TY - JOUR
AU - Zheng,, Jing
AB - Abstract Fine particulate matter (PM2.5) in the ambient atmosphere is strongly associated with detrimental health effects. However, these particles from various sources and regions are unlikely equally toxic. While animal studies are impractical for high-throughput toxicity testing, appropriate in vitro models are urgently needed. Co-culture of A549 and THP-1 macrophages grown at air–liquid interface (ALI) or under submerged conditions was exposed to same concentrations of ambient PM2.5 to provide accurate comparisons between culture methods. Following 24-h incubation with PM2.5 collected in Harbin in China, biological endpoints being investigated include cytotoxicity, reactive oxygen species (ROS) levels and pro-inflammatory mediators. The co-culture grown under submerged condition demonstrated a significant increase in ROS levels and all tested pro-inflammatory indicators [interleukin (IL)-1β, IL-6, IL-8 and tumor necrosis factor-α] in mRNA expression and released protein levels. Similar but a declining response trend was observed using the same PM2.5 incubation after grown at ALI. We further observed a significant increase of PM2.5-induced phosphorylation of p38 MAPK and activation of NF-κB p65 in a dose-dependent trend for co-cultures grown under submerged condition. These results provide important implications that culture conditions (ALI versus submerged) can induce different extents of biological responses to ambient PM2.5; the co-culture grown at ALI is less likely to produce false-positive results than submerged culture. Hence, culture conditions should be discussed when comparing in vitro methods used for high-throughput PM2.5 toxicity assessment in future. fine particulate matter (PM2.5), air–liquid interface (ALI), submerged culture, co-culture model, in vitro toxicity Introduction Epidemiological investigations have reported that short-term exposure to different sources of ambient fine particulate matter (PM2.5) is associated with increased mortality or hospitalizations for respiratory diseases, and the development of severe systemic diseases [1–3]. Currently, it has been testified that PM2.5 can induce respiratory injury depending on in vivo and in vitro experimentation. However, ambient particles from different sources and regions have different potential toxic characterization. Thus, animal studies are impractical for high-throughput toxicity testing. Moreover, regarding 3Rs (refinements, reduction and replacement) principles, physiology-related in vitro respiratory models and in vitro simulation of inhaled particle exposure should be developed and improved to investigate the toxicological processes underlying ambient PM2.5-associated effects. When investigating PM2.5 toxicity, some crucial parameters should be considered to accomplish predicting human-relevant health outcomes. Starting with employing standardized protocols to prepare a well-characterized particulate matter, for PM2.5, resuspension is still the most commonly used method. In addition, it is critical to choose system and dose, which can mimic human real exposure conditions. PM2.5 is fine enough to reach alveolar surface; thus, the most suitable cell types to study the potential pulmonary toxicity of PM2.5 include alveolar macrophages and alveolar epithelial type I and type II cells. These cells play key roles in engulfing foreign particles, gas exchange and secreting lung surfactants. To increase human relevance in in vitro models, NCI-H441 (type I-like alveolar epithelial cells) and A549 (type II-like alveolar epithelial cells) have been used frequently in monocultures or in complex co-culture models to evaluate fine particle-induced pulmonary toxicity [4, 5]. Although monoculture models may be used to investigate the potential toxicity of PM2.5 under some experimental conditions, but the intricate interaction that exists between different cell types in vivo when exposure to inhaled particles cannot be accurately represented by a single cell type. Thus, various studies suggest that co-culture or tri-culture is more suitable to mimic in vivo complex physiological responses [6]. Additionally, respiratory cells could not differentiate under conventional submerged culture conditions, which is often utilized for monocultures and sometimes for co-cultures in previous studies. Hence, air–liquid interface (ALI) culture systems have recently been introduced to allow respiratory cells to differentiate and secrete surfactants in in vitro culture conditions. Also, ALI has been used in exposure systems to mimic more realistically the exposure conditions during particle inhalation [7–10]. Until now, lots of progress has been made in establishing physiology-related in vitro models of the respiratory system to simulate inhaled particle exposure in vivo. But the limitation present is that complex and expensive special-designed equipment are needed in the ALI exposure systems. Therefore, it is unrealistic for toxicity testing of various concentration of ambient PM2.5 evaluating by different labs with advanced ALI exposure methods. That means the research field of particle toxicity still lack relevant universal in vitro models to accurately evaluate the biological effects observed in vivo after respiratory exposure. For the evaluation of airborne substances, A549 cell line represents a prominent cell model [11, 12]. They are preferentially used in cytotoxicity testing due to their expression of some main drug-metabolizing enzymes of the lung and secretion of important cytokines [13]. Compared with conventional culture, ALI culture of A549 induced accumulation of pulmonary surfactant, although without functional tight junctions [14]. Furthermore, our previous study has shown that co-culture of A549 and THP-1 macrophages was more sensitive than A549 monocultures in investigating PM2.5 cytotoxicity [15]. Other researchers have also reported that co-culture of alveolar A549 cells and THP-1 macrophages was used to mimic cell–cell interactions and communications of complex alveolar structure, which play a crucial role in the mechanisms of defense against particles [16, 17]. Despite the prospective ALI exposure system that has been introduced, such a system has some limitations that restrict its use for high-throughput screening of various PM2.5 and for universal use in the majority of labs. Transcription factor nuclear factor kappa B (NF-κB) pathway typically consists of the p50/p65 dimer and is considered to be a redox-sensitive transcriptional factor, which involves the transcriptional regulator of pro-inflammatory responses [18]. Moreover, previous studies have shown that p38 mitogen-activated protein kinase (MAPK), extracellular signal-regulated kinase-1 and -2 (ERK1/2) and the c-Jun-N-terminal kinase (JNK) pathway are activated by cellular stress [19, 20]. Ambient exposure to PM2.5 can cause diverse biological responses on different pulmonary cell types. Most studies support that oxidative stress may play a key role in inducing pulmonary cell injury. PM2.5-induced increasing of pro-inflammatory cytokines, such as interleukin-6 (IL-6), IL-1β and tumor necrosis factor (TNF)-α, may involve relatively complicated reactive oxygen species (ROS) signaling networks [21–23]. Actually, the activation of MAPKs and NF-κB has been observed as a response to most of the respirable particles [24]. Additionally, matrix metalloproteinases (MMPs) play important roles in the pathologic processes of several respiratory diseases via inducing tissue remodeling. In non-small cell lung cancer cells, it is observed that the activation of p38 MAPK and NF-κB pathways induced the overproduction of inflammatory and/or metastatic molecules, including TNF-α and MMPs [25, 26]. In this study, we hypothesize that culture methods employed in the co-culture of alveolar epithelial cells (A549) and macrophages (THP-1) would significantly affect cellular response to PM2.5. To test our hypothesis, we evaluated if exposing co-cultured cells at ALI condition to PM2.5 suspensions generates different toxicity patterns and/or biological response levels compared to traditional submerged co-cultures to the same suspensions. Ambient PM2.5 collected from an urban area of Harbin city in northeast China was used for experiments. The major source of PM2.5 was the emissions of coal combustion since it was collected in Winter coal heating season. An exposure system was set up using transwell system to expose pulmonary cells after ALI cultures or submerged cultures to PM2.5 suspensions in inserts to provide accurate comparisons between the two methods. Considering the process of biological activation induced by particles, one of the most widely accepted opinion supports that oxidative stress-mediated pro-inflammation and the activation of redox-sensitive transcription factors should be involved. Meanwhile, pro-inflammatory responses have also been recognized to be the most sensitive biological response for particle toxicity [6, 27, 28]. Hence, the cellular response (cell viability, oxidative stress and inflammation) was assessed at 24 h, and comparisons of the PM2.5 toxicities between culture methods were performed. The dose-dependent cellular responses of the co-cultured cells grown at ALI following PM2.5 suspension exposure were compared with co-cultured cells submerged in media. Based on the culture-specific in vitro toxicity information, we deduced corresponding lowest observed adverse effect levels (LOAELs) and listed our data with other published studies, which also investigated the difference of biological sensitivity between submerged and ALI culture or exposure methods. Furthermore, we used the more sensitive co-culture model to discuss if ROS-dependent activation of MAPK and downstream NF-κB signaling pathways was involved in PM2.5-induced biological effects, and MMP-9 expression was measured upon PM2.5 treatment. Materials and Methods Particles sampling and preparation of suspensions The method was similar with our previous reports except using a different sampling machine and collecting from a different city [15, 29]. Briefly, fine particles sampled with an air sampler (KC-120H, Qingdao, China) were collected onto glass fiber filters (Laoshan Mountain Electronic Instrument Factory CO., LTD, China) in November 2016 in urban area of Harbin city, China. The sampling site was placed on the roof of school research building (~20 m above the ground level) at Harbin Medical University. The collected filter samples were kept at −20°C until chemical analysis or retracted for toxicity studies. The extracted material was quickly frozen, dried by lyophilizer and then stored at −80°C for the following studies. When exposing cells to PM2.5 suspension, we firstly used sterile distilled water to reconstituted extracts to obtain a concentration of 1 mg/ml and then diluted in culture medium to achieve designed treatment doses. Chemical elements in ambient fine particles Filter sample was acid digested and then the extracts were used to analyze elemental and ionic analyses in fine particles. An inductively coupled plasma-optical emission spectroscopy (ICP-OES) instrument (Leeman Prodigy, USA) was used to determine the concentrations of trace elements. Meanwhile, ion chromatograph (Metrohm, Switzerland) was used to characterize the ion components. Cell culture and preparation of co-culture systems Human A549 alveolar epithelial