TY - JOUR
AU1 - Torgersen, Maria L.
AU2 - Engedal, Nikolai
AU3 - Pedersen, Anne-Mari G.
AU4 - Husebye, Harald
AU5 - Espevik, Terje
AU6 - Sandvig, Kirsten
AB - Abstract Infection with Shiga toxin (Stx)-producing, gram-negative bacteria can induce serious conditions such as dysentery and hemolytic uremic syndrome. In target cells, Stx is internalized by endocytosis, and travels through the Golgi apparatus and the endoplasmic reticulum to reach the cytosol, where it inhibits protein synthesis. Toll-like receptor 4 (TLR4) mediates the recognition of gram-negative bacteria. Here, we have investigated whether the cellular uptake and transport of Stx could involve TLR4. We found that upon small interfering RNA (siRNA)-mediated TLR4 depletion in epithelial colon carcinoma cells, Stx transport to the Golgi was strongly reduced, and this was primarily caused by diminished Stx cellular binding rather than by reduction in toxin uptake or endosome-to-Golgi transport. The reduced cellular binding of Stx upon siRNA-transfection was solely due to TLR4 depletion, because reconstitution of TLR4 expression by the introduction of an siRNA-resistant TLR4 gene completely abolished the TLR4-targeting siRNA-mediated effect. Importantly, the effect of TLR4 depletion was not restricted to cancer cells or epithelial cells, because primary human umbilical vein endothelial cells also displayed reduced Stx binding upon TLR4 depletion. These results indicate that although TLR4 is imperative in innate immunity against gram-negative bacteria, it may be exploited by bacterial toxins, for example Stx, to gain access and entry into cells. shiga toxin, globotriaosylceramide, Toll-like receptor 4, endothelial cells, retrograde transport Introduction Shiga toxin (Stx) and the related Shiga-like toxins 1 and 2 (Stx1 and Stx2) are produced by Shigella dysenteriae and Stx-producing Escherichia coli, respectively (for reviews, see Sandvig et al., 2009; Johannes & Romer, 2010; Sandvig et al., 2010). Stx1 is virtually identical to Stx (differing in only one amino acid residue), whereas Stx2 has less amino acid similarity to Stx, but shares the overall toxin structure and mechanism of action. The common toxin structure consists of an enzymatically active A-subunit noncovalently attached to a stable pentamer of identical B-chains (StxB), which mediates specific binding of the toxin to the glycosphingolipid globotriaosylceramide (Gb3). After binding to Gb3, the toxin is taken up by endocytosis and transported in a retrograde manner via early endosomes to the Golgi apparatus and further to the endoplasmic reticulum (Sandvig et al., 1992; Johannes & Romer, 2010; Sandvig et al., 2010). From the endoplasmic reticulum, the A-subunit is translocated to the cytosol, where it inhibits protein synthesis by enzymatic modification of the 28S rRNA. In the body, an infection with gram-negative bacteria such as S. dysenteriae and Stx-producing E. coli can be recognized by host cells expressing Toll-like receptor 4 (TLR4), due to the specific interaction of TLR4 with lipopolysaccharide, an outer membrane component of gram-negative bacteria. TLR4 is expressed by immune cells, but also by some epithelial cells that line the barrier between the body and the outside environment, such as in the gut epithelium (Gribar et al., 2008), as well as by some types of endothelial cells (Talreja et al., 2004; Dauphinee & Karsan, 2006). The activation of TLR4 by lipopolysaccharide initiates signaling that results in the secretion of pro-inflammatory cytokines such as tumor necrosis factor, interleukin (IL)-1β, IL-6, and IL-8. The Stx receptor, Gb3, is mostly expressed by kidney cells (Lingwood, 1994; Khan et al., 2009), germinal center B cells (Mangeney et al., 1991), and some types of endothelial cells (Miyamoto et al., 2006; Schuller et al., 2007; Obata et al., 2008). At least in the latter cell type the expression of Gb3 can be induced by pro-inflammatory cytokines (van de Kar et al., 1992; van Setten et al., 1997; Lingwood, 1999). Moreover, Gb3 is overexpressed in several cancer types, including those of epithelial origin, for example ovarian, breast, and colorectal cancers (Farkas-Himsley et al., 1995; LaCasse et al., 1999; Falguières et al., 2008), and Gb3 is therefore a candidate target for diagnostic and therapeutic purposes (Tarrago-Trani & Storrie, 2007; Engedal et al., 2010; Johannes & Romer, 2010). Of note, many Gb3-expressing cancer types also express TLR4 (Simiantonaki et al., 2007; Huang et al., 2008; Zhou et al., 2009). Thus, coexpression of Gb3 and TLR4 is likely to occur in several different cell types under both normal and malignant conditions. TLR4 has been shown to localize not only to the plasma membrane but also to early endosomes and the Golgi apparatus (Latz et al., 2002; Husebye et al., 2006). TLR4 was shown to cycle rapidly between the Golgi and the plasma membrane (Latz et al., 2002), and it was suggested that cells may regulate the cell surface expression of TLR4 by enhancing or diminishing the retention of TLR4 in the Golgi. Moreover, a recent study reported that StxB could rapidly enhance the cell surface expression of TLR4 (Fischer et al., 2007). Given these findings, we hypothesized that TLR4 might play a role in the binding and/or retrograde trafficking of Stx. Here, we report that small interfering RNA (siRNA)-mediated depletion of TLR4 in Stx-sensitive cells results in a strong reduction in the amount of Stx that is transported to the trans-Golgi network (TGN). Further, we found that this reduction could be fully, or at least to a large extent, explained by diminished cellular binding of Stx upon TLR4 depletion, rather than by reduced Stx uptake or reduced endosome-to-Golgi transport of Stx per se. The effect of TLR4 depletion on Stx binding was observed in both human colon carcinoma SW480 cells and primary human umbilical vein endothelial cells, indicating that TLR4 is required for efficient binding of Stx in different cell types, and that TLR4 may play a role in the pathophysiology of Stx-induced human disease. Materials and methods Materials H235SO4 was purchased from Hartmann Analytics. Highly purified Stx was provided by Dr J.E. Brown (USAMRIID, Fort Detrick). The plasmid encoding StxB-sulf2 was a kind gift from Dr B. Goud (Institute Curie, Paris) and the plasmid encoding enhanced green fluorescent protein (EGFP) (pcDNA3-EGFP-C1) was a kind gift from Dr Harald Stenmark (The Norwegian Radium Hospital, Oslo). An siRNA-resistant TLR4 gene (TLR4r) encoding the natural human TLR4 protein sequence was manufactured by DNA 2.0 (Menlo Park, CA) and cloned into the mammalian expression vector pcDNA3 (Invitrogen). All other chemicals were from Sigma-Aldrich or Merck unless otherwise stated. Cells and transfection SW480 and Hct116 human colon carcinoma cells were grown under 5% CO2 in RPMI 1640 or DMEM/F-12 1 : 1, respectively, both media supplemented with 10% fetal calf serum (FCS), 100 U mL−1 penicillin, 100 µg mL−1 streptomycin, and 2 mM l-glutamine (all from Gibco). Pooled primary human umbilical vein endothelial cells (HUVECs) were purchased from Lonza, and grown in optimized growth media (Lonza). HUVECs from passages three to five were used in the experiments. Cells were transfected with siRNA oligos in the absence of antibiotics and serum 1 day after seeding into six-well plates (8 × 104 cells per well), using 1 mL of a transfection solution containing 1.6 µL Lipofectamine RNAiMAX (Invitrogen) and a final concentration of 25 nM siRNA (for HUVECs: half of both), according to the manufacturer's instructions. After 5 h, the cells received complete growth medium and were cultured for 48 h before the experiments. The siRNA oligos had the following sequences (5′–3′ direction, sense strand): TLR4-1, GGUGUGAAAUCCAGACAAU (Eurogentec); TLR4-2, GGGCUUAGAACAACUAGAA (Dharmacon); TLR4-3, CGAUGAUAUUAUUGACUUA (Qiagen); and Gb3 synthase, CGUGCUGGUCCUGAUGAAA (Qiagen). Control cells were transfected with a nontargeting control duplex (Dharmacon). For TLR4 reconstitution experiments, SW480 cells were seeded on coverslips in six-well plates (2 × 105 cells