: char. 114). Among the taxa examined, the third proximal radial is absent in Gelanoglanis and Pseudobunocephalus. 210. [3699] Pectoral fin, third proximal radial, size: (0) narrow; (1) wide, expanded laterally (Ferraris, 1988: char. P9; Walsh, 1990: char. 6; Royero, 1999: char. 90; Akama, 2004: char. 115; Ribeiro, 2011: char. 134; Birindelli, 2014: char. 255, modified). The third proximal radial of the pectoral fin in most catfishes is narrow, with approximately the same width throughout its length, and it is also similar in size to the second proximal radial and somewhat rod shaped to rectangular. However, in Ageneiosus and Tympanopleura (except for Tympanopleura atronasus and Tympanopleura piperata), the distal portion of the third proximal radial is very large, approximately twice the size of the second. Previous authors assumed that this condition was present in Tetranematichthys, but in the present observations the third proximal radial is slightly larger than the second, but with the distal expansion very distinct from that found in Ageneiosus. Furthermore, Birindelli (2014) described this character as variation in the size of the second proximal radial, contrary to previous authors and the present observations that the variation in size is indeed in the third proximal radial. 211. [3700] Pectoral fin, first unbranched ray: (0) rigid, sharp spine; (1) somewhat rigid, not sharp; (2) soft (Walsh, 1990: char. 33; Ribeiro, 2011: char. 119, modified). In many catfishes, the first element of the pectoral fin is modified into a strong, sharp spine. In Ageneiosus inermis, Ageneiosus militaris, Ageneiosus ucayalensis, Ageneiosus uranophthalmus and Helogenes marmoratus, the first unbranched ray is somewhat rigid, but not modified into a sharp spine. Notwithstanding, in Gelanoglanis nanonocticolus and Gelanoglanis varii, the first unbranched pectoral-fin ray is soft (see more details by Calegari et al., 2014; Calegari & Reis, 2016). 212. [3701] Pectoral fin, first unbranched ray, base, dorsal process, development: (0) small, simple; (1) large, discoid (Royero, 1999: char. 86; Akama, 2004: char. 117; Birindelli, 2014: char. 256). In the outgroup taxa (except Doradidae), Ageneiosus pardalis and Tympanopleura piperata, the dorsal process of the base of the pectoral-fin spine is small and simple. In contrast, most Auchenipteridae and all Doradidae have the dorsal process of the first unbranched ray of the pectoral fin large and discoid. 213. [3702] Pectoral-fin spine, anterior margin, serrations: (0) absent; (1) present (Ferraris, 1988: char. P7; Walsh, 1990: char. 34; Soares-Porto, 1998: char. 20; Royero, 1999: char. 88; Akama, 2004: char. 107; Britto, 2002: char. 255; Vigliotta, 2008: char. 59; Birindelli, 2014: char. 257). In Diplomystidae, some Mochokidae and the auchenipterids Ageneiosus inermis, Ageneiosus vittatus, Ageneiosus dentatus, Ageneiosus militaris, Auchenipterus (except for Auchenipterus fordicei), Centromochlus existimatus, Centromochlus heckelii, Epapterus, Gelanoglanis, Pseudepapterus and Pseudauchenipterus, the pectoral-fin spine is smooth along its anterior margin or bears a few tiny blunt granules only on the proximalmost portion, but not serrae. Ribeiro (2011) considered Ageneiosus inermis to have reduced granular serrae on the anterior margin of the spine; however, the tiny blunt granules were coded as serrae absent. However, most examined catfishes that have the first element of the pectoral fin modified into a spine also have serrae on its anterior margin. Those taxa in which the first unbranched ray of the pectoral fin is not modified into a spine were coded as inapplicable for this character. 214. [3703] Pectoral-fin spine, anterior margin, serrations, orientation: (0) antrorse; (1) retrorse; (2) perpendicular (Ferraris, 1988: char. P5; Birindelli, 2014: char. 258). Within auchenipterids, Centromochlus meridionalis, Tatia carolae, Pseudotatia and Asterophysus batrachus have antrorse, or anteriorly oriented, serrae on the pectoral-fin spine. However, in Entomocorus, Auchenipterichthys, Trachelyichthys (except Trachelyichthys sp. 1), Trachelyopterus (except Trachelyopterus amblops and Trachelyopterus coriaceus) and Trachycorystes menezesi, the serrae are retrorse or posteriorly oriented. In most Auchenipteridae that have serrae on the anterior margin of the pectoral-fin spine, the serrae are perpendicular to the spine axis.Those taxa in which the first unbranched ray of the pectoral fin is not modified into a spine and those without serrae on the anterior margin were coded as inapplicable for this character. 215. [3704] Pectoral-fin spine, anterior margin, serrations, shape: (0) sharp, pointed; (1) blunt or truncated. Among the taxa examined, Pimelodus maculatus, Ariidae, Ageneiosus, Auchenipterus fordicei, Glanidium ribeiroi, Tatia intermedia, Tetranematichthys, Tympanopleura, Tocantinsia and Trachelyopterus coriaceus have serrae on the anterior margin of the pectoral-fin spine that are blunt or truncated, not ending as a sharp point. In Ageneiosus, the serrae are very small and somewhat globular. Those taxa in which the first unbranched ray of the pectoral fin is not modified into a spine and those without serrae on the anterior margin were coded as inapplicable for this character. 216. [3705] Pectoral-fin spine, dorsal surface, serrations: (0) absent; (1) present (Akama, 2004: char. 110; Birindelli, 2014: char. 260). Among the catfishes examined, Spinipterus and Acanthodoras cataphractus (Linnaeus, 1758) have serrae along the entire dorsal surface of the pectoral-fin spine. Birindelli (2014) also coded the presence of those serrae in Trachelyopterichthys taeniatus, Trachelyopterus porosus and Trachelyopterus striatulus, but in the present study serrae in those taxa were not observed. The serrae observed by Birindelli are possibly associated with a sexually dimorphic feature of mature males during the reproductive season, because those species usually present remarkable sexual modifications on the fin spines. The derived condition observed in Spinipterus and Acanthodoras is permanent and not limited to the reproductive season. Those taxa in which the first unbranched ray of the pectoral fin is not modified into a spine were coded as inapplicable for this character. 217. [3706] Pectoral-fin spine, length: (0) moderate, less than one-third of SL; (1) elongate, greater than one-third of SL (Ferraris, 1988: char. P2; Royero, 1999: char. 91; Akama, 2004: char. 106; Birindelli, 2014: char. 261). Most catfishes examined have a moderate-sized pectoral-fin spine. Among the taxa examined, Centromochlus heckelii, Centromochlus existimatus, Centromochlus macracanthus and the doradids Trachycodoras nattereri and Franciscodoras marmoratus have a very long pectoral-fin spine, which reaches to or surpasses one-third of SL. Those taxa in which the first unbranched ray of the pectoral fin is not modified into a spine were coded as inapplicable for this character. 218. [3707] Cleithrum and coracoid, fenestra: (0) present; (1) absent. Among the catfishes examined, Auchenipteridae, Diplomystidae, Ariidae, Aspredinidae, most Mochokidae and Helogenes marmoratus have a fenestra in the suture that articulates the cleithrum and coracoid ventrally. Although the fenestra in most Mochokidae is present, it is restricted to the lateral portion and is ventrally covered by the scapulo-coracoid. Pimelodus and most Doradidae (except Trachydoras, Franciscodoras and Wertheimeria) lack the cleithrum–coracoid fenestra. 219. [3708] Cleithrum, dorsal process, size: (0) moderate, shorter than pectoral-fin spine; (1) distinctively large, approximately the same length as the pectoral-fin spine. The dorsal process of the cleithrum is usually of moderate size, shorter than the pectoral-fin spine. Among all taxa examined, only Gelanoglanis has the derived condition, a huge dorsal process on the cleithrum, approximately the same length as the pectoral-fin spine or the first unbranched ray when the spine is absent (Fig. 11). Although the dorsal process in Asterophysus batrachus is approximately the same size as the pectoral-fin spine, it was coded as being of moderate size because the relative size in this taxon is an artefact of the reduction of the pectoral-fin spine. Additionally, to assert the homology of this state in this taxon compared with the remaining auchenipterids, the posterior process was considered moderate in size. 220. [3709] Cleithrum, posterodorsal process: (0) present; (1) absent. Most catfishes have a conspicuous pointy process between the dorsal and the posterior process of the cleithrum. Among the taxa examined, the auchenipterids Centromochlus existimatus, Centromochlus perugiae, Centromochlus heckelii, Centromochlus reticulatus, Gelanoglanis, Tatia brunnea, Tatia carolae, Tatia creutzbergi, Tatia jacaratia, Tatia meesi, Tatia sp. 1 and sp. 2 and the outgroup Nemadoras humeralis, Oxydoras niger, Rhynchodoras woodsi, Trachydoras nattereri, Aspredinidae, Helogenes marmoratus and Synodontis ornatipinnis lack the posterodorsal process. 221. [3710] Cleithrum, posterior process: (0) present; (1) absent (Ferraris, 1988: char. P8; Walsh, 1990: char. 5; Royero, 1999: char. 84; Akama, 2004: char. 112; Britto, 2002: char. 246; Vigliotta, 2008: char. 53; Birindelli, 2014: char. 265; modified). The posterior process of the cleithrum forms an extension of the lateral margin of the pectoral girdle dorsal to the pectoral-fin insertion. In most catfishes, the posterior process is present, elongated and pointed. Among the taxa examined, Ageneiosus, Tympanopleura (except Tympanopleura brevis and Tympanopleura rondoni) and Helogenes marmoratus lack the posterior process of the cleithrum. 222. [3711] Cleithrum, posterior process, size: (0) small, not surpassing base of branched pectoral-fin rays; (1) moderate, approximately half the length of the pectoral-fin spine; (2) long, approximately two-thirds the length of the pectoral-fin spine (Ferraris, 1988: char. P8; Royero, 1999: char. 84; Walsh, 1990: char. 5; Akama, 2004: char. 112; Britto, 2002: char. 246; Vigliotta, 2008: char. 53; Birindelli, 2014: char. 265; modified). The size of the cleithrum posterior process is variable among catfishes. Within the auchenipterids, Asterophysus batrachus, Pseudepapterus, Tetranematichthys, Tympanopleura brevis and Tympanopleura rondoni have a small posterior process, not surpassing the base of the branched pectoral-fin rays. Auchenipterichthys, Auchenipterus, Entomocorus, Epapterus, Gelanoglanis, Pseudauchenipterus, Tocantinsia, Trachelyopterus and Spinipterus sp. ‘oncinha’ have a moderate posterior process on the cleithrum, approximately half the length of the pectoral-fin spine. Finally, Centromochlus, Glanidium, Liosomadoras, Tatia, Pseudotatia, Trachelyichthys, Trachelyopterichthys, Spinipterus acsi and Trachycorystes have an elongated posterior process, reaching to at least two-thirds of the pectoral-fin spine, but usually surpassing that point. Those taxa lacking the posterior process of cleithrum were coded as inapplicable for this character. 223. [3712] Cleithrum, posterior process, ornamentation: (0) absent; (1) present (Curran, 1989: char. 11; Akama, 2004: char. 113; Birindelli, 2014: char. 267). Most auchenipterids have small, bony, rounded protuberances on the posterior process of cleithrum, more numerous along the lateral margin. Among the auchenipterids examined, Tympanopleura brevis, Tympanopleura rondoni, Asterophysus, Auchenipterus, Entomocorus, Epapterus, Gelanoglanis, Glanidium (except Glanidium cesarpintoi), Pseudepapterus jequitinhonhae, Pseudepapterus nodosus, Tetranematichthys and Trachycorystes menezesi have the posterior process smooth, without any ornamentation. Those taxa lacking the posterior process of cleithrum were coded as inapplicable for this character. 224. [3713] Cleithrum, posterior process, ornamentation, arrangement: (0) scattered; (1) arranged in single row; (2) arranged in two rows (Curran, 1989: char. 11; Akama, 2004: char. 113; Birindelli, 2014: char. 267; modified). In most taxa that have ornamentation on the posterior process of cleithrum, the ornamentation is scattered and homogeneously spread. Tatia brunnea, Tatia carolae, Tatia creutzbergi, Tatia strigata, Tatia sp. 2 and the doradids Oxydoras niger, Rhynchodoras woodsi and Trachydoras nattereri have ornamentation on the posterior process distributed in only one row. Furthermore, Liosomadoras, Spinipterus acsi, Anadoras grypus, Megalodoras uranoscopus and Nemadoras humeralis have two rows of ornamentation. Those taxa that lack the cleithrum posterior process were coded as inapplicable for this character. 225. [3714] Scapulo-coracoids, articulation at symphysis, shape: (0) straight; (1) entirely interdigitate; (2) interdigitated in posterior portion only (Mo, 1991; de Pinna et al., 2007: char. 103; Birindelli, 2014: char. 269). The plesiomorphic condition of the symphysis articulation between the contralateral scapulo-coracoids is straight, as found in Diplomystidae and Helogenes marmoratus. Most catfishes have an interdigitated suture along the entire length of the symphysis. Nevertheless, in the auchenipterids Asterophysus, some Centromochlus, Gelanoglanis, Pseudepapterus, some Tatia, the aspredinid Pterobunocephalus and the mochokid Euchilichthys, the interdigitated suture is only in the posterior portion of the length of the scapulo-coracoids. 226. [3715] Scapulo-coracoid, posterior process: (0) absent; (1) present (de Pinna, 1996: char. 79). The absence of the scapulo-coracoid posterior process is a plesiomorphic condition found only in Diplomystidae. 227. [3716] Scapulo-coracoid, posterior process, size: (0) short, extending up to base of branched pectoral-fin rays; (1) elongate, greatly surpassing base of branched pectoral-fin rays (Britto, 2002: char. 250; Birindelli, 2014: char. 270). The plesiomorphic and most common condition in Auchenipteridae is the possession of a short scapulo-coracoid posterior process, reaching to approximately the base of the branched pectoral-fin rays. In Auchenipterichthys coracoideus, Auchenipterichthys thoracatus, Auchenipterus, Epapterus, Trachelyichthys exilis and the outgroups Aspredinidae (except Pterobunocephalus) and doradid Trachydoras nattereri, the posterior process is elongated, surpassing the base of the branched pectoral-fin rays and usually reaching to half the length of the rays. Birindelli (2014) coded Pseudepapterus as bearing a long posterior process, but in the specimens analysed herein, a short posterior process was observed, as in the remaining auchenipterids. Those taxa that lack the scapulo-coracoid posterior process were coded as inapplicable for this character. 228. [3717] Scapulo-coracoid, posterior process: (0) straight; (1) twisted, forming deep concavity. The scapulo-coracoid posterior process of most catfishes is a relatively straight projection of the lateral portion, never forming a concavity. However, Entomocorus, Pseudauchenipterus affinis, Pseudauchenipterus flavescens and Pseudepapterus have a condition in which a transverse, twisted laminar bony crest forms the posterior process. This configuration causes a strong concavity similar to a tunnel. 229. [3718] Scapulo-coracoid, posterior process, distal margin, shape: (0) rounded and wide; (1) pointed and thin. In most catfishes, the distal portion of the scapulo-coracoid posterior process is rounded and relatively wide and wing shaped. The derived condition, shared by Auchenipterus, Entomocorus, Epapterus, Pseudauchenipterus affinis and Pseudauchenipterus flavescens, Pseudepapterus, the Aspredinidae (except Aspredo aspredo) and the Doradidae, is a pointed and thin posterior process. 