cells and THP-1 cell lines were kindly provided by Dr Jing Bai (Harbin Medical University, Harbin, China). These two types of cells were routinely maintained in RPMI 1640 (Hyclone, Logan, UT) supplemented with 10% FBS (Biological Industries, Kibbutz Beit-Haemek, Israel) and 1% penicillin–streptomycin at 37°C in an incubator, which sustained a humidified mixture of 5% CO2 and 95% air. Before using THP-1 cells to establish co-culture models, THP-1 cells were induced to adherent macrophages by incubating with 100 ng/ml of phorbol myristate acetate (PMA, Sigma–Aldrich, Ref. P1585) in culture flasks for 48 h. Co-culture at ALI condition Transwell plate (PET membrane, 0.4 μm pore-size, corning, USA) was used to establish the co-culture systems. A549 cells (1 × 105 cells/apical) were seeded in the insert with 0.5 ml culture medium and another 1.5 ml medium in the basal chamber and grown for 48 h until confluence. Meanwhile, THP-1 cells were induced by PMA to differentiate into mature macrophage-like cells. Two days prior exposure, the differentiated THP-1 cells were seeded on the A549 cells with a ratio of 10 A549 cells to 1 THP-1 cell calculating based on the exposure time. Eight hours after seeding, apical media were removed to allow A549 differentiation and form surfactant at ALI condition for 40 h before PM2.5 exposure. In inserts, 4 days after A549 seeding, co-culture of A549 cells and THP-1 macrophages was exposed to 0.35 ml PM2.5 suspensions (20, 60 and 180 μg/ml diluted in 1% FBS culture medium) in inserts for 24 h (Fig. 1A). Figure 1 Open in new tabDownload slide Co-culture models grown under ALI and submerged conditions. Co-culture at ALI condition (A). Co-culture under submerged condition (B). Figure 1 Open in new tabDownload slide Co-culture models grown under ALI and submerged conditions. Co-culture at ALI condition (A). Co-culture under submerged condition (B). Co-culture under submerged condition For submerged co-cultures, A549 cells were seeded in the insert using the same amount and culture medium with ALI culture. Differentiated THP-1 macrophages were seeded on A549 cells 8 h before exposure to achieve a ratio of 10 A549 cells to 1 THP-1 macrophages. In inserts, 4 days after A549 seeding, the co-cultures were exposed to 0.35 ml PM2.5 suspensions in insert media containing 1% FBS with various concentrations of 20, 60 and 180 μg/ml for 24 h (Fig. 1B). Biological response assessment Transepithelial electrical resistance measurement Transepithelial electrical resistance (TEER) measurement (Ω.cm2) was performed to characterize the barrier function of the different culture conditions. Daily TEER experiments were performed under both culture conditions with a Millicell-ERS System (MERS 000 01; Millipore AG, Volketswil, Switzerland). The specific measuring and calculation method was described in our previous study [15]. Dichlorofluorescein assay The level of intracellular ROS generation was determined by using a dichlorodihydrofluorescein diacetate (DCFDA) assay. After 24 h of PM2.5 exposure, the apical culture medium was removed in some inserts, 1 μl of H2O2 (50 mg/ml) in PBS was added and the cells were incubated for 10 min to be used for positive controls. Afterwards, all exposed cells were washed with PBS. Then, the cells were incubated with 10 μM of a DCFDA probe (Beyotime Institute of Biotechnology, Shanghai, China) in culture medium without FBS (0.5 ml/insert) for 25 min at 37°C in the incubator. Subsequently, the cells were washed with PBS and scraped; the scraped contents were recovered in tubes and then centrifuged at 4°C for 5 min. The tube contents were transferred into black 96-well plates and the fluorescence of the samples was read (excitation: 488 nm, emission: 525 nm) using a spectrophotometer (Synergy H1, BioTek, USA). The values of each sample were showed in percentage of intracellular ROS compared to their respective controls. C‌CK-8 assay Co-cultured cells in the apical side were treated with 20, 60 and 180 μg/ml of PM2.5 for 24 h, respectively. Cell viability as a parameter of toxicity was determined by measuring the mitochondrial activity using the CCK-8 kit (Saint-Bio, Shanghai, China) according to the manual. After 24-h exposure, inserts were moved into new 12-well plates with 1.5 ml growth medium per well and 0.5 ml CCK-8 solution (diluted 1:4 in culture medium) was added to each insert and incubated for 1 h. Then, 100 μl of the supernatant was transferred to a 96-well plate, and triplicates were done for each well. Absorbance was measured at 450 nm using the plate reader (Synergy H1, BioTek, USA) and absorbance of 650 nm was also measured as a reference wavelength. LDH assay Lactate dehydrogenase (LDH) is a commonly used marker of membrane integrity and serves as a proxy for viability and cytotoxicity. We measured the release of intracellular LDH into culture medium. Culture medium from apical and basal sides retrieved after 24-h exposure to PM2.5 suspensions was pooled to evaluate the cell integrity. Before detecting LDH levels, the collected culture medium at both sides was centrifuged at 3000 r.p.m. for 5 min to remove PM2.5. A commercially available kit (Beyotime Institute of Biotechnology, Shanghai, China) was used according to the supplier manual. Quantification of pro-inflammatory mediators by enzyme-linked immunosorbent assay Inflammatory response was evaluated by quantification of IL-1β, IL-6, IL-8 and TNF-α in apical medium with enzyme-linked immunosorbent assay (ELISA) assay kits (Invitrogen, Thermo Fisher Scientific, CA, USA). Absorbance was measured according to the supplier procedure using a microplate reader (Synergy H1, BioTek, VT, USA). The mediators’ concentrations were calculated as pg/ml. mRNA expression analysis by quantitative real-time polymerase chain reaction After 24-h exposure to various concentrations of PM2.5 or culture medium, total RNA was extracted from co-cultured cells using RNAzol. cDNA was synthesized using 0.5 μg RNA with the GoScript™ Reverse Transcription System kit (Promega Corporation, WI, USA). Primers for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), IL-1β, IL-6, IL-8, TNF-α and MMP-9 are shown in Table 1. The details of performing quantitative real-time polymerase chain reaction (PCR) have been described as previously reported [15]. Values were obtained from the threshold cycle (Ct) number. The relative target gene mRNA levels were calculated using the equation 2−ΔΔCt, where ΔΔCt = ΔCt target gene − ΔCt GAPDH. Data represent the ratio between treatment and corresponding controls. Table 1 Primer sequences used in qPCR Gene . Forward (5′ to >3′) . Reverse (5′ to >3′) . GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC TNF-α GAGGCCAAGCCCTGGTATG CGGGCCGATTGATCTCAGC MMP-9 TGTACCGCTATGGTTACACTCG GGCAGGGACAGTTGCTTCT Gene . Forward (5′ to >3′) . Reverse (5′ to >3′) . GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC TNF-α GAGGCCAAGCCCTGGTATG CGGGCCGATTGATCTCAGC MMP-9 TGTACCGCTATGGTTACACTCG GGCAGGGACAGTTGCTTCT Open in new tab Table 1 Primer sequences used in qPCR Gene . Forward (5′ to >3′) . Reverse (5′ to >3′) . GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC TNF-α GAGGCCAAGCCCTGGTATG CGGGCCGATTGATCTCAGC MMP-9 TGTACCGCTATGGTTACACTCG GGCAGGGACAGTTGCTTCT Gene . Forward (5′ to >3′) . Reverse (5′ to >3′) . GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC TNF-α GAGGCCAAGCCCTGGTATG CGGGCCGATTGATCTCAGC MMP-9 TGTACCGCTATGGTTACACTCG GGCAGGGACAGTTGCTTCT Open in new tab Western blotting After 24-h exposure, cell culture supernatants from apical and basal sides of transwell system were removed and the inserts were immediately rinsed with ice-cold PBS, and cells were stored at −80°C until further processing. Frozen cells were thawed, lysed and harvested using centrifugation at 8000 r.p.m. for 10 min at 4°C. The protein levels of p38, p-p38, NF-κB p65 and p-NF-κB p65 were determined by western blotting. Protein content was determined using the BCA protein assay kit (Wanleibio, Shenyang, China). 20 μg of each sample was resolved on a SDS-10% PAGE and transferred onto a Polyvinylidene Fluoride (PVDF) membrane (Millipore, Billerica, USA). The PVDF membranes were washed with TBST (20 mM Tris–HCl, 150 mM NaCl and 0.1% Tween 20) for 5 min and then blocked in TBST containing 5% non-fat milk at room temperature for 1 h. After washing four times with TBST, the membranes were incubated overnight at 4°C with primary antibodies (anti-p38 MAPK, anti-phospho-p38 MAPK, anti-NF-κB p65, anti-phospho-NF-κB p65, anti-MMP-9), diluted (1:500) and then continued to be washed four times followed by incubating with secondary goat anti-rabbit HRP-conjugated antibodies (1:5000) for 45 min at 37°C. All primary and secondary antibodies were purchased from Wanleibio, Shenyang, China. Immunoreactive bands were detected with ECL reagents (Millipore, Billerica, USA) following the manufacturer’s protocol. β-actin was used as loading controls to ensure equal loading of total protein for each sample. The intensity of specific bands was determined and quantitated by the image analyzer. Statistical analysis The significance was performed by means of analysis of variance followed by Bonferroni’s post hoc test using GraphPad Prism 5.0 (GraphPad Software Inc., San Diego, CA). All the data were expressed as mean ± SE. A P value <0.05 was considered to be statistically significant. Results PM2.5 characteristics The compositions of ambient PM2.5 used in this study are summarized in Table 2. Obviously, the major metal elements were Na (7837 μg/g), K (974 μg/g), Ca (753 μg/g), Al (461 μg/g), B (332 μg/g), Ga (259 μg/g), Zn (243 μg/g) and Fe (222 μg/g), and the major ions were Cl− (2231 μg/g), SO42− (664 μg/g) and NO3− (652 μg/g); besides these major elements and ions, other components like Si, Mg, Sn, P, Cu, Cr, As, Pb and Mn were also found in this ambient PM2.5. Table 2 Trace elements and inorganic ions composition of Harbin PM2.5 Trace elements (μg/g) . Inorganic ions (μg/g) . Al 461 Cl− 2231 As 13 NO3− 652 B 332 SO42− 664 Ba 131 NH4+ 35 Cr 24 Cu 26 Fe 222 Ga 259 Mn 8 Ni 4 Pb 11 Sb 11 Sn 89 Ti 36 Zn 243 K 974 P 88 Nb 7 Zr 5 Si 127 Ca 753 Na 7837 Mg 96 Trace elements (μg/g) . Inorganic ions (μg/g) . Al 461 Cl− 2231 As 13 NO3− 652 B 332 SO42− 664 Ba 131 NH4+ 35 Cr 24 Cu 26 Fe 222 Ga 259 Mn 8 Ni 4 Pb 11 Sb 11 Sn 89 Ti 36 Zn 243 K 974 P 88 Nb 7 Zr 5 Si 127 Ca 753 Na 7837 Mg 96 Open in new tab Table 2 Trace elements and inorganic ions composition of Harbin PM2.5 Trace elements (μg/g) . Inorganic ions (μg/g) . Al 461 Cl− 2231 As 13 NO3− 652 B 332 SO42− 664 Ba 131 NH4+ 35 Cr 24 Cu 26 Fe 222 Ga 259 Mn 8 Ni 4 Pb 11 Sb 11 Sn 89 Ti 36 Zn 243 K 974 P 88 Nb 7 Zr 5 Si 127 Ca 753 Na 7837 Mg 96 Trace elements (μg/g) . Inorganic ions (μg/g) . Al 461 Cl− 2231 As 13 NO3− 652 B 332 SO42− 664 Ba 131 NH4+ 35 Cr 24 Cu 26 Fe 222 Ga 259 Mn 8 Ni 4 Pb 11 Sb 11 Sn 89 Ti 36 Zn 243 K 974 P 88 Nb 7 Zr 5 Si 127 Ca 753 Na 7837 Mg 96 Open in new tab Biological activity of the cells Effects of PM2.5 exposure on cell viability and cytotoxicity Co-culture of A549 plus THP-1 macrophages after grown at ALI and submerged conditions was exposed to PM2.5 suspensions. In order to compare the two experimental approaches, culture period and PM2.5 suspension concentrations were kept identical between ALI and submerged growth experiments. Overall, for co-cultures after 24-h exposure to various concentration of PM2.5, no significant decreases in cell viability (CCK-8) were observed in both culture conditions (P > 0.05). High-dose (180 μg/ml) exposure resulted in the lowest cell viability of 89.3 and 86.7% in co-cultures grown under ALI and submerged conditions, respectively (Fig. 2A). Thus, relative to growth at ALI, submerged cells showed a slightly pronounced response to the same concentration of PM2.5. Figure 2 Open in new tabDownload slide Cell viability and LDH levels at 24-h post-exposure of ambient PM2.5. Co-cultures (A549 + THP-1) were exposed to suspension of ambient PM2.5 for 24 h after grown under ALI and submerged conditions. Three dose levels (20, 60 and 180 μg/ml) were used. No significant changes for cell viability were observed in the response to PM2.5 exposure for both culture methods (A). There was a significant increase in LDH level after exposure of submerged cells only (B). The results are expressed as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding medium of unexposed co-cultured cells: *P < 0.05. Figure 2 Open in new tabDownload slide Cell viability and LDH levels at 24-h post-exposure of ambient PM2.5. Co-cultures (A549 + THP-1) were exposed to suspension of ambient PM2.5 for 24 h after grown under ALI and submerged conditions. Three dose levels (20, 60 and 180 μg/ml) were used. No significant changes for cell viability were observed in the response to PM2.5 exposure for both culture methods (A). There was a significant increase in LDH level after exposure of submerged cells only (B). The results are expressed as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding medium of unexposed co-cultured cells: *P < 0.05. Release of LDH is a marker for cell integrity. We used this indicator to assess the cytotoxic potential after exposing co-culture of A549 and THP-1 to PM2.5. Although a concentration-dependent increase tendency of LDH release was observed in co-cultures grown at ALI, no statistical significance was observed relative to the control (P > 0.05), even at the high dose (180 μg/ml), which is ~1.2-fold higher than corresponding non-stimulated cells. LDH levels for co-cultures grown in submerged medium after 24-h exposure showed similar concentration-related increase tendency with ALI condition, while high dose induced a significant increase, nearly 1.4-fold higher than the corresponding control (P < 0.05) (Fig. 2B). Epithelial barrier integrity According to our previous study, the TEER values of A549 and THP-1 co-cultures consistently increased for the first 4 days and reached a maximum [15]. Afterwards, the TEER value maintained stable for another 3–4 days. Therefore, in this study, we allowed the co-cultures grown at ALI or submerged conditions for 4 days following 24-h exposure to various concentration of PM2.5. TEER values were daily measured from 2 days after seeding A549 to Day 4. Subsequently, we continued to monitor TEER right before and after PM2.5 exposure (Day 5). As shown in Fig. 3, A549 co-cultured with THP-1 macrophages showed similar resistance values between 15 and 50 Ω.cm2 under both culture conditions. Even after PM2.5 exposure, we still did not observe any significant changes in TEER values irrespective of exposure doses under both culture conditions (P > 0.05) (Fig. 3). This indicated that the culture strategies we used did not lead to an alteration in barrier integrity. Figure 3 Open in new tabDownload slide Barrier function assessment of co-culture of A549 and THP-1 macrophages via TEER measurement. Data are shown as mean ± SE of three independent experiments with three replicates in each. Figure 3 Open in new tabDownload slide Barrier function assessment of co-culture of A549 and THP-1 macrophages via TEER measurement. Data are shown as mean ± SE of three independent experiments with three replicates in each. Oxidative stress Intracellular ROS levels were examined after 24-h exposure. We observed ROS values significantly increased at medium and high doses of PM2.5 (60 and 180 μg/ml) for submerged culture grown in medium. As for co-cultures grown at ALI with PM2.5 treatment, a significant increase was observed only at high dose, compared to respectively unexposed co-cultures (P < 0.05) (Fig. 4). Figure 4 Open in new tabDownload slide Intracellular ROS levels of co-culture of A549 and THP-1 macrophages exposed to PM2.5 after grown under ALI and submerged conditions. Data are shown as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding unexposed co-cultured cells: *P < 0.05, **P < 0.01. Figure 4 Open in new tabDownload slide Intracellular ROS levels of co-culture of A549 and THP-1 macrophages exposed to PM2.5 after grown under ALI and submerged conditions. Data are shown as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding unexposed co-cultured cells: *P < 0.05, **P < 0.01. Inflammatory responses The release of pro-inflammatory mediators (IL-1β, IL-6, IL-8 and TNF-α) in apical culture medium were measured using ELISA, and corresponding gene mRNA expression in cells were analyzed via real-time PCR method. IL-1β levels were significantly elevated in co-cultures grown under two conditions after medium and high doses (60 and 180 μg/ml) of PM2.5 exposure. One vigorous response of IL-1β was found under submerged culture to high-dose exposure, up to 5.7-fold increase compared to corresponding unexposed controls (P < 0.01), while for cells grown at ALI after exposure to high-dose PM2.5, IL-1β rose to ~2.5-fold compared to corresponding unexposed controls (P < 0.01) (Fig. 5A). We observed a significant dose-dependent increase in IL-6 and IL-8 levels in the co-cultures grown in submerged medium with all concentrations of PM2.5 tested, compared to corresponding controls. Whereas, for co-cultures grown at ALI, IL-6 and IL-8 levels showed significant increase at medium and high doses of PM2.5 (60 and 180 μg/ml) (Fig. 5B and C). Meanwhile, quantities of TNF-α secretion showed that significant increase was only observed in high-dose PM2.5 exposure for co-cultures grown under submerged and ALI conditions (P < 0.01) (Fig. 5D). Besides the release of pro-inflammatory indicators, mRNA analysis also revealed that PM2.5 can induce the upregulation of IL-1β, IL-6, IL-8 and TNF-α expression (Fig. 6). For the expression of IL-1β, IL-6 and TNF-α mRNA, a significant increase was only found in high-dose exposure for the two culture methods (P < 0.05) (Fig. 6A, B and D). While for IL-8 mRNA, the significant increase was present in both medium- and high-dose exposure for two culture methods (P < 0.01) (Fig. 6C). Interestingly, we found that co-cultures showed more pronounced response to all detected pro-inflammatory indicators in co-cultures grown in medium after 24-h PM2.5 exposure than co-cultures grown at ALI. Moreover, among all detected indicators, both IL-8 secretion levels and mRNA expression increases were the most sensitive, which was about 10 times higher secretion levels for both growth conditions, compared to the corresponding controls. Figure 5 Open in new tabDownload slide Levels of pro-inflammatory mediators IL-1β (A), IL-6 (B), IL-8 (C) and TNF-α (D) in apical culture medium. Co-culture of A549 and THP-1 macrophages was exposed to PM2.5 suspensions (20, 60 and 180 μg/ml) or kept in culture medium for 24 h after grown under ALI or submerged conditions. Data are shown as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding unexposed controls: *P < 0.05, **P < 0.01. Figure 5 Open in new tabDownload slide Levels of pro-inflammatory mediators IL-1β (A), IL-6 (B), IL-8 (C) and TNF-α (D) in apical culture medium. Co-culture of A549 and THP-1 macrophages was exposed to PM2.5 suspensions (20, 60 and 180 μg/ml) or kept in culture medium for 24 h after grown under ALI or submerged conditions. Data are shown as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding unexposed controls: *P < 0.05, **P < 0.01. Figure 6 Open in new tabDownload slide Effects of a 24-h incubation with ambient PM2.5 on inflammatory gene expressions of IL-1β (A), IL-6 (B), IL-8 (C) and TNF-α (D) in co-culture of A549 plus THP-1 macrophages. Co-cultures were incubated in PM2.5 suspension with different dose levels (20, 60 and 180 μg/ml) or with culture medium as controls after grown under ALI or submerged condition. Data are shown as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding unexposed controls: *P < 0.05, **P < 0.01. Figure 6 Open in new tabDownload slide Effects of a 24-h incubation with ambient PM2.5 on inflammatory gene expressions of IL-1β (A), IL-6 (B), IL-8 (C) and TNF-α (D) in co-culture of A549 plus THP-1 macrophages. Co-cultures were incubated in PM2.5 suspension with different dose levels (20, 60 and 180 μg/ml) or with culture medium as controls after grown under ALI or submerged condition. Data are shown as mean ± SE of three independent experiments with three replicates in each. Values are significantly compared to corresponding unexposed controls: *P < 0.05, **P < 0.01. PM2.5-induced activation of p38 MAPK and NF-κB p65 in co-culture of A549 and THP-1 macrophages To sum up the above biological responses, LDH, ROS and pro-inflammatory indicators showed similar increasing tendency under both culture conditions, which indicated that these two cultures have a similar behavior after PM2.5 suspension exposure, and growth under submerged condition showed a more vigorous response. Therefore, for further mechanism investigation, only co-cultures grown under submerged condition were detected to discuss whether ROS/MAPK/NF-κB pathway was involved. In co-cultures of A549 and THP-1 macrophages incubated with various concentration of ambient PM2.5 (20, 60 and 180 μg/ml) for 24 h, phosphorylation of p38 MAPK and NF-κB p65 increased with increasing particle concentrations (Fig. 7A and B). Optical quantification of protein bands of p-p38 MAPK/p38 MAPK from repetitive experiments demonstrated significant increases for all concentration exposure compared to unexposed cells (P < 0.01), the high dose of PM2.5 triggered an ~3-fold increase (P < 0.01). When compared to unexposed cells, the levels of p-NF-κB p65/NF-κB p65 were also increased significantly at medium and high doses (60 and 180 μg/ml) (P < 0.05) (Fig. 7C); no any obvious changes shown at low-dose exposure. Figure 7 Open in new tabDownload slide Activation of p38 MAPK and NF-κB p65 signaling pathways in co-cultures upon PM2.5 treatment after grown under submerged condition. Phosphorylation levels of p38 and NF-κB p65 were detected by western blotting (A, B). Blots are representative of three separate experiments. Compared with β-actin expression, the optical densities of protein bands are shown in (C). Data are shown as mean ± SE of three independent experiments. Values are significantly compared to controls: *P < 0.05, **P < 0.01. Figure 7 Open in new tabDownload slide Activation of p38 MAPK and NF-κB p65 signaling pathways in co-cultures upon PM2.5 treatment after grown under submerged condition. Phosphorylation levels of p38 and NF-κB p65 were detected by western blotting (A, B). Blots are representative of three separate experiments. Compared with β-actin expression, the optical densities of protein bands are shown in (C). Data are shown as mean ± SE of three independent experiments. Values are significantly compared to controls: *P < 0.05, **P < 0.01. Destruction of the extracellular matrix The mRNA level of MMP-9 was increased after high dose of PM2.5 exposure (P < 0.01) (Fig. 8A). Western blotting showed that PM2.5 could