per well), and transfected with siRNA oligos the following day, as described above. After 24 h, the cells were cotransfected with 0.5 µg pcDNA3-EGFP-C1 and 2 µg of either a plasmid encoding an siRNA-resistant TLR4 gene (pcDNA3-TLR4r) or the empty vector (pcDNA3), using 3.5 µL FuGENE6 (Roche) per microgram of DNA. Immunofluorescence was performed 24 h after DNA transfection. All plasmid DNAs were prepared using the EndoFree® Plasmid Maxi Kit (Qiagen). Quantitative real-time reverse transcriptase (RT)-PCR Total RNA was isolated from siRNA-transfected cells using the Aurum Total RNA mini kit (Bio-Rad), according to the manufacturer's instructions. Total RNA (0.5 µg) was used for cDNA synthesis using the iScript cDNA Synthesis kit (Bio-Rad). The real-time PCR analysis was run on a LightCycler 480 Real-Time PCR System using LightCycler 480 SYBR green 1 Master mix (Roche). The cycling conditions were 95 °C for 5 min, followed by 45 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 10 s. The relative quantities of TLR4 or Gb3 synthase transcripts were determined using the LightCycler 480 Abs Quant/2nd Derivative Max method provided in the LightCycler 480 Relative Quantification Software module (Roche). Transcript quantities were normalized to the relative quantity of the housekeeping gene TBP (TATA box-binding protein) for each condition. The following primers were ordered from MWG (5′–3′ direction): TLR4, CGTGGAGGTGGTTCCTAATAT and AGCTCAGGTCCAGGTTCTT; TBP, GCCCGAAACGCCGAATAT and CGTGGCTCTCTTATCCTCATGA. Primers towards Gb3 synthase were from Qiagen (QuantiTect, B3GALT4). Endocytosis of Stx Internalization and total cell association of biotin-Stx were analyzed as described previously (Torgersen et al., 2007). Briefly, Stx was biotinylated with the reducible EZ-Link Sulfo-NHS-SS-Biotin (Pierce Biotechnology), and a monoclonal antibody against Stx (3C10, Toxin Technology) was labeled with a special BV-TAG®-label containing a Tris-(bipyridine)-chelated ruthenium (II) atom (BioVeris Corporation). The cells were incubated with biotin-Stx (10–20 ng mL−1 for SW480 cells and 250 ng mL−1 for HUVEC) for 15 min at 37 °C. In order to distinguish the internalized toxin molecules from the total cell-associated molecules (bound+internalized), one half of the cell plate was treated with 0.1 M MESNa for 30 min on ice to reduce the SS-linked biotin in the cell surface-bound toxin, whereas the other half of the plate remained untreated. Then the cells were lysed [0.1 M NaCl, 10 mM Na2HPO4, pH 7.4, 1 mM EDTA, 1% Triton X-100, 60 mM n-octyl β-d-glucopyranoside, and a mixture of protease inhibitors (Roche)], and the cell lysate was incubated with the BV-TAG®-labeled anti-Stx antibody (0.5 µg mL−1) and streptavidin-coated magnetic beads (0.1 mg mL−1, Invitrogen) by gentle shaking for 1.5 h. The amount of streptavidin-captured Stx complexed to the BV-TAG®-labeled antibody was quantified using an M1R Analyzer (BioVeris Corporation). Counts from cells treated with MESNa represent the amount of internalized toxin, whereas counts from untreated cells represent the amount of total cell-associated toxin. Sulfation of StxB-sulf2 and Western blot analysis The sulfation experiments were performed essentially as described previously (Torgersen et al., 2007). Briefly, cells were preincubated in sulfate-free Dulbecco's modified Eagle's medium (DMEM) containing 0.2 mCi mL−1 H235SO4 for 90 min at 37 °C before StxB-sulf2 was added (1.2 µg mL−1), and the incubation was continued for 45 min at 37 °C. The cells were washed in cold phosphate-buffered saline (PBS), lysed [0.1 M NaCl, 10 mM Na2HPO4, pH 7.4, 1 mM EDTA, 1% Triton X-100, 60 mM n-octyl β-d-glucopyranoside, and a mixture of protease inhibitors (Roche)], and scraped. The cleared lysate was subjected to immunoprecipitation with anti-Stx antibody (3C10, Toxin Technology) prebound to protein-A/sepharose CL-4B (GE Healthcare) overnight at 4 °C. The adsorbed material was analyzed by 4–20% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions and transferred onto a polyvinylidene fluoride (PVDF) membrane, which was subsequently dried with methanol. The bands were detected by exposing the membrane to a K-Screen (Bio-Rad), and the signal intensities were quantified using the quantity one software (Bio-Rad). Next, the total amount of StxB-sulf2 on the membranes was determined by incubating the membranes with anti-Stx antibody (3C10, Toxin Technology) at 1 µg mL−1 in 2.5% milk for 1 h, followed by 30 min of incubation with a horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (115-035-003, Jackson Immunoresearch Laboratories, 1/6000 dilution in 2.5% milk), and detection using ECL Plus (GE Healthcare) and BioMax MR film (Kodak). Bands were scanned on a GS-800 densitometer (Bio-Rad) and quantified using QUANTITY ONE (Bio-Rad). The total amount of sulfated proteins in the lysates was measured by precipitating proteins with 5% TCA, dissolving them in 0.1 M KOH, and quantifying the radioactivity using a liquid scintillation counter (Packard). In addition, lysate protein concentrations were determined using the BCA assay (Pierce). Only minor changes were observed in the total protein levels. Every sulfation experiment was performed in duplicate, i.e. cells in two separate wells were treated identically. For Western blot analysis of TLR4 protein, cleared cell extracts (10 µg proteins/lane) were separated by 4–20% SDS-PAGE and transferred to a PVDF membrane. The membrane was blocked in 7.5% milk for 30 min, followed by an overnight incubation with an anti-TLR4 antibody (IMG-6307A, Imgenex) at 0.5 µg mL−1 in 2.5% milk, a 45-min incubation with an HRP-conjugated goat anti-rabbit IgG antibody (111-035-144, Jackson Immunoresearch Laboratories, 1/10 000 dilution in 2.5% milk), and detection with ECL plus reagent as described above. As a loading control, the bottom half of the membrane was subjected to immunodetection of γ-tubulin, using a monoclonal anti-γ-tubulin antibody (Sigma, clone GTU-88, 1/20 000 dilution) and an HRP-conjugated goat anti-mouse IgG antibody (115-035-003, Jackson Immunoresearch Laboratories, 1/10 000 dilution). Bands were scanned and quantified as described above. The intensities of the TLR4-positive bands (MWapp∼110 kDa) were normalized to those of the γ-tubulin-positive bands. Measurement of secreted IL-8 by enzyme-linked immunosorbent assay (ELISA) Transfected or nontransfected SW480 cells were left untreated or stimulated with ultrapure lipopolysaccharide (25 ng mL−1, InvivoGen) or Stx (10 ng mL−1) for 16–20 h. Subsequently, cell-free supernatants were assayed for IL-8 by ELISA (BD Biosciences), according to the manufacturer's procedure. In assessing the specificity of lipopolysaccharide-induced IL-8 secretion, polyclonal goat IgG TLR4 blocking antibody and normal goat IgG control antibody, both from RnD Systems (catalog # AF1478 and AB-108-C, respectively), were utilized. Immunofluorescence Transfected SW480 cells grown on coverslips were incubated with Stx (250 ng mL−1) for 15 min, washed, and incubated for a further 30 min at 37 °C. The cells were fixed in 3% paraformaldehyde in PBS, permeabilized in 0.1% Triton X-100 and blocked in 10% FCS. Stx was stained with the mouse anti-Stx antibody 3C10 (Toxin Technology), followed by Cy2- or Cy3-labeled donkey anti-mouse IgG (Jackson Immunoresearch Laboratories). The cells were mounted in ProLong Gold with 4′-6-diamidino-2-phenylindole (Invitrogen) and analyzed using a Zeiss LSM 510 Meta confocal microscope (Zeiss) equipped with a Plan-Apochromat 63 ×/1.4 and a Neo-Fluar 100 ×/1.45 oil immersion objective. Images of thin single-plane sections were taken, and the total Stx fluorescence intensity per cell was quantified using the histogram-function in the Zeiss lsm image browser software. For TLR4 reconstitution experiments, Stx signal intensity was quantified in GFP-positive cells. In total, ∼200 cells were quantified per condition (60–70 cells per condition per experiment). Determination of cell surface Gb3 expression The cell surface expression of Gb3 was determined by indirect immunofluorescence, followed by flow cytometry. Transfected