230. [3719] Scapulo-coracoid, bony crest: (0) absent; (1) present (Birindelli et al., 2007: char. 673; Birindelli, 2014: char. 273). A transverse laminar bony crest is present dorsally on the scapulo-coracoid, between the adductor superficialis and the arrector ventralis muscles in most auchenipterids, except Gelanoglanis, which shares the plesiomorphic condition with Diplomystidae. Birindelli (2014) considered that crest to be absent in Auchenipterus, Epapterus, Pseudepapterus, Doradidae and Mochokidae. That laminar crest was indeed observed in those taxa; however, it is located more posteriorly, near to or at the posterior border, along the end of the scapulo-coracoid suture. Figure 11. Open in new tabDownload slide Lateral view of pectoral girdle of Gelanoglanis pan, paratype, MZUSP 96032. Abbreviations: DP-CLE, dorsal process of cleithrum; PP-CLE, posterior process of cleithrum. Scale bar: 2 mm. Figure 11. Open in new tabDownload slide Lateral view of pectoral girdle of Gelanoglanis pan, paratype, MZUSP 96032. Abbreviations: DP-CLE, dorsal process of cleithrum; PP-CLE, posterior process of cleithrum. Scale bar: 2 mm. Pelvic girdle 231. [3720] Pelvic fin, position: (0) at approximately middle of SL; (1) within anterior half of SL (Birindelli, 2014: char. 275). In the outgroups (except Aspredo aspredo, Helogenes and Pterobunocephalus) and other auchenipterids, the pelvic fin originates approximately at the midbody, differing from the auchenipterids Asterophysus, Auchenipterus, Epapterus, Pseudepapterus, Trachelyichthys and Trachelyopterichthys, where the pelvic fin originates within the anterior half of the SL. Contrary to Birindelli (2014), the derived condition was recognized in members of Auchenipteridae. 232. [3721] Pelvic fin, first unbranched ray in nuptial males, length: (0) same size as in females and non-nuptial males; (1) longer than in females and non-nuptial males (Ferraris, 1988: char. PV2; Royero, 1999: char. 133; Akama, 2004: char. 170; Birindelli, 2014: char. 279). A highly specialized feature within Siluriformes is the modified size of the first unbranched pelvic-fin ray of nuptial males, with an elongated soft ray that differs from that of females or non-nuptial males. This derived condition is found only in Entomocorus, and the modified pelvic-fin ray reaches nearly to the end of the anal-fin base. 233. [3722] Pelvic fins, innermost rays, union: (0) separate; (1) united by skin (Ferraris, 1988: char. PV6; Ferraris & Vari, 1999: 393 pp.; Akama, 2004: char. 123; Birindelli, 2014: char. 281). Most catfishes have the pelvic fins separated from each other. Auchenipterus, Epapterus and Pseudepapterus share a derived condition of a consistent skin membrane joining the proximal half of the contralateral last pelvic-fin rays. 234. [3723] Basipterygium, anteromedial processes, union: (0) separated from each other; (1) sutured together along their entire length; (2) sutured together only anteriorly. In most catfishes, the anteromedial process of the basipterygium is separated from the main portion of the bone, forming an elongate, rod-like extension (Fig. 12A, C–E). In Auchenipterus, Epapterus, Pseudepapterus and Pseudotatia, the anteromedial process is entirely incorporated into the anterior portion of the basipterygium through a bony lamina. In such cases, the anteromesial portion of the basipterygium seems to increase in size during ontogeny (Fig. 12B). Furthermore, a similar condition is found in Centromochlus heckelii, Centromochlus existimatus, Entomocorus, Gelanoglanis stroudi and Gelanoglanis travieso, Tatia (except for Tatia musaica and Tatia meesi), Trachelyopterichthys, Trachelyopterus insignis, Trachelyopterus albicrux, Trachelyopterus striatulus and Trachelyopterus teaguei, in which the anteromedial process is united to its contralateral pair by the anterior portion only, leaving the most posterior portion of the process separate. 235. [3724] Basipterygium, anterolateral and anteromedial processes, distance: (0) widely separated, with distance greater than the width of the anterolateral processes; (1) close, with distance approximately the same width as the anterolateral processes. Most catfishes have the processes on the anterior margin of the basipterygium widely separated from each other by a distance at least twice the width of the anterolateral processes (Fig. 12B, D, E). In Ageneiosus, Centromochlus perugiae, Centromochlus meridionalis, Centromochlus simplex, Centromochlus aff. C. simplex and Tympanopleura, the anterior processes are close together, separated from each other by a distance similar to the width of the anterolateral process (Fig. 12A, C). 236. [3725] Basipterygium, anterolateral and anteromedial processes, relative length: (0) anterolateral and anteromedial processes approximately of the same length; (1) anterolateral process much longer than anteromedial. In the plesiomorphic condition found in Ageneiosus, Auchenipterus, Epapterus, Centromochlus meridionalis, Glanidium, Pseudauchenipterus, Pseudepapterus, Tetranematichthys, Tympanopleura, Trachelyopterus amblops, Trachelyopterus coriaceus and Trachycorystes menesezi, the processes on the anterior margin of the basipterygium are similar in length (Fig. 12A, B, D, E). However, in most catfishes, both processes are of different lengths relative to each other (Fig. 12C). 237. [3726] Basipterygium, anterolateral process, dorsal portion, bony crest: (0) absent; (1) present. In the very distinctive derived condition found in Auchenipterus, Epapterus and Pseudepapterus, the dorsal surface of the anterolateral process of the basipterygium bears a large, elongate and transversely positioned bony crest. This bony crest runs approximately along the same orientation as the anterolateral process. 238. [3727] Basipterygium, lateral process, cartilage, extension: (0) short; (1) long, anteriorly expanded (Birindelli, 2014: char. 285; modified). The cartilage of the lateral process of the basipterygium is robust, hard and covers the lateral and anterior portions of the process in all catfishes examined (but not Diplomystidae, Ariidae, Aspredinidae and Helogenes marmoratus, which lack the process itself). In most catfishes, the lateral process has a short extension of rounded cartilage on its distal tip, approximately the same size as the lateral process. Within the Auchenipteridae, this condition is found in Entomocorus, Epapterus, Glanidium, Tetranematichthys, Trachelyichthys sp. 1, Trachelyopterichthys and the outgroups Mochokidae, Pimelodidae and Doradidae (Fig. 12E). However, a long anterior extension of cartilage on the lateral margin of the basipterygium is found in most Auchenipteridae (Fig. 12A–D). Those taxa without the lateral process were coded as inapplicable for this character. 239. [3728] Basipterygium, lateral process, cartilage, union with basipterygium: (0) separated from basipterygium; (1) fused to basipterygium. The cartilage on the lateral process of the basipterygium is commonly separated from the lateral margin of the basipterygium. In Pseudepapterus, the anteriorly expanded lateral process is fused to the lateral wall of the basipterygium. Those taxa with an absence of the lateral process of the basipterygium were coded as inapplicable for this character. 240. [3729] Basipterygium, posterior portion, shape: (0) short, without conspicuous process; (1) long, with process developed as wing; (2) long, with thin, pointed process (Akama, 2004: char. 121; Birindelli, 2014: char. 286; modified). In most catfishes examined, the posterior portion of the basipterygium is short, without a conspicuous or elongate posterior process. In some taxa, the basipterygium is longer and wider, forming a wing on its posterior portion, as in Ageneiosus, Asterophysus, Centromochlus existimatus, Centromochlus heckelii, Trachelyopterus, Tympanopleura, Trachycorystes, Ariidae, Pimelodidae, Chiloglanis disneyi Trewavas, 1974 and Aspredo aspredo. A less common condition is the posterior process developed as a long, pointed extension with a thin posterior tip; this latter condition is found in Auchenipterichthys, Liosomadoras and Aspredinidae. 241. [3730] Basipterygium, posterior margin, cartilage, size: (0) short, half length of basipterygium; (1) long, approximately same length as basipterygium. The basipterygium of the catfishes examined has an extension of hard cartilage attached to the posterior border. This cartilage is difficult to observe in specimens where the cartilage was not stained and is usually lost in dry skeletons. In Auchenipteridae, the cartilage assists with the attachment of the pelvic girdle to the skin by means of a ligament originating at the tip of the cartilage and running horizontally along the length of the ventral portion of the basipterygium. Most catfishes examined have a relatively short posterior cartilage, approximately half the length of the basipterygium or, usually, one-third the length of the first unbranched pelvic-fin ray. Auchenipterichthys punctatus, Auchenipterichthys longimanus, Trachelyichthys, Trachelyopterichthys and all the centromochlines (except for some species of Glanidium where this character was not possible to observe) have an elongate posterior process; its length is similar to the length of the basipterygium (Fig. 12C). 242. [3731] Basipterygium, posterior portion, cartilage in ventral view, direction: (0) posteriorly projected; (1) ventrally directly. The posterior cartilage of the basipterygium is straight and posteriorly directed in most catfishes examined. A distinct derived condition is found in Entomocorus, Auchenipterus, Epapterus and Pseudepapterus, where the posterior cartilage is ventrally folded, forming a curve. This elaboration on the posterior cartilage seems functionally to improve the attachment of the pelvic girdle to the skin, because the posterior and the anterior portions of the basipterygium are connected by strong ligaments to the skin. 243. [3732] Pelvic-fin ray, dorsal surface, basal process, orientation: (0) oriented posteromedially; (1) oriented dorsally. The basal process of the pelvic-fin rays is oriented posteromedially, facing the next ray in most catfishes. In Auchenipterichthys, Centromochlus, Entomocorus, Liosomadoras, Pseudotatia, Tatia, Tocantinsia, Trachelyichthys, Trachelyopterus insignis, Spinipterus and the outgroups Rhynchodoras woodsi, Megalodoras uranoscopus, Bunocephalus doriae and Aspredo aspredo, the process is oriented dorsally. Figure 12. Open in new tabDownload slide Dorsal view of pelvic girdles. A, Tympanopleura brevis, MCP 30617. B, Auchenipterus brevior, CAS 52135. C, Centromochlus meridionalis, MZUSP 96595. D, Pseudauchenipterus affinis, MZUSP 51720. E, Tetranematichthys wallacei, MCP 27174. Abbreviations: AL-P, anterolateral process; AM-P, anteromedial process; BP-P, basal process of the pterigyophore; C-LP, cartilage of the lateral process; C-PP, cartilage of the posterior process. Scale bars: 1 mm (A, B, D); 0.5 mm (C); 2 mm (E). Figure 12. Open in new tabDownload slide Dorsal view of pelvic girdles. A, Tympanopleura brevis, MCP 30617. B, Auchenipterus brevior, CAS 52135. C, Centromochlus meridionalis, MZUSP 96595. D, Pseudauchenipterus affinis, MZUSP 51720. E, Tetranematichthys wallacei, MCP 27174. Abbreviations: AL-P, anterolateral process; AM-P, anteromedial process; BP-P, basal process of the pterigyophore; C-LP, cartilage of the lateral process; C-PP, cartilage of the posterior process. Scale bars: 1 mm (A, B, D); 0.5 mm (C); 2 mm (E). Anal fin 244. [3733] Urogenital pore, female, modification: (0) unmodified, ending as developed papilla; (1) modified, with enlarged pore ending in internal cavity for insemination (Royero, 1999: char. 124; Akama, 2004: char. 144). In most catfishes, the female urogenital pore has a developed papilla. In Auchenipteridae, however, the urogenital aperture of females is internally enlarged, ending in a cavity developed to retain spermatozoids transferred by males during insemination. 245. [3734] Urogenital organ, male, modification: (0) absent; (1) present, modified as intromittent organ (Ferraris, 1988: char. A1; Akama, 2004: char. 146; modified). Auchenipteridae are inseminating fishes with an intromittent organ (i.e. gonopodium) on the modified anal fin of adult males, which is used to transfer spermatozoids to females. The primary function of the modifications of the anal fin (enlargement, elongation and fusion of the proximal radials) is, possibly, to help in sustaining the intromittent organ during the reproductive act. Although inseminating behaviour is also known in Scoloplacidae (Spadella et al., 2006) and Astroblepidae (Spadella et al., 2012), this character seems to have evolved independently in those groups. 246. [3735] Intromitent organ, genital tube, position: (0) at base of anal fin and united by skin to anterior anal-fin rays; (1) anterior to anal fin and apart from anal-fin rays (Birindelli, 2014: char. 46; modified). The genital tube in Auchenipteridae varies in its position relative to the anal fin. In most Auchenipteridae, the genital tube is joined to the anal-fin base and attached to the first anal-fin rays by skin. In Centromochlinae and Entomocorus, the genital tube is positioned anteriorly to the anal fin and separated from the first rays. Although examination of the type series of Pseudotatia parva allowed codification as state 1, Mees (1974: 107) stated that the urogenital opening of presumed males is at the end of a tube along the anterior edge of the anal fin, and Ferraris (1988: 95 p.) reported that the urogenital tube extends nearly the entire length of the anterior margin of the anal fin. For this reason and because of the rarity of this species, collection of new specimens is highly desirable. This character requires further investigation because additional traits could be involved in the configuration of the intromittent organ. Those taxa without an intromittent organ were coded as inapplicable for this character. 247. [3736] Urogenital papilla, male, hood-like flap of skin covering urogenital base: (0) absent; (1) present (Ferraris, 1988: char. A4). Among Siluriformes, the Auchenipteridae is the only family with the urogenital organ tubular and slender, modified into an intromittent organ in adult males. Members of Centromochlinae (except Gelanoglanis) have the genital tube emerging from a hood-like flap of skin that covers the base of the urogenital tube (Ferraris, 1988: char. A4), as in Centromochlus and Tatia, or sometimes that covers almost the entire urogenital tube, as in Glanidium. 248. [3737] Anal fin, dimorphic shape: (0) absent, males and females with similar anal fins; (1) present, males and females with distinct anal fins. Auchenipteridae are inseminating fishes with conspicuous sexual dimorphism. Differences in shape and, to a lesser extent, size and orientation represent important modifications of the anal fin. In centromochlines, the anal fin of both nuptial and non-nuptial males is very distinct from that of females, thus representing secondary sexual dimorphism. In Auchenipteninae and outgroups, the shape of the anal fin of males and females has no conspicuous differences. 249. [3738] Anal fin, proximal radials, fusion in nuptial males: (0) separated, not fused; (1) partly or totally fused (Ferraris, 1988: char. A5, A6; Soares-Porto, 1998: char. 28; Royero, 1999: char. 132; Akama, 2004: char. 133, 152; Birindelli, 2014: char. 288, 289, 291; modified). The orientation of the anal-fin rays of mature males of Auchenipteridae is variable depending on the modification of the proximal radials. During the reproductive season, mature males undergo enlargement and fusion of the proximal radials and sometimes also of the anal-fin rays. The thickening of the proximal radials and genital tube results in a curvature of the anal-fin pterigyophores, in which they assume a backward orientation rather than the typical ventral orientation. This fusing configuration of the anal-fin proximal radials is a common modification in the centromochlines. Akama (2004) considered the orientation and the modification of the proximal radials to be separate characters, and Birindelli (2014) interpreted them as three separate characters: the orientation of the anal fin, the orientation of the proximal radials, and the fusion of the radials. However, the orientation of the anal fin is herein considered to be dependent on the modification of the proximal radials, and all taxa with modified proximal radials also have a posteriorly oriented anal fin. Therefore, in the present study, the features that represent this transformation series were included as a single event. 