increase protein levels of MMP-9 following medium and high dose of PM2.5 exposure (P < 0.01) (Fig. 8B and C). Figure 8 Open in new tabDownload slide Effects of a 24-h incubation with ambient PM2.5 on MMP-9 gene expressions and protein levels in co-culture of A549 and THP-1 macrophages. Co-cultures were incubated in PM2.5 suspensions with different dose levels (20, 60 and 180 μg/ml) or with culture medium as controls after grown under submerged condition. The mRNA expression of MMP-9 was detected by real-time PCR (A). Western blotting was used to detect the expression of MMP-9 proteins (B) and optical densities of the protein bands compared with β-actin expression (C). Data are shown as mean ± SE of three independent experiments. Values are significantly compared to corresponding unexposed controls: **P < 0.01. Figure 8 Open in new tabDownload slide Effects of a 24-h incubation with ambient PM2.5 on MMP-9 gene expressions and protein levels in co-culture of A549 and THP-1 macrophages. Co-cultures were incubated in PM2.5 suspensions with different dose levels (20, 60 and 180 μg/ml) or with culture medium as controls after grown under submerged condition. The mRNA expression of MMP-9 was detected by real-time PCR (A). Western blotting was used to detect the expression of MMP-9 proteins (B) and optical densities of the protein bands compared with β-actin expression (C). Data are shown as mean ± SE of three independent experiments. Values are significantly compared to corresponding unexposed controls: **P < 0.01. Discussion It is known that the source of ambient PM2.5 is diverse; thus, the chemical composition of PM2.5 from different areas could be significantly different. As we have mentioned previously, the research field of particle toxicity still lack relevant universal in vitro models to accurately evaluate the biological effects observed in vivo after respiratory exposure. In spite of ALI has advantages, and many studies investigating the toxicity of particles with ALI have been reported, submerged culture-based in vitro toxicity assays using the resuspension PM2.5 to expose cells are still widely used to assess the toxicity of PM2.5. Thus, it is meaningful to obtain quantitative information on whether the advanced ALI culture compared to submerged culture is more sensitive for evaluating PM2.5 toxicity. But now, the database is too limited to draw a definite conclusion on this issue. There are investigations which show that ALI model is more sensitive than submerged model [6, 9, 10, 14, 30], while the inconsistent results also exist [13, 31–34]. For that reason, we compared the cellular response to PM2.5 after ALI culture and submerged culture in order to develop a physiologically relevant in vitro model for evaluating the toxicity of ambient PM2.5 from different sources and provided a comparison with the literature data on different types of particles and cells. Inhalation is the most relevant entry point for particles into the human body. Although, in the field of lung toxicity, animal experiments are still widely used, there is a need to replace, reduce and refine animal testing considering an ethical and legal obligation. Additionally, in vitro methods are more appropriate in discussing the toxicity mechanism of particle pollutions than in vivo studies. Nowadays, alveolar A549 cells are often employed since these cells, together with alveolar macrophages, represent target and first line of cellular defense against deposited PM2.5 [35]. The morphology and functionality (surfactant synthesis, oxidative metabolism and transport properties) of A549 cells are consistent with that of pulmonary alveolar type II cells in vivo [36, 37]. These alveolar macrophages found in the alveolar spaces are the principal phagocytic and scavenger cells on alveolar surfaces [38]. In this study, A549 cells were used as a model for epithelial cells, and THP-1-induced macrophages were added on the top of A549 cells to mimic complex cell–cell interactions and communications present in vivo, which are extremely important considering in the mechanisms of defense against inhaled particles. The co-culture was allowed to grow in 0.4-μm inserts in the present study. It is reported that co-cultures of A549 and THP-1 macrophages grown in 0.4-μm pore inserts at the ALI, after reaching confluence, non-physiological medium is not able to translocate from the basolateral to the apical compartment [14]. It is worth mentioning that a ratio of 10 A549 cells to 1 THP-1 cell was used to mimic physiology situation, which is among the highest pneumocyte to macrophage ratio observed in normal human lungs [39]. Air–liquid cultivation for pulmonary cells resembles the in vivo reality closer than conventional submerged cultivation. According to the daily TEER monitoring, A549 grown under both culture conditions showed similar low-resistance values between 15 and 50 Ω.cm2. Therefore, our results also support that A549 cells lack functional tight junctions, which was consistent with currently available reports [40, 41]. Interestingly, PM2.5 exposure did not cause an obvious change in TEER values, which is similar with our previous study [15]. In that study, we exposed A549 monocultures or A549 and THP-1 co-cultures to ambient PM2.5 collected from Shanghai city in China. Although A549 lacks functional tight junctions, this cell line is widely regarded as a valid model cell system for pulmonary particle toxicity studies [42, 43]. As for PM2.5 exposure strategy, we took the commonly used approach that exposing co-cultured cells to resuspension of PM2.5 in a liquid medium for 24 h and then assessed various endpoints as indicators of PM2.5-induced toxicity, including cytotoxicity, oxidative stress and inflammation. Although direct aerosol exposure at ALI frequently described as being a more physiologic strategy, there have been only a limited number of studies on the comparison of advanced ALI exposure with traditional suspension exposure [7, 9, 31, 44]. That is because some factors limited the direct comparison, such as how to define equivalent amounts of PM2.5 and how to decide the most sensitive time points for detecting biological responses. Specifically, different original exposure doses or deposition doses on the exposed cells upon these two methodological approaches lead to the toxicity comparison of the same resourced particles extremely hard. Besides, aerosol and suspension exposure strategies differ fundamentally in their dose–response pattern. An investigation found that, in the aerosol scenario, biological activation tend to their maximum after 4 h of exposure, whereas under submerged conditions, response present most pronounced mainly after 24 h exposure [31]. Hence, the available studies to compare the sensitivity of ALI and submerged methods were conducted in diversified ways (Table 3). The major approaches in in vitro study are still using the PM2.5 resuspension to expose cells, although the separation of phases and post-treatment of filter-collected PM2.5 may modify the toxicity of PM2.5, even the protein in culture medium may interact with particle during incubation. In this study, we applied 1% FBS in the culture medium when treatment with PM2.5 suspension; this is rational to lower the interaction between proteins and particles [38, 45, 46]. Table 3 Comparison of the LOAELs for ambient PM exposure of pulmonary cells under ALI and submerged conditions Reference . Ambient PM sources . Human epithelial cell type . Culture/exposure method and dose levels . Biological parameter . Dose for the lowest observed adverse effect levels (LOAELs) . Submerged (μg/cm2) . ALI (μg/cm2) . ALI more sensitive than submerged . [32] Ambient air pollution particle (coarse, fine, ultrafine) NIST 1648 NHBE (primary) BEAS-2B ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 50 μg/25 μl (44.6 μg/cm2) and 250 μg/25 μl (223 μg/cm2) for 4 h ALI culture then suspension exposure; submerged culture then suspension exposure Same dose level: 250 μg/25 μl (223 μg/cm2) for 4 h IL-8 (mRNA) IL-6 (mRNA) HOX1 (mRNA) COX2 (mRNA) IL-8 (mRNA) HOX1 (mRNA) Coarse: <44.6 Fine: 44.6–223 Ultrafine: >223 Coarse: <44.6 Fine: <44.6 Ultrafine: <44.6 Coarse: <44.6 Fine: 44.6–223 Ultrafine: 44.6–223 Coarse: 44.6–223 Fine: 44.6–223 Ultrafine: 44.6–223 <223 <223 >223 >223 >223 >223 >223 >223 44.6–223 >223 >223 >223 >223 >223 >223 >223 No No Unclear No No No No No No No No No No No [33] Silver nanoparticles Tri-culture model: A549, human peripheral blood monocyte-derived dendritic and macrophage cells ALI culture then aerosol exposure: 0.03, 0.3 and 3 μg/cm2 for 24 h; submerged culture then suspension exposure: 10, 20 and 30 μg/ml for 24 h (deposited dose: 1.7, 3.4 and 5.1 μg/cm2 for 24 h) LDH (protein) TNF-а (protein) IL-8 (protein) 1.7–3.4 (apical) 3.4–5.1 (basal) > 5.1 (apical) > 5.1 (basal) 3.4–5.1 (apical) < 1.7 (basal) >3 (basal) >3 (basal) >3 (basal) No Unclear No [9] Particles from a diesel engine 16HBE14o- Submerged culture then aerosol exposure at ALI: diesel exhaust exposure for 6 h, particles deposited 1.0 × 10−4 μg/cm2, rinsed cells and post-incubated for 20 h; submerged culture then suspension exposure: 0, 0.13, 0.25, 1.88, 2.5 and 12.5 μg/cm2 for 6 h, rinsed cells and then post-incubated for 20 h IL-8 (protein) 0.25–1.88 ≥1.0 × 10−4 μg/cm2 Yes (ALI exposure induces a similar response in IL-8 release to the suspension exposure at extremely lower dose) [6] Airborne zinc oxide nanoparticles A549 Submerged culture and 1 h at ALI, then aerosol exposure: final dose was delivered to the cells after 3 h (0.7 μg/cm2 and 2.2 μg/cm2); submerged culture then suspension exposure: 0.7 μg/cm2 and 2.5 μg/cm2 for 1 h incubation HMOX1(mRNA) SOD-2 (mRNA) GCS (mRNA) IL-8 (mRNA) IL-6 (mRNA) GM-CSF (mRNA) > 2.5 > 2.5 > 2.5 0.7–2.5 > 2.5 > 2.5 >2.2 >2.2 0.7–2.2 <0.7 <0.7 0.7 Unclear Unclear Yes Yes Yes Yes [30] Urban-like test atmospheres combined diesel exhaust with a complex VOC mixtures (coarse particles) A549 cell line Submerged culture then PM-only direct exposure at ALI: particles deposited 2.6 μg/cm2 for 1 h; submerged culture then suspension exposure: 2.6 or 42.5 μg/cm2 for 9 h COX-2 (mRNA) IL-8 (mRNA) > 42.5 2.6–42.5 <2.6 <2.6 Yes Yes [14] Three nano-TiO2 and one nano-CeO2 Co-cultures of A549 and THP-1 ALI culture then aerosol exposure: exposed for 3 h at the ALI to aerosols and then kept in the incubator at the ALI for 21 h, deposited doses were around 0.1, 1, 3 μg/cm2; submerged culture and suspension exposure: 3 h to suspension to generate around 1, 3 and 10 μg/cm2 deposition, fresh medium was added and cells were kept for 21 h in the incubator IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-а (protein) Using apical medium for analysis: 1–3 (one nano-TiO2), 3–10(one nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10(one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10 (one nano-CeO2) 1–3 (two nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) Using apical washing liquid for analysis: 0.1–1 (two nano-TiO2), 1–3 (one nano-CeO2), >3 (one TiO2) 0.1–1 (two nano-TiO2), 1–3 (one nano-TiO2, one nano-CeO2) 0.1–1 (three nano-TiO2), 1–3 (one nano-CeO2) 0.1–1 (two nano-TiO2), > 3(one nano-TiO2, one TiO2) Unclear Yes Yes Unclear [13] Quartz particles (fine particles) A549 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 100, 200 and 300 μg/cm2 for 24 h Cytotoxicity (MTS) 100–200 >300 No [34] Two different amorphous silica