SW480 cells (∼7.5 × 105) were gently harvested with Accutase (Sigma-Aldrich) and incubated with a monoclonal rat anti-human Gb3 antibody (clone 38-13, AbD Serotec) or an isotype-matched control antibody (rat IgM, κ, BD Biosciences), both at 25 µg mL−1 in 150 µL PBS/2% FCS, for 30 min on ice. Cells were washed twice with PBS/2% FCS, followed by another 30 min of incubation on ice with DyLight™ 488-conjugated goat anti-rat IgM (Jackson Immunoresearch Laboratories) at 8 µg mL−1 in 150 µL PBS/2% FCS. Cells were washed twice with PBS/2% FCS, and 10 000 cells were run on a FACSCalibur flow cytometer (BD Biosciences). Data were analyzed using cell quest software (BD Biosciences). Dead cells were excluded from the analyses according to the distribution of live and dead cells in the forward/side-scatter dot plot. Results and discussion Knockdown of functional TLR4 by siRNA The intestinal carcinoma epithelial cell line SW480 has been reported to express functional TLR4 (Suzuki et al., 2003; Otte et al., 2004), as well as the Stx receptor Gb3 (Holmes et al., 1987). As shown in the current study, Stx was bound, endocytosed, and transported in a retrograde manner to the Golgi apparatus in SW480 cells, as in many other toxin-sensitive cells (Sandvig et al., 2009). We therefore chose this cell line as a first model to examine the potential role of TLR4 in Stx trafficking. To this end, we initially tested whether we could efficiently deplete SW480 cells of TLR4 by siRNA. After 48 h of transfection with a TLR4-targeting siRNA oligo (termed ‘TLR4-1’), the mRNA and protein level of TLR4 was reduced by 90% and 80% as assessed by quantitative real-time RT-PCR (Fig. 1a) and Western blot analysis (Fig. 1b), respectively. SW480 cells evidently expressed functional TLR4 proteins at the cell surface, because ultrapure lipopolysaccharide potently induced IL-8 secretion in a manner that was efficiently and specifically blocked by an anti-TLR4 antibody (Fig. 1c). We therefore used lipopolysaccharide-induced IL-8 secretion to assess the knockdown of functional TLR4 protein. After 48 h of transfection with the TLR4-1 siRNA oligo, the ability of lipopolysaccharide to induce IL-8 secretion was reduced by 90% (Fig. 1d). Two additional TLR4-targeting siRNAs (‘TLR4-2’ and ‘TLR4-3’) were tested, and these oligos reduced lipopolysaccharide-induced IL-8 secretion by 70–80% (data not shown). We thus concluded that TLR4 was efficiently knocked down at both the mRNA and the protein level after 48 h of siRNA transfection. Figure 1 View largeDownload slide Knockdown of TLR4 in SW480 cells upon siRNA transfection. (a) Real-time RT-PCR of TLR4 mRNA 48 h after siRNA transfection. The amount of TLR4 mRNA is presented as percent of that in control siRNA-transfected cells (mean value ± SEM from three independent experiments). (b) Western-blot analysis of TLR4 protein levels 48 h after siRNA transfection. The level of TLR4 protein is presented as percent of that in control siRNA-transfected cells (mean value ± SEM from three independent experiments). One representative blot is shown as an insert to the graph. Western blot analysis of γ-tubulin served as a loading control, to which the TLR4 bands were normalized upon quantification. The TLR4-positive bands displayed an apparent molecular weight of ∼110 kDa. (c) Lipopolysaccharide-induced IL-8 production in SW480 cells is mediated by TLR4. Cells were pretreated (30 min) with anti-TLR4 blocking antibody AF1478 or an isotype-matched control antibody (both 10 µg mL−1, RnD Systems) before lipopolysaccharide (25 ng mL−1) was added. IL-8 production was determined by ELISA (mean values ± SEMs from three independent experiments). The IL-8 production of untreated control cells (medium) was arbitrarily set to 1. (d) IL-8 ELISA to verify the functional knockdown of TLR4 in SW480 cells after 48 h of siRNA transfection. The bars show fold induction of IL-8 upon lipopolysaccharide stimulation (mean values ± SEMs from three independent experiments). Figure 1 View largeDownload slide Knockdown of TLR4 in SW480 cells upon siRNA transfection. (a) Real-time RT-PCR of TLR4 mRNA 48 h after siRNA transfection. The amount of TLR4 mRNA is presented as percent of that in control siRNA-transfected cells (mean value ± SEM from three independent experiments). (b) Western-blot analysis of TLR4 protein levels 48 h after siRNA transfection. The level of TLR4 protein is presented as percent of that in control siRNA-transfected cells (mean value ± SEM from three independent experiments). One representative blot is shown as an insert to the graph. Western blot analysis of γ-tubulin served as a loading control, to which the TLR4 bands were normalized upon quantification. The TLR4-positive bands displayed an apparent molecular weight of ∼110 kDa. (c) Lipopolysaccharide-induced IL-8 production in SW480 cells is mediated by TLR4. Cells were pretreated (30 min) with anti-TLR4 blocking antibody AF1478 or an isotype-matched control antibody (both 10 µg mL−1, RnD Systems) before lipopolysaccharide (25 ng mL−1) was added. IL-8 production was determined by ELISA (mean values ± SEMs from three independent experiments). The IL-8 production of untreated control cells (medium) was arbitrarily set to 1. (d) IL-8 ELISA to verify the functional knockdown of TLR4 in SW480 cells after 48 h of siRNA transfection. The bars show fold induction of IL-8 upon lipopolysaccharide stimulation (mean values ± SEMs from three independent experiments). Depletion of TLR4 inhibits retrograde transport of Stx to the TGN In order to determine the effect of TLR4 depletion on the retrograde transport of Stx to the TGN, we analyzed the sulfation of a recombinant StxB molecule with two sulfation sites (StxB-sulf2). This biochemical assay exploits the fact that the sulfotransferase enzyme is uniquely located in the TGN, and therefore the degree of StxB-sulf2 sulfation reflects its transport to the TGN. siRNA-mediated knockdown of TLR4 in SW480 cells with the TLR4-1 siRNA oligo resulted in an ∼70% inhibition of StxB-sulf2 sulfation compared with that observed in control siRNA-transfected cells (Fig. 2a). Total protein sulfation was unaffected (Fig. 2a). Also, with the two other, less potent TLR4-targeting siRNA oligos (TLR4-2 and TLR4-3), a consistent, albeit smaller reduction in StxB-sulf2 sulfation was found (ranging from 27% to 36% reduction in two independent experiments; data not shown). To rule out off-target effects, the TLR4-1 siRNA oligo was tested in another colon carcinoma cell line, Hct116, which, like SW480 cells, is Stx-sensitive, but unlike SW480 does not express TLR4 (Suzuki et al., 2003; Bhattacharjee et al., 2005; Zhao et al., 2007). As shown in Fig. 2b, the TLR4-1 siRNA did not affect StxB sulfation in Hct116 cells. This was not due to Hct116 cells being more difficult to transfect than SW480 cells, because transfection with an siRNA duplex that targets the Gb3 synthase enzyme and thus disrupts the synthesis of Gb3 was equally effective in reducing StxB sulfation in Hct116 cells as in SW480 cells (Fig. 2a and b). These results indicate that the reduced Stx transport observed upon transfection with TLR4-targeting siRNA is unlikely to be caused by off-target effects. Figure 2 View largeDownload slide TLR4-targeting siRNA reduces StxB cell association and transport to the Golgi in TLR4-positive SW480 cells, but not in TLR4-negative Hct116 cells. SW480 (a) or Hct116 (b) were transfected with control siRNA or specific siRNAs against TLR4 or Gb3 synthase, and the cells were treated and assayed for StxB sulfation as described in Materials and methods. Subsequently, the membranes were immunoblotted for StxB. Representative sulfation autoradiographs with the corresponding immunoblots are shown in the upper panels. In the lower panels, the amount of sulfated StxB (white bars), total sulfated proteins (gray bars), and StxB (black bars) in cells transfected with TLR4- or Gb3 synthase siRNA are shown as percent of that in control siRNA-transfected cells [mean values ± SEMs from four (a) and three (b) independent experiments performed in