250. [3739] Anal fin, proximal radials, fusion in nuptial males, degree: (0) partly fused; (1) totally fused. In centromochlines, nuptial males have different degrees of fusion of the anal-fin proximal radials. In Centromochlus, Tatia and Glanidium, the radials are partly fused, whereas in Gelanoglanis, all proximal radials are entirely fused to each other. In Centromochlus and Tatia, the anteriormost portions of the proximal radials are separated from each other. Conversely, in Glanidium, the fusion is restricted to the anteriormost portions of the proximal radials, which are separated from each other distally. Those taxa with free proximal radials were coded as inapplicable for this character. 251. [3740] Anal fin, size: (0) moderate, roughly one-third of SL; (1) short, not surpassing one-eighth of SL; (2) long, at least half of SL. Three different size patterns exist among the anal fins of auchenipterids. In the plesiomorphic condition, the anal fin is moderate in size, approximately one-third of the SL. Although Diplomystes appears to have a short anal fin relative to its body length, when compared with species having a truly short anal fin, Diplomystes fits in the condition of moderate anal fin. Some taxa, such as the centromochlines, have a very short anal fin, which is less than one-eighth of the SL. On the contrary, Ageneiosus, Auchenipterus, Epapterus, Pseudepapterus, Tetranematichthys, Tympanopleura, Trachelyichthys and Trachelyopterichthys have a very long anal fin, never shorter than approximately half the SL. 252. [3741] Anal fin, last proximal radial, shape: (0) rod-like; (1) laminar (Ferraris, 1988: char. A8; Akama, 2004: char. 134; Birindelli, 2014: char. 292). Most examined taxa have the last proximal radial of the anal fin rod-like in shape. Among auchenipterids, in most species of Ageneiosus, Auchenipterus, Auchenipterichthys, Tocantinsia, Tympanopleura rondoni and Tympanopleura cryptica, the posteriormost proximal radial of the anal fin is laminar and laterally expanded, with its length being approximately twice the length of the anterior proximal radial. 253. [3742] Anal fin, unbranched rays, distal portion, ornamentation in nuptial males: (0) absent; (1) present (Akama, 2004: char. 158; Birindelli, 2014: char. 295). Among nuptial males of the auchenipterids examined, all species of Auchenipterus have blunt hooks on the distal portion of the fused unbranched anal-fin rays. 254. [3743] Anal fin, anterior rays, size in nuptial males: (0) equal to non-nuptial males; (1) larger than non-nuptial males (Royero, 1999: char. 131; Akama, 2004: char. 148; Birindelli, 2014: char. 299). Males of Siluriformes have the anterior anal-fin rays equal in size to those of females. In nuptial males of all auchenipterids examined, the anterior anal-fin rays are enlarged relative to the remaining rays when compared with non-nuptial males. According to previous authors, this condition should be absent in centromochlines, Entomocorus, Pseudauchenipterus, Asterophysus and Tocantinsia. However, an enlargement to different degrees of the first anal-fin rays (usually the three first rays) was observed in nuptial males of all the auchenipterids. 255. [3744] Anterior anal-fin rays of nuptial males, distal portion, spermatic vesicle: (0) absent; (1) present (Akama, 2004: char. 149; Birindelli, 2014: char. 48). Nuptial males of Pseudauchenipterus nodosus, Pseudauchenipterus affinis, Pseudepapterus, Asterophysus batrachus and Trachelyichthys possess a vesicle in the distal portion of the anteriormost anal-fin ray. This vesicle supposedly stores sperm in the reproductive season and might, potentially, occur in other members of the Auchenipterinae, although not observed here. Given that the level of maturation of nuptial males involves different stages of development of the vesicle, this trait requires further investigation. The shape of this vesicle is variable between these taxa. In Trachelyichthys, the vesicle is a distal compressed skin fold, expanded ventrally to the ray. Pseudauchenipterus have a large rounded vesicle also in the distal portion of the ray, whereas Pseudepapterus bears an elongated vesicle in the posterior half portion of the ray, which is laterally expanded with conspicuous transverse lamellae. Asterophysus has a thickened skin fold on the distal portion of the ray. 256. [3745] Anal-fin rays, space between modified anterior rays and remaining rays of nuptial males: (0) absent; (1) present (Birindelli, 2014: char. 49). In the plesiomorphic condition, catfishes lack gaps between contiguous anal-fin rays. However, Epapterus has a derived condition, in which the first anal-fin rays are distally separated from the remaining rays. This gap is caused by the presence of two very short subsequent rays that brake the continuity of the anal fin, giving the impression of a space between the anteriormost and the remaining rays. Caudal fin 257. [3746] Caudal fin, shape: (0) bifurcated; (1) truncated; (2) rounded (Ferraris, 1988: char. C1; Walsh, 1990: char. 26; Royero, 1999: char. 142; Akama, 2004: char. 135; Birindelli, 2014: char. 300). Among catfishes examined, a bifurcated caudal fin seems to be the plesiomorphic condition. Among the auchenipterids, Ageneiosus inermis, Ageneiosus vittatus, Auchenipterichthys, Epapterus, Liosomadoras, Tetranematichthys, Tympanopleura, Trachelyichthys, Trachelyopterichthys, Trachelyopterus, Trachycorystes and Spinipterus have a truncated caudal fin. Auchenipterus nuchalis was considered polymorphic for this character. Furthermore, Aspredinidae (except Aspredo aspredo), the Doradid Acanthodoras cataphractus, and the Mochokids Chiloglanis disneyi and Atopochilus savorgnani Sauvage, 1879 have a rounded caudal-fin shape. 258. [3747] Hypurapophysis, type: (0) type A; (1) type B; (2) type C; (3) type D (Lundberg & Baskin, 1969; Ferraris, 1988: char. C7; Akama, 2004: char. 141; Birindelli, 2014: char. 303). Among catfishes examined, the hypurapophysis may be arranged in four different shapes, according to the description of Lundberg & Baskin (1969). Type A is when the hypurapophysis is on the parahypural arch, and the second hypurapophysis is on the base of the hypural (Lundberg & Baskin, 1969: fig. 3A), a condition found only in Diplomystidae and Megalodoras uranoscopus within examined taxa. Type B is when the hypurapophysis and the secondary hypurapophysis are laterally continuous, with the secondary hypurapophysis on the hypural 1 (Lundberg & Baskin, 1969: fig. 3B), as found in Tympanopleura brevis, Tympanopleura piperata, Asterophysus batrachus, Auchenipterichthys punctatus, Auchenipterichthys longimanus, Centromochlus reticulatus, Epapterus, some species of Glanidium, Tatia musaica, Tatia caxiuanensis, Tatia sp. 1, Pseudepapterus, Trachycorystes trachycorystes, Trachelyichthys, Trachelyopterichthys, Tetranematichthys and most Doradidae. Type C is similar to type B, but the secondary hypurapophysis is on hypurals 1 and 2 (Lundberg & Baskin, 1969: fig. 3C), and is found in most catfishes examined. Type D is when the hypurapophysis is on the parahypural, and the secondary hypurapophysis is on hypurals 1 and 2 (Lundberg & Baskin, 1969: fig. 3D), as found in Gelanoglanis, Trachelyopterus teaguei, Trachelyopterus albicrux, Trachelyopterus lucenai, Trachelyopterus coriaceus, some Mochokidae, Helogenes and Aspredinidae; this is in contrast with the observations of Birindelli (2014), who coded Gelanoglanis as type C. 259. [3748] Hypurapophysis, ventral process: (0) absent; (1) present (Ferraris, 1988: char. C5; Akama, 2004: char. 139; Birindelli, 2014: char. 304). The hypurapophysis in the derived condition bears a conspicuous, rod-like ventral process oriented longitudinally to the body axis. Among the taxa examined, Asterophysus, Auchenipterus, Centromochlus, Glanidium, Entomocorus, Epapterus, Liosomadoras, most species of Tatia, Pseudauchenipterus, Pseudepapterus, Tetranematichthys and the outgroups Mochokidae (except Chiloglanis) and Genidens barbus (Lacepède, 1803) have a ventral process on the hypurapophysis. In Epapterus and Pseudepapterus, it is more extremely developed, with a ventral process that is highly elongated and somewhat curved anteriorly. 260. [3749] Caudal fin, ventral lobe, principal rays, first unbranched ray, site of articulation: (0) on parahypural; (1) on last haemal spine; (2) on penultimate haemal spine; (3) on antepenultimate haemal spine; (4) on last fourth haemal spine (Ferraris, 1988: char. C3; Akama, 2004: char. 137; Birindelli, 2014: char. 307; modified). In the plesiomorphic condition, the principal unbranched ray on the ventral lobe of the caudal fin is attached to the parahypural. In most catfishes, the first unbranched principal ray is attached to the last haemal spine. However, Auchenipterichthys, Trachelyichthys, Trachelyopterichthys, Trachelyopterus amblops, Trachelyopterus galeatus, Trachelyopterus lucenai, Trachelyopterus teaguei and Spinipterus have the unbranched ray articulating to the penultimate haemal spine. Additionally, Tetranematichthys, Trachelyopterus striatulus and Trachelyopterus porosus have the unbranched ray articulating to the antepenultimate haemal spine, whereas Trachelyopterus coriaceus and Trachelyopterus albicrux have it attached to the last fourth haemal spine. 261. [3750] Caudal-fin skeleton, dorsal elements, fusion: (0) all hypurals separated; (1) hypurals 3 and 4 fused, and 5 distinct; (2) hypurals 3, 4 and 5 fused (Vigliotta, 2008: char. 72; Birindelli, 2014: char. 309). In the plesiomorphic condition, the dorsal elements of the caudal fin skeleton are separated from each other. Most catfishes examined have the third and fourth hypurals fused and the fifth separated. Furthermore, Tatia strigata, Pseudauchenipterus jequitinhonhae and the outgroups Aspredinidae, most Mochokidae and the doradids Acanthodoras cataphractus and Trachycodoras nattereri have all dorsal elements fused. 262. [3751] Caudal-fin skeleton, ventral elements, fusion: (0) all hypurals separated; (1) hypurals 1 and 2 fused, and parahypural distinct; (2) hypurals 1, 2 and parahypural fused (Vigliotta, 2008: char. 71; Birindelli, 2014: char. 310). The plesiomorphic condition, in which all ventral elements are separated from each other, is present in Diplomystidae and Helogenes marmoratus, among the taxa examined. All members of Auchenipteridae and the remaining outgroups have the opposite condition, in which all ventral elements are fused, except for the doradid Oxydoras niger and Mochokids Atopochilus, Euchilichthys and Mochokiella, which have the parahypural free from the first and second hypurals. 263. [3752] Fifth hypural, proximal portion, contact with confluence between third and fourth hypurals and epineural: (0) contacting; (1) not contacting. The plesiomorphic condition found in Diplomystidae, in which the base of the fifth hypural contacts the confluence between the fourth hypural and the epineural, is shared with Centromochlus (except for Centromochlus heckelii, Centromochlus meridionalis and Centromochlus existimatus), Entomocorus, Glanidium (except for Glanidium catharinensis), Liosomadoras oncinus, Pseudotatia parva, some Tatia and the doradid Rhynchodoras woodsi. All remaining auchenipterids lack such contact. 264. [3753] Caudal skeleton, orientation: (0) posteriorly oriented; (1) posteroventrally oriented. The caudal fin is oriented posteriorly in most catfishes. However, Tetranematichthys, Trachelyichthys, Trachelyopterichthys and Trachycorystes trachycorystes have a somewhat posteroventrally directed caudal fin. Interestingly, the dorsal profile of the caudal fin forms a slope, probably caused by the high number of procurrent rays that situate the caudal fin into a more ventral position. Species classification and taxonomic arrangement As the first large-scale phylogeny of Auchenipteridae, a new classification for the family is inferred based on the MP reconstruction and is presented herein to bring the taxonomy more in line with our new phylogenetic hypothesis. This classification follows the sequencing convention (Wiley, 1981), which exactly reflects the tree without the necessity of naming every node, avoiding the creation of unnecessary new rank categories. The strict consensus tree corroborates the monophyly of the superfamily Doradoidea, the family Auchenipteridae and its two subfamilies, Centromochlinae and Auchenipterinae. The classification increases the number of tribes in Auchenipteridae from two to nine, based on evidence of major groups in Auchenipterinae (Liosomadoradini, Trachelyopterini, Asterophysini, Auchenipterini and Ageneiosini) and in Centromochlinae (Gelanoglanini, Pseudotatiini, Centromochlini and Glanidiini). In contrast, Centromochlus, Glanidium and Tatia were recovered as paraphyletic. To maintain the classification monophyletic, previously proposed subgeneric names are being recognized as genera, with a nomenclatural reorganization of the species of Tatia and Centromochlus. In addition, Glanidium leopardum is regarded as a separate genus, resurrecting the available name Gephyromochlus. Finally, the phylogenetic position of the intriguing monotypic genus Spinipterus was tested with a complete codification for the first time, including osteological characters through a CT scan analysis and molecular data, revealing its closest relationship with Trachelyopterus. Phylogenetic reconstruction and diagnoses of clades The phylogenetic relationships are inferred based on the strict consensus tree from 146 taxa obtained by the MP analysis of 264 morphological characters and 1082 molecular informative sites of a total of 3490 bp. The morphology data matrix is shown in the Supporting Information (Appendix S2). Owing to an artefact of TNT software, the character count starts from zero, in which 0–3489 refer to molecular data and 3490–3753 to morphological data, which are presented in this way in the synapomorphy list (Supporting Information, Appendix S3) and diagnoses. The consensus tree is generated from 211 maximally parsimonious primary trees of 9025 steps, consistency index 0.27 and retention index 0.66 (Figs 13, 14; clade numbers appear above branches and Goodman–Bremer index below). The diagnoses of the clades herein presented correspond to the results of the phylogenetics hypothesis, and the character number and state transformation is given in parenthesis after each synapomorphy. Convergences and reversions within each clade are also reported. Synapomorphies are distinguished as exclusive and non-exclusive, in which the more inclusive clades (e.g. superfamily, families and subfamilies) consider the exclusivity in the scope of all taxa included, and those less inclusive within Auchenipteridae (e.g. tribes, subtribes, genera) consider the exclusivity in the family. The phylogenetic diagnosis is followed by additional synapomorphies previously proposed by other studies, in the case of those characters that were not included in the present analysis. After the phylogenetic diagnosis, a complementary taxonomic diagnosis, mostly including features not covered in the phylogenetic analysis, is presented as a comparison section seeking to facilitate the recognition/identification of the taxon. An asterisk preceding the taxon name indicates that it was not included in the present study but is also part of the phylogenetic group proposed, even provisionally. Figure 13. Open in new tabDownload slide Parsimony analysis of combined data from morphology (264 characters) and five genes (coI, 16S, rag2, myh6 and SH3PX3). Strict consensus of 211 maximally parsimonious trees (consistency index = 0.27; retention index = 0.66) with 9025 steps, showing the relationships of Auchenipteridae genera and a new proposed classification. Tree branches were truncated at genus level. Clade numbers appear above branches and Goodman–Bremer index below. Figure 13. Open in new tabDownload slide Parsimony analysis of combined data from morphology (264 characters) and five genes (coI, 16S, rag2, myh6 and SH3PX3). Strict consensus of 211 maximally parsimonious trees (consistency index = 0.27; retention index = 0.66) with 9025 steps, showing the relationships of Auchenipteridae genera and a new proposed classification. Tree branches were truncated at genus level. Clade numbers appear above branches and Goodman–Bremer index below. Figure 14. Open in new tabDownload slide Parsimony analysis of combined data from morphology (264 characters) and five genes (coI, 16S, rag2, myh6 and SH3PX3). Strict consensus of 211 maximally parsimonious trees (consistency index = 0.27; retention index = 0.66) with 9025 steps, showing the relationships of Centromochlinae and Auchenipterinae, including all species examined, and the new proposed classification. Clade numbers appear above branches and Goodman–Bremer index below. Figure 14. Open in new tabDownload slide Parsimony analysis of combined data from morphology (264 characters) and five genes (coI, 16S, rag2, myh6 and SH3PX3). Strict consensus of 211 maximally parsimonious trees (consistency index = 0.27; retention index = 0.66) with 9025 steps, showing the relationships of Centromochlinae and Auchenipterinae, including all species examined, and the new proposed classification. Clade numbers appear above branches and Goodman–Bremer index below. CLASSIFICATION Family Auchenipteridae Bleeker, 1862 Subfamily Centromochlinae Bleeker, 1862 Tribe Gelanoglanini, trib. nov. Genus Ferrarissoaresia Grant, 2015, stat. nov. Genus Gelanoglanis Böhlke, 1980 Tribe Pseudotatiini, trib. nov. Genus Pseudotatia Mees, 1974 Tribe Centromochlini Bleeker, 1862 Genus Gephyromochlus Hoedman, 1961, stat. nov. Genus Centromochlus Kner, 1857 Genus Duringlanis Grant, 2015, stat. nov. Tribe Glanidiini, trib. nov. Genus Balroglanis Grant, 2015, stat. nov. Genus Glanidium Lütken, 1874 Genus Tatia Miranda Ribeiro, 1911 Subfamily Auchenipterinae Bleeker, 1862 Tribe Liosomadoradini, trib. nov. Genus Liosomadoras Fowler, 1940 Tribe Trachelyopterini Bleeker, 1858 Subtribe Trachycorystina Miranda Ribeiro, 1911 Genus Tocantinsia Mees, 1974 Genus Trachycorystes Bleeker, 1858 Subtribe Auchenipterichthyina, subtrib. nov. Genus Auchenipterichthys Bleeker, 1862 Genus Trachelyopterichthys Bleeker, 1862 Genus Trachelyichthys Mees, 1974 Subtribe Trachelyopterina Bleeker, 1858 Genus Spinipterus Akama & Ferraris, 2011 Genus Trachelyopterus Valenciennes, 1840 Tribe Asterophysini Bleeker, 1862 Genus Asterophysus Kner, 1857 Tribe Auchenipterini Bleeker, 1862 Genus Pseudauchenipterus Bleeker, 1862 Genus Entomocorus Eigenmann, 1917 Genus Pseudepapterus Steindachner, 1915 Genus Epapterus Cope, 1878 Genus Auchenipterus Valenciennes, 1840 Tribe Ageneiosini Bleeker, 1862 Genus Tetranematichthys Bleeker, 1858 Genus Tympanopleura Eigenmann, 1912 Genus Ageneiosus La Cepède, 1803 Superfamily Doradoidea Bleeker, 1858 (Clade 20) Doradini Bleeker, 1858a: 39 (type family: Doradidae Bleeker, 1858; also in Bleeker, 1858b: 48, 52). Included families: Auchenipteridae Bleeker, 1862 and Doradidae Bleeker, 1858. Diagnosis: Doradoidea is diagnosed by 17 molecular and 12 morphological synapomorphies. Exclusive: (1) antorbital directly articulated to lateral ethmoid (char. 3518: 0 → 2), reversed in Gelanoglanis, Pseudauchenipterus, Ageneiosini, Megalodoras uranoscopus and Oxydoras niger; (2) exoccipital and neural arch of complex vertebra connected by bony suture (char. 3579: 0 → 1); (3) posterior portion of transformator process of tripus ventromedially folded (char. 3654: 0 → 1); (4) posterior parapophysis of compound centrum absent (char. 3664: 0 → 1); (5) base of dorsal process of first pectoral-fin unbranched ray large, discoid (char. 3701: 0 → 1); (6) premaxillary teeth curved (char. 3589: 1 → 0); reversed in some Doradoidea. Non-exclusive: (7) coronoid process of anguloarticular of same size as coronoid process of dentary (char. 3601: 1 → 0), convergent in Diplomystidae and Bunocephalus, reversed in some Ageneiosus, Tympanopleura, and in Auchenipterus, Epapterus, Entomocorus, Trachelyopterus, Spinipterus and doradids Clade 25; (8) bony contact of autopalatine on posterior portion of premaxilla (char. 3612: 0 → 1), convergent in Synodontis petricola and Pimelodidae, and reversed in Ageneiosini, Asterophysus, Epapterus, Pseudepapterus, Entomocorus and some Auchenipterus and Gelanoglanis; (9) gill filaments ossified (char. 3641: 0 → 1), convergent in some species of Mochokidae; reversed in Asterophysus, Gelanoglanis and some species of Centromochlus; (10) pectoral girdle elongated (char. 3695: 0 → 2), convergent in Pimelodus and some mochokids; reversed in Trachycorystina, Auchenipterichthyina (except Auchenipterichthys), Auchenipterini (except Entomocorus), Asterophysus, Ageneiosini and Glanidium catharinensis; (11) posterior process of cleithrum elongated, approximately two-thirds to same length as pectoral-fin spine (char. 3711: 1 → 2), convergent in Aspredo aspredo, reversed in Ageneiosini, Auchenipterini, Asterophysus, Trachelyopterina and Gelanoglanis; and (12) posterior process of cleithrum ornamented (char. 3712: 0 → 1), convergent in some species of Mochokidae, reversed in Auchenipterina (except Pseudauchenipterus jequitinhonhae and Pseudauchenipterus nodosus) and Ageneiosini. Additional synapomorphies: dorsal surface of epiotic participating in cephalic shield (char. 83: 0 → 1, exclusive); and seven to nine branchiostegal rays (char. 177: 0 → 1) (Birindelli, 2014). Comparisons: Doradoidea species differ from Pimelodidae, Ariidae, Diplomystidae Pseudopimelodidae, Heptapteridae, Cetopsidae and Trichomycteridae by the continuous orbital margin, i.e. eye covered by a continuous membrane that is conjoint to the skin (vs. free orbital margin); they differ from Pimelodidae, Diplomystidae, Ariidae and Cetopsidae by having the gill-opening membranes united with the isthmus across a large extension (vs. separate from each other and free from the isthmus, or united with the isthmus at one single location, or united to each other and free from the isthmus). Family Doradidae Bleeker, 1858 (Clade 21) Doradini Bleeker, 1858a: 39 (type genus: Doras La Cepède, 1803; also in Bleeker, 1858b : 48, 52). Included taxa: Acanthodoras Bleeker, 1862, *Agamyxis Cope, 1878, Franciscodoras Eigenmann, 1925, Astrodoradinae Higuchi et al., 2007, Doradinae Bleeker, 1858 and Wertheimerinae Birindelli, 2014. Diagnosis: Doradidae is diagnosed by 13 molecular and seven morphological synapomorphies. Exclusive: (1) midlateral scutes present (char. 3528: 0 → 1); and (2) ventral process on fourth basibranchial present (char. 3643: 0 → 1). Non-exclusive: (3) gill rakers of first branchial arch distinctly longer than those in remaining arches (char. 3637: 0 → 1), convergent in Ariidae, some mochokids, Pimelodus, Auchenipterini, Ageneiosus and Tympanopleura; (4) posterior process of third epibranchial of approximately the same length as its mesial portion (char. 3648: 0 → 1), convergent in several siluriforms; (5) distal portion of posterior process of third epibranchial pointed (char. 3649: 0 → 1); convergent in several auchenipterids; (6) posterior nuchal plate broad (char. 3673: 0 → 1), convergent in some auchenipterids; and (7) hypurapophysis of type B (Lundberg & Baskin, 1969) (char. 3747: 2 → 1), convergent in some auchenipterids, reversed in Megalodoras uranoscopus. Additional synapomorphies: Ligament present between Müllerian ramus and lateral line (char. 212: 0 → 1, exclusive); infranuchal ligament between posterior nuchal plate and first rib ossified (char. 213: 1 → 2, exclusive); pectoral-fin spine locking foramen absent (char. 253: 0 → 1); and six or seven branched rays in ventral lobe of caudal fin (char. 306: 1 → 0). In addition, the coronomeckelian bone connected to dentary (char. 137: 0 → 1) was also proposed by Birindelli (2014) as diagnostic for the family, but in the present observations, the coronomeckelian bone of auchenipterids contacts the dentary in the same way as in doradids, with the shape and size of the coronomeckelian bone being variable between both families (Birindelli, 2014). Comparisons: Doradids are distinguished from all Siluriformes by having one longitudinal row of bony scutes on each side of the midlateral portion of body, in which each midlateral scute bears a backward-directed thorn (except Wertheimeria, although sometimes, large individuals possess such scutes in the caudal peduncle; vs. bony scutes absent in Siluriformes, except Loricariidae and Callichthydae, in diverse configurations); it differs from Auchenipteridae by the subterminal or ventral mouth, except Astrodoradinae (vs. terminal mouth, except Ageneiosini), lack of suborbital groove (vs. suborbital groove present), and intromittent organ absent in anal fin of males (vs. intromittent organ present, anterior to or attached at anterior rays, in anal fin of males). Family Auchenipteridae Bleeker, 1862 (Clade 29) Euanemini Bleeker, 1858a: 39 (type genus: Euanemus Müller & Troschel, 1842; also in Bleeker, 1858b: 49). Auchenipterini Bleeker, 1862 (in Bleeker, 1862–63): 14 (type genus: Auchenipterus Valenciennes, in Cuvier & Valenciennes, 1840; name in prevailing recent practice, ICZN Article 35.5). Type genus: Auchenipterus Valenciennes, 1840. Included subfamilies: Auchenipterinae Bleeker, 1862 and Centromochlinae Bleeker, 1862. Diagnosis: Auchenipteridae is diagnosed by 20 molecular and 14 morphological synapomorphies. Exclusive: (1) suborbital groove to lodge maxillary bone present (char. 3501: 0 → 1); (2) urogenital pore of female enlarged, ending in internal cavity for insemination (char. 3733: 0 → 1); (3) anal fin of male with intromittent organ (char. 3734: 0 → 1); (4) anterior rays of anal fin of nuptial males larger than in non-nuptial males (char. 3743: 0 → 1); (5) first hypobranchial funnel shaped, with constriction on mid-portion and medial margin narrower than lateral (char. 3645: 0 → 1), reversed in several auchenipterids; and (6) cartilage on lateral process of basipterygium anteriorly elongated (char. 3727: 0 → 1), reversed in Entomocorus, Epapterus, Glanidium, Tetranematichthys, Trachelyopterichthys and Trachelyichthys sp. 1. Non-exclusive: (7) antorbital participating in orbital margin (char. 3514: 0 → 1), convergent in Helogenes, reversed in Ageneiosini, Gelanoglanis and Trachelyopterus insignis; (8) ventral projection on antorbital present (char. 3516: 0 → 1), convergent in Anadoras grypus, Bunocephalus doriae and Pimelodus maculatus; (9) premaxillary curved (char. 3584: 0 → 1), reversed in Auchenipterichthys, Entomocorus, Gelanoglanis, Glanidium catharinensis and Glanidium cesarpintoi, convergent in Pseudobunocephalus and Helogenes; (10) levator operculi crest on hyomandibula present (char. 3617: 0 → 1), convergent in Helogenes and most mochokids, reversed in several auchenipterids; (11) interopercle short, ovoid (char. 3626: 0 → 2), reversed in several auchenipterids, convergent in Helogenes and Aspredo aspredo; (12) os suspensorium reduced (char. 3655: 0 → 1), reversed in several auchenipterids, convergent in some doradids, Pseudobunocephalus and Euchilichthys dybowskii; (13) basal process of pelvic-fin rays dorsally oriented (char. 3732: 0 → 1), reversed in Ageneiosini, Asterophysus, Gelanoglanis, Auchenipterini (except Entomocorus), Trachelyopterus, Trachelyopterichthys and Trachycorystes, convergent in Aspredo aspredo, Bunocephalus doriae, Megalodoras uranoscopus and Rhynchodoras woodsi; and (14) ventral process on hypurapophysis present (char. 3748: 0 → 1), reversed in Ageneiosus, Tympanopleura, Gelanoglanis and Trachelyopterini, convergent in Genidens barbus and most mochokids. Additional synapomorphies: maxillary barbel moving vertically (char. 13: 0 > 1, exclusive); posterior testicular lobes modified into hypertrophied storage bags (char. 44: 0 > 1); and vertical rows of neuromasts dorsal to lateral line present (char. 117: 0 > 1) (Birindelli, 2014). Comparisons: Auchenipterids differ from other Siluriformes by having a suborbital groove (vs. suborbital region without depression), secondary sexual dimorphism present in anal fin of males; genital tube present attached to anteriormost ray or anterior to anal fin (vs. lack of intromittent organ, except Astroblepidae and Scoloplacidae), anal fin of nuptial males larger than non-nuptial males (vs. anal fin of nuptial males and non-nuptial males of same size). Subfamily Centromochlinae Bleeker, 1862 (Clade 30) Centromochli Bleeker, 1862 (in Bleeker, 1862–63): 7 (type genus: Centromochlus Kner, 1857). Included tribes: Centromochlini, Gelanoglanini, Glanidiini and Pseudotatiini. Diagnosis: Centromochlinae is diagnosed by 28 molecular and eight morphological synapomorphies. Exclusive: (1) secondary sexual dimorphism in anal fin present, male and female with distinct anal-fin shape (char. 3737: 0 → 1); and (2) proximal radials of anal fin partly or totally fused in nuptial males (char. 3738: 0 → 1); Non-exclusive: (3) posterior process of posttemporal–supracleithrum anteroventrally oriented (char. 3561: 0 → 1), reversed in Glanidium catharinensis and Glanidium sp. 1 RS, and Glanidium sp. 2 RS, convergent in several auchenipterids; (4) lateroposterior portion of sphenotic slightly concave (char. 3552: 0 → 1), reversed in Glanidium, Centromochlus heckelii, some species of Tatia, convergent in Liosomadoras morrowi, Trachelyichthys decaradiatus, Trachelyichthys sp. 1, Trachelyopterus lucenai, Trachelyopterus porosus, some mochokids and doradids and Pimelodus tetramerus Ribeiro & Lucena, 2006; (5) maxilla elongated, rod-like (char. 3590: 0 → 1), reversed in Glanidium and Tatia, convergent in Auchenipterichthys, Pseudepapterus, Trachelyopterus amblops, Trachelyopterus insignis and some mochokids; (6) middle nuchal plate and parieto-supraoccipital in contact (char. 3672: 0 → 1), reversed in Centromochlus, Duringlanis perugiae, Glanidium and some species of Tatia, convergent in Ageneiosini, Asterophysus, Entomocorus, Epapterus, Pseudepapterus, some mochokids, Ariidae, Nemadoras humeralis and Rhynchodoras woodsi; (7) anterior margin of pectoral girdle anteriorly pointed (char. 3694: 0 → 2), reversed in Tatia simplex, Glanidium catharinensis, Tatia intermedia, Tatia sp. 4, convergent in Asterophysus, Auchenipterus, Entomocorus, Pseudauchenipterus, Trachelyichthys decaradiatus, Trachelyopterus insignis, Trachycorystes menezesi, Spinipterus acsi, Pimelodus, Helogenes, Pterobunocephalus depressus and Trachycodoras nattereri; and (8) cartilage on posterior margin of basipterygium elongated, approximately same length as basipterygium (char. 3730: 0 → 1), convergent in Auchenipterichthys longimanus, Auchenipterichthys punctatus and Trachelyopterichthys. Additional synapomorphies: four to six branchiostegal rays (char. 177: 1 → 0); and five branched dorsal-fin rays (char. 237: 0 → 1) (Birindelli, 2014). Comparisons: Centromochlines are distinguished from auchenipterines by several characteristics related to modifications of the anal fin for copulation, such as: short anal-fin base (males and females); presence of secondary sexual dimorphism in the anal fin, where males have a drop-shaped anal fin (vs. lack of sexual dimorphism in the shape of the anal fin in the non-reproductive season); genital tube of adult males located anterior to the anal-fin rays and apart from anal-fin base (vs. genital tube of adult males attached to the base of anal-fin origin and united by skin anteriorly to the