nanoparticles A549 Submerged culture then ALI exposure: 52 μg/cm2 deposition after 5 h and 117 μg/cm2 after 7 h and then post-incubated in medium till 24 h after the onset of exposure Submerged culture then suspension exposure:15.6 μg/cm2 for 24 h LDH (protein) IL-6 (protein) IL-8 (protein) COX-2 (protein) < 15.6 < 15.6 < 15.6 < 15.6 <52 Undetected <52 <52 No Unclear No No [31] ZnO nanoparticles under workplace conditions Tri-culture: 16HBE14o-, human monocyte-derived macrophage, human monocyte-derived dendritic cells ALI culture then aerosol exposure: 1.3, 2.9 and 6.1 μg/cm2 deposition over a 30-min exposure, followed by a 4- or 24-h post-incubation prior to sampling; submerged culture then suspension exposure: 1.3, 3.9, 7.9, 15.8 and 20.9 μg/cm2 (calculated based on 80 ppm mentioned in the article) for 4- and 24-h incubation LDH (protein) GSH (protein) SOD1 (mRNA) HO-1 (mRNA) TNF-α (protein) < 1.3 for 24 h incubation > 20.9 for both timepoints > 20.9 for both timepoints 1.3–3.9 for 24 h incubation < 1.3 for both timepoints <1.3 for both timepoints (unsure) >6.1 for both timepoints >6.1 for both timepoints >6.1 for both timepoints (unsure) >6.1 for both timepoints Unclear Unclear Unclear Unclear No [10] Coarse ambient PM NHBE (primary cells) ALI culture then aerosol exposure: average 2 μg/cm2 for 3 h; submerged culture then suspension exposure: 7, 12.5, 25 and 65 μg/cm2 for 1 h IL-8 (mRNA) HOX-1 (mRNA) COX-2 (mRNA) 12.5–25 25–65 ≤ 7.0 ≤2.0 ≤2.0 ≤2.0 Yes Yes Unclear This study Ambient fine particulate matter Co-culture of A549 and THP-1 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 20, 60 and 180 μg/ml (6.25, 18.75 and 56.25 μg/cm2) for 24 h IL-1β (mRNA) IL-6 (mRNA) IL-8 (mRNA) TNF-α (mRNA) IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-α (protein) 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 <6.25 <6.25 18.75–56.25 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 6.25–18.75 6.25–18.75 18.75–56.25 Unclear Unclear Unclear Unclear Unclear No No Unclear Reference . Ambient PM sources . Human epithelial cell type . Culture/exposure method and dose levels . Biological parameter . Dose for the lowest observed adverse effect levels (LOAELs) . Submerged (μg/cm2) . ALI (μg/cm2) . ALI more sensitive than submerged . [32] Ambient air pollution particle (coarse, fine, ultrafine) NIST 1648 NHBE (primary) BEAS-2B ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 50 μg/25 μl (44.6 μg/cm2) and 250 μg/25 μl (223 μg/cm2) for 4 h ALI culture then suspension exposure; submerged culture then suspension exposure Same dose level: 250 μg/25 μl (223 μg/cm2) for 4 h IL-8 (mRNA) IL-6 (mRNA) HOX1 (mRNA) COX2 (mRNA) IL-8 (mRNA) HOX1 (mRNA) Coarse: <44.6 Fine: 44.6–223 Ultrafine: >223 Coarse: <44.6 Fine: <44.6 Ultrafine: <44.6 Coarse: <44.6 Fine: 44.6–223 Ultrafine: 44.6–223 Coarse: 44.6–223 Fine: 44.6–223 Ultrafine: 44.6–223 <223 <223 >223 >223 >223 >223 >223 >223 44.6–223 >223 >223 >223 >223 >223 >223 >223 No No Unclear No No No No No No No No No No No [33] Silver nanoparticles Tri-culture model: A549, human peripheral blood monocyte-derived dendritic and macrophage cells ALI culture then aerosol exposure: 0.03, 0.3 and 3 μg/cm2 for 24 h; submerged culture then suspension exposure: 10, 20 and 30 μg/ml for 24 h (deposited dose: 1.7, 3.4 and 5.1 μg/cm2 for 24 h) LDH (protein) TNF-а (protein) IL-8 (protein) 1.7–3.4 (apical) 3.4–5.1 (basal) > 5.1 (apical) > 5.1 (basal) 3.4–5.1 (apical) < 1.7 (basal) >3 (basal) >3 (basal) >3 (basal) No Unclear No [9] Particles from a diesel engine 16HBE14o- Submerged culture then aerosol exposure at ALI: diesel exhaust exposure for 6 h, particles deposited 1.0 × 10−4 μg/cm2, rinsed cells and post-incubated for 20 h; submerged culture then suspension exposure: 0, 0.13, 0.25, 1.88, 2.5 and 12.5 μg/cm2 for 6 h, rinsed cells and then post-incubated for 20 h IL-8 (protein) 0.25–1.88 ≥1.0 × 10−4 μg/cm2 Yes (ALI exposure induces a similar response in IL-8 release to the suspension exposure at extremely lower dose) [6] Airborne zinc oxide nanoparticles A549 Submerged culture and 1 h at ALI, then aerosol exposure: final dose was delivered to the cells after 3 h (0.7 μg/cm2 and 2.2 μg/cm2); submerged culture then suspension exposure: 0.7 μg/cm2 and 2.5 μg/cm2 for 1 h incubation HMOX1(mRNA) SOD-2 (mRNA) GCS (mRNA) IL-8 (mRNA) IL-6 (mRNA) GM-CSF (mRNA) > 2.5 > 2.5 > 2.5 0.7–2.5 > 2.5 > 2.5 >2.2 >2.2 0.7–2.2 <0.7 <0.7 0.7 Unclear Unclear Yes Yes Yes Yes [30] Urban-like test atmospheres combined diesel exhaust with a complex VOC mixtures (coarse particles) A549 cell line Submerged culture then PM-only direct exposure at ALI: particles deposited 2.6 μg/cm2 for 1 h; submerged culture then suspension exposure: 2.6 or 42.5 μg/cm2 for 9 h COX-2 (mRNA) IL-8 (mRNA) > 42.5 2.6–42.5 <2.6 <2.6 Yes Yes [14] Three nano-TiO2 and one nano-CeO2 Co-cultures of A549 and THP-1 ALI culture then aerosol exposure: exposed for 3 h at the ALI to aerosols and then kept in the incubator at the ALI for 21 h, deposited doses were around 0.1, 1, 3 μg/cm2; submerged culture and suspension exposure: 3 h to suspension to generate around 1, 3 and 10 μg/cm2 deposition, fresh medium was added and cells were kept for 21 h in the incubator IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-а (protein) Using apical medium for analysis: 1–3 (one nano-TiO2), 3–10(one nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10(one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10 (one nano-CeO2) 1–3 (two nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) Using apical washing liquid for analysis: 0.1–1 (two nano-TiO2), 1–3 (one nano-CeO2), >3 (one TiO2) 0.1–1 (two nano-TiO2), 1–3 (one nano-TiO2, one nano-CeO2) 0.1–1 (three nano-TiO2), 1–3 (one nano-CeO2) 0.1–1 (two nano-TiO2), > 3(one nano-TiO2, one TiO2) Unclear Yes Yes Unclear [13] Quartz particles (fine particles) A549 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 100, 200 and 300 μg/cm2 for 24 h Cytotoxicity (MTS) 100–200 >300 No [34] Two different amorphous silica nanoparticles A549 Submerged culture then ALI exposure: 52 μg/cm2 deposition after 5 h and 117 μg/cm2 after 7 h and then post-incubated in medium till 24 h after the onset of exposure Submerged culture then suspension exposure:15.6 μg/cm2 for 24 h LDH (protein) IL-6 (protein) IL-8 (protein) COX-2 (protein) < 15.6 < 15.6 < 15.6 < 15.6 <52 Undetected <52 <52 No Unclear No No [31] ZnO nanoparticles under workplace conditions Tri-culture: 16HBE14o-, human monocyte-derived macrophage, human monocyte-derived dendritic cells ALI culture then aerosol exposure: 1.3, 2.9 and 6.1 μg/cm2 deposition over a 30-min exposure, followed by a 4- or 24-h post-incubation prior to sampling; submerged culture then suspension exposure: 1.3, 3.9, 7.9, 15.8 and 20.9 μg/cm2 (calculated based on 80 ppm mentioned in the article) for 4- and 24-h incubation LDH (protein) GSH (protein) SOD1 (mRNA) HO-1 (mRNA) TNF-α (protein) < 1.3 for 24 h incubation > 20.9 for both timepoints > 20.9 for both timepoints 1.3–3.9 for 24 h incubation < 1.3 for both timepoints <1.3 for both timepoints (unsure) >6.1 for both timepoints >6.1 for both timepoints >6.1 for both timepoints (unsure) >6.1 for both timepoints Unclear Unclear Unclear Unclear No [10] Coarse ambient PM NHBE (primary cells) ALI culture then aerosol exposure: average 2 μg/cm2 for 3 h; submerged culture then suspension exposure: 7, 12.5, 25 and 65 μg/cm2 for 1 h IL-8 (mRNA) HOX-1 (mRNA) COX-2 (mRNA) 12.5–25 25–65 ≤ 7.0 ≤2.0 ≤2.0 ≤2.0 Yes Yes Unclear This study Ambient fine particulate matter Co-culture of A549 and THP-1 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 20, 60 and 180 μg/ml (6.25, 18.75 and 56.25 μg/cm2) for 24 h IL-1β (mRNA) IL-6 (mRNA) IL-8 (mRNA) TNF-α (mRNA) IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-α (protein) 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 <6.25 <6.25 18.75–56.25 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 6.25–18.75 6.25–18.75 18.75–56.25 Unclear Unclear Unclear Unclear Unclear No No Unclear Open in new tab Table 3 Comparison of the LOAELs for ambient PM exposure of pulmonary cells under ALI and submerged conditions Reference . Ambient PM sources . Human epithelial cell type . Culture/exposure method and dose levels . Biological parameter . Dose for the lowest observed adverse effect levels (LOAELs) . Submerged (μg/cm2) . ALI (μg/cm2) . ALI more sensitive than submerged . [32] Ambient air pollution particle (coarse, fine, ultrafine) NIST 1648 NHBE (primary) BEAS-2B ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 50 μg/25 μl (44.6 μg/cm2) and 250 μg/25 μl (223 μg/cm2) for 4 h ALI culture then suspension exposure; submerged culture then suspension exposure Same dose level: 250 μg/25 μl (223 μg/cm2) for 4 h IL-8 (mRNA) IL-6 (mRNA) HOX1 (mRNA) COX2 (mRNA) IL-8 (mRNA) HOX1 (mRNA) Coarse: <44.6 Fine: 44.6–223 Ultrafine: >223 Coarse: <44.6 Fine: <44.6 Ultrafine: <44.6 Coarse: <44.6 Fine: 44.6–223 Ultrafine: 44.6–223 Coarse: 44.6–223 Fine: 44.6–223 Ultrafine: 44.6–223 <223 <223 >223 >223 >223 >223 >223 >223 44.6–223 >223 >223 >223 >223 >223 >223 >223 No No Unclear No No No No No No No No No No No [33] Silver nanoparticles Tri-culture model: A549, human peripheral blood monocyte-derived dendritic and macrophage cells ALI culture then aerosol exposure: 0.03, 0.3 and 3 μg/cm2 for 24 h; submerged culture then suspension exposure: 10, 20 and 30 μg/ml for 24 h (deposited dose: 1.7, 3.4 and 5.1 μg/cm2 for 24 h) LDH (protein) TNF-а (protein) IL-8 (protein) 1.7–3.4 (apical) 3.4–5.1 (basal) > 5.1 (apical) > 5.1 (basal) 3.4–5.1 (apical) < 1.7 (basal) >3 (basal) >3 (basal) >3 (basal) No Unclear No [9] Particles from a diesel engine 16HBE14o- Submerged culture then aerosol exposure at ALI: diesel exhaust exposure for 6 h, particles deposited 1.0 × 10−4 μg/cm2, rinsed cells and post-incubated for 20 h; submerged culture then suspension exposure: 0, 0.13, 0.25, 1.88, 2.5 and 12.5 μg/cm2 for 6 h, rinsed cells and then post-incubated for 20 h IL-8 (protein) 0.25–1.88 ≥1.0 × 10−4 μg/cm2 Yes (ALI exposure induces a similar response in IL-8 release to the suspension exposure at extremely lower dose) [6] Airborne zinc oxide nanoparticles A549 Submerged culture and 1 h at ALI, then aerosol exposure: final dose was delivered to the cells after 3 h (0.7 μg/cm2 and 2.2 μg/cm2); submerged culture then suspension exposure: 0.7 μg/cm2 and 2.5 μg/cm2 for 1 h incubation HMOX1(mRNA) SOD-2 (mRNA) GCS (mRNA) IL-8 (mRNA) IL-6 (mRNA) GM-CSF (mRNA) > 2.5 > 2.5 > 2.5 0.7–2.5 > 2.5 > 2.5 >2.2 >2.2 0.7–2.2 <0.7 <0.7 0.7 Unclear Unclear Yes Yes Yes Yes [30] Urban-like test atmospheres combined diesel exhaust with a complex VOC mixtures (coarse particles) A549 cell line Submerged culture then PM-only direct exposure at ALI: particles deposited 2.6 μg/cm2 for 1 h; submerged culture then suspension exposure: 2.6 or 42.5 μg/cm2 for 9 h COX-2 (mRNA) IL-8 (mRNA) > 42.5 2.6–42.5 <2.6 <2.6 Yes Yes [14] Three nano-TiO2 and one nano-CeO2 Co-cultures of A549 and THP-1 ALI culture then aerosol exposure: exposed for 3 h at the ALI to aerosols and then kept in the incubator at the ALI for 21 h, deposited doses were around 0.1, 1, 3 μg/cm2; submerged culture and suspension exposure: 3 h to suspension to generate around 1, 3 and 10 μg/cm2 deposition, fresh medium was added and cells were kept for 21 h in the incubator IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-а (protein) Using apical medium for analysis: 