duplicate]. *P<0.05; paired-samples t-test. Figure 2 View largeDownload slide TLR4-targeting siRNA reduces StxB cell association and transport to the Golgi in TLR4-positive SW480 cells, but not in TLR4-negative Hct116 cells. SW480 (a) or Hct116 (b) were transfected with control siRNA or specific siRNAs against TLR4 or Gb3 synthase, and the cells were treated and assayed for StxB sulfation as described in Materials and methods. Subsequently, the membranes were immunoblotted for StxB. Representative sulfation autoradiographs with the corresponding immunoblots are shown in the upper panels. In the lower panels, the amount of sulfated StxB (white bars), total sulfated proteins (gray bars), and StxB (black bars) in cells transfected with TLR4- or Gb3 synthase siRNA are shown as percent of that in control siRNA-transfected cells [mean values ± SEMs from four (a) and three (b) independent experiments performed in duplicate]. *P<0.05; paired-samples t-test. Inhibition of Stx transport to the TGN upon TLR4 depletion is primarily caused by reduced cellular Stx binding The reduced sulfation of StxB observed upon TLR4 depletion could be explained by a reduction in either the initial toxin binding, the endocytic uptake, or the endosome-to-TGN transport of StxB. Strikingly, immunodetection of the total amount of StxB on the sulfation membranes (Fig. 2a) consistently showed that less StxB was present in the lanes corresponding to TLR4 siRNA-transfected SW480 cells compared with the lanes corresponding to control siRNA-transfected cells, indicating that StxB cell association was reduced upon TLR4 depletion. This was not due to the TLR4 siRNA having a detrimental effect on cell growth or cell death, because both the total protein sulfation (Fig. 2a) and the total cell number (data not shown) were unaffected by the TLR4 siRNA. Moreover, it was not due to a general adverse effect of the TLR4 siRNA, because in Hct116 cells, neither the amount of sulfated StxB nor the total amount of StxB on the immunoblot was reduced by the TLR4 siRNA (Fig. 2b). In both SW480 and Hct116 cells, however, StxB was nearly absent in the lanes corresponding to Gb3 synthase siRNA-transfected cells, indicating that Gb3 was required for Stx cell association in both cell lines (Fig. 2a and b). The reduction in StxB cell association upon TLR4 depletion (∼50% as assessed by immunoblotting) was slightly, but significantly less than the reduction in Stx transport to the TGN (∼70% as assessed by StxB sulfation) (P<0.05 in a t-test from four independent experiments) (Fig. 2a). This suggests that in addition to reduced cellular binding of StxB, reduced endosome-to-TGN transport of StxB and/or reduced cellular uptake of StxB could also, to some extent, contribute to the observed reduction in StxB sulfation. However, because the assay described above may not be sensitive enough to measure the differences observed, and in order to further assess the relative contributions of these steps, we next used a previously established method (Torgersen et al., 2007) to measure both the uptake and the total cell association of biotin-labeled Stx (biotin-Stx). As shown in Fig. 3a, the internalization of biotin-Stx was reduced by ∼35% upon TLR4 depletion. This reduction was most likely entirely due to reduced binding of Stx to the cell surface, because the total cell association of biotin-Stx was reduced to a similar extent (∼30%) (Fig. 3b). Furthermore, immunofluorescence studies using confocal microscopy showed that the cellular association of unmodified Stx was reduced by ∼45% upon TLR4 siRNA transfection (Fig. 4). Together, these results indicate that the observed inhibition of Stx retrograde transport to the Golgi apparatus (as measured by StxB sulfation) is at least to a large extent, caused by a diminished binding of Stx to the cell surface. However, because the depletion of TLR4 seemed to yield a stronger reduction in Stx transport to the Golgi (∼70%) than the reduction in Stx cell association (∼30–50%, depending on the method used), and the cellular uptake of Stx per se seemed to be unaffected, we cannot rule out the possibility that the endosome-to-Golgi transport of Stx is also somewhat inhibited by TLR4 knockdown. Notably, the observation that TLR4 depletion reduced StxB transport to the Golgi at least to the same extent as toxin binding strongly indicates that TLR4 regulates the binding of Stx molecules destined for transport to the Golgi. Figure 3 View largeDownload slide Internalization and total cell association of Stx is reduced in SW480 cells upon TLR4 depletion. Cells were incubated with biotin-Stx (20 ng mL−1) for 15 min at 37°C, and the amount of internalized biotin-Stx (a) and total cell-associated biotin-Stx (b) was quantified as described in Materials and methods (mean values ± SEMs from four independent experiments). *P<0.05; paired-samples t-test. Figure 3 View largeDownload slide Internalization and total cell association of Stx is reduced in SW480 cells upon TLR4 depletion. Cells were incubated with biotin-Stx (20 ng mL−1) for 15 min at 37°C, and the amount of internalized biotin-Stx (a) and total cell-associated biotin-Stx (b) was quantified as described in Materials and methods (mean values ± SEMs from four independent experiments). *P<0.05; paired-samples t-test. Figure 4 View largeDownload slide Labeling intensity of Stx is reduced in TLR4-depleted cells. SW480 cells were treated with Stx, fixed, and prepared for immunofluorescence as described in Materials and methods. Stx was visualized by Cy2-labeled secondary antibodies (green color), and the specificity of the Stx staining was confirmed by the absence of a signal in Gb3 synthase-depleted cells. Scale bar=20 µm. The right panel shows the mean fluorescence intensity of TLR4-depleted cells compared with control transfected cells (mean values ± SEMs from four independent experiments with a total of 557 quantified control cells and 597 TLR4-depleted cells). *P<0.05; paired-samples t-test. Figure 4 View largeDownload slide Labeling intensity of Stx is reduced in TLR4-depleted cells. SW480 cells were treated with Stx, fixed, and prepared for immunofluorescence as described in Materials and methods. Stx was visualized by Cy2-labeled secondary antibodies (green color), and the specificity of the Stx staining was confirmed by the absence of a signal in Gb3 synthase-depleted cells. Scale bar=20 µm. The right panel shows the mean fluorescence intensity of TLR4-depleted cells compared with control transfected cells (mean values ± SEMs from four independent experiments with a total of 557 quantified control cells and 597 TLR4-depleted cells). *P<0.05; paired-samples t-test. Reconstitution of TLR4 expression abolishes TLR4 siRNA-mediated inhibition of Stx cell association Our observation that the TLR4-targeting siRNA did not affect StxB sulfation in TLR4-negative Hct116 cells indicated that the phenotype observed in SW480 cells was not due to an off-target effect of the siRNA oligo. However, because the possibility still existed that the TLR4-targeting siRNA could have other off-target effects in SW480 cells than in Hct116 cells, we wished to determine more firmly whether the siRNA-mediated effects observed in SW480 cells were specifically caused by TLR4 depletion. To this end, we reconstituted TLR4 expression in TLR4-depleted cells by transfection-mediated introduction of a version of the TLR4 gene containing silent mutations that make it siRNA resistant, but still encodes the natural human TLR4 protein. Subsequently, we analyzed Stx cell association by confocal immunofluorescence microscopy. In order to visualize transfected cells, the plasmid containing the siRNA-resistant TLR4 gene was cotransfected with an EGFP-expressing plasmid. As shown in Fig. 5, the TLR4-targeting siRNA oligo strongly inhibited Stx cell association in cells transfected with the empty vector. However, and strikingly, the TLR4-targeting siRNA no longer had any effect in cells that were transfected with the plasmid containing the siRNA-resistant TLR4 gene (Fig. 5). This result strongly indicates that the observed siRNA-mediated effect