anal-fin rays); proximal radials of the anal fin fused in nuptial males, transforming the fin into a strong, functional structure (vs. proximal radials of anal fin not fused to each other); and, except for Gelanoglanis, the genital papilla of adult males with a hood-like flap of skin covering urogenital base (vs. genital papilla of adult males not covered by a hood-like flap of skin). Additionally, this subfamily is distinguished from the remaining auchenipterids by the very elongate cartilage on the posterior margin of the basipterygium, with approximately the same length as the basipterygium (vs. cartilage short). Tribe Gelanoglanini Calegari, Vari & Reis trib. nov. (Clade 31) Type genus: Gelanoglanis Böhlke, 1980. lsid: zoobank.org:act:E5676982-D0D0-4EE7-8BE2-DC9285AE2752 Included genera: Gelanoglanis Böhlke, 1980 and Ferrarissoaresia Grant, 2015. Diagnosis: Gelanoglanini is diagnosed by five molecular and five morphological synapomorphies. Non-exclusive: (1) gill filaments not ossified (char. 3641: 0 → 1), convergent in Balroglanis schultzi, Balroglanis macracanthus and Duringlanis romani; (2) anterior nuchal plate absent (char. 3670: 0 → 1), convergent in Ageneiosini, Duringlanis romani, Pseudepapterus and Clade 58 in Tatia; (3) four pterygiophores supporting soft dorsal-fin ray (char. 3675: 2 → 3), convergent in Glanidium cesarpintoi, most species of Tatia, Pseudepapterus, Trachelyichthys, Trachelyopterichthys anduzei, some species of Trachelyopterus and Spinipterus; (4) serration on anterior margin of dorsal-fin spine absent (char. 3689: 1 → 0), convergent in Centromochlus existimatus, Auchenipterini and Trachelyichthys; and (5) suture between scapulo-coracoids conspicuously interdigitated up to middle of coracoids, or only near posterior border (char. 3714: 1 → 2), convergent in Asterophysus, Gephyromochlus, Pseudepapterus and some species of Tatia. Genus Gelanoglanis Böhlke, 1980 (Clade 32) Gelanoglanis Böhlke, 1980: 150 (type species: Gelanoglanis stroudi Böhlke, 1980; type by original designation. Gender masculine). Included species: Gelanoglanis nanonocticolus Soares-Porto, Walsh, Nico & Netto, 1999, Gelanoglanis pan Calegari, Reis & Vari, 2014, Gelanoglanis stroudi Böhlke, 1980, Gelanoglanis travieso Rengifo, Lujan, Taphorn & Petry, 2008, Gelanoglanis varii Calegari & Reis, 2016, Gelanoglanis sp. 1 Peru Sabaj-Pérez et al., undescribed, and Gelanoglanis sp. 2 Peru Sabaj-Pérez et al., undescribed. Diagnosis: Gelanoglanis is diagnosed by 37 molecular and 50 morphological synapomorphies. Exclusive: (1) soft papillae on maxillary barbel (char. 3502: 0 → 1); (2) nasal unossified (char. 3511: 0 → 1); (3) passageway of mandibular ramus outside to lower jaw (char. 3524: 0 → 1); (4) lateral line ending well before caudal-fin peduncle, approximately at end of anal fin (char. 3526: 0 → 2); (5) mesethmoid, elongate and narrow in dorsal view (char. 3532: 2 → 3); (6) anterior region of head with fleshy region anterior to mesethmoid and premaxillae (char. 3535: 0 → 1); (7) premaxillae positioned laterally to mesethmoid in dorsal view (char. 3536: 0 → 2); (8) anteroventral portion of mesethmoid with process developed into laminar keel (char. 3537: 2 → 0); (9) anterior cranial fontanel absent (char. 3539: 0 → 1); (10) vomer fused to mesethmoid (char. 3572: 0 → 1); (11) premaxilla vertically laminar (char. 3583: 0 → 3); (12) sesamoid 1 extremelly reduced, spherical to ovoid shaped (char. 3621: 1 → 3); (13) first two branchial arches without gill rakers (char. 3635: 1 → 2); (14) third and fourth branchial arches without gill rakers (char. 3636: 0 → 2); (15) third proximal radial of pectoral fin absent (char. 3698: 0 → 1); (16) dorsal process of cleithrum distinctively large, approximately the same length as the pectoral-fin spine (char. 3708: 0 → 1); (17) scapulo-coracoid without bony crest (char. 3719: 1 → 0); (18) proximal radials of anal- fin totally fused to each other in mature males (char. 3739: 0 → 1); and (19) first unbranched ray of ventral lobe of caudal fin articulated on parahypural (char. 3749: 1 → 0). Non-exclusive: (20) one pair of mental barbels (char. 3504: 1 → 0), convergent in Ageneiosini; (21) antorbital not participating on orbital margin (char. 3514: 1 → 0), convergent in Trachelyopterus insignis and Ageneiosini; (22) ventral projection on antorbital absent (char. 3516: 1 → 0), convergent in Asterophysus; (23) lateral ethmoid contacting only mesial portion of antorbital (char. 3517: 2 → 0), convergent in some species of Ageneiosus and Tympanopleura, Entomocorus, Liosomadoras and Pseudauchenipterus; (24) contact between antorbital and lateral ethmoid by ligament (char. 3518: 2 → 0), convergent in Tympanopleura brevis and Ageneiosus uranophthalmus; (25) infraorbitals not ossified (char. 3519: 3 → 6), convergent in small body-sized Tatia of clade 50 (except Tatia creutzbergi); (26) mesethmoid elongated, with length at least twice its width (char. 3533: 1 → 0), convergent in Auchenipterini (except Pseudauchenipterus) and Tetranematichthys; (27) anteromedial portion of mesethmoid not contacting premaxilla (char. 3534: 0 → 1), convergent in Ageneiosini and Pseudepapterus; (28) posterior process of epioccipital forming simple spine (char. 3563: 3 → 0), convergent in Asterophysus, Auchenipterichthys, Balroglanis macracanthus, Balroglanis schultzi, Entomocorus and Trachelyopterichthys; (29) premaxilla straight (char. 3584: 0 → 1), convergent in Auchenipterichthys, Entomocorus, Glanidium catharinensis and Glanidium cesarpintoi; (30) distal portion of premaxilla extended (char. 3586: 0 → 1); convergent in Ageneiosini, Auchenipterus and Pseudepapterus cucuhyensis; (31) premaxillary teeth straight (char. 3589: 0 → 1), convergent in several auchenipterids; (32) coronomeckelian bone positioned oblique (char. 3596: 0 → 1), convergent in most species of Tatia, Duringlanis romani, Balroglanis macracanthus and Liosomadoras; (33) coronoid process on mandible smaller than posterior portion of dentary (char. 3601: 0 → 2), convergent in some species of Ageneiosus and Tympanopleura, Entomocorus and Epapterus; (34) hyomandibula articulated only to sphenotic (char. 3619: 1 → 3), convergent in several auchenipterids; (35) hyomandibula separated from metapterygoid (char. 3620: 0 → 1), convergent in Ageneiosini, Centromochlus, Tatia, Tetranematichthys, Pseudobunocephalus and several doradids; (36) interopercle large, plate shaped (char. 3626: 2 → 0), convergent in Auchenipterichthys and Trachelyopterichthys; (37) third and fourth branchial arches without gill rakers (char. 3642: 0 → 2), convergent in Ageneiosus and Tympanopleura; (38) first hypobranchial elongate, cylindrical (char. 3645: 1 → 3), convergent in Asterophysus; (39) posterior process of third epibranchial approximately of same length as its mesial portion (char. 3648: 0 → 1), convergent in several auchenipterids; (40) distal portion of posterior process of third epibranchial pointed (char. 3649: 0 → 1), convergent in several auchenipterids; (41) Müllerian ramus reduced, not surpassing one-half the length of the transcapular process (char. 3661: 0 → 1), convergent in Ageneiosus and Pseudepapterus; (42) proximal extremity of ribs straight (char. 3649: 1 → 0), convergent in several auchenipterids; (43) serration on lateral margin of pectoral-fin spine absent (char. 3702: 1 → 0), convergent in some species of Ageneiosus, Centromochlus and Auchenipterini (except Auchenipterus fordicei and Entomocorus); (44) posterodorsal process of cleithrum absent (char. 3709: 0 → 1), convergent in some species of Tatia and Duringlanis perugiae; (45) posterior process of cleithrum moderated in size, approximately half the length of the pectoral-fin spine (char. 3711: 2 → 1), convergent in Auchenipterini (except Pseudepapterus), Tocantinsia, Trachelyopterus and Spinipterus sp. ‘oncinha’; (46) posterior process of cleithrum smooth, without ornamentation (char. 3712: 1 → 0), convergent in Tympanopleura brevis, Tympanopleura rondoni, Asterophysus, Auchenipterini (except Pseudauchenipterus flavescens and Pseudauchenipterus affinis) and Tetranematichthys; (47) contralateral anteromedial processes of basipterygium sutured to each other only on anterior portion (char. 3723: 0 → 2), convergent in Centromochlus, Entomocorus, Gephyromochlus, Tatia (except Tatia musaica and Tatia meesi), Trachelyopterichthys and some species of Trachelyopterus; (48) basal process of pelvic-fin rays posteromedially oriented (char. 3732: 1 → 0), convergent in several auchenipterids; (49) hypurapophysis of type D (Lundberg & Baskin, 1969) (char. 3747: 2 → 3), convergent in some species of Trachelyopterus; and (50) ventral process of hypurapophysis absent (char. 3748: 1 → 0), convergent in several auchenipterids. Additional diagnosis: posterior naris long, narrow and located immediately anterior to eye (Calegari et al., 2014: char. 2); and mouth oblique and sinuous, with free fleshy flange around angle of mouth opening (Calegari et al., 2014: char. 5). The only synapomorphy proposed by Soares-Porto et al. (1999) not included in the present analysis is the short base in all fins (except caudal fin), including relatively few fin rays (Calegari et al., 2014: char. 6). However, the present results indicate that Gelanoglanis is similar to the remaining Centromochlinae with respect to the number of fin rays and the size of the fin base, not representing a diagnostic feature (Böhlke, 1980; Soares-Porto et al., 1999; Calegari et al., 2014). Comparisons: Gelanoglanis is the only miniature group of species in the family, thus easily distinguished by the smaller body size. It differs from other auchenipterid genera by the laterally compressed head (vs. rounded head, slightly or deeply depressed), sinuous shape of the mouth in lateral view (vs. mouth straight), anterior portion of snout with a fleshy region, not supported by skeleton (vs. anterior portion of snout structured by premaxilla and mesethmoid bones), premaxillae positioned laterally to the mesethmoid (vs. premaxilla positioned anterior or anterolaterally), premaxilla laminar and oriented vertically to the head (vs. premaxilla horizontally oriented), passageway of mandibular ramus of lateral line system running outside to the lower jaw (vs. mandibular ramus running inside dentary), lateral line ending well before caudal-fin peduncle, approximately at the end of the anal fin (vs. reaching near or surpassing the caudal fin). Furthermore, it differs from all auchenipterids, except Ageneiosini, by having one pair of mental barbels (vs. two pairs of mental barbels). Genus Ferrarissoaresia Grant, 2015 STAT. NOV. Centromochlus (Ferrarissoaresia) Grant, 2015: 3 (type species: Centromochlus meridionalis Sarmento-Soares, Cabeceira, Carvalho, Zuanon & Akama, 2013, by original designation and monotypy. Gender feminine). lsid: zoobank.org:act:9F4414A7-126A-4DE0-8010-41B11730AC6E Included species: *Ferrarissoaresia ferrarisi (Birindelli, Sarmento-Soares & Lima, 2015) and Ferrarissoaresia meridionalis (Sarmento-Soares, Cabeceira, Carvalho, Zuanon & Akama, 2013). Diagnosis: Ferrarissoaresia is diagnosed by 43 molecular and five morphological autapomorphies: Exclusive: (1) axillary slit absent in adults (char. 3498: 0 → 1), exclusive within Centromochlinae, convergent in Liosomadoras morrowi, Trachelyopterus lucenai, Trachelyopterus teaguei and Trachycorystes menezesi. Non-exclusive: (2) epiphyseal bar present in anterior cranial fontanel (char. 3540: 0 → 1), convergent in Centromochlus, Glanidium cesarpintoi, Tympanopleura atronasus, Ageneiosus inermis, Auchenipterichthys longimanus, Auchenipterichthys thoracatus, Auchenipterus ambyiacus, Liosomadoras, Tocantinsia, Trachelyopterichthys, some species of Trachelyopterus and Trachycorystes menezesi; (3) coronoid process of anguloarticular developed into a thin and conspicuous process (char. 3602: 1 → 0), convergent in clade 90 in Auchenipterini, Glanidium, Liosomadoras, some species of Tatia, Tetranematichthys, Trachelyopterina, Trachycorystina and Trachelyopterichthys; (4) posterior bony projection on last pterygiophore of dorsal fin (char. 3680: 0 → 1), convergent in Centromochlus, Balroglanis macracanthus, Balroglanis schultzi, some species of Tatia and several auchenipterines; and (5) anterolateral and anteromedial processes of basipterygium approximately of same length (char. 3725: 1 → 0), convergent in Ageneiosini, Auchenipterini (except Entomocorus), Glanidium, Trachycorystes menezesi, Trachelyopterus amblops and Trachelyopterus coriaceus. Comparisons: Ferrarissoaria is distinguished from all Centromochlinae by the relatively long outer mental barbel, surpassing the pectoral-fin base (vs. outer mental barbel short, similar to the size of the inner barbel, ending much anterior to the pectoral-fin origin); from all Centromochlinae (except Gelanoglanis) by the small eye, approximately one-third of head depth, not surpassing the mouth gap or the line of upper lip (vs. eye relatively large, occupying half of head depth or more), and except Tatia, Glanidium and Pseudotatia, by having the eye positioned dorsolaterally (vs. eye positioned laterally). Ferrarissoaresia differs from Gephyromochlus, Centromochlus, Duringlanis and Balroglanis by the eye not being visible in ventral view (vs. visible in ventral view). It is further distinguished from Centromochlus, Tatia and Gelanoglanis by having the hyomandibular and metapterygoid contacting each other (vs. not contacting each other), and from Centromochlus, Tatia (except Tatia musaica, Tatia meesi, Tatia reticulata and Tatia simplex) and Glanidium by the lack of an anterior nuchal plate (vs. anterior nuchal plate present). Remarks: Ferrarissoaresia, with the single species Ferrarissoaresia meridionalis, has a distinctive body shape and a splotchy colour pattern consisting of median brown speckles with darker large spots concentrated in the dorsolateral surface of body. Although Centromochlus ferrarisi was not included in the present study, it is provisionally transferred to the genus Ferrarissoaresia based on the sharing of several diagnostic characters. The lack of an anterior nuchal plate, the hyomandibular contacting the metapterygoid, the small-sized eye positioned dorsolaterally, the short body length, and the outer mental barbel elongated, characteristics not found in Tatia and Centromochlus, support the allocation in Ferrarissoaresia. In spite of that, the inclusion of Ferrarissoaresia ferrarisi in a phylogenetic context is necessary to confirm its generic position. Tribe Pseudotatiini Calegari, Vari & Reis trib. nov. Type genus: Pseudotatia Mees, 1974. lsid: zoobank.org:act:C6BC3B58-2803-4A6F-A0F6-E41203A34DFB Included genus: Pseudotatia Mees, 1974. Diagnosis: Pseudotatiini is diagnosed by seven morphological autapomorphies. Exclusive: (1) mesethmoid expanded anterolaterally, with notch only on posterior portion (char. 3532: 0 → 1), exclusive within Centromochlinae, convergent in Auchenipterini, Trachelyichthys and Trachelyopterichthys; (2) six free pterygiophores on dorsal fin (char. 3675: 2 → 1); and (3) contralateral anteromedial processes of basipterygium sutured to each other along entire length (char. 3723: 0 → 1), convergent in Auchenipterus, Epapterus and Pseudepapterus (clade 92). Non-exclusive: (4) anterior cartilage of lateral ethmoid extended (char. 3547: 0 → 1), convergent in Gelanoglanis varii, Gelanoglanis pan, Auchenipterini and Ageneiosini; (5) posterior process of third epibranchial elongated, approximately the same length as its mesial portion (char. 3648: 0 → 1), convergent in Trachelyichthys (except Tatia sp. 1), Auchenipterini (except Pseudauchenipterus affinis and Entomocorus), Gelanoglanis, Auchenipterichthys longimanus, Auchenipterichthys thoracatus, Ageneiosus vittatus, Tympanopleura atronasus, some species of Trachelyopterus and Spinipterus; (6) posterior process of third epibranchial pointed (char. 3649: 0 → 1), convergent in several