1–3 (one nano-TiO2), 3–10(one nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10(one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10 (one nano-CeO2) 1–3 (two nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) Using apical washing liquid for analysis: 0.1–1 (two nano-TiO2), 1–3 (one nano-CeO2), >3 (one TiO2) 0.1–1 (two nano-TiO2), 1–3 (one nano-TiO2, one nano-CeO2) 0.1–1 (three nano-TiO2), 1–3 (one nano-CeO2) 0.1–1 (two nano-TiO2), > 3(one nano-TiO2, one TiO2) Unclear Yes Yes Unclear [13] Quartz particles (fine particles) A549 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 100, 200 and 300 μg/cm2 for 24 h Cytotoxicity (MTS) 100–200 >300 No [34] Two different amorphous silica nanoparticles A549 Submerged culture then ALI exposure: 52 μg/cm2 deposition after 5 h and 117 μg/cm2 after 7 h and then post-incubated in medium till 24 h after the onset of exposure Submerged culture then suspension exposure:15.6 μg/cm2 for 24 h LDH (protein) IL-6 (protein) IL-8 (protein) COX-2 (protein) < 15.6 < 15.6 < 15.6 < 15.6 <52 Undetected <52 <52 No Unclear No No [31] ZnO nanoparticles under workplace conditions Tri-culture: 16HBE14o-, human monocyte-derived macrophage, human monocyte-derived dendritic cells ALI culture then aerosol exposure: 1.3, 2.9 and 6.1 μg/cm2 deposition over a 30-min exposure, followed by a 4- or 24-h post-incubation prior to sampling; submerged culture then suspension exposure: 1.3, 3.9, 7.9, 15.8 and 20.9 μg/cm2 (calculated based on 80 ppm mentioned in the article) for 4- and 24-h incubation LDH (protein) GSH (protein) SOD1 (mRNA) HO-1 (mRNA) TNF-α (protein) < 1.3 for 24 h incubation > 20.9 for both timepoints > 20.9 for both timepoints 1.3–3.9 for 24 h incubation < 1.3 for both timepoints <1.3 for both timepoints (unsure) >6.1 for both timepoints >6.1 for both timepoints >6.1 for both timepoints (unsure) >6.1 for both timepoints Unclear Unclear Unclear Unclear No [10] Coarse ambient PM NHBE (primary cells) ALI culture then aerosol exposure: average 2 μg/cm2 for 3 h; submerged culture then suspension exposure: 7, 12.5, 25 and 65 μg/cm2 for 1 h IL-8 (mRNA) HOX-1 (mRNA) COX-2 (mRNA) 12.5–25 25–65 ≤ 7.0 ≤2.0 ≤2.0 ≤2.0 Yes Yes Unclear This study Ambient fine particulate matter Co-culture of A549 and THP-1 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 20, 60 and 180 μg/ml (6.25, 18.75 and 56.25 μg/cm2) for 24 h IL-1β (mRNA) IL-6 (mRNA) IL-8 (mRNA) TNF-α (mRNA) IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-α (protein) 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 <6.25 <6.25 18.75–56.25 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 6.25–18.75 6.25–18.75 18.75–56.25 Unclear Unclear Unclear Unclear Unclear No No Unclear Reference . Ambient PM sources . Human epithelial cell type . Culture/exposure method and dose levels . Biological parameter . Dose for the lowest observed adverse effect levels (LOAELs) . Submerged (μg/cm2) . ALI (μg/cm2) . ALI more sensitive than submerged . [32] Ambient air pollution particle (coarse, fine, ultrafine) NIST 1648 NHBE (primary) BEAS-2B ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 50 μg/25 μl (44.6 μg/cm2) and 250 μg/25 μl (223 μg/cm2) for 4 h ALI culture then suspension exposure; submerged culture then suspension exposure Same dose level: 250 μg/25 μl (223 μg/cm2) for 4 h IL-8 (mRNA) IL-6 (mRNA) HOX1 (mRNA) COX2 (mRNA) IL-8 (mRNA) HOX1 (mRNA) Coarse: <44.6 Fine: 44.6–223 Ultrafine: >223 Coarse: <44.6 Fine: <44.6 Ultrafine: <44.6 Coarse: <44.6 Fine: 44.6–223 Ultrafine: 44.6–223 Coarse: 44.6–223 Fine: 44.6–223 Ultrafine: 44.6–223 <223 <223 >223 >223 >223 >223 >223 >223 44.6–223 >223 >223 >223 >223 >223 >223 >223 No No Unclear No No No No No No No No No No No [33] Silver nanoparticles Tri-culture model: A549, human peripheral blood monocyte-derived dendritic and macrophage cells ALI culture then aerosol exposure: 0.03, 0.3 and 3 μg/cm2 for 24 h; submerged culture then suspension exposure: 10, 20 and 30 μg/ml for 24 h (deposited dose: 1.7, 3.4 and 5.1 μg/cm2 for 24 h) LDH (protein) TNF-а (protein) IL-8 (protein) 1.7–3.4 (apical) 3.4–5.1 (basal) > 5.1 (apical) > 5.1 (basal) 3.4–5.1 (apical) < 1.7 (basal) >3 (basal) >3 (basal) >3 (basal) No Unclear No [9] Particles from a diesel engine 16HBE14o- Submerged culture then aerosol exposure at ALI: diesel exhaust exposure for 6 h, particles deposited 1.0 × 10−4 μg/cm2, rinsed cells and post-incubated for 20 h; submerged culture then suspension exposure: 0, 0.13, 0.25, 1.88, 2.5 and 12.5 μg/cm2 for 6 h, rinsed cells and then post-incubated for 20 h IL-8 (protein) 0.25–1.88 ≥1.0 × 10−4 μg/cm2 Yes (ALI exposure induces a similar response in IL-8 release to the suspension exposure at extremely lower dose) [6] Airborne zinc oxide nanoparticles A549 Submerged culture and 1 h at ALI, then aerosol exposure: final dose was delivered to the cells after 3 h (0.7 μg/cm2 and 2.2 μg/cm2); submerged culture then suspension exposure: 0.7 μg/cm2 and 2.5 μg/cm2 for 1 h incubation HMOX1(mRNA) SOD-2 (mRNA) GCS (mRNA) IL-8 (mRNA) IL-6 (mRNA) GM-CSF (mRNA) > 2.5 > 2.5 > 2.5 0.7–2.5 > 2.5 > 2.5 >2.2 >2.2 0.7–2.2 <0.7 <0.7 0.7 Unclear Unclear Yes Yes Yes Yes [30] Urban-like test atmospheres combined diesel exhaust with a complex VOC mixtures (coarse particles) A549 cell line Submerged culture then PM-only direct exposure at ALI: particles deposited 2.6 μg/cm2 for 1 h; submerged culture then suspension exposure: 2.6 or 42.5 μg/cm2 for 9 h COX-2 (mRNA) IL-8 (mRNA) > 42.5 2.6–42.5 <2.6 <2.6 Yes Yes [14] Three nano-TiO2 and one nano-CeO2 Co-cultures of A549 and THP-1 ALI culture then aerosol exposure: exposed for 3 h at the ALI to aerosols and then kept in the incubator at the ALI for 21 h, deposited doses were around 0.1, 1, 3 μg/cm2; submerged culture and suspension exposure: 3 h to suspension to generate around 1, 3 and 10 μg/cm2 deposition, fresh medium was added and cells were kept for 21 h in the incubator IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-а (protein) Using apical medium for analysis: 1–3 (one nano-TiO2), 3–10(one nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10(one nano-CeO2) 1–3 (two nano-TiO2), 3–10 (one nano-TiO2), > 10 (one nano-CeO2) 1–3 (two nano-TiO2), > 10 (one nano-TiO2, one nano-CeO2) Using apical washing liquid for analysis: 0.1–1 (two nano-TiO2), 1–3 (one nano-CeO2), >3 (one TiO2) 0.1–1 (two nano-TiO2), 1–3 (one nano-TiO2, one nano-CeO2) 0.1–1 (three nano-TiO2), 1–3 (one nano-CeO2) 0.1–1 (two nano-TiO2), > 3(one nano-TiO2, one TiO2) Unclear Yes Yes Unclear [13] Quartz particles (fine particles) A549 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 100, 200 and 300 μg/cm2 for 24 h Cytotoxicity (MTS) 100–200 >300 No [34] Two different amorphous silica nanoparticles A549 Submerged culture then ALI exposure: 52 μg/cm2 deposition after 5 h and 117 μg/cm2 after 7 h and then post-incubated in medium till 24 h after the onset of exposure Submerged culture then suspension exposure:15.6 μg/cm2 for 24 h LDH (protein) IL-6 (protein) IL-8 (protein) COX-2 (protein) < 15.6 < 15.6 < 15.6 < 15.6 <52 Undetected <52 <52 No Unclear No No [31] ZnO nanoparticles under workplace conditions Tri-culture: 16HBE14o-, human monocyte-derived macrophage, human monocyte-derived dendritic cells ALI culture then aerosol exposure: 1.3, 2.9 and 6.1 μg/cm2 deposition over a 30-min exposure, followed by a 4- or 24-h post-incubation prior to sampling; submerged culture then suspension exposure: 1.3, 3.9, 7.9, 15.8 and 20.9 μg/cm2 (calculated based on 80 ppm mentioned in the article) for 4- and 24-h incubation LDH (protein) GSH (protein) SOD1 (mRNA) HO-1 (mRNA) TNF-α (protein) < 1.3 for 24 h incubation > 20.9 for both timepoints > 20.9 for both timepoints 1.3–3.9 for 24 h incubation < 1.3 for both timepoints <1.3 for both timepoints (unsure) >6.1 for both timepoints >6.1 for both timepoints >6.1 for both timepoints (unsure) >6.1 for both timepoints Unclear Unclear Unclear Unclear No [10] Coarse ambient PM NHBE (primary cells) ALI culture then aerosol exposure: average 2 μg/cm2 for 3 h; submerged culture then suspension exposure: 7, 12.5, 25 and 65 μg/cm2 for 1 h IL-8 (mRNA) HOX-1 (mRNA) COX-2 (mRNA) 12.5–25 25–65 ≤ 7.0 ≤2.0 ≤2.0 ≤2.0 Yes Yes Unclear This study Ambient fine particulate matter Co-culture of A549 and THP-1 ALI culture then suspension exposure; submerged culture then suspension exposure Same dose levels: 20, 60 and 180 μg/ml (6.25, 18.75 and 56.25 μg/cm2) for 24 h IL-1β (mRNA) IL-6 (mRNA) IL-8 (mRNA) TNF-α (mRNA) IL-1β (protein) IL-6 (protein) IL-8 (protein) TNF-α (protein) 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 <6.25 <6.25 18.75–56.25 18.75–56.25 18.75–56.25 6.25–18.75 18.75–56.25 6.25–18.75 6.25–18.75 6.25–18.75 18.75–56.25 Unclear Unclear Unclear Unclear Unclear No No Unclear Open in new tab According to our previous paper, these three doses (20, 60 and 180 μg/ml) of ambient PM2.5 did not induce obvious cytotoxicity in A549 monocultures and in co-culture of A549 and THP-1 macrophages under submerged condition [15]. In this study, we proposed two culture approaches to address the disparity of PM2.5-induced toxicity. For this purpose, we used a well-characterized model of A549 pulmonary epithelial cells exposed to a non-cytotoxic concentration of ambient PM2.5 for 24 h. To put the PM2.5 concentrations applied for in vitro toxicity testing into perspective, it is meaningful to consider that the current ambient air quality standard in China is 75 μg/m3 averaged per day. According to human lung alveolar surface (120 m2), an alveolar deposition efficiency of 20% for PM2.5, this corresponds to a theoretically daily alveolar surface deposited dose of 13.5 ng/cm2, which is approximately three orders of magnitudes lower than what was used here for PM2.5 exposure (6.25–56.25 𝜇g/cm2) [6, 47, 48]. Moreover, it can be seen that the dose levels applied in this study are falling into the dosage range using in submerged exposure (0.25–300 𝜇g/cm2) in Table 3. As described above, in spite of some differences between ALI and submerged culture or exposure, it is still instructive to compare the PM2.5 dose–response curves observed under ALI and submerged culture conditions in our study and relate these findings to similar data set for other particles and pulmonary cell types from published literature. Here, the LOAELs were used to determine the dose range of adverse biological response occurred. If none of the three applied dose levels showed a statistically significant response, the LOAEL should be above the highest dose level (>56.25 𝜇g/cm2). If the medium dose showed no response, but the high dose did, then the LOAEL falls in the range of 18.75–56.25 𝜇g/cm2. If both the medium and the high doses induced a statistically significant response, but the low dose did not, then the LOAEL should be in the range of 6.25–18.75 𝜇g/cm2. If three dose levels showed a response, then the LOAEL is <6.25 𝜇g/cm2. We take this method to define LOAEL in this study as reported in Lenz’s research [6]. Our data reveal that two biological parameters (protein levels of IL-6 and IL-8) presented higher LOAELs, which means decreasing response levels under ALI culture conditions. Other parameters investigated in our present study were inconclusive. Similar results were reported by other studies with pulmonary cell lines and primary cells [13, 31–34]. However, some other studies found that ALI is more sensitive than submerged condition [6, 9, 10, 14, 30]. In the current study, co-culture of A549 and THP-1 macrophages grown at ALI showed a decreased biological response to PM2.5 collected from Harbin city in China than the co-culture grown under submerged condition. Endpoints employed to estimate these responses including cytotoxicity; ROS production, which represents the ability to induce oxidative stress; pro-inflammatory cytokine proteins (IL-1β, IL-6, IL-8 and TNF-α) in cell medium and corresponding gene expression in cells. PM2.5 induced a concentration-dependent formation of ROS, as measured in the DCFHDA assay. The contribution of redox active metals, such as Fe, Cu, Cr, Mn and Ni [49], was observed in ambient PM2.5 used in this study, which possess the ability to produce ROS. Changes in ROS and LDH were the greatest by exposing co-cultured cells to high dose of PM2.5 after grown under submerged condition. Similarly, the strongest inflammatory response in co-cultures was also presented in exposing to high concentration of PM2.5 after submerged culture, and IL-8 changes appeared to be the most sensitive indicator in both submerged and ALI cultures. A549 is an immortalized line of alveolar epithelial cells, which does not demonstrate the characteristics of cell differentiation, but it can secrete surfactant when grown at ALI. Therefore, the obvious disparity between cells grown at ALI and those submerged in medium may be caused due to the surfactant, which is forming a protection layer against PM2.5 [50, 51]. One study has shown that incubating with nature pulmonary surfactant effectively reduced the cytotoxicity of mesoporous carbon nanomaterials [52]. Another possible explanation of stronger response to PM2.5 under submerged conditions might be that hypoxic condition exists for respiratory cells grown under submersion. Thus, we deduced that hypoxia may also be one of the causes why different culture conditions affected the final biological responses. One study has presented an interaction between hypoxia and the exposure, which augments the pro-inflammatory response in cells. In the view of the above results, this study supported that ambient PM2.5 was associated with inflammation and injury of alveolar cells. Once PM2.5 deposits in the alveolar space, the primary defense mechanism in the alveolar is provided by macrophages that scavenges foreign particles and initiates inflammatory response by coordinating with epithelial cells. Inflammation is considered as a central mechanism for the development of adverse health effects by particle exposure [53, 54]. Thus, understanding how particles trigger inflammatory reactions in the respiratory system is a quite important issue in particle toxicology. In spite of the two culture methods showed different sensitivity to ambient PM2.5 exposure, biological activity of detected mediators showed a similar elevated trend, we deduced that PM2.5-induced inflammation in co-cultures grown under ALI or submerged condition share the same signaling pathways. Later, we only examined co-culture of A549 and THP-1 grown under submerged condition for the following discussion of toxicity mechanism. ROS increase was observed in co-cultures grown under submerged condition after medium and high dose of PM2.5 exposure. PM2.5 exposure enhanced IL-1β, IL-6, IL-8 and TNF-α production, which is in agreement with the activation of the transcription factor NF-κB in co-cultured cells shown by western blotting. Integrating evidence in literature, it can be hypothesized that exposure of co-cultured alveolar cells to PM2.5 caused oxidative stress through induction of ROS, and increased ROS formation may trigger the activation of pro-inflammatory pathways. It is generally viewed that induction of inflammatory cytokines such as IL-1-family proteins, TNF-α, IL-6 and IL-8 involves the ROS-dependent NF-κB activation pathway [55]. However, considering the biological process in co-cultured cells, it is still unclear how ROS induce NF-κB signaling activation. Maybe oxidants directly trigger the components of the NF-κB pathway or rather affect upstream targets in co-cultures of A549 and THP-1 macrophages [56]. In order to determine the cellular signaling by which these events occurred, the levels of p38 MAPK involved in the activation of NF-κB were examined via western blotting. Significant changes in the proportion of active (phosphorylated) forms of p38 in a concentration-related increase were observed. This suggests that the signaling pathway by which these transcription factors are activated involves the activation of p38. In fact, some investigators supported that respirable particles that induce inflammatory cytokines have often been linked to the activation of MAPKs and NF-κB [24, 57]. In this work, we also evaluated the gene expression and protein levels of MMP-9 in A549 co-cultured with THP-1 macrophage exposure to PM2.5 after grown under submerged condition. It is known that MMP-9 has low expression under physiological conditions. However, once the inflammatory process occurred, a persistent MMP activity can cause not only epithelial damage but also tissue dysfunction. Our results demonstrated that PM2.5 could induce upregulation of MMP-9 expression and increasing of MMP-9 protein levels in co-culture of A549 plus THP-1, which is similar with a previously reported study [58]. Increasing of MMP-9 expression is involved in the disruption of the extracellular matrix and is associated with tissue remodeling in many pulmonary diseases [21, 59]. Conclusions Overall, we conclude from our data that PM2.5 may cause predominantly oxidative stress-dependent inflammation in co-culture of A549 and THP-1 cells after grown under ALI and submerged conditions. Lacking protection by the surfactant and hypoxia is the supposed reason for the higher cytotoxicity of particles for co-cultures after grown under submerged condition than ALI. We suppose that surfactant protection of epithelial cells defensing particle-induced cytotoxicity occurs in vivo and that A549 cells under ALI culture are able to mimic this situation. Therefore, the in vitro co-cultured models under ALI culture are proper to understand the toxicological effects of fine particles. Besides, the submerged condition of alveolar cells can be seen in vivo when serious pathological conditions (e.g. pulmonary edema) occur. Nonetheless, the present study provide important implications that culture conditions (submerged versus ALI) can induce differential biological responses to ambient PM2.5 exposure, including cytotoxicity, oxidative stress, as well as protein levels and gene expression of pro-inflammatory mediators; these conditions should be considered when comparing in vitro methods used for ambient PM2.5 toxicity assessment testing moving forward. However, there are some limitations in this study: although A549 cells are commonly used in investigating particle-induced lung toxicity due to above-mentioned advantages, this cell line has a limitation in reflecting responses of normal lung tissues because they are adenocarcinomic human alveolar epithelial cells. Meanwhile, co-cultured cells were treated with PM2.5 suspension, not to aerosol. In addition, respirable particles that induce inflammatory cytokines have often been linked to the activation of MAPKs and NF-κB. The MAPK family members include the ERK1/2, JNKs and the p38 MAPKs. In fact, all three members are possibly involved in the activation of NF-κB, while we only discuss the p38 MAPKs. We should consider the three members and using their inhibitors to test the signaling pathways in further studies. In future, a physiologically relevant in vitro model for investigating realistic inhaled particles should be developed. It is crucial to estimate ambient PM2.5 toxicity accurately and achieve high-throughput examining using cellular models. Funding This work was supported by the National Natural Science Foundation of China (grant number 81502778) and by Startup Fund for Youngman Research at SJTU (SFYR at SJTU, grant number 19X100040040). Conflict of interest statement The authors have declared that no competing interests exist. References 1. Silvani S , Figliuzzi M, Remuzzi A. Toxicological evaluation of airborne particulate matter. Are cell culture technologies ready to replace animal testing? J Appl Toxicol 2019 ; 39 : 1484 – 91 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 2. Chi R , Li H, Wang Q et al. Association of emergency room visits for respiratory diseases with sources of ambient PM2.5 . J Environ Sci 2019 ; 86 : 154 – 63 . Google Scholar Crossref Search ADS WorldCat 3. Jiao A , Xiang Q, Ding Z et al. Short-term impacts of ambient fine particulate matter on emergency department visits: comparative analysis of three exposure metrics . Chemosphere 2020 ; 241 :125012. Google Scholar OpenURL Placeholder Text WorldCat 4. Salomon JJ , Muchitsch VE, Gausterer JC et al. The cell line NCl-H441 is a useful in vitro model for transport studies of human distal lung epithelial barrier . Mol Pharm 2014 ; 11 : 995 – 1006 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Steinritz D , Mohle N, Pohl C et al. Use of the Cultex (R) radial flow system as an in vitro exposure method to assess acute pulmonary toxicity of fine dusts and nanoparticles with special focus on the intra- and inter-laboratory reproducibility . Chem Biol Interact 2013 ; 206 : 479 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Lenz AG , Karg E, Brendel E et al. Inflammatory and oxidative stress responses of an alveolar epithelial cell line to airborne zinc oxide nanoparticles at the air-liquid interface: a comparison with conventional, submerged cell-culture conditions . Biomed Res Int 2013 ; 2013 :652632. Google Scholar OpenURL Placeholder Text WorldCat 7. Lenz AG , Karg E, Lentner B et al. A dose-controlled system for air-liquid interface cell exposure and application to zinc oxide nanoparticles . Part Fibre Toxicol 2009 ; 6 : 32 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Bitterle E , Karg E, Schroeppel A et al. Dose-controlled exposure of A549 epithelial cells at the air-liquid interface to airborne ultrafine carbonaceous particles . Chemosphere 2006 ; 65 : 1784 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Holder AL , Lucas D, Goth-Goldstein R et al. Cellular response to diesel exhaust particles strongly depends on the exposure method . Toxicol Sci 2008 ; 103 : 108 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Volckens J , Dailey L, Walters G et al. Direct particle-to-cell deposition of coarse ambient particulate matter increases the production of inflammatory mediators from cultured human airway epithelial cells . Environ Sci Technol 2009 ; 43 : 4595 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Tabei Y , Sonoda A, Nakajima Y et al. In vitro evaluation of the cellular effect of indium tin oxide nanoparticles using the human lung adenocarcinoma A549 cells . Metallomics 2015 ; 7 : 816 – 27 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Jugan ML , Barillet S, Simon-Deckers A et al. Titanium dioxide nanoparticles exhibit genotoxicity and impair DNA repair activity in A549 cells . Nanotoxicology 2012 ; 6 : 501 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Ohlinger K , Kolesnik T, Meindl C et al. Air-liquid interface culture changes surface properties of A549 cells . Toxicol in Vitro 2019 ; 60 : 369 – 82 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Loret T , Peyret E, Dubreuil M et al. Air-liquid interface exposure to aerosols of poorly soluble nanomaterials induces different biological activation levels compared to exposure to suspensions . Part Fibre Toxicol 2016 ; 13 :58. Google Scholar OpenURL Placeholder Text WorldCat 15. Wang GH , Zhang XF, Liu XY et al. Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models . Toxicol Lett 2019 ; 301 : 133 – 45 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Lehnert BE . Pulmonary and thoracic macrophage subpopulations and clearance of particles from the lung . Environ Health Perspect 1992 ; 97 : 17 – 46 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Furuyama A , Kanno S, Kobayashi T et al. Extrapulmonary translocation of intratracheally instilled fine and ultrafine particles via direct and alveolar macrophage-associated routes . Arch Toxicol 2009 ; 83 : 429 – 37 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Schwarze PE , Ovrevik J, Lag M et al. Particulate matter properties and health effects: consistency of epidemiological and toxicological studies . Hum Exp Toxicol 2006 ; 25 : 559 – 79 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Jalmi SK , Sinha AK. ROS mediated MAPK signaling in abiotic and biotic stress- striking similarities and differences . Front Plant Sci 2015 ; 6 : 769 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Dou C , Zhang J, Qi C. Cooking oil fume-derived PM2.5 induces apoptosis in A549 cells and MAPK/NF-small ka, CyrillicB/STAT1 pathway activation . Environ Sci Pollut Res Int 2018 ; 25 : 9940 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Wang J , Huang J, Wang L et al. Urban particulate matter triggers lung inflammation via the ROS-MAPK-NF-kappaB signaling pathway . J Thorac Dis 2017 ; 9 : 4398 – 412 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Yan Z , Jin Y, An Z et al. Inflammatory cell signaling following exposures to particulate matter and ozone . Biochim Biophys Acta 2016 ; 1860 : 2826 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Zhao Q , Chen H, Yang T et al. Direct effects of airborne PM2.5 exposure on macrophage polarizations . Biochim Biophys Acta 2016 ; 1860 : 2835 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Ovrevik J , Refsnes M, Lag M et al. Activation of proinflammatory responses in cells of the airway mucosa by particulate matter: oxidant- and non-oxidant-mediated triggering mechanisms . Biomolecules 2015 ; 5 : 1399 – 440 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Weng Y , Cai M, Zhu J et al. Matrix metalloproteinase activity in early-stage lung cancer . Onkologie 2013 ; 36 : 256 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Tsao SM , Hsia TC, Yin MC. Protocatechuic acid inhibits lung cancer cells by modulating FAK, MAPK, and NF-kappaB pathways . Nutr Cancer 2014 ; 66 : 1331 – 41 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Xia T , Kovochich M, Liong M et al. Comparison of the mechanism of toxicity of zinc oxide and cerium oxide nanoparticles based on dissolution and oxidative stress properties . ACS Nano 2008 ; 2 : 2121 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Liu W , Zhang M, Feng J et al. The influence of Quercetin on maternal immunity, oxidative stress, and inflammation in mice with exposure of fine particulate matter during gestation . Int J Environ Res Public Health 2017 ; 14 :592. Google Scholar OpenURL Placeholder Text WorldCat 29. Wang GH , Jiang RF, Zhao ZH et al. Effects of ozone and fine particulate matter (PM2.5) on rat system inflammation and cardiac function . Toxicol Lett 2013 ; 217 : 23 – 33 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Lichtveld KM , Ebersviller SM, Sexton KG et al. In vitro exposures in diesel exhaust atmospheres: resuspension of PM from filters versus direct deposition of PM from air . Environ Sci Technol 2012 ; 46 : 9062 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Raemy DO , Grass RN, Stark WJ et al. Effects of flame made zinc oxide particles in human lung cells - a comparison of aerosol and suspension exposures . Part Fibre Toxicol 2012 ; 9 : 1 – 18 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Ghio AJ , Dailey LA, Soukup JM et al. Growth of human bronchial epithelial cells at an air-liquid interface alters the response to particle exposure . Part Fibre Toxicol 2013 ; 10 : 1 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Herzog F , Loza K, Balog S et al. Mimicking exposures to acute and lifetime concentrations of inhaled silver nanoparticles by two different in vitro approaches . Beilstein J Nanotechnol 2014 ; 5 : 1357 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat 34. Panas A , Comouth A, Saathoff H et al. Silica nanoparticles are less toxic to human lung cells when deposited at the air-liquid interface compared to conventional submerged exposure . Beilstein J Nanotechnol 2014 ; 5 : 1590 – 602 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Gohlsch K , Muckter H, Steinritz D et al. Exposure of 19 substances to lung A549 cells at the air liquid interface or under submerged conditions reveals high correlation between cytotoxicity in vitro and CLP classifications for acute lung toxicity . Toxicol Lett 2019 ; 316 : 119 – 26 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Foster KA , Oster CG, Mayer MM et al. Characterization of the A549 cell line as a type II pulmonary epithelial cell model for drug metabolism . Exp Cell Res 1998 ; 243 : 359 – 66 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Balis JU , Bumgarner SD, Paciga JE et al. Synthesis of lung surfactant-associated glycoproteins by A549 cells: description of an in vitro model for human type II cell dysfunction . Exp Lung Res 1984 ; 6 : 197 – 213 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Klein SG , Hennen J, Serchi T et al. Potential of coculture in vitro models to study inflammatory and sensitizing effects of particles on the lung . Toxicol in Vitro 2011 ; 25 : 1516 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Crapo JD , Barry BE, Gehr P et al. Cell number and cell characteristics of the normal human lung . Am Rev Respir Dis 1982 ; 126 : 332 – 7 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 40. Leibrock L , Wagener S, Singh AV et al. Nanoparticle induced barrier function assessment at liquid-liquid and air-liquid interface in novel human lung epithelia cell lines . Toxicol Res UK 2019 ; 8 : 1016 – 27 . Google Scholar Crossref Search ADS WorldCat 41. Hermanns MI , Unger RE, Kehe K et al. Lung epithelial cell lines in coculture with human pulmonary microvascular endothelial cells: development of an alveolo-capillary barrier in vitro . Lab Investig 2004 ; 84 : 736 – 52 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Herzog E , Byrne HJ, Casey A et al. SWCNT suppress inflammatory mediator responses in human lung epithelium in vitro . Toxicol Appl Pharmacol 2009 ; 234 : 378 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Don Porto Carero A , Hoet PH, Verschaeve L et al. Genotoxic effects of carbon black particles, diesel exhaust particles, and urban air particulates and their extracts on a human alveolar epithelial cell line (A549) and a human monocytic cell line (THP-1) . Environ Mol Mutagen 2001 ; 37 : 155 – 63 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Abe S , Takizawa H, Sugawara I et al. Diesel exhaust (DE)-induced cytokine expression in human bronchial epithelial cells: a study with a new cell exposure system to freshly generated DE in vitro . Am J Respir Cell Mol Biol 2000 ; 22 : 296 – 303 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Kroll A , Dierker C, Rommel C et al. Cytotoxicity screening of 23 engineered nanomaterials using a test matrix of ten cell lines and three different assays . Part Fibre Toxicol 2011 ; 8 : 9 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Bihari P , Vippola M, Schultes S et al. Optimized dispersion of nanoparticles for biological in vitro and in vivo studies . Part Fibre Toxicol 2008 ; 5 : 14 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Bachofen H , Schurch S. Alveolar surface forces and lung architecture . Comp Biochem Physiol A Mol Integr Physiol 2001 ; 129 : 183 – 93 . Google Scholar Crossref Search ADS PubMed WorldCat 48. Patel VI , Metcalf JP. Airway macrophage and dendritic cell subsets in the resting human lung . Crit Rev Immunol 2018 ; 38 : 303 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat 49. Jan R , Roy R, Bhor R et al. Toxicological screening of airborne particulate matter in atmosphere of Pune: reactive oxygen species and cellular toxicity . Environ Pollut 2019 ; 261 :113724. Google Scholar OpenURL Placeholder Text WorldCat 50. Rothen-Rutishauser B , Blank F, Muhlfeld C et al. In vitro models of the human epithelial airway barrier to study the toxic potential of particulate matter . Expert Opin Drug Metab Toxicol 2008 ; 4 : 1075 – 89 . Google Scholar Crossref Search ADS PubMed WorldCat 51. Ross AJ , Dailey LA, Brighton LE et al. Transcriptional profiling of mucociliary differentiation in human airway epithelial cells . Am J Respir Cell Mol Biol 2007 ; 37 : 169 – 85 . Google Scholar Crossref Search ADS PubMed WorldCat 52. Chen Y , Yang Y, Xu B et al. Mesoporous carbon nanomaterials induced pulmonary surfactant inhibition, cytotoxicity, inflammation and lung fibrosis . J Environ Sci 2017 ; 62 : 100 – 14 . Google Scholar Crossref Search ADS WorldCat 53. Donaldson K , Stone V, Seaton A et al. Ambient particle inhalation and the cardiovascular system: potential mechanisms . Environ Health Perspect 2001 ; 109 : 523 – 7 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 54. Kelly FJ , Fussell JC. Air pollution and airway disease . Clin Exp Allergy 2011 ; 41 : 1059 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat 55. Li N , Hao M, Phalen RF et al. Particulate air pollutants and asthma. A paradigm for the role of oxidative stress in PM-induced adverse health effects . Clin Immunol 2003 ; 109 : 250 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 56. Janssen-Heininger YM , Macara I, Mossman BT. Cooperativity between oxidants and tumor necrosis factor in the activation of nuclear factor (NF)-kappaB: requirement of Ras/mitogen-activated protein kinases in the activation of NF-kappaB by oxidants . Am J Respir Cell Mol Biol 1999 ; 20 : 942 – 52 . Google Scholar Crossref Search ADS PubMed WorldCat 57. Kleinman MT , Araujo JA, Nel A et al. Inhaled ultrafine particulate matter affects CNS inflammatory processes and may act via MAP kinase signaling pathways . Toxicol Lett 2008 ; 178 : 127 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 58. Morales-Barcenas R , Chirino YI, Sanchez-Perez Y et al. Particulate matter (PM(1)(0)) induces metalloprotease activity and invasion in airway epithelial cells . Toxicol Lett 2015 ; 237 : 167 – 73 . Google Scholar Crossref Search ADS PubMed WorldCat 59. Atkinson JJ , Senior RM. Matrix metalloproteinase-9 in lung remodeling . Am J Respir Cell Mol Biol 2003 ; 28 : 12 – 24 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Co-culture of human alveolar epithelial (A549) and macrophage (THP-1) cells to study the potential toxicity of ambient PM2.5: a comparison of growth under ALI and submerged conditions
JF - Toxicology Research
DO - 10.1093/toxres/tfaa072
DA - 2020-10-29
UR - https://www.deepdyve.com/lp/oxford-university-press/co-culture-of-human-alveolar-epithelial-a549-and-macrophage-thp-1-tg0zalB7fP
SP - 636
EP - 651
VL - 9
IS - 5
DP - DeepDyve
ER -