on Stx cell association is solely caused by TLR4 depletion and not by any off-target effects. Figure 5 View largeDownload slide The reduction in the Stx labeling intensity upon TLR4 knockdown is rescued by overexpression of siRNA-resistant TLR4 (TLR4r). SW480 cells were consecutively transfected with siRNA oligos and plasmid DNA as indicated. Subsequently, the cells were treated with Stx and prepared for immunofluorescence as described in Materials and methods. Cell-associated Stx was visualized by Cy3-labeled secondary antibodies (red color), and transfected cells by EGFP expression (green color). Scale bar=20 µm. The right panel shows the mean fluorescence labeling intensity of Stx in TLR4-depleted cells with or without reconstitution of TLR4 expression (mean values ± SEMs from three independent experiments). In total, ∼200 cells were quantified from each condition, and the Stx signal intensity level was normalized to that of cells consecutively transfected with control siRNA oligo and pcDNA3 empty vector. Figure 5 View largeDownload slide The reduction in the Stx labeling intensity upon TLR4 knockdown is rescued by overexpression of siRNA-resistant TLR4 (TLR4r). SW480 cells were consecutively transfected with siRNA oligos and plasmid DNA as indicated. Subsequently, the cells were treated with Stx and prepared for immunofluorescence as described in Materials and methods. Cell-associated Stx was visualized by Cy3-labeled secondary antibodies (red color), and transfected cells by EGFP expression (green color). Scale bar=20 µm. The right panel shows the mean fluorescence labeling intensity of Stx in TLR4-depleted cells with or without reconstitution of TLR4 expression (mean values ± SEMs from three independent experiments). In total, ∼200 cells were quantified from each condition, and the Stx signal intensity level was normalized to that of cells consecutively transfected with control siRNA oligo and pcDNA3 empty vector. TLR4 depletion does not decrease the level of Gb3 at the cell surface The most straightforward explanation for the diminished binding of Stx to the cell surface upon TLR4 siRNA transfection would be that TLR4 depletion simply decreases the amount of the Stx receptor, Gb3, at the cell surface. To assess this possibility, we analyzed both the mRNA level of the final metabolic enzyme responsible for Gb3 synthesis, Gb3 synthase, and the cell surface level of Gb3 in SW480 cells. As determined by real-time RT-PCR, the Gb3 synthase mRNA level was not decreased upon transfection with TLR4 siRNA (97.6 ± 9.4%, mean value ± SEM of control siRNA-transfected cells from three independent experiments). Furthermore, as determined by indirect immunofluorescence (using an anti-Gb3 antibody and a fluorescently labeled secondary antibody), followed by flow cytometry, the cell surface level of Gb3 was found to be unchanged upon transfection with TLR4 siRNA compared with control siRNA (Fig. 6). Thus, TLR4 siRNA had no effect compared with control siRNA either in terms of the percentage of cells displaying high fluorescence (reflecting cells with high cell surface Gb3 expression) or in terms of the mean fluorescence intensity (reflecting the overall average cell surface Gb3 expression) (Fig. 6). Also, the mean fluorescence intensity among the cells with high Gb3 expression was unchanged upon TLR4 depletion (data not shown). To verify the specificity of the anti-Gb3 antibody, SW480 cells were transfected with Gb3 synthase siRNA. As expected, both the percentage of cells with high cell surface Gb3 expression and the overall average cell surface Gb3 expression were strongly reduced (Fig. 6). Together, these results indicate that the inhibition of Stx cell association upon TLR4 depletion is not due to reduced Gb3 expression, and instead, a more complex mechanism is involved (see the discussion below). Figure 6 View largeDownload slide The level of cell surface Gb3 immunostaining is unchanged upon TLR4 depletion. SW480 cells were transfected with siRNAs as indicated, and subjected to indirect immunofluorescence and flow cytometry as described in Materials and methods. Pink, unstained cells; filled purple, isotype-matched control+2nd antibody; green, anti-Gb3 antibody+2nd antibody. In the green histogram, the broad, far most right peak is considered as ‘Gb3++ cells’, containing high amounts of Gb3 at the cell surface. Cells to the left of this peak are considered to have relatively little or no surface Gb3. Percentages of Gb3++ cells are indicated above the region markers. The numbers in parentheses below the siRNA names indicate the mean fluorescence intensities of all cells. Histograms from one representative experiment out of three independent experiments are shown. Figure 6 View largeDownload slide The level of cell surface Gb3 immunostaining is unchanged upon TLR4 depletion. SW480 cells were transfected with siRNAs as indicated, and subjected to indirect immunofluorescence and flow cytometry as described in Materials and methods. Pink, unstained cells; filled purple, isotype-matched control+2nd antibody; green, anti-Gb3 antibody+2nd antibody. In the green histogram, the broad, far most right peak is considered as ‘Gb3++ cells’, containing high amounts of Gb3 at the cell surface. Cells to the left of this peak are considered to have relatively little or no surface Gb3. Percentages of Gb3++ cells are indicated above the region markers. The numbers in parentheses below the siRNA names indicate the mean fluorescence intensities of all cells. Histograms from one representative experiment out of three independent experiments are shown. Stx cell association is independent of TLR4-mediated signaling Because TLR4 is a signaling receptor, we wished to determine whether it was loss of TLR4-induced signaling, or alternatively, loss of the TLR4 protein itself that was important for the observed effect of TLR4 depletion on Stx cellular binding. For the former alternative to be possible, TLR4 signaling must be active in the control condition (in control siRNA-transfected cells). One possibility is that the transfection by itself could activate TLR4 signaling. It was reported recently that in addition to the transfection agents by themselves, siRNAs can nonspecifically and siRNA-sequence-independently induce the expression of inflammatory cytokines (Yoo et al., 2006). However, this did not seem to be the case under our conditions, because we did not observe any enhancement in the basal level of IL-8 secretion on comparing control siRNA-transfected cells with nontransfected cells (data not shown), nor did the TLR4 siRNA reduce the basal level of IL-8 secretion from SW480 cells (data not shown). Another possibility is that our Stx preparation contained contaminating lipopolysaccharide that would initiate TLR4 signaling in control cells, but not in TLR4-depleted cells. However, using two sensitive lipopolysaccharide detection assays, a Limulus amebocyte lysate assay (QCL-1000, Lonza) and an NFκB reporter assay in HEK293 cells expressing human TLR4, MD2, and CD14 (Yang et al., 2000; Latz et al., 2002), we could not detect any lipopolysaccharide in our Stx stock preparation (data not shown). In our experiments, these two assays showed sensitivity towards 0.25 EU mL−1 endotoxin (Limulus assay) and 0.1 ng mL−1 ultrapure lipopolysaccharide (NFκB reporter assay) (data not shown). As a third possibility, we considered whether Stx by itself could initiate TLR4-dependent signaling. However, as shown in Fig. 7a, Stx did not induce IL-8 secretion from SW480 cells, indicating that Stx did at least not activate the classical, MyD88-dependent TLR-mediated signaling cascade. Furthermore, Stx did not induce the secretion of interferon-β or IP-10, two downstream targets of the MyD88-independent signaling pathway (data not shown). Nevertheless, from this, we could not completely rule out the possibility that Stx could activate a partial TLR4-dependent signaling response important for its own cell association. Therefore, and because we observed that Stx did not interfere with the ability of lipopolysaccharide to signal (Fig. 7a), we next examined whether lipopolysaccharide-induced stimulation of TLR4-mediated signaling would affect Stx cell association. As shown in Fig. 7b, neither a 30-min pretreatment with lipopolysaccharide nor simultaneous treatment with lipopolysaccharide and biotin-Stx affected the cell association of biotin-Stx. Internalization of biotin-Stx and StxB-sulf2 sulfation were also unaffected by lipopolysaccharide (data not shown). We therefore concluded that TLR4-mediated signaling does not affect Stx cell association (nor its uptake and transport), and thus that the effect we observe upon TLR4 depletion is due to optimal Stx cell association being dependent on the TLR4 protein itself. Figure 7 View largeDownload slide Stx association to SW480 cells is independent of TLR4-mediated signaling. (a) Secretion of IL-8 in cells treated with lipopolysaccharide (25 ng mL−1) and/or Stx (10 ng mL−1). The figure shows the IL-8 secretion in treated cells relative to that in untreated control cells (medium) (mean values ± SEMs from four independent experiments). (b) Total cell-associated biotin-Stx with or without lipopolysaccharide stimulation. Biotin-Stx (10 ng mL−1) was either added alone (medium), or simultaneously with lipopolysaccharide (25 ng mL−1), or 30 min after lipopolysaccharide (preinc.). The total cell-associated biotin-Stx was quantified and presented as percent of that in cells treated with biotin-Stx alone (mean values ± SEMs from three independent experiments). Figure 7 View largeDownload slide Stx association to SW480 cells is independent of TLR4-mediated signaling. (a) Secretion of IL-8 in cells treated with lipopolysaccharide (25 ng mL−1) and/or Stx (10 ng mL−1). The figure shows the IL-8 secretion in treated cells relative to that in untreated control cells (medium) (mean values ± SEMs from four independent experiments). (b) Total cell-associated biotin-Stx with or without lipopolysaccharide stimulation. Biotin-Stx (10 ng mL−1) was either added alone (medium), or simultaneously with lipopolysaccharide (25 ng mL−1), or 30 min after lipopolysaccharide (preinc.). The total cell-associated biotin-Stx was quantified and presented as percent of that in cells treated with biotin-Stx alone (mean values ± SEMs from three independent experiments). TLR4 depletion inhibits the binding of Stx to primary human umbilical vein endothelial cells To examine whether TLR4 could potentially play a role in the pathophysiology of Stx-induced human disease, or whether the observed effect upon TLR4 depletion in the SW480 cell line was restricted to cancer cells, we wished to evaluate the effect of TLR4 depletion in a cell model that expresses both Gb3 and TLR4 under normal (nonmalignant) physiological conditions. Primary human umbilical vein endothelial cells (HUVECs) are used as a model for studying Stx-induced damage to Gb3-expressing endothelial cells, which is believed to be a major contributor to Stx-induced human disease. Many types of endothelial cells, including HUVECs, have been reported to express TLR4 (Talreja et al., 2004; Dauphinee & Karsan, 2006). When we transfected HUVECs with TLR4 siRNA for 48 h, TLR4 mRNA levels were reduced by ∼80% (Fig. 8a). Moreover, we observed a strong reduction in the total cell association of biotin-Stx in TLR4 siRNA-transfected cells (Fig. 8b). Furthermore, because the total cell association of biotin-Stx was reduced by ∼90% upon transfection with siRNA directed against Gb3 synthase (Fig. 8b), the association of HUVECs with biotin-Stx was evidently dependent on Gb3. The reduction observed in TLR4 siRNA-transfected cells (∼50%) was similar to that found in SW480 cells (∼30–50%). Furthermore, just like in SW480 cells, we did not observe a stronger reduction in the uptake of biotin-Stx than in the total cell association of biotin-Stx (data not shown), indicating that also in HUVECs, the uptake of Stx per se is not altered by TLR4 depletion. HUVECs expressed low levels of Gb3 at the cell surface, and too little StxB was transported to the Golgi to enable us to measure StxB sulfation. Thus, we could not evaluate whether the endosome-to-Golgi step could also be affected in HUVECs. In summary, HUVECs showed a strongly decreased association to Stx upon TLR4 depletion, indicating that TLR4 may be a determinant in the binding of Stx to endothelial cells. Figure 8 View largeDownload slide Cell association of Stx is reduced upon TLR4 depletion in HUVECs. (a) Real-time RT-PCR of TLR4 mRNA in HUVEC cells 48 h after siRNA transfection. The amount of TLR4 mRNA is presented as percent of that in control siRNA-transfected cells (mean value ± SEM from three independent experiments). (b) Total cell-associated Stx in HUVECs upon knockdown of TLR4 or Gb3 synthase. Transfected cells were incubated with biotin-Stx (250 ng mL−1) for 15 min at 37°C, and the amount of total cell-associated biotin-Stx was quantified as described in Materials and methods (mean values ± SEMs from four independent experiments). Figure 8 View largeDownload slide Cell association of Stx is reduced upon TLR4 depletion in HUVECs. (a) Real-time RT-PCR of TLR4 mRNA in HUVEC cells 48 h after siRNA transfection. The amount of TLR4 mRNA is presented as percent of that in control siRNA-transfected cells (mean value ± SEM from three independent experiments). (b) Total cell-associated Stx in HUVECs upon knockdown of TLR4 or Gb3 synthase. Transfected cells were incubated with biotin-Stx (250 ng mL−1) for 15 min at 37°C, and the amount of total cell-associated biotin-Stx was quantified as described in Materials and methods (mean values ± SEMs from four independent experiments). How does TLR4 facilitate Stx binding to cells? The elucidation of the exact mechanism(s) as to how TLR4 facilitates Stx binding to cells will be a subject of future studies. However, the results obtained in the present study provide some important clues. First of all, our data demonstrate that Stx binding to SW480 cells and HUVECs is strictly dependent on Gb3, because the siRNA-mediated depletion of Gb3 almost completely abolished the cellular association of Stx (Fig. 4 and Fig. 8b). We therefore consider Gb3 to be required for TLR4 to facilitate Stx binding. An interaction between Gb3 and TLR4 might enable Stx to bind directly to TLR4. However, Stx did not seem to activate TLR4, and TLR4 engagement by lipopolysaccharide, or the blocking anti-TLR4 antibody AF1478, did not affect Stx binding (Fig. 8b and data not shown). Thus, rather than Gb3 enabling Stx binding to TLR4, it seems more likely that the role of TLR4 is to facilitate Stx binding to Gb3. How could this be achieved, given our findings that the total cell surface level of Gb3 was unaltered upon TLR4 depletion? The interaction between Stx and Gb3 is complex and not completely understood. Each of the five B-chains in the StxB pentamer has three potential Gb3-binding sites, implying that one Stx molecule could simultaneously bind up to 15 Gb3s (Ling et al., 1998). Optimal interaction between Stx and Gb3 is postulated to involve a mixture of Gb3 species with different fatty acid chain lengths in their ceramide backbone moieties (Pallizzari et al., 1992), combined with an optimal organization of Gb3 species (Nyholm et al., 1996), as well as a favorable surrounding lipid environment in the plasma membrane itself (Arab & Lingwood, 1996). It is conceivable that TLR4 or a TLR4-associated molecule can alter such parameters via interactions with Stx/Gb3-associated molecules. Several molecules have been reported to associate with Gb3 or the Stx/Gb3 complex, including the death receptor Fas (Chakrabandhu et al., 2008), heat-shock protein 70 (Hsp70) (Gehrmann et al., 2008), the ABC drug transporter P-glycoprotein (De Rosa et al., 2008), the HIV-1 surface envelope glycoprotein gp120 (Mahfoud et al., 2002), as well as two unidentified 27- and 40-kDa molecules (Shimizu et al., 2003). Interestingly, several reports indicate a functional interplay between Hsp70 and TLR4 (Calderwood et al., 2007). Thus, Hsp70 might provide a possible link between the Stx/Gb3 complex and TLR4. Further work is required to elucidate the role of