auchenipterids; and (7) serration absent on posterior margin of dorsal-fin spine (char. 3693: 0 → 1), convergent in most of Ageneiosus, Asterophysus, Epapterus, Duringlanis perugiae, Gelanoglanis travieso, Glanidium cesarpintoi, Pseudepapterus, Tatia (except Tatia intermedia), Tocantinsia, Trachelyopterichthys, Trachelyopterus amblops, Trachelyopterus insignis, Trachycorystes trachycorystes and Spinipterus. Genus Pseudotatia Mees, 1974 Pseudotatia Mees, 1974: 105 (type species: Pseudotatia parva Mees, 1974; type by original designation. Gender feminine). Included species: Pseudotatia parva Mees, 1974. Diagnosis: Same as for tribe Pseudotatiini. Comparisons: Pseudotatia differs from all centromochlines by having more numerous rays on the anal fin, a total of 15–17 rays (vs. 7–14 total anal-fin rays) and, except for Glanidium ribeiroi, by having more numerous rays on the dorsal fin, six branched rays (vs. five in remaining genera, except Tatia creutzbergi and Tatia gyrina with four rays). It differs from Centromochlus, Balroglanis, Glanidium (except Glanidium cesarpintoi) and Duringlanis romani by the lack of serration on the posterior margin of the dorsal-fin spine. It differs from Ferrarissoaresia by the shorter outer mental barbel, not reaching the pectoral-fin spine (vs. long outer mental barbel surpassing the pectoral-fin base); and from Tatia, Gelanoglanis and Centromochlus by having the hyomandibula and metapterygoid in contact to each other (vs. such bones not in contact). Tribe Centromochlini Bleeker, 1862 (Clade 36) Centromochlini Bleeker, 1862 (in Bleeker, 1862–63): 7 (type genus: Centromochlus Kner, 1857). Included genera: Centromochlus Kner, 1857, Duringlanis Grant, 2015 and Gephyromochlus Hoedmann, 1961. Diagnosis: Centromochlini is diagnosed by 11 molecular synapomorphies. Genus Gephyromochlus (Hoedman, 1961) stat. nov. Centromochlus (Gephyromochlus) Hoedman, 1961: 135 (type species: Centromochlus (Gephyromochlus) leopardus Hoedman, 1961; type by monotypy. Gender masculine). lsid: zoobank.org:act:EDA1D921-D1D1-492F-B72E-9EF000F3DDC3 Included species: Gephyromochlus leopardus (Hoedman, 1961). Diagnosis: Gephyromochlus is diagnosed by 71 molecular autapomorphies. Comparisons: Gephyromochlus differs from all centromochlines, except Centromochlus and Gelanoglanis, by having the anterior margin of the pectoral-fin spine smooth, without serration (vs. pectoral-fin spine serrated). It differs from Duringlanis by having the lateral border of the median nuchal plate arched, curved mesially (vs. lateral border of median nuchal plate straight), and elongated anterior fontanel, surpassing the line of the posterior naris (vs. small, not surpassing the line of the posterior naris); from Centromochlus by the possession of an anterior nuchal plate (vs. anterior nuchal plate absent); from Balroglanis by having the anterior margin of the dorsal-fin spine smooth, not serrated (vs. anterior margin of dorsal-fin spine serrated); from Ferrarissoaresia by the outer mental barbel being short, ending much anterior to the pectoral-fin origin (vs. relatively long outer mental barbel, surpassing the pectoral-fin base); from Tatia by having more branched anal-fin rays, nine or 10 (vs. six to eight); and from Gelanoglanis by having a rounded and slightly depressed head (vs. laterally compressed head), possession of two pairs of mental barbels (vs. one pair of mental barbels) and other features that can be seen in the Gelanoglanis diagnosis. Genus Centromochlus Kner, 1857 (Clade 38) Centromochlus Kner, 1857: 430 (type species: Centromochlus megalops Kner, 1857; type by subsequent designation by Bleeker, 1862 (in Bleeker, 1862–63): 7. Gender masculine. Species considered as junior synonym of Centromochlus heckelii by Mees, 1974). Included species: Centromochlus existimatus Mees, 1974 and Centromochlus heckelii (De Filippi, 1853). Diagnosis: Centromochlus is diagnosed by 20 morphological synapomorphies. Exclusive: (1) ventral keel on parasphenoid present (char. 3576: 0 → 1), exclusive within Auchenipteridae; and (2) distal portion of Müllerian ramus protruded posteriorly (char. 3660: 0 → 1). Non-exclusive: (3) eye extremely large, occupying almost entire head depth (char. 3491: 0 → 1), convergent in Tympanopleura, Auchenipterus, Balroglanis macracanthus, Balroglanis schultzi, Entomocorus and Epapterus; (4) contralateral mandibulae running approximately in parallel (char. 3492: 0 → 1), convergent in Balroglanis; (5) epiphyseal bar on anterior cranial fontanel present (char. 3540: 0 → 1), convergent in Tympanopleura atronasus, Ageneiosus inermis, Auchenipterichthys longimanus, Auchenipterichthys thoracatus, Auchenipterus ambyiacus, Ferrarissoaresia, Liosomadoras, Trachelyopterichthys, Trachycorystes menezesi and some species of Trachelyopterus; (6) coronomeckelian bone strongly sutured, continuous to anguloarticular (char. 3597: 0 → 1), convergent in Ageneiosini, Trachelyopterini (except Trachelyichthys), Auchenipiterini (except Pseudepapterus, Pseudauchenipterus jequitinhonhae and Pseudauchenipterus nodosus), Glanidium cesarpintoi and Gephyromochlus; (7) ascending process of Meckel’s cartilage absent (char. 3598: 0 → 1), exclusive within Centromochlinae, convergent in Asterophysus within Auchenipteridae; (8) coronoid process of mandible absent (char. 3600: 0 → 1), exclusive within Centromochlinae, convergent in Asterophysus within Auchenipteridae; (9) posterodorsal portion of dentary straight (char. 3603: 0 → 1), exclusive within Centromochlinae, convergent in Asterophysus within Auchenipteridae; (10) metapterygoid and hyomandibula separated (char. 3620: 0 → 1), convergent in Ageneiosini, Gelanoglanis and Tatia; (11) posterior projection on urohyal in ventral view elongated, at least twice the length of the main body of the urohyal (char. 3628: 1 → 0), convergent in Ageneiosini, Auchenipterichthys longimanus, Auchenipterus, Epapterus and Pseudepapterus; (12) distal tips of first hypobranchial approximately with same width, in hourglass shape (char. 3645: 1 → 2), convergent in Trachelyopterini, Tetranematichthys, Balroglanis, Tatia meesi and Tatia intermedia; (13) parapophysis of fifth vertebra small, smaller than subsequent vertebra (3665: 1 → 2), convergent in Asterophysus, Auchenipterichthys, Auchenipterus osteomystax, Gelanoglanis, Glanidium catharinensis, Glanidium ribeiroi, Pseudauchenipterus, Trachelyopterichthys, Trachycorystes and some species of Tracheyopterus; (14) compound centrum including up to eighth vertebra (char. 3667: 3 → 4), exclusive within Centromochlinae, convergent in Trachelyopterini (except Trachelyichthys, Trachelyopterus albicrux and Trachelyopterus teaguei); (15) posterior bony projection on last dorsal-fin pterygiophore present (char. 3680: 0 → 1), convergent in Ageneiosini, Auchenipterichthys (except Auchenipterichthys punctatus), Auchenipterini, some species of Tatia, Tocantinsia and Trachelyopterina (except Spinipterus acsi); (16) dorsal-fin spine elongated, greater than one-third of SL (char. 3685: 0 → 2), convergent in Tatia intermedia; (17) anterior margin of pectoral-fin spine smooth, without serration (char. 3702: 1 → 0), some species of Ageneiosus, Auchenipterini (except Entomocorus and Auchenipterus fordicei), Gelanoglanis and Gephyromochlus; (18) pectoral-fin spine elongated, greater than one-third of SL (char. 3706: 0 → 1), convergent in Balroglanis macracanthus; (19) posterior portion of basipterygium long, with process developed as wing (char. 3729: 0 → 1), convergent in Ageneiosini, Auchenipterina, Trachycorystina and Asterophysus; and (20) anterior portion of fifth hypural contacting point of convergence between third and fourth hypurals and epineural (char. 3752: 0 → 1), convergent in Auchenipterinae (except Liosomadoras morrowi and Entomocorus), Gelanoglanini and some species of Tatia. Comparisons: Centromochlus differs from all Centromochlinae by having a ventral keel on the anterior half of the parasphenoid (vs. ventral keel absent); except for Balroglanis by having the proximal portion of the maxillary barbel ventrally positioned, in such a way that it is visible ventrally (vs. proximal portion of maxillary barbel laterally positioned, not visible ventrally); and lateral margins of the mandibulae running approximately in parallel (vs. lateral margins of mandibulae diverging laterally). Centromochlus differs from all centromochlines, except Gelanoglanis and Gephyromochlus, by having the anterior margin of the pectoral-fin spine smooth, without serration (vs. anterior margin of pectoral-fin spine serrated); from all centromochlines, except Balroglanis and Duringlanis, by having the eye ventrally displaced, in such a way that that almost the entire eye is visible in ventral view (vs. eye not visible, or little visible in ventral view) and, except Balroglanis, by having the origin of the outer mental barbel aligned near to the vertical line of the inner one (Fig. 1A) (vs. origin of outer mental barbel positioned further laterally relative to the inner, spaced from each other by more than the barbel-base size; Fig. 1D); from Ferrarissoaresia, Duringlanis, Balroglanis and Gephyromochlus by having the posterior process of the urohyal dorsally curved, concave (vs. straight), and by the longer pectoral-fin spine, greater than one-third of SL (vs. less than one-third of SL). It differs from Balroglanis by having subequal outer and inner barbels (Fig. 1A) (vs. outer mental barbel distinctly longest than inner; Fig. 1C). It differs from Glanidium and Tatia (except Tatia boemia and Tatia jacaratia) by the posterior process of the cleithrum being positioned posteriorly (vs. posterior process of cleithrum dorsally inclined). Remarks: Centromochlus was described by Kner (1857) to include two species: Centromochlus megalops, whose holotype was not designated, and Centromochlus aulopygius (currently Tatia). In his description of Centromochlus, Kner did not designate a type species for the genus. Additionally, Kner (1857) reported the type locality for Centromochlus heckelii as Bogotá, without any additional information about a particular river or basin. Given that Bogotá is a town high in the Andes, as already noted by Mees (1974), and there is no records of this species in that region, it indicates that the type locality is not precise and likely to be wrong. Thereafter, Bleeker (1862–63; volume II: 7), by describing a new ‘Phalanx’ Centromochli, proposed by subsequent designation Centromochlus megalops as the type species of Centromochlus, but without any further discussion about the decision. Notwithstanding, in the study addressing the Auchenipteridae and Pimelodidae diversity of fishes from Suriname, Mees (1974) proposed Centromochlus megalops Kner, 1857 as a junior synonym of Centromochlus heckelii. Controversially, Royero (1999: 257), in his PhD dissertation, analysed populations of Centromochlus heckelii from the Orinoco basin and opted for the revalidation of Centromochlus megalops. His decision was mostly based on a lot (ICN-MHN 1927) of Centromochlus from the Meta River in Colombia, which he considered to be a representative of Centromochlus megalops under a unique distinction of the absence of pigmentation on the caudal peduncle base (vs. pigmentation present in Centromochlus heckelii). The syntypes of Centromochlus megalops analysed herein (see Supporting Information, Appendix S1, Material examined), indeed have the caudal peduncle base with such pigmentation (see Fig. 15, syntype photographs), thus not matching the unique diagnostic feature proposed to distinguish Centromochlus megalops from Centromochlus heckelii. Perhaps, this condition of a hyaline caudal-fin base is present only in populations from the Orinoco River other than that in the Meta River, and possibly represent a third species (specimens of that population were not analysed in detail in the present study). Yet, reinforcing that the population in the Meta River is Centromochlus heckelii, the anterior cranial fontanel does not reach the parieto-supraoccipital, a feature observed in specimens analysed from this locality (ANSP 131675). Consequently, the analysis of photographs and X-rays of the syntypes of Centromochlus megalops (NMW 47359, one specimen; NMW 47360; one specimen), allowed us to identify these specimens clearly and maintain this species herein as a junior synonym of Centromochlus heckelii, based on the anterior fontanel not reaching to the parieto-supraoccipital (Fig. 15) and fewer pectoral-fin rays. Figure 15. Open in new tabDownload slide Ventral and dorsal view of Centromochlus megalops, syntype, NMW 47359. Photography credits to Naturhistorisches Museum, Vienna. Figure 15. Open in new tabDownload slide Ventral and dorsal view of Centromochlus megalops, syntype, NMW 47359. Photography credits to Naturhistorisches Museum, Vienna. Genus Duringlanis Grant, 2015 (Clade 39) STAT. NOV. Centromochlus (Duringlanis) Grant, 2015: 1 (type species: Centromochlus perugiae Steindachner, 1882; type by original designation. Gender masculine). lsid: zoobank.org:act:C0379B54-EE63-48BF-AA81-A13862C6AE20 Included species: *Duringlanis altae (Fowler, 1945), Duringlanis perugiae (Steindachner, 1882) and Duringlanis romani (Mees, 1988). Diagnosis: Duringlanis is diagnosed by eight molecular and three morphological synapomorphies. Non-exclusive: (1) terminus of lateral line approaching end of caudal-fin peduncle (char. 3526: 0 → 1), convergent in the small body-sized Tatia of clades 50 and 58; (2) one row of gill rakers on third and fourth branchial arches (char. 3636: 0 → 1), convergent in Balroglanis (except Balroglanis carolae), Tatia simplex and Tatia aff. Tatia simplex; and (3) serration on anterior margin of dorsal-fin spine, spine shaped (char. 3692: 0 → 1); convergent in Asterophysus, Liosomadoras and some species of Tatia (Tatia reticulata, Tatia boemia, Tatia brunnea, Tatia caxiuanensis, Tatia nigra, Tatia strigata, Tatia sp. 2, Tatia sp. 3 and Tatia sp. 4). Comparisons: Duringlanis differs from Gephyromochlus, Balroglanis and Centromochlus by having a small, rounded anterior fontanel, not surpassing the line of the posterior naris (vs. ellipsoid anterior fontanel, elongated, surpassing the line of the posterior naris); from Balroglanis by having the posterior nuchal plate rounded and lacking lateroposterior projection (Fig. 16A) (vs. posterior nuchal plate forming an arch owing to the presence of lateral and posterior projections; Fig. 16B); spiny posterior process of epioccipital not exposed, covered by the median nuchal plate (Fig. 16A) (vs. posterior process of epioccipital exposed beyond the lateral border of median nuchal plate; Fig. 16B); lateral border of median nuchal plate straight (Fig. 16A) (vs. lateral border of median nuchal plate arched, curved mesially; Fig. 16B); from Centromochlus by having a shorter pectoral-fin spine, less than one-third of SL (vs. long pectoral-fin spine, greater than one-third of SL); and from Ferrarissoaresia by having the dorsal-fin spine serrated, serration particularly tiny and restricted to the tip of the spine in Duringlanis romani (vs. smooth anterior margin of dorsal-fin spine), and shorter outer mental barbel, distant from pectoral-fin origin (vs. outer mental barbel long, surpassing the pectoral-fin origin). It differs from Tatia, Gephyromochlus and Glanidium by having subequal outer and inner mental barbels (Fig. 1B) (vs. outer mental barbel distinctly longest than inner; Fig. 1C, D); from Tatia, Centromochlus and Gelanoglanis by having the hyomandibula and metapterygoid in contact with each other (vs. hyomandibula and metapterygoid separate from each other); and from Glanidium by the lateral line ending near to the caudal peduncle (vs. terminus of lateral line surpassing the caudal-fin origin). Figure 16. Open in new tabDownload slide Lateral profile of head. A, Duringlanis romani, AMNH 91382, right side. B, Balroglanis schultzi, MZUSP 94138, left side. Abbreviations: MNP, middle nuchal plate; PNP, posterior nuchal plate. Scale bars: 5 mm. Figure 16. Open in new tabDownload slide Lateral profile of head. A, Duringlanis romani, AMNH 91382, right side. B, Balroglanis schultzi, MZUSP 94138, left side. Abbreviations: MNP, middle nuchal plate; PNP, posterior nuchal plate. Scale bars: 5 mm. Tribe Glanidiini Calegari, Vari & Reis trib. nov. (Clade 41) Type genus: Glanidium Lütken, 1874. lsid: zoobank.org:act:C20A6ACA-BCA1-445E-98E1-A9556FA43EC2 Included genera: Balroglanis Grant, 2015, Glanidium Lütken, 1874 and Tatia Miranda Ribeiro, 1911. Diagnosis: Glanidiini is diagnosed by 22 molecular synapomorphies. Genus Balroglanis (Grant, 2015) (Clade 42) STAT. NOV. Centromochlus (Balroglanis) Grant, 2015: 2 (type species: Centromochlus schultzi Rössel, 1962; by original designation. Gender masculine). lsid: zoobank.org:act:A6E7310F-02A5-4CB5-9537-5D73D126D1BF Included species: Balroglanis carolae (Vari & Ferraris, 2013), Balroglanis macracanthus (Soares-Porto, 2000) and Balroglanis schultzi (Rössel, 1962). Diagnosis: Balroglanis is diagnosed by 19 molecular and three morphological synapomorphies. Non-exclusive: (1) contralateral mandibulae running approximately in parallel (char. 3492: 0 → 1), convergent in Centromochlus; (2) distal tips of first hypobranchial approximately of the same width, hourglass shaped (char. 3645: 1 → 2), convergent in Trachelyopterini, Tetranematichthys, Centromochlus, Tatia meesi and Tatia intermedia; and (3) anterior nuchal plate absent (char. 3670: 0 → 1), convergent in Ageneiosini, Gelanoglanini, Duringlanis romani, Pseudepapterus and clade 58 in Tatia. Comparisons: Balroglanis differs from all centromochlines, except Centromochlus and Duringlanis, by having the eye ventrally displaced, in a way such that almost the entire eye is visible in ventral view (vs. eye not visible, or little visible in ventral view); and except Centromochlus by the outer mental barbel being aligned near to the vertical line of the inner one (Fig. 1C) (vs. origin of outer mental barbel positioned further laterally relative to the inner, spaced from each other by more than the barbel-base size; Fig. 1D). It further differs from Centromochlus, Gephyromochlus and Glanidium by the lack of an anterior nuchal plate (vs. anterior nuchal plate present); from Tatia (except Tatia intermedia and Tatia simplex) and Pseudotatia by having the dorsal-fin spine serrated on the posterior border (vs. serrations absent on posterior border of dorsal-fin spine); from Glanidium and Tatia (except Tatia boemia and Tatia jacaratia) by having the posterior process of cleithrum positioned posteriorly (vs. posterior process of cleithrum dorsally inclined); and from Duringlanis by having the lateral border of the median nuchal plate arched, curved mesially (Fig. 16B) (vs. lateral border of the median nuchal plate straight; Fig. 16A), ellipsoid anterior fontanel, elongated, surpassing the line of the posterior naris (vs. small, rounded anterior fontanel, not surpassing the line of the posterior naris), the posterior nuchal plate forming an arch in the lateral portion owing to the presence of lateral and posterior projections (Fig. 16B) (vs. posterior nuchal plate rounded and lacking lateral projection; Fig. 16A), posterior process of epioccipital exposed beyond the lateral border of the median nuchal plate (Fig. 16B) (vs. spiny posterior process of epioccipital not exposed, covered by the median nuchal plate; Fig. 16A); from Centromochlus by having smaller pectoral-fin spine, less than one-third of SL (vs. pectoral-fin spine long, greater than one-third of SL); from Gelanoglanis by having rounded head, slightly depressed (vs. head laterally compressed); and from Pseudotatia by having fewer anal-fin rays, seven to nine (vs. 15–17 total anal-fin rays). Genus Glanidium Lütken, 1874 (Clade 45) Glanidium Lütken, 1874: 31 (type species: Glanidium albescens Lütken, 1874; type by monotypy. Gender neuter). Included species: *Glanidium albescens Reinhardt, 1874, *Glanidium botocudo Sarmento-Soares & Martins-Pinheiro, 2013, Glanidium catharinensis Miranda Ribeiro, 1962, Glanidium cesarpintoi Ihering, 1928, Glanidium melanopterum Miranda Ribeiro, 1918, Glanidium ribeiroi (Haseman, 1911), Glanidium sp. RS 1 Sarmento-Soares, Calegari, Martins-Pinheiro & Malabarba, undescribed, Glanidium sp. RS 2 Sarmento-Soares, Calegari, Martins-Pinheiro & Malabarba, undescribed. Diagnosis: Glanidium is diagnosed by three molecular and six morphological synapomorphies. Non-exclusive: (1) parasphenoid short, ≥ 50% of its length composed by wide base of bone (char. 3577: 1 → 0), convergent in Ageneiosini, Gelanoglanini, Pseudotatia, Tatia gyrina, Tatia creutzbergi, Pseudauchenipterus, Trachelyopterini, Liosomadoradini and Asterophysini; (2) trigeminofacial foramen not exposed, covered by parasphenoid (char. 3581: 0 → 1), exclusive within Centromochlinae, convergent in Ageneiosini (Tympanopleura piperata and Tympanopleura cryptica), Liosomadoras, Auchenipterichthys, Auchenipterus brachyurus, Auchenipterus ambyiacus, Trachelyopterina (except Trachelyopterus amblops), Trachycorystina and Trachelyichthys (except Trachelyichthys decaradiatus); (3) coronoid process of anguloarticular developed into thin and conspicuous process (char. 3602: 1 → 0), convergent in Auchenipterus, Ferrarissoaresia, Pseudepapterus, Liosomadoras, Tatia boemia, Tatia sp. 4, Tatia jacaratia, Tatia nigra, Trachelyopterichthys, Trachelyopterina, Trachycorystina and Tetranematichthys; (4) anterolateral and anteromedial processes of basipterygium of approximately same length (char. 3725: 1 → 0), exclusive within Centromochlinae, convergent in Ageneiosini, Auchenipterini (except Entomocorus), Trachelyopterus amblops and Trachelyopterus coriaceus; (5) cartilage of lateral process of basipterygium short (char. 3727: 1 → 0), exclusive within Centromochlinae, convergent in Entomocorus, Epapterus, Trachelyopterichthys, Tetranematichthys and Trachelyichthys sp. 1; and (6) basal process of pelvic-fin rays oriented posteromedially in dorsal view (char. 3732: 1 → 0), convergent in Gelanoglanis, Ageneiosini, Auchenipterini (except Entomocorus), Trachelyopterichthys, Trachelyopterus and Trachycorystes. Comparisons: Glanidium differs from remaining centromochlines by having the trigeminofacial foramen not exposed, covered by the parasphenoid (vs. trigeminofacial foramen exposed in ventral view) and anterolateral and anteromedial processes of the basipterygium of approximately the same length (vs. anterolateral process longer than anteromedial process). It differs from Tatia, Centromochlus and Gelanoglanis by having the hyomandibula and metapterygoid in contact with each other (vs. hyomandibula and metapterygoid separated from each other); from Balroglanis and Gelanoglanis by the possession of an anterior nuchal plate (vs. anterior nuchal plate absent); from Centromochlus, Duringlanis and Balroglanis by having the eye not or little visible in ventral view (vs. eye ventrally displaced, in such a way that almost the entire eye is visible in ventral view). It differs from Pseudotatia by having fewer anal-fin rays, 12–14 total rays (vs. 15–17 total rays); from Ferrarissoaresia by having the outer and inner mental barbels of similar length, ending much anterior to the pectoral-fin origin (vs. long outer mental barbel, surpassing the pectoral-fin origin); from Centromochlus by having the maxillary barbel laterally positioned, not visible ventrally (vs. proximal portion of maxillary barbel ventrally positioned, in such a way that it is visible ventrally); and from Duringlanis by having the terminus of the lateral line surpassing the caudal-fin origin (vs. lateral line ending near to the caudal peduncle). Genus Tatia Miranda Ribeiro, 1911 (Clade 49) Tatia Miranda Ribeiro, 1911: 360 (type species: Centromochlus intermedius Steindachner, 1877; type by subsequent designation by Jordan, 1920: 545. Gender feminine). Included species: Tatia aulopygia Kner, 1857, Tatia boemia Koch & Reis, 1996, Tatia bockmanni (Sarmento-Soares & Buckup, 2005), *Tatia britskii (Sarmento-Soares & Birindelli, 2015), Tatia brunnea Mees, 1974, Tatia caudosignata DoNascimiento, Albornoz-Garzón & García-Melo 2019, Tatia caxiuanensis Sarmento-Soares & Martins-Pinheiro, 2008, Tatia concolor Mees, 1974, Tatia creutzbergi (Boeseman, 1953), *Tatia dunni (Fowler, 1945), *Tatia galaxias Mees, 1974, Tatia gyrina (Eigenmann & Allen, 1942), Tatia jacaratia Pavanelli & Bifi, 2009, Tatia intermedia (Steindachner, 1877), *Tatia marthae Vari & Ferraris, 2013, Tatia meesi Sarmento-Soares & Martins Pinheiro, 2008, *Tatia melanoleuca Vari & Calegari, 2014, Tatia musaica Royero, 1992, Tatia neivai (Ihering, 1930), Tatia nigra Sarmento-Soares & Martins-Pinheiro 2008, Tatia orca (Sarmento-Soares, Lazzarotto, Rapp Py-Daniel & Leitão, 2017), *Tatia punctata Mees, 1974, Tatia reticulata Mees, 1974, Tatia simplex Mees, 1974, Tatia aff. Tatia simplex Mees, 1974, Tatia strigata Soares-Porto, 1995, Tatia sp. 1 Calegari & Reis, undescribed, Tatia sp. 2 Calegari & Reis, undescribed, Tatia sp. 3 Calegari & Reis, undescribed and Tatia sp. 4 Calegari & Reis, undescribed. Diagnosis: Tatia is diagnosed by 13 molecular and three morphological synapomorphies. Non-exclusive: (1) coronomeckelian bone obliquely positioned (char. 3596: 0 → 1), reversed in Tatia intermedia and Tatia sp. 4, convergent in Duringlanis romani, Balroglanis macracanthus, Gelanoglanis and Liosomadoras; (2) hyomandibula and metapterygoid separated from each other (char. 3620: 0 → 1), convergent in Ageneiosini, Gelanoglanis and Centromochlus; and (3) contralateral anteromedial processes of basipterygium sutured to each other on anterior portion only (char. 3723: 0 → 2), reversed in Tatia musaica and Tatia meesi, convergent in Gelanoglanis, Centromochlus, Entomocorus, Gephyromochlus, Trachelyopterichthys, Trachelyopterus albicrux, Trachelyopterus insignis, Trachelyopterus striatulus and Trachelyopterus teaguei. Comparisons: Tatia differs from remaining centromochlines, except Gelanoglanis and Centromochlus, by having the hyomandibula and metapterygoid separated from each other (vs. hyomandibula and metapterygoid contacting each other). Tatia (but not Tatia intermedia and Tatia simplex) is distinguished from Glanidium, except Glanidium cesarpintoi, Balroglanis, Ferrarissoaresia and Centromochlus, by the lack of serration on the posterior border of the dorsal-fin spine (vs. dorsal-fin spine serrated on posterior border). It differs from Duringlanis and Centromochlus by having the outer mental barbel longer than inner (vs. outer and inner mental barbels of approximately the same length); from Centromochlus and Balroglanis by having the maxillary barbel laterally positioned, not visible ventrally (vs. proximal portion of maxillary barbel ventrally positioned, in such a way that it is visible ventrally), and eye not visible, or little visible in ventral view (vs. eye ventrally displaced, in such a way that almost the entire eye is visible in ventral view); and from Gelanoglanis by the rounded and depressed head (vs. laterally compressed head) and mouth straight (vs. mouth sinuous in lateral view). Tatia, except Tatia meesi, Tatia musaica, Tatia reticulata and Tatia simplex, is further distinguished from Gephyromochlus, Ferrarissoaresia, Balroglanis and Gelanoglanis by the possession of an anterior nuchal plate (vs. anterior nuchal plate absent). Subfamily Auchenipterinae Bleeker, 1862 (Clade 67) Auchenipterini Bleeker, 1862 (in Bleeker, 1862–63): 14 (type genus: Auchenipterus Valenciennes, 1840). Included tribes: Asterophysini, Ageneiosini, Auchenipterini, Liosomadoradini and Trachelyopterini. Diagnosis: Auchenipterinae are diagnosed by 21 molecular and three morphological synapomorphies. Exclusive: (1) lateral margin of frontal not participating in orbital margin (char. 3553: 0 → 1), reversed in Entomocorus, Tocantinsia, Trachycorystes trachycorystes and Trachelyichthys. Non-exclusive: (2) coronoid process of anguloarticular developed as a large and laminar process (char. 3602: 0 → 1), reversed in Ageneiosus (except Ageneiosus dentatus), Auchenipterichthys, Pseudauchenipterus and Trachelyichthys, convergent in Tatia boemia, Tatia nigra, Tatia jacaratia, Tatia sp. 4, Glanidium and Ferrarissoaresia; and (3) compound centrum including up to sixth vertebra (char. 3667: 1 → 2), reversed in Auchenipterini and Trachelyopterini (except Pseudepapterus), Tympanopleura cryptica, Tympanopleura brevis and Ageneiosus militaris, convergent in Glanidium catharinensis and Glanidium cesarpintoi. Comparisons: Auchenipterinae is mostly represented by members of large body size, except Epapterus, Pseudepapterus and Spinipterus, and differs from all centromochlines by having a medium to long anal fin (vs. short anal fin), genital tube of adult males attached to the base of the anal-fin origin and united by skin to the anal-fin rays (vs. genital tube of adult males located anterior to the anal-fin rays and apart from anal-fin base), lack of sexual dimorphism in the shape of the anal fin (vs. secondary sexual dimorphism present in the anal fin, where the male and female have distinct anal-fin shapes), and by the genital papilla of adult males not being covered by a hood-like flap of skin (vs. adult males with a hood-like flap of skin covering the urogenital base, except Gelanoglanis). Liosomadoradini Calegari, Vari & Reis trib. nov. (Clade 68) Type genus: Liosomadoras Fowler, 1940. lsid: zoobank.org:act:993091D9-5BA7-4322-8D53-6AC3CADBF67E Included genus: Liosomadoras Fowler, 1940. Diagnosis: Liosomadoradini is diagnosed by seven morphological synapomorphies. Exclusive: (1) coronomeckelian bone obliquely positioned (char. 3596: 0 → 1), exclusive within Auchenipterinae, convergent in Duringlanis romani, Balroglanis macracanthus, Gelanoglanis and Tatia (except Tatia intermedia and Tatia sp. 4). Non-exclusive: (2) lateral ethmoid contacting only mesial portion of antorbital (char. 3517: 2 → 0), convergent in Entomocorus, Gelanoglanis, Pseudauchenipterus, Ageneiosus intrusus, Ageneiosus uranophthalmus, Ageneiosus militaris, Ageneiosus dentatus and Ageneiosus inermis; (3) spines present on antorbital and suborbital ossified tubules (char. 3520: 0 → 1), convergent in Tatia caxiuanensis, Trachelyopterichthys, Trachycorystes trachycorystes and Spinipterus; (4) posterodorsal process of hyomandibula present, well developed (char. 3613: 0 → 2), convergent in some species of Ageneiosus and Tympanopleura, Glanidium, some species of Tatia, Balroglanis schultzi, Pseudotatia, Auchenipterichthys (except Auchenipterichthys punctatus), Trachelyopterus and Trachycorystes trachycorystes; (5) posterodorsal process of hyomandibula thin, shorter than its depth (char. 3614: 0 → 1), convergent in Ageneiosus militaris, Ageneiosus pardalis, Tympanopleura atronasus, Glanidium, some species of Tatia, Balroglanis schultzi, Auchenipterichthys (except Auchenipterichthys punctatus), most species of Trachelyopterus and Trachycorystes trachycorystes; (6) three rows of serration on anterior margin of dorsal-fin spine (char. 3690: 0 → 2), convergent in Spinipterus; and (7) ornamentation on posterior process of cleithrum arranged in two rows (char. 3713: 0 → 2), convergent only in Spinipterus acsi. Genus Liosomadoras Fowler, 1940 (Clade 68) Liosomadoras Fowler, 1940: 226 (type species: Liosomadoras morrowi Fowler, 1940; type by original designation. Gender masculine). Included species: Liosomadoras morrowi Fowler, 1940 and Liosomadoras oncinus (Jardine in Schomburgk, 1841). Diagnosis: Same as for tribe Liosomadoradini. Comparisons: Liosomadoras is easily distinguished from all members of Auchenipteridae by its colour pattern, reminiscent of the jaguar, which gives to the genus its popular name of jaguar catfish (vs. several distinct colour patterns, including bold spotted, white narrow stripes, black thick stripes, diffused blotches, or with