Stx/Gb3- and TLR4-associated molecules in cellular Stx binding. Concluding remarks In conclusion, we propose a role for TLR4 in facilitating Stx binding to Gb3 without affecting the total cell surface level of Gb3. Numerous possibilities exist as to how this can be achieved, and this will be a topic of future studies. Our results showing that the cellular association of Stx to primary HUVECs is strongly decreased upon TLR4 depletion indicate that TLR4 may be a determinant in Stx binding to endothelial cells, and thus that TLR4 could play an as yet unsuspected role in the pathophysiology of Stx-induced human disease. This is the first time that a TLR is demonstrated to be involved in cellular binding and intracellular transport of Stx. An interesting and open topic for future studies will be to determine whether the participation of TLR4 in Gb3-dependent binding of Stx is unique for TLR4 or whether other members of the TLR family may play similar roles. Interestingly, although TLR4 is known as a key component in the innate immune defense against gram-negative bacteria, the current and other studies suggest that the role played by TLR4 is not always beneficial to the host. Thus, it was shown recently that TLR4 can facilitate the translocation of uropathogenic E. coli across renal collecting duct cells (Chassin et al., 2008). Moreover, the pertussis toxin, secreted by Bordetella pertussis, has been reported to initiate intracellular signals through TLR4 and induce disease in a manner that is at least partly dependent on TLR4 (Kerfoot et al., 2004). Finally, lipopolysaccharide is postulated to play an etiological role in disease induced by Stx-producing bacteria, as lipopolysaccharide has been shown to augment the adverse affects of Stx in animal models (Yuhas et al., 1995; Siegler et al., 2001) as well as to enhance the expression of Gb3 and cytotoxicity of Stx in cultured cells (Obrig et al., 1993; Hughes et al., 2000; Stone et al., 2008). Of note, although it can be expected, it remains to be demonstrated whether these adverse effects of lipopolysaccharide are mediated by TLR4. Future studies will reveal the full role played by TLR4 in the pathophysiology of human diseases involving Stx and other pathogenic factors in the context of bacterial infections. Authors' contribution The authors Maria L. Torgersen and Nikolai Engedal contributed equally to this work. Acknowledgements We are grateful to Anne-Grethe Myrann for expert technical assistance. This work was supported by the Norwegian Cancer Society, the Norwegian Research Council for Science and the Humanities, the National Program for Research in Functional Genomics in Norway (FUGE) in the Research Council of Norway, and the Helse Sør-Øst, Norway. References Arab S. Lingwood C.A. ( 1996) Influence of phospholipid chain length on verotoxin/globotriaosyl ceramide binding in model membranes: comparison of a supported bilayer film and liposomes. Glycoconj J  13: 159– 166. Google Scholar CrossRef Search ADS PubMed  Bhattacharjee R.N. Park K.S. Okada K. Kumagai Y. Uematsu S. Takeuchi O. Akira S. Iida T. Honda T. ( 2005) Microarray analysis identifies apoptosis regulatory gene expression in HCT116 cells infected with thermostable direct hemolysin-deletion mutant of Vibrio parahaemolyticus. Biochem Bioph Res Co  335: 328– 334. Google Scholar CrossRef Search ADS   Calderwood S.K. Theriault J. Gray P.J. Gong J. ( 2007) Cell surface receptors for molecular chaperones. Methods  43: 199– 206. Google Scholar CrossRef Search ADS PubMed  Chakrabandhu K. Huault S. Garmy N. Fantini J. Stebe E. Mailfert S. Marguet D. Hueber A.O. ( 2008) The extracellular glycosphingolipid-binding motif of Fas defines its internalization route, mode and outcome of signals upon activation by ligand. Cell Death Differ  15: 1824– 1837. Google Scholar CrossRef Search ADS PubMed  Chassin C. Vimont S. Cluzeaud F. et al.   . ( 2008) TLR4 facilitates translocation of bacteria across renal collecting duct cells. J Am Soc Nephrol  19: 2364– 2374. Google Scholar CrossRef Search ADS PubMed  Dauphinee S.M. Karsan A. ( 2006) Lipopolysaccharide signaling in endothelial cells. Lab Invest  86: 9– 22. Google Scholar CrossRef Search ADS PubMed  De Rosa M.F. Ackerley C. Wang B. Ito S. Clarke D.M. Lingwood C. ( 2008) Inhibition of multidrug resistance by adamantylgb3, a globotriaosylceramide analog. J Biol Chem  283: 4501– 4511. Google Scholar CrossRef Search ADS PubMed  Engedal N. Skotland T. Torgersen M.L. Sandvig K. ( 2010) Shiga toxin and its use in targeted cancer therapy and imaging. Microbial Biotechnol , in press, DOI: https://doi.org/10.1111/j.1751-7915.2010.00180.x. Falguières T. Maak M. von Weyhern C. Sarr M. Sastre X. Poupon M.F. Robine S. Johannes L. Janssen K.P. ( 2008) Human colorectal tumors and metastases express Gb3 and can be targeted by an intestinal pathogen-based delivery tool. Mol Cancer Ther  7: 2498– 2508. Google Scholar CrossRef Search ADS PubMed  Farkas-Himsley H. Hill R. Rosen B. Arab S. Lingwood C.A. ( 1995) The bacterial colicin active against tumor cells in vitro and in vivo is verotoxin 1. P Natl Acad Sci USA  92: 6996– 7000. Google Scholar CrossRef Search ADS   Fischer H. Ellström P. Ekström K. Gustafsson L. Gustafsson M. Svanborg C. ( 2007) Ceramide as a TLR4 agonist; a putative signalling intermediate between sphingolipid receptors for microbial ligands and TLR4. Cell Microbiol  9: 1239– 1251. Google Scholar CrossRef Search ADS PubMed  Gehrmann M. Liebisch G. Schmitz G. Anderson R. Steinem C. De Maio A. Pockley G. Multhoff G. ( 2008) Tumor-specific Hsp70 plasma membrane localization is enabled by the glycosphingolipid Gb3. PLoS ONE  3: e1925. Google Scholar CrossRef Search ADS PubMed  Gribar S.C. Richardson W.M. Sodhi C.P. Hackam D.J. ( 2008) No longer an innocent bystander: epithelial toll-like receptor signaling in the development of mucosal inflammation. Mol Med  14: 645– 659. Google Scholar CrossRef Search ADS PubMed  Holmes E.H. Hakomori S. Ostrander G.K. ( 1987) Synthesis of type 1 and 2 lacto series glycolipid antigens in human colonic adenocarcinoma and derived cell lines is due to activation of a normally unexpressed beta 1–3N-acetylglucosaminyltransferase. J Biol Chem  262: 15649– 15658. Google Scholar PubMed  Huang B. Zhao J. Unkeless J.C. Feng Z.H. Xiong H. ( 2008) TLR signaling by tumor and immune cells: a double-edged sword. Oncogene  27: 218– 224. Google Scholar CrossRef Search ADS PubMed  Hughes A.K. Stricklett P.K. Schmid D. Kohan D.E. ( 2000) Cytotoxic effect of Shiga toxin-1 on human glomerular epithelial cells. Kidney Int  57: 2350– 2359. Google Scholar CrossRef Search ADS PubMed  Husebye H. Halaas Ø Stenmark H. Tunheim G. Sandanger Ø Bogen B. Brech A. Latz E. Espevik T. ( 2006) Endocytic pathways regulate Toll-like receptor 4 signaling and link innate and adaptive immunity. EMBO J  25: 683– 692. Google Scholar CrossRef Search ADS PubMed  Johannes L. Romer W. ( 2010) Shiga toxins — from cell biology to biomedical applications. Nat Rev Microbiol  8: 105– 116. Google Scholar PubMed  Kerfoot S.M. Long E.M. Hickey M.J. Andonegui G. Lapointe B.M. Zanardo R.C. Bonder C. James W.G. Robbins S.M. Kubes P. ( 2004) TLR4 contributes to disease-inducing mechanisms resulting in central nervous system autoimmune disease. J Immunol  173: 7070– 7077. Google Scholar CrossRef Search ADS PubMed  Khan F. Proulx F. Lingwood C.A. ( 2009) Detergent-resistant globotriaosyl ceramide may define verotoxin/glomeruli-restricted hemolytic uremic syndrome pathology. Kidney Int  75: 1209– 1216. Google Scholar CrossRef Search ADS PubMed  LaCasse E.C. Bray M.R. Patterson B. et al.   . ( 1999) Shiga-like toxin-1 receptor on human breast cancer, lymphoma, and myeloma and absence from CD34(+) hematopoietic stem cells: implications for ex vivo tumor purging and autologous stem cell transplantation. Blood  94: 2901– 2910. Google Scholar PubMed  Latz E. Visintin A. Lien E. Fitzgerald K.A. Monks B.G. Kurt-Jones E.A. Golenbock D.T. Espevik T. ( 2002) Lipopolysaccharide rapidly traffics to and from the Golgi apparatus with the toll-like receptor 4-MD-2-CD14 complex in a process that is distinct from the initiation of signal transduction. J Biol Chem  277: 47834– 47843. Google Scholar CrossRef Search ADS PubMed  Ling H. Boodhoo A. Hazes B. Cummings M.D. Armstrong G.D. Brunton J.L. Read R.J. ( 1998) Structure of the shiga-like toxin I B-pentamer complexed with an analogue of its receptor Gb3. Biochemistry  37: 1777– 1788. Google Scholar CrossRef Search ADS PubMed  Lingwood C.A. ( 1994) Verotoxin-binding in human renal sections. Nephron  66: 21– 28. Google Scholar CrossRef Search ADS PubMed  Lingwood C.A. ( 1999) Verotoxin/globotriaosyl ceramide recognition: angiopathy, angiogenesis and antineoplasia. Bioscience Rep  19: 345– 354. Google Scholar CrossRef Search ADS   Mahfoud R. Garmy N. Maresca M. Yahi N. Puigserver A. Fantini J. ( 2002) Identification of a common sphingolipid-binding domain in Alzheimer, prion, and HIV-1 proteins. J Biol Chem  277: 11292– 11296. Google Scholar CrossRef Search ADS PubMed  Mangeney M. Richard Y. Coulaud D. Tursz T. Wiels J. ( 1991) CD77: an antigen of germinal center B cells entering apoptosis. Eur J Immunol  21: 1131– 1140. Google Scholar CrossRef Search ADS PubMed  Miyamoto Y. Iimura M. Kaper J.B. Torres A.G. Kagnoff M.F. ( 2006) Role of shiga toxin versus H7 flagellin in enterohaemorrhagic Escherichia coli signalling of human colon epithelium in vivo. Cell Microbiol  8: 869– 879. Google Scholar CrossRef Search ADS PubMed  Nyholm P.G. Magnusson G. Zheng Z. Norel R. Binnington-Boyd B. Lingwood C.A. ( 1996) Two distinct binding sites for globotriaosyl ceramide on verotoxins: identification by molecular modelling and confirmation using deoxy analogues and a new glycolipid receptor for all verotoxins. Chem Biol  3: 263– 275. Google Scholar CrossRef Search ADS PubMed  Obata F. Tohyama K. Bonev A.D. Kolling G.L. Keepers T.R. Gross L.K. Nelson M.T. Sato S. Obrig T.G. ( 2008) Shiga toxin 2 affects the central nervous system through receptor globotriaosylceramide localized to neurons. J Infect Dis  198: 1398– 1406. Google Scholar CrossRef Search ADS PubMed  Obrig T.G. Louise C.B. Lingwood C.A. Boyd B. Barley-Maloney L. Daniel T.O. ( 1993) Endothelial heterogeneity in Shiga toxin receptors and responses. J Biol Chem  268: 15484– 15488. Google Scholar PubMed  Otte J.M. Cario E. Podolsky D.K. ( 2004) Mechanisms of cross hyporesponsiveness to Toll-like receptor bacterial ligands in intestinal epithelial cells. Gastroenterology  126: 1054– 1070. Google Scholar CrossRef Search ADS PubMed  Pellizzari A. Pang H. Lingwood C.A. ( 1992) Binding of verocytotoxin 1 to its receptor is influenced by differences in receptor fatty acid content. Biochemistry  31: 1363– 1370. Google Scholar CrossRef Search ADS PubMed  Sandvig K. Garred Ø Prydz K. Kozlov J.V. Hansen S.H. van Deurs B. ( 1992) Retrograde transport of endocytosed Shiga toxin to the endoplasmic reticulum. Nature  358: 510– 512. Google Scholar CrossRef Search ADS PubMed  Sandvig K. Bergan J. Dyve A.B. Skotland T. Torgersen M.L. ( 2010) Endocytosis and retrograde transport of Shiga toxin. Toxicon  58: 1181– 1185. Google Scholar CrossRef Search ADS   Sandvig K. Torgersen M.L. Engedal N. Skotland T. Iversen T.G. ( 2010) Protein toxins from plants and bacteria: probes for intracellular transport and tools in medicine. FEBS Lett  584: 2626– 2634. Google Scholar CrossRef Search ADS PubMed  Schuller S. Heuschkel R. Torrente F. Kaper J.B. Phillips A.D. ( 2007) Shiga toxin binding in normal and inflamed human intestinal mucosa. Microbes Infect  9: 35– 39. Google Scholar CrossRef Search ADS PubMed  Shimizu T. Hamabata T. Yoshiki A. Hori T. Ito S. Takeda Y. Hayashi H. ( 2003) An association of 27- and 40-kDa molecules with glycolipids that bind A-B bacterial enterotoxins to cultured cells. Biochim Biophys Acta  1612: 186– 194. Google Scholar CrossRef Search ADS PubMed  Siegler R.L. Pysher T.J. Lou R. Tesh V.L. Taylor F.B. Jr ( 2001) Response to shiga toxin-1, with and without lipopolysaccharide, in a primate model of hemolytic uremic syndrome. Am J Nephrol  21: 420– 425. Google Scholar CrossRef Search ADS PubMed  Simiantonaki N. Kurzik-Dumke U. Karyofylli G. Jayasinghe C. Michel-Schmidt R. Kirkpatrick C.J. ( 2007) Reduced expression of TLR4 is associated with the metastatic status of human colorectal cancer. Int J Mol Med  20: 21– 29. Google Scholar PubMed  Stone M.K. Kolling G.L. Lindner M.H. Obrig T.G. ( 2008) p38 mitogen-activated protein kinase mediates lipopolysaccharide and tumor necrosis factor alpha induction of shiga toxin 2 sensitivity in human umbilical vein endothelial cells. Infect Immun  76: 1115– 1121. Google Scholar CrossRef Search ADS PubMed  Suzuki M. Hisamatsu T. Podolsky D.K. ( 2003) Gamma interferon augments the intracellular pathway for lipopolysaccharide (LPS) recognition in human intestinal epithelial cells through coordinated up-regulation of LPS uptake and expression of the intracellular Toll-like receptor 4-MD-2 complex. Infect Immun  71: 3503– 3511. Google Scholar CrossRef Search ADS PubMed  Talreja J. Kabir M.H. Filla B. Stechschulte D.J. Dileepan K.N. ( 2004) Histamine induces toll-like receptor 2 and 4 expression in endothelial cells and enhances sensitivity to Gram-positive and Gram-negative bacterial cell wall components. Immunology  113: 224– 233. Google Scholar CrossRef Search ADS PubMed  Tarrago-Trani M.T. Storrie B. ( 2007) Alternate routes for drug delivery to the cell interior: pathways to the Golgi apparatus and endoplasmic reticulum. Adv Drug Deliver Rev  59: 782– 797. Google Scholar CrossRef Search ADS   Torgersen M.L. Wälchli S. Grimmer S. Skånland S.S. Sandvig K. ( 2007) Protein kinase C delta is activated by Shiga toxin and regulates its transport. J Biol Chem  282: 16317– 16328. Google Scholar CrossRef Search ADS PubMed  van de Kar N.C. Monnens L.A. Karmali M.A. van Hinsbergh V.W. ( 1992) Tumor necrosis factor and interleukin-1 induce expression of the verocytotoxin receptor globotriaosylceramide on human endothelial cells: implications for the pathogenesis of the hemolytic uremic syndrome. Blood  80: 2755– 2764. Google Scholar PubMed  van Setten P.A. van Hinsbergh V.W. van der Velden T.J. van de Kar N.C. Vermeer M. Mahan J.D. Assmann K.J. van Den Heuvel L.P. Monnens L.A. ( 1997) Effects of TNF alpha on verocytotoxin cytotoxicity in purified human glomerular microvascular endothelial cells. Kidney Int  51: 1245– 1256. Google Scholar CrossRef Search ADS PubMed  Yang H. Young D.W. Gusovsky F. Chow J.C. ( 2000) Cellular events mediated by lipopolysaccharide-stimulated toll-like receptor 4. MD-2 is required for activation of mitogen-activated protein kinases and Elk-1. J Biol Chem  275: 20861– 20866. Google Scholar CrossRef Search ADS PubMed  Yoo J.W. Hong S.W. Kim S. Lee D.K. ( 2006) Inflammatory cytokine induction by siRNAs is cell type- and transfection reagent-specific. Biochem Bioph Res Co  347: 1053– 1058. Google Scholar CrossRef Search ADS   Yuhas Y. Weizman A. Dinari G. Ashkenazi S. ( 1995) An animal model for the study of neurotoxicity of bacterial products and application of the model to demonstrate that Shiga toxin and lipopolysaccharide cooperate in inducing neurologic disorders. J Infect Dis  171: 1244– 1249. Google Scholar CrossRef Search ADS PubMed  Zhao L. Kwon M.J. Huang S. Lee J.Y. Fukase K. Inohara N. Hwang D.H. ( 2007) Differential modulation of Nods signaling pathways by fatty acids in human colonic epithelial HCT116 cells. J Biol Chem  282: 11618– 11628. Google Scholar CrossRef Search ADS PubMed  Zhou M. Farland-Mancini M.M. Funk H.M. Husseinzadeh N. Mounajjed T. Drew A.F. ( 2009) Toll-like receptor expression in normal ovary and ovarian tumors. Cancer Immunol Immun  58: 1375– 1385. Google Scholar CrossRef Search ADS   © 2010 Federation of European Microbiological Societies
TI - Toll-like receptor 4 facilitates binding of Shiga toxin to colon carcinoma and primary umbilical vein endothelial cells
JF - Journal of the Endocrine Society
DO - 10.1111/j.1574-695X.2010.00749.x
DA - 2011-02-01
UR - https://www.deepdyve.com/lp/oxford-university-press/toll-like-receptor-4-facilitates-binding-of-shiga-toxin-to-colon-ugZTA8qb6J
SP - 63
EP - 75
VL - 61
IS - 1
DP - DeepDyve
ER -