unique background colour); and except for Spinipterus, by having three vertical rows of serration along the anterior margin of the dorsal-fin spine (vs. one row, or two in Trachycorystes trachycorystes and Trachelyopterichthys) and, except for Spinipterus acsi, by having two rows of ornamentation on the posterior process of the cleithrum. It differs from all auchenipterids except Trachelyopterichthys, Trachycorystes trachycorystes and Spinipterus by having spines on the antorbital and infraorbitals bones (vs. such bones smooth, without any spines), and from Ageneiosini, Auchenipterini (except Entomocorus), Trachelyopterichthys and Trachelyichthys by having a moderate-sized anal fin, approximately one-third of SL (vs. anal fin long, at least half SL). Liosomadoras is further distinguished from Spinipterus by the lack of serration on the dorsal margin of the pectoral-fin spine (vs. dorsal margin of pectoral-fin spine serrated), posterior margin of dorsal-fin spine smooth, without serration (vs. posterior margin of dorsal-fin spine serrated) and anterior fontanel rounded (vs. anterior fontanel elliptic). Tribe Trachelyopterini Bleeker, 1858 (Clade 70) Tracheliopterini [Trachelyopterini] Bleeker, 1858a: 40 (type genus: Trachelyopterus Valenciennes, 1840. Also in Bleeker, 1858b: 49, 250, 257). Included subtribes: Auchenipterichthyina, Trachelyopterina and Trachycorystina. Diagnosis: Trachelyopterini is diagnosed by six molecular and three morphological synapomorphies. Non-exclusive: (1) postzygapophysis of compound centrum extended up to eighth vertebra (char. 3666: 2 → 4), reversed in Trachelyichthys and Trachelyopterus teaguei, convergent in Epapterus dispilurus; (2) compound centrum including up to eighth vertebra (char. 3667: 2 → 4), reversed in Trachelyichthys, Trachelyopterus teaguei and Trachelyopterus albricrux, exclusive within Auchenipterinae, convergent in Centromochlus; and (3) ventral process of hypurapophysis absent (char. 3748: 1 → 0), convergent in Ageneiosus, Tympanopleura and Gelanoglanis. Subtribe Trachycorystina Miranda Ribeiro, 1911 (Clade 72) Trachycorystina Miranda Ribeiro, 1911: 25, 352 (type genus: Trachycorystes Bleeker, 1858). Included genera: Tocantinsia Mees, 1974 and Trachycorystes Bleeker, 1858. Diagnosis: Trachycorystina is diagnosed by four molecular and one morphological synapomorphy. Non-exclusive: (1) ventral processes of dorsal-fin spinelet straight (char. 3683: 1 → 0), convergent in Trachelyopterichthys, Pseudauchenipterus jequitinhonhae, Pseudauchenipterus affinis and Liosomadoras oncinus. Genus Tocantinsia Mees, 1974 Tocantinsia Mees, 1974: 108 (type species: Tocantinsia depressa Mees, 1974; type by original designation. Gender feminine. Subsequent to the description of the genus, Mees (1984) proposed the synonymization of its type species with Glanidium piresi Miranda Ribeiro, 1920, still recognizing the genus Tocantinsia as valid). Included species: Tocantinsia piresi (Miranda Ribeiro, 1920). Diagnosis: Tocantinsia is diagnosed by 13 molecular and five morphological synapomorphies. Non-exclusive: (1) Medial portion of dentary dorsally arched on symphysis (char. 3607: 0 → 1), convergent in Asterophysus; (2) upper gill rakers moderate in size, approximately half length of gill filaments (char. 3638: 1 → 0), convergent in Ageneiosini (except Tympanopleura cryptica), Glanidium (except Glanidium cesarpintoi), Gephyromochlus and Pseudauchenipterus; (3) serration on anterior margin of pectoral-fin spine truncated (char. 3704: 0 → 1), convergent in Ageneiosini, Auchenipterus fordicei, Glanidium ribeiroi, Tatia intermedia and Trachelyopterus coriaceus; (4) last proximal radial of anal fin laminar (char. 3741: 0 → 1), convergent in Ageneiosus (except Ageneiosus inermis, Ageneiosus militaris and Ageneiosus lineatus), Tympanopleura rondoni, Tympanopleura cryptica, Auchenipterus and Auchenipterichthys; and (5) caudal fin bifurcated (char. 3746: 1 → 0), convergent in Centromochlinae, Auchenipterini (except Epapterus), Tympanopleura, Ageneiosus (except Ageneiosus inermis, Ageneiosus vittatus). Comparisons: Tocantinsia is a predator species comprising individuals of relatively large size, robust, frequently serving as a source of food in local communities along the Tocantins drainage. It is easily distinguished from remaining auchenipterids, except Asterophysus, by having the medial portion of the dentary dorsally arched on the symphysis (vs. dentary straight); and from auchenipterines, except Auchenipterini (apart from Epapterus), Asterophysus, Tympanopleura and Ageneiosus (apart from Ageneiosus inermis and Ageneiosus vittatus), by having the caudal fin bifurcated (vs. caudal fin truncated). It differs from auchenipterines, except Trachycorystes, Spinipterus and Liosomadoras, by the posterior process of the epioccipital being pointed and very short, with a wide base formed by the lateral border of the epioccipital (vs. epioccipital forming a simple spine, bifurcated or laminar) and, except for Asterophysus, by having the dorsal profile of the head posteriorly to the eye flat and straight (vs. head posteriorly arched or with some level of curvature). It is further distinguished from Asterophysus by having the dorsal-fin origin posteriorly displaced relative to the pectoral-fin origin, at a distance approximately equivalent to the length of the dorsal-fin spine (vs. dorsal-fin origin approximately at a vertical line from the pectoral-fin origin), posterior process of post-temporal supracleithrum surpassing the vertical line from the dorsal-fin origin (vs. posterior process of post-temporal suprachleitrum not reaching the vertical line from the dorsal-fin origin), and the mouth gape reaching the eye, but never surpassing it (vs. end of mouth gape far surpassing the eye). Genus Trachycorystes Bleeker, 1858 (Clade 73) Trachycorystes Bleeker, 1858b: 200 (type species: Auchenipterus trachycorystes Valenciennes, 1840; type by absolute tautonymy. Gender masculine). Included species: Trachycorystes menezesi Britski & Akama, 2011 and Trachycorystes trachycorystes (Valenciennes, 1840). Diagnosis: Trachycorystes is diagnosed by six morphological synapomorphies. Non-exclusive: (1) nasal bone plate-like, laterally expanded (char. 3512: 0 → 1), convergent in Tatia boemia, Tatia brunnea, Tatia jacaratia, Tatia caxiuanensis, Tatia nigra, Trachelyopterichthys, Trachelyopterus and Spinipterus sp. ‘oncinha’; (2) lateroposterior portion of sphenotic slightly concave (char. 3552: 0 → 1), convergent in Ageneiosus (except Ageneiosus pardalis and Ageneiosus vittatus), Liosomadoras morrowi, Trachelyichthys, Trachelyopterus lucenai, Trachelyopterus porosus and several centromochlines; (3) bony expansion in posteromedial portion of premaxilla (char. 3585: 0 → 1), convergent in Ageneiosus (except Ageneiosus intrusus and Ageneiosus uranophthalmus) and Auchenipterus fordicei; (4) posterior bony projection on last dorsal-fin pterygiophore absent (char. 3680: 0 → 1), convergent in Auchenipterichthys punctatus, Liosomadoras, Entomocorus, Gelanoglanis, Glanidium, Duringlanis perugiae, Tatia simplex, Pseudotatia, Tatia nigra, Tatia intermedia, Tatia caxiuanensis, Tatia sp. 2, Balroglanis carolae, Trachelyichthys, Trachelyopterichthys and Spinipterus acsi; (5) posterior portion of basipterygium long, with process developed as wing (char. 3729: 0 → 1), convergent in Ageneiosus, Tympanopleura, Asterophysus, Centromochlus and Trachelyopterus; and (6) basal process of pelvic-fin rays posteromedially oriented (char. 3732: 1 → 0), convergent in Epapterus, Pseudepapterus, Pseudauchenipterus, Glanidium, Gelanoglanis, Ageneiosini, Asterophysus, Trachelyopterichthys and Trachelyopterus (except Trachelyopterus insignis). Comparisons: Trachycorystes are medium-sized predator species with the cephalic shield well exposed on the surface of the head, and distinguished from all auchenipterines, except Asterophysus, by the uniform dark brown or greyish to black coloration of the body, lacking any colour marks (vs. distinctly marked colour patterns present, or light background with darker dorsal profile); from all auchenipterines, except Asterophysus and Trachelyopterus, by having the lower jaw prognate, slightly outward in comparison to the premaxilla (less evident in Trachycorystes menezesi) (vs. lower and upper jaws ending in the same vertical line); and except for Trachycorystes menezesi, distinguishes from Tocantinsia, Asterophysus, Pseudepapterus, Pseudauchenipterus, Entomocorus, Auchenipterus, Ageneiosus (except Ageneiosus vittatus and Ageneiosus inermis) and Tympanopleura by having truncated caudal fin (vs. bifurcated caudal fin). It is distinguished from auchenipterines, except Ageneiosini, Auchenipterichthys, Pseudauchenipterus, Liosomadoras, Tocantinsia and some species of Trachelyopterus (Trachelyopterus insignis, Trachelyopterus galeatus, Trachelyopterus amblops and Trachelyopterus albicrux) by having six branched dorsal-fin rays (vs. five, four, three or seven branched dorsal-fin rays); and, except for Auchenipterichthys, Asterophysus and Pseudepapterus, by the number of branched pelvic-fin rays, eight or nine (vs. Entomocorus, Trachelyopterus and Spinipterus with five rays, Pseudauchenipterus with seven rays, Trachelyichthys with ten or 11 rays, Auchenipterus and Trachelyopterichthys with 10–14 rays, and Epapterus with 14–16 rays). It differs from all auchenipterines, except Trachelyichthys, Trachelyopterichthys and Spinipterus acsi, by having a long posterior process of the cleithrum, approximately two-thirds or the same length as the pectoral-fin spine (vs. posterior process of cleithrum small, not surpassing the base of branched pectoral-fin rays, or moderate, approximately half of pectoral-fin spine length). Subtribe Auchenipterichthyina Calegari, Vari & Reis subtrib. nov. (Clade 74) Type genus: Auchenipterichthys Bleeker, 1862. lsid: zoobank.org:act:86EB6D9F-6CB1-41CA-8294-18066A8414B1 Included genera: Auchenipterichthys Bleeker, 1862, Trachelyichthys Mees, 1974 and Trachelyopterichthys Bleeker, 1862. Diagnosis: Auchenipterichthyina is diagnosed by six molecular and four morphological synapomorphies. Non-exclusive: (1) posterior process of posttemporal–supracleithrum dorsoventrally oriented (char. 3561: 1 → 0), convergent in Entomocorus, Epapterus, Pseudauchenipterus nodosus, Trachelyopterus amblops, Trachelyopterus cf. Trachelyopterus galeatus, Trachelyopterus insignis, Spinipterus, most species of Ageneiosus and Tympanopleura and Centromochlinae (except Glanidium catharinensis, Glanidium sp. 1 RS and Glanidium sp. 2 RS; (2) posterior process of epioccipital forming simple spine (char. 3563: 3 → 0), reversed in Trachelyichthys, convergent in Asterophysus, Entomocorus, Gelanoglanis and Balroglanis (except Balroglanis carolae); (3) accessory cartilage between third and fourth basibranchials present (char. 3644: 0 → 1), convergent in Ageneiosus (except Ageneiosus lineatus), Auchenipterus fordicei, Duringlanis, Pseudauchenipterus flavescens, Pseudepapterus hasemani and Tetranematichthys; and (4) os suspensorium moderate in size (char. 3655: 1 → 0), convergent in Auchenipterus ambyacus, Auchenipterus nuchalis, Balroglanis, Duringlanis romani, Centromochlus, Glanidium, Entomocorus, Epapterus, Pseudauchenipterus, Gephyromochlus, most species of Tatia, Trachelyopterus (except Trachelyopterus aff. Trachelyopterus porosus) and Trachycorystes menezesi. Genus Auchenipterichthys Bleeker, 1862 (Clade 75) Auchenipterichthys Bleeker, 1862 (in Bleeker, 1862–63): 7 (type species: Auchenipterus thoracatus Kner, 1857; type by original designation. Gender masculine). Included species: Auchenipterichthys coracoideus (Eigenmann & Allen, 1942), Auchenipterichthys longimanus (Günther, 1864), Auchenipterichthys punctatus (Valenciennes, 1840) and Auchenipterichthys thoracatus (Kner, 1857). Diagnosis: Auchenipterichthys is diagnosed by 12 molecular and five morphological synapomorphies. Non-exclusive: (1) lateral line sinusoidal (char. 3525: 2 → 1), convergent in Ageneiosus, Tympanopleura and Auchenipterini (except Entomocorus); (2) laminar expansion on posteromedial portion of premaxilla absent (char. 3584: 1 → 0), convergent in Entomocorus, Gelanoglanis, Glanidium catharinensis and Glanidium cesarpintoi; (3) serrations on anterior margin of pectoral-fin spine retrorse (char. 3703: 2 → 1), convergent in Entomocorus, Trachelyichthys (except Trachelyichthys sp. 1), Trachelyopterus (except Trachelyopterus amblops and Trachelyopterus coriaceus) and Trachycorystes menezesi; (4) posterior portion of basipterygium long, with thin and pointed process (char. 3729: 0 → 2), convergent in Liosomadoras; and (5) last proximal radial of anal fin laminar (char. 3741: 0 → 1), convergent in Ageneiosus (except Ageneiosus lineatus), Tympanopleura cryptica, Auchenipterus and Tocantinsia. Comparisons: Auchenipterichthys is distinguished from all auchenipterines, except Ageneiosus, Tympanopleura, Auchenipterus, Pseudauchenipterus, Epapterus and Pseudepapterus, by having the lateral line sinusoidal along its entire length (vs. lateral line straight, or sinusoidal in the anterior portion and straight in the posterior half); and except for Trachycorystes, Asterophysus and Pseudepapterus, by the number of branched pelvic-fin rays, eight or nine (one specimen with ten) (vs. six in Liosomadoras, Tocantinsia, Ageneiosus, Tympanopleura and Tetranematichthys, five in Entomocorus, Trachelyopterus and Spinipterus; seven in Pseudauchenipterus, ten or 11 in Trachelyichthys, 10–14 in Auchenipterus and Trachelyopterichthys, and 14–16 in Epapterus). Yet, it differs from Pseudepapterus by having a robust dorsal-fin spine, moderate in size, approximately one-third of SL (vs. rudimentary dorsal-fin spine, less than one-sixth of SL), with six branched dorsal-fin rays (vs. three to five rays), and anterior margin of dorsal-fin spine serrated (vs. anterior margin of dorsal-fin spine smooth, lacking serration). Genus Trachelyopterichthys Bleeker, 1862 (Clade 79) Trachelyopterichthys Bleeker, 1862 (in Bleeker, 1862–63): 16 (type species: Trachelyopterus taeniatus Kner, 1857; type by original designation and monotypy. Gender masculine). Included species: Trachelyopterichthys anduzei Ferraris & Fernandez, 1987 and Trachelyopterichthys taeniatus (Kner, 1857). Diagnosis: Trachelyopterichthys is diagnosed by ten morphological synapomorphies. Non-exclusive: (1) nasal bone plate-like, laterally expanded (char. 3512: 0 → 1), convergent in Tatia boemia, Tatia brunnea, Tatia jacaratia, Tatia caxiuanensis, Tatia nigra, Trachelyopterus and Spinipterus sp. ‘oncinha’; (2) antorbital and ossified suborbital tubules with spines (char. 3520: 0 → 1), convergent in Tatia caxiuanensis, Liosomadoras, Trachycorystes trachycorystes and Spinipterus; (3) trigeminofacial foramen ventrally exposed (char. 3581: 1 → 0), convergent in Auchenipterini (except Auchenipterus ambyiacus and Auchenipterus brachyurus), Tympanopleura cryptica, Tympanopleura piperata, Trachelyichthys decaradiatus, Trachelyopterus amblops and Centromochlinae (except Glanidium); (4) distal portion of premaxilla extended (char. 3587: 0 → 1), convergent in Ageneiosini, Centromochlus existimatus and Duringlanis perugiae; (5) premaxillary teeth straight (char. 3589: 0 → 1), convergent in Entomocorus, Gelanoglanis, Gephyromochlus, Glanidium cesarpintoi, Liosomadoras oncinus, Tocantinsia, Trachycorystes trachycorystes, Spinipterus and some species of Tatia; (6) anterior process on pharyngobranchial tooth-plate absent (char. 3653:
TI - Phylogenetic systematics of the driftwood catfishes (Siluriformes: Auchenipteridae): a combined morphological and molecular analysis
JF - Zoological Journal of the Linnean Society
DO - 10.1093/zoolinnean/zlz036
DA - 2019-10-25
UR - https://www.deepdyve.com/lp/oxford-university-press/phylogenetic-systematics-of-the-driftwood-catfishes-siluriformes-wpCB4Pg00D
SP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -