TY - JOUR
AU - García-Peñarrubia, P
AB - Summary Great effort has been paid to identify novel targets for pharmaceutical intervention to control inflammation associated with different diseases. We have studied the effect of signalling inhibitors in the secretion of the proinflammatory and profibrogenic cytokine interleukin (IL)-1β in monocyte-derived macrophages (M-DM) obtained from the ascites of cirrhotic patients and compared with those obtained from the blood of healthy donors. Peritoneal M-DM were isolated from non-infected ascites of cirrhotic patients and stimulated in vitro with lipopolysaccharide (LPS) and heat-killed Candida albicans in the presence or absence of inhibitors for c-Jun N-terminal kinase (JNK), mitogen-activated protein kinase kinase 1 (MEK1), p38 mitogen-activated protein kinase (MAPK) and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K). The IL1B and CASP1 gene expression were evaluated by quantitative reverse transcription–polymerase chain reaction (qRT–PCR). The expression of IL-1β and caspase-1 were determined by Western blot. IL-1β was also assayed by enzyme-linked immunosorbent assay (ELISA) in cell culture supernatants. Results revealed that MEK1 and JNK inhibition significantly reduced the basal and stimulated IL-1β secretion, while the p38 MAPK inhibitor had no effect on IL-1β levels. On the contrary, inhibition of PI3K increased the secretion of IL-1β from stimulated M-DM. The activating effect of PI3K inhibitor on IL-1β release was mediated mainly by the enhancement of the intracellular IL-1β and caspase-1 content release to the extracellular medium and not by increasing the corresponding mRNA and protein expression levels. These data point towards the role of MEK1 and JNK inhibitors, in contrast to the PI3K-protein kinase B inhibitors, as potential therapeutic tools for pharmaceutical intervention to diminish hepatic damage by reducing the inflammatory response mediated by IL-1β associated with liver failure. cytokines, inflammation, macrophages, protein kinases, signal transduction Introduction Liver cirrhosis is an end-stage hepatic derangement characterized by a progressive replacement of the hepatic architecture by non-functional fibrotic tissue. The implication of the innate immune system in the pathogenesis of liver cirrhosis has been largely described. In this respect, chronic hepatic inflammation and fibrosis are key features associated with macrophage accumulation in the liver [1,2]. Increased hepatic and systemic damage is also associated with the elevated production of proinflammatory cytokines such as interleukin (IL)-1β, tumour necrosis factor (TNF)-α and IL-6, as well as anti-inflammatory cytokines, IL-10 and transforming growth factor (TGF)-β [3]. Because macrophages are involved in many of the pathophysiological events associated with liver cirrhosis [4] these cells are good candidates as current targets for anti-inflammatory therapy intended to avoid progression of liver injury. Pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS), bactDNA, mannan and glucans, among others, are potent inducers of cytokine secretion from myeloid-derived monocytes and macrophages [5–7]. Our group previously reported the primed status of peritoneal monocyte-derived macrophages (M-DM) from cirrhotic patients, which is related to extracellular-regulated kinase (ERK) phosphorylation and IL-6 secretion [8] and, more recently, that the release of the proinflammatory cytokines tumour necrosis factor (TNF)-α and IL-6 by peritoneal M-DM from this clinical setting depends strongly upon the mitogen-activated protein kinase (MAPK) signalling pathways, while the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) protein kinase B (Akt) pathway plays a prominent role in the modulation of the anti-inflammatory IL-10-mediated function [9]. IL-1β is an important pleiotropic cytokine with immune and proinflammatory activities. Its potent proinflammatory role is mediated by induction of additional mediators, including IL-1β itself, IL-1α, TNF-α, IL-6, IL-8, cyclooxygenase-2 (COX-2) and prostaglandin E2 (PGE2). Its autocrine properties allow that even small localized IL-1β concentrations are able to induce potent biological functions [10]. Hence, processing and secretion of biologically active IL-1β is tightly regulated at several levels. Infectious and inflammatory mediators induce nuclear factor (NF)-κB-dependent transcription of the IL1B gene. IL-1β is further regulated at the level of RNA stability and translational control, and requires post-translational proteolytic cleavage to acquire its active properties. Activation of caspase-1 by inflammasome assembly plays a critical role in this process, although a caspase-1 non-dependent mechanism also exists for IL-1β processing [10]. Assembly of this multi-protein complex is triggered by a wide range of structurally diverse damage-associated molecular patterns (DAMPs) or PAMPs stimuli, and the signalling pathways involved in it, as well as its cross-talk with other intracellular signalling routes triggered by membrane PRRs, such as the MAPKs and PI3K–Akt, are poorly understood [11]. Related to liver cirrhosis, in a mouse model of alcoholic liver disease (ALD), IL-1β signalling was required for the development of inflammation and injury. The increase of IL-1β was caused by up-regulation of caspase-1 activity and inflammasome activation [12]. This group also found that IL-1β increased the hepatotoxic effect of TNF-α. Furthermore, during experimental liver fibrosis IL-1 levels were elevated, and the progression of liver fibrosis was lower in IL-1R-deficient mice. Additionally, it was found that the expression of matrix metalloproteinase-9 (MMP-9), matrix metalloproteinase-13 (MMP-13) and tissue inhibitor of metalloproteinase-1 (TIMP) regulators of fibrosis is dependent upon IL-1β [13]. However, the specific role of caspase-1 versus other caspases or proteases in liver fibrosis remains to be fully understood [14]. In this study we have explored the relative importance of ERK1/2, c-Jun N-terminal kinase (JNK) and p38 MAPK and PI3K–Akt pathways on the expression and release of the inflammatory cytokine IL-1β in M-DM obtained from the ascites of cirrhotic patients, trying to gain further insight into the pathogenesis of liver cirrhosis that could lead to the identification of novel targets for pharmaceutical intervention to prevent or reduce hepatic damage. For this aim, we have examined the effects of several MAPK and PI3K–Akt inhibitors on baseline and lipopolysaccharide (LPS)- and Candida albicans-stimulated secretion of IL-1β in M-DM from the ascites of cirrhotic patients. M-DM from the blood of healthy controls was assayed as a reference population. As agents triggering cytokine secretion through interaction with PRRs we have used soluble LPS, recognized by the complex Toll-like receptor-4 (TLR-4)/CD14/MD2, and compared with particulate heat-killed yeast cells, whose polysaccharide structures are recognized mainly, although not exclusively, by lectin receptors, either independently or in co-operation with TLR-2 and -4 or other signalling receptors. These stimuli trigger different intracellular pathways inducing not only cytokines secretion but, in the case of C. albicans, also phagocytosis [6]. The ‘primed status’ of M-DM from ascites of cirrhotic patients could be the consequence of a persistent low-level challenge with gut translocated bacterial products, from which spontaneous bacterial peritonitis is the most frequent and fatal complication. It has been described in murine experimental models that translocated bacterial products are located in mesenteric nodes and ascitic fluid. Hence, studies of the immune status of peritoneal cells in cirrhosis are relevant, and these findings must be related to the general immune status of cirrhotic patients. A fuller understanding of the molecular mechanisms of macrophage activation in this pathological scenario is clearly desirable in delineating therapeutic target molecules to reduce the inflammatory response associated with liver failure. Material and methods Ethics statement The ethics committees (Comité Ético de Investigación Clínica Hospital General de Alicante, Hospital Universitario Virgen de la Arrixaca, and Comité de Bioética de la Universidad de Murcia) approved the study protocol and all patients gave informed written consent to be included in this study. Patients Enrolled patients were admitted at the Liver Unit of Hospital General Universitario de Alicante, Spain or the Liver Transplant Unit of Hospital Universitario Virgen de la Arrixaca, Murcia, Spain. Cirrhosis was diagnosed by histology or by clinical, laboratory and/or ultrasonographic findings. Patients with detectable levels of LPS in ascites were excluded. Other exclusion criteria were the presence of a positive blood or ascites culture, an ascites polymorphonuclear (PMN) count equal to or higher than 250/μl [15], signs or symptoms of systemic inflammatory response syndrome [16], upper gastrointestinal bleeding, hepatocellular carcinoma fulfilling Milan criteria [17] and/or portal thrombosis, previous liver transplantation, transjugular intrahepatic portosystemic shunt, norfloxacin treatment as prophylaxis of spontaneous bacterial peritonitis, age older than 80 or younger than 18 years, aetiology other than chronic alcohol intake or hepatitis C virus (HCV) chronic infection and refusal to participate in the study. Some of the patients included in this study were the subjects of a previous study published recently by our group [9]. Peripheral blood and ascites were collected from 20 patients with cirrhosis requiring a large-volume paracentesis at admission. Blood was obtained for routine haematological, biochemical and coagulation studies. Simultaneously, a large-volume paracentesis was performed on all patients at admission in aseptic conditions following the usual procedures to obtain ascites [18]. All patients received intravenous albumin after paracentesis (8 g/l of ascites) as routine protocol if the volume of ascites evacuated was greater than 5 litres. Samples for routine biochemical study and PMN counts were obtained. Ascites was inoculated at bedside in aerobic and anaerobic blood culture bottles, 10 ml each [19]. Isolation and stimulation of M-DM Ascites samples were centrifuged at 500 g and cells were collected, washed in phosphate-buffered saline (PBS) and then resuspended in Dulbecco's modified Eagle's medium (DMEM) (Gibco Invitrogen, Paisley, UK). Cells from ascites were stained with mouse anti-human CD14-fluorescein isothiocyanate (FITC) (eBioscience, San Diego, CA, USA) antibody, and mouse immunoglobulin (Ig)G1-FITC antibody was used as isotype control (BD Pharmingen, San Diego, CA, USA), as described previously [8]. Flow cytometry analyses were performed to determine the percentage of CD14+ cells in the ascites. Cells were then seeded for panning at 0·2 × 106 M-DM/well in 96-well plates for enzyme-linked immunosorbent assay (ELISA), or 1–2 × 106 M-DM/well in six-well plates for immunoblotting or mRNA extraction, according to the percentage of CD14+ cells in the sample. After an overnight incubation at 37°C in complete culture medium (CCM), consisting of DMEM (Gibco Invitrogen) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Flow Laboratories, Irvine, UK), cells were washed with CCM to eliminate non-adhered cells, including lymphocytes. The purity of the M-DM in cell culture was more than 95%. M-DM were then treated directly with 0·1 μg/ml LPS (Escherichia coli serotype 0111.B4, Sigma Aldrich, Saint Louis, MO, USA) or heat-killed C. albicans SC5314 strain at a ratio of 1:5 cell : yeasts, and cell culture supernatants were collected after 24 h for cytokine detection, or maintained for 3 h in serum starvation conditions (2% FBS) and treated for 15 min with 5 μg/ml LPS or heat-killed C. albicans at a ratio of 1:5 cell : yeasts for immunoblotting analysis of cell lysates. When needed, the cells were treated with 50 μM of intracellular signalling inhibitors 30 min before stimulation. The intracellular signalling inhibitors, PD98059 [mitogen-activated protein kinase kinase 1 (MEK1) inhibitor], SB203580 (p38 MAPK inhibitor), SP600125 (JNK inhibitor) and LY294002 (PI3K inhibitor) were obtained from Sigma Aldrich. Caspase-1 inhibitor YVAD was from Calbiochem (Gibbstown, NJ, USA). Blood from 20 healthy donors was collected to obtain control M-DM, diluted with sterile PBS and layered in tubes containing Ficoll (Axis-Shield PoC As, Oslo, Norway). Lympho/monocyte fractions were collected and washed with DMEM. Before seeding for panning, the percentage of monocytes present in the lympho/monocyte fraction was determined by flow cytometry. Cells were seeded for 24 h and then treated as described above for ELISA and immunoblotting tests. When needed, cell viability was measured in triplicate by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay [20]. Briefly, 100 μl of MTT (2 mg/ml) (Sigma-Aldrich) in CCM were added to each well and incubated at 37°C for 4 h. The formed formazan crystals were solubilized in 100 μl isopropanol, 0·04 N HCl, 0·1% Tween-20 (Sigma-Aldrich), and the absorbance was then measured at 550 nm using a microplate reader. Cellular lysates and immunoblotting Protein extracts were obtained and treated as described elsewhere [8]. Primary antibodies against IL-1β (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), caspase-1 (Invitrogen, Camarillo, CA, USA) and β-actin (Sigma Aldrich) were used before incubation with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody. The activity of membrane-bound peroxidase was detected by using an enhanced chemiluminescent detection method (Enhanced ChemiLuminescence system©; Amersham Pharmacia Biotech, Piscataway, NJ, USA). Protein bands were quantified by densitometry using Scion Image software and expressed relative to β-actin. ELISAs Cell culture supernatants were assayed by ELISA kits for IL-1β. The assay was performed in triplicate following the manufacturer's instructions (eBioscience, San Diego, CA, USA). The absorbance in each well was measured with a microplate reader at 450 nm and corrected at 570 nm. mRNA expression analysis Total cellular RNA was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany). The cDNA was reversed-transcribed from 1 μg total RNA using a first-strand reverse transcription kit (Invitrogen). Quantitative reverse transcription–polymerase chain reaction (qRT–PCR) was carried out using SYBR green master mix on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) and specific primer sets for gene encoding caspase-1 (CASP1), interleukin (IL)-1β (IL1B) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Amplification reactions were performed under the following conditions: 10 min 95°C, 40 cycles for 15 s at 95°C and 1 min at 60°C. Each sample was run in triplicate and normalized to GAPDH. The specificity of primers was confirmed by melt curve analysis. Data were collected and analysed using the software 7500 System SDS 1·4 (Applied Biosystems). Relative transcript levels were calculated using the ΔΔCt method. Primer sequences were as follows: CASP1, forward TTTCCGCAAGGTTCGATTTTCA, reverse GGCATCTGCGCTCTACCATC; IL1B, forward ACAGATGAAGTGCTCCTTCCA, reverse GTCGGAGATTCGTAGCTGGAT; and GAPDH, forward CATGTTCCAATATGATTCCACC, reverse CCTGGAAGATGGTGATGG. Statistical analysis Results are reported as either median and interquartile range (IQR) [represented graphically as box-plots, where the top and bottom of the box are the 25th and 75th percentiles (the lower and upper quartiles, respectively) and the band inside the box is the 50th percentile (the median), the end of the whiskers represents the lowest datum still within 1·5 IQR of the lower quartile, and the highest datum still within 1·5 IQR of the upper quartile] or histograms representing mean ± standard error of the mean (s.e.m.). The observations considered as outliers are not represented. Statistical differences were analysed using the Mann–Whitney U-test and Wilcoxon's signed-rank test. All reported P-values are two-sided, and P-values lower than 0·05 were considered statistically significant. All calculations were performed using spss version 19·0 software (SPSS, Inc., Chicago, IL, USA). Reporting of the study conforms to Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) and Enhancing the QUAlity and Transparency Of health Research (EQUATOR) guidelines [21]. Results Effect of MAPK and PI3K inhibitors on the LPS- and heat-killed C. albicans-stimulated IL-1β release from M-DM of cirrhotic patients We have recently described that secretion of the proinflammatory cytokines IL-6 and TNF-α in peritoneal M-DM from cirrhotic patients depends strongly upon the MAPK signalling pathways [9]. IL-1β is a potent inflammatory cytokine involved in acute and chronic inflammatory diseases. Herein, we further explored the effect of specific MAPK and PI3K inhibitors on both the IL-1β baseline secretion and the LPS- and heat-killed C. albicans-stimulated IL-1β release from peritoneal M-DM from 17 cirrhotic patients. The clinical and analytical characteristics of patients included in this study are shown in Table 1. Alcoholic or hepatitis C viral cirrhotic patients were not stratified, as we have reported recently that there were no significant differences in basal, LPS- or C. albicans-stimulated IL-1β secretion between them [22], which justifies consideration here as a homogeneous group of work. As can be observed in Fig. 1, the baseline secretion of IL-1β (11·13 pg/106 cells) was decreased significantly in the presence of JNK and MEK1 inhibitors, 95 and 66·7% inhibition from untreated controls, respectively (Fig. 1a,b), whereas p38 MAPK and PI3K inhibitors had no significant effect (Fig. 1c,d). As expected, LPS induced a significant increase of the secreted IL-1β (89·69 pg/106 cells) that was decreased statistically by the JNK and MEK1 inhibitors, 64·6 and 80·4% inhibition, respectively (Fig. 1a,b), while inhibition of p38 MAPK phosphorylation did not affect the LPS-induced IL-1β secretion (Fig. 1c). Strikingly, inhibition of PI3K turned out to favour the LPS-induced secretion of IL-1β, reaching 6·9-fold activation level (Fig. 1d). Stimulation of peritoneal M-DM with heat-killed C. albicans induced a strong increase on the secretion of IL-1β (322·79 pg/106 cells), which was only statistically inhibited in the presence of the JNK inhibitor (87% inhibition) and the MEK1 inhibitor (71·4% inhibition) (Fig. 1a,b). Of note, the inhibition of PI3K significantly increases 2·3-fold the C. albicans-induced secretion of IL-1β (Fig. 1d). Viability assessed by the MTT method in M-DM treated with the signalling inhibitors did not vary significantly from untreated controls after 24 h in culture (data not shown). Table 1 Clinical and analytical characteristics of patients included in the study Variable . Patients with cirrhosis and culture-negative ascites (n = 20) . Aetiology (n) ALC (11), HCV (9) Age 56·3 (15·4) Male sex n (%) 17 (85) Previous episodes of ascites n (%) 17 (85) Child–Pugh mean score 9 (3·1) Meld mean score 15·1 (5·9) Bilirubin (mg/dl) 2·5 (2) Albumin (g/dl) 3·02 (0·9) Quick (%) 56·3 (24·5) Serum creatinine (mg/dl) 1·2 (0·9) Serum sodium (mEq/l) 131·8 (7·2) INR 1·50 (0·4) Blood WBC/mm3 4320 (2715) Ascites WBC/mm3 112 (133) Ascites total protein (g/dl) 1·6 (1·1) Variable . Patients with cirrhosis and culture-negative ascites (n = 20) . Aetiology (n) ALC (11), HCV (9) Age 56·3 (15·4) Male sex n (%) 17 (85) Previous episodes of ascites n (%) 17 (85) Child–Pugh mean score 9 (3·1) Meld mean score 15·1 (5·9) Bilirubin (mg/dl) 2·5 (2) Albumin (g/dl) 3·02 (0·9) Quick (%) 56·3 (24·5) Serum creatinine (mg/dl) 1·2 (0·9) Serum sodium (mEq/l) 131·8 (7·2) INR 1·50 (0·4) Blood WBC/mm3 4320 (2715) Ascites WBC/mm3 112 (133) Ascites total protein (g/dl) 1·6 (1·1) Continuous variables are expressed as median (interquartile range) and categorical variables as percentage. ALC = alcohol intake; HCV = hepatitis C virus chronic infection; INR = International Normalized Ratio; WBC = white blood cells. Open in new tab Table 1 Clinical and analytical characteristics of patients included in the study Variable . Patients with cirrhosis and culture-negative ascites (n = 20) . Aetiology (n) ALC (11), HCV (9) Age 56·3 (15·4) Male sex n (%) 17 (85) Previous episodes of ascites n (%) 17 (85) Child–Pugh mean score 9 (3·1) Meld mean score 15·1 (5·9) Bilirubin (mg/dl) 2·5 (2) Albumin (g/dl) 3·02 (0·9) Quick (%) 56·3 (24·5) Serum creatinine (mg/dl) 1·2 (0·9) Serum sodium (mEq/l) 131·8 (7·2) INR 1·50 (0·4) Blood WBC/mm3 4320 (2715) Ascites WBC/mm3 112 (133) Ascites total protein (g/dl) 1·6 (1·1) Variable . Patients with cirrhosis and culture-negative ascites (n = 20) . Aetiology (n) ALC (11), HCV (9) Age 56·3 (15·4) Male sex n (%) 17 (85) Previous episodes of ascites n (%) 17 (85) Child–Pugh mean score 9 (3·1) Meld mean score 15·1 (5·9) Bilirubin (mg/dl) 2·5 (2) Albumin (g/dl) 3·02 (0·9) Quick (%) 56·3 (24·5) Serum creatinine (mg/dl) 1·2 (0·9) Serum sodium (mEq/l) 131·8 (7·2) INR 1·50 (0·4) Blood WBC/mm3 4320 (2715) Ascites WBC/mm3 112 (133) Ascites total protein (g/dl) 1·6 (1·1) Continuous variables are expressed as median (interquartile range) and categorical variables as percentage. ALC = alcohol intake; HCV = hepatitis C virus chronic infection; INR = International Normalized Ratio; WBC = white blood cells. Open in new tab Fig. 1 Open in new tabDownload slide Effect of cell signalling inhibitors on the interleukin (IL)-1β release in monocyte-derived macrophages (M-DM) from ascites. M-DM were isolated from patients with cirrhosis and ascites (n = 17) and the IL-1β concentration was measured by enzyme-linked immunosorbent assay (ELISA) in 24-h cell culture supernatants at baseline or following treatment with lipopolysaccharide (LPS) or Candida albicans, with or without co-treatment with the signalling inhibitors for c-Jun N-terminal kinase (JNK) (a), mitogen-activated protein kinase kinase 1 (MEK1) (b), p38 mitogen-activated protein kinase (MAPK) (c) and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) (d). Results are expressed as pg IL-1β/106 cells and represented as box-plots. Wilcoxon's signed-rank test: *P < 0·05; ***P < 0·001 between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01, between absence and presence of signalling inhibitors (I) for each condition (resulting % of inhibition or fold-activation are indicated over the boxes). Fig. 1 Open in new tabDownload slide Effect of cell signalling inhibitors on the interleukin (IL)-1β release in monocyte-derived macrophages (M-DM) from ascites. M-DM were isolated from patients with cirrhosis and ascites (n = 17) and the IL-1β concentration was measured by enzyme-linked immunosorbent assay (ELISA) in 24-h cell culture supernatants at baseline or following treatment with lipopolysaccharide (LPS) or Candida albicans, with or without co-treatment with the signalling inhibitors for c-Jun N-terminal kinase (JNK) (a), mitogen-activated protein kinase kinase 1 (MEK1) (b), p38 mitogen-activated protein kinase (MAPK) (c) and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) (d). Results are expressed as pg IL-1β/106 cells and represented as box-plots. Wilcoxon's signed-rank test: *P < 0·05; ***P < 0·001 between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01, between absence and presence of signalling inhibitors (I) for each condition (resulting % of inhibition or fold-activation are indicated over the boxes). Effect of MAPK and PI3K inhibitors on the LPS- and heat-killed C. albicans-stimulated IL-1β release from M-DM of healthy donors To discern whether this phenomenon was specific for cirrhotic peritoneal M-DM we performed parallel analysis of the basal, LPS- or C. albicans-stimulated IL-1β levels, and the effect of the inhibitors of MAPKs and PI3K signalling pathways on the IL-1β release in M-DM from the blood of healthy donors. The baseline secretion of IL-1β from M-DM from the blood of 20 healthy donors (11·9 pg/106 cells) was also increased significantly after stimulation with LPS and C. albicans (1306·6 pg/106 and 649·3 pg/106 cells, respectively). Therefore, both M-DM populations produce similar basal levels of IL-1β and respond efficiently to LPS or C. albicans stimulation. Furthermore, as shown in Fig. 2, both cell populations behave similarly in the presence of the intracellular signalling inhibitors assayed, with the exception of the significant reduction of IL-1β basal levels recorded in the presence of the JNK and MEK1 inhibitors in M-DM from ascites versus M-DM from the blood of healthy donors (Fig. 1a,b versus Fig. 2a,b). Also, inhibition of PI3K enhanced the release of IL-1β in both M-DM populations, confirming the described regulatory role of PI3K in the secretion of IL-1β in healthy blood monocytes [23] (Fig. 2d). Nevertheless, while the increase of secreted IL-1β in the presence of LY294002 in M-DM of cirrhotic ascites was statistically significant in LPS- (6·9-fold activation) and C. albicans-stimulated cells (2·3-fold activation), those of M-DM from the blood of healthy donors were only significant on the basal levels (4·1-fold activation). In this regard, Molnarfi et al. [23] found the effect of LY294002 statistically significant in LPS-induced cells, although their observed increment was similar to ours (∼1·5-fold activation). This could be related to the donor's variability. Conversely, stimulation with C. albicans in the presence of LY294002 induced a non-significant decrease of IL-1β secretion in this cell population. Fig. 2 Open in new tabDownload slide Effect of cell signalling inhibitors on the interleukin (IL)-1β release in monocyte-derived macrophages (M-DM) from the blood of healthy donors. M-DM were isolated from the blood of healthy donors (n = 13) and the IL-1β concentration was measured by enzyme-linked immunosorbent assay (ELISA) in 24-h cell culture supernatants at baseline or following treatment with lipopolysaccharide (LPS) or Candida albicans, with or without co-treatment with the signalling inhibitors for c-Jun N-terminal kinase (JNK) (a), mitogen-activated protein kinase kinase 1 (MEK1) (b), p38 mitogen-activated protein kinase (MAPK) (c) and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) (d). Results are expressed as pg IL-1β/106 cells and represented as box-plots. Wilcoxon's signed-rank test: ***P < 0·001 between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01, between absence and presence of signalling inhibitors (I) for each condition (resulting % of inhibition or fold activation are indicated over the boxes). Fig. 2 Open in new tabDownload slide Effect of cell signalling inhibitors on the interleukin (IL)-1β release in monocyte-derived macrophages (M-DM) from the blood of healthy donors. M-DM were isolated from the blood of healthy donors (n = 13) and the IL-1β concentration was measured by enzyme-linked immunosorbent assay (ELISA) in 24-h cell culture supernatants at baseline or following treatment with lipopolysaccharide (LPS) or Candida albicans, with or without co-treatment with the signalling inhibitors for c-Jun N-terminal kinase (JNK) (a), mitogen-activated protein kinase kinase 1 (MEK1) (b), p38 mitogen-activated protein kinase (MAPK) (c) and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) (d). Results are expressed as pg IL-1β/106 cells and represented as box-plots. Wilcoxon's signed-rank test: ***P < 0·001 between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01, between absence and presence of signalling inhibitors (I) for each condition (resulting % of inhibition or fold activation are indicated over the boxes). Effect of PI3K inhibition on IL-1β gene and protein expression in M-DM from cirrhotic patients and healthy donors To explore whether the observed increments of secreted IL-1β induced by PI3K inhibition were mediated by an increase in the IL-1β gene expression, using qRT–PCR we analysed the basal, LPS- and heat-killed C. albicans-stimulated IL1B mRNA expression in the presence or absence of the PI3K inhibitor, LY294002. Basal expression of IL1B mRNA was higher in M-DM from ascites, although variability among patients precludes achieving statistically significant differences (Fig. 3a). As expected, LPS- and C. albicans-stimulation significantly increased the expression of IL1B mRNA in M-DM from ascites and blood of healthy controls (Fig. 3b,c). Inhibition of PI3K induced a non-significant increase of baseline IL-1β mRNA expression in both cell populations. However, the corresponding results on stimulated IL-1β mRNA expression were variable. Thus, while in M-DM from ascites the PI3K inhibitor produced a non-significant increase on LPS-induced, and a statistically significant decrease of C. albicans-induced IL-1B gene expression, it reduced the IL1B mRNA expression in both cases in M-DM from healthy controls, although this effect was only significant on LPS-stimulated cells. These results indicate that the effect of PI3K–Akt pathway inhibition on IL-1β gene expression does not suffice to explain the increments in the IL-1β secreted protein detected by ELISA described above (Figs 1d and 2d). As this technique mainly detects the mature form of IL-1β protein secreted to the medium, using Western blot we decided to analyse the total production, both the mature and immature forms, of IL-1β in both M-DM cell populations. The results shown in Fig. 3d revealed that ascitic M-DM express higher levels of intracellular IL-1β than blood M-DM, which is consistent with the higher, although not significant, mRNA expression level in ascitic M-DM described above (Fig. 3a). In addition, the intracellular content of IL-1β protein was noticeably increased in response to LPS and C. albicans treatment, and this effect was partially reduced by the addition of the PI3K inhibitor (Figs 3d and 4a). These data are consistent with the IL1B gene expression results shown in Fig. 3b,c, but not with those obtained when measured the secreted IL-1β in M-DM culture supernatants by ELISA (Figs 1d and 2d). To clarify this discrepancy, we also analysed by Western blot the content of IL-1β, both mature and pro-IL-1β, in culture supernatants of ascitic M-DM (Fig. 4b). The results showed that the extracellular levels of IL-1β correlated with those measured by ELISA (Fig. 4c). These findings demonstrate that whereas the stimulation with LPS or C. albicans increases the total content of the protein, which is mainly accumulated inside the cell, inhibition of PI3K induces the extracellular release of both the mature and immature forms of IL-1β. Fig. 3 Open in new tabDownload slide Basal and stimulated interleukin (IL)-1β modulation in response to phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibition in monocyte-derived macrophages (M-DM) from cirrhotic patients and healthy donors. M-DM were isolated from the ascites of patients with cirrhosis (n = 6) or from the blood of healthy donors (n = 6) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans in the presence or absence of the PI3K inhibitor LY294002. The IL1B gene expression was evaluated by quantitative reverse transcription–polymerase chain reaction (qRT–PCR) and normalized to GAPDH expression. Results of basal IL1B gene expression between both M-DM populations are referred to ascites basal levels, normalized as 1, and represented as histogram (a). Results of IL1B gene expression in ascites M-DM (b) and blood M-DM (c) populations are referred to their basal levels, normalized as 1, and represented as histograms. A representative Western blot of intracellular protein content of ascites and blood M-DM, indicating the expression of precursor and mature form of IL-1β is shown (d). Wilcoxon's signed-rank test: *P < 0·05; **P < 0·01; ***P < 0·001 between control and LPS or C. albicans treatments; ##P < 0·01 between absence and presence of the PI3K inhibitor. Fig. 3 Open in new tabDownload slide Basal and stimulated interleukin (IL)-1β modulation in response to phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibition in monocyte-derived macrophages (M-DM) from cirrhotic patients and healthy donors. M-DM were isolated from the ascites of patients with cirrhosis (n = 6) or from the blood of healthy donors (n = 6) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans in the presence or absence of the PI3K inhibitor LY294002. The IL1B gene expression was evaluated by quantitative reverse transcription–polymerase chain reaction (qRT–PCR) and normalized to GAPDH expression. Results of basal IL1B gene expression between both M-DM populations are referred to ascites basal levels, normalized as 1, and represented as histogram (a). Results of IL1B gene expression in ascites M-DM (b) and blood M-DM (c) populations are referred to their basal levels, normalized as 1, and represented as histograms. A representative Western blot of intracellular protein content of ascites and blood M-DM, indicating the expression of precursor and mature form of IL-1β is shown (d). Wilcoxon's signed-rank test: *P < 0·05; **P < 0·01; ***P < 0·001 between control and LPS or C. albicans treatments; ##P < 0·01 between absence and presence of the PI3K inhibitor. Fig. 4 Open in new tabDownload slide Interleukin (IL)-1β modulation in response to phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibition in ascites monocyte-derived macrophages (M-DM). M-DM were isolated from patients with cirrhosis and ascites (n = 17) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans in the presence or absence of the PI3K inhibitor LY294002. A representative Western blot of ascites M-DM lysates (a) and cell culture supernatants (b), indicating the expression of precursor and mature form of IL-1β is shown. Densitometric analysis of results are referred to basal levels, normalized as 1, and represented as histogram. The enzyme-linked immunosorbent assay (ELISA) quantification of the corresponding cell culture supernatants is shown (c). Results are expressed as pg IL-1β/106 cells and represented as histogram. Wilcoxon's signed-rank test: *P < 0·05; **P < 0·01, between control and LPS or C. albicans treatments; #P < 0·05, between absence or presence of the PI3K inhibitor (I). Fig. 4 Open in new tabDownload slide Interleukin (IL)-1β modulation in response to phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibition in ascites monocyte-derived macrophages (M-DM). M-DM were isolated from patients with cirrhosis and ascites (n = 17) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans in the presence or absence of the PI3K inhibitor LY294002. A representative Western blot of ascites M-DM lysates (a) and cell culture supernatants (b), indicating the expression of precursor and mature form of IL-1β is shown. Densitometric analysis of results are referred to basal levels, normalized as 1, and represented as histogram. The enzyme-linked immunosorbent assay (ELISA) quantification of the corresponding cell culture supernatants is shown (c). Results are expressed as pg IL-1β/106 cells and represented as histogram. Wilcoxon's signed-rank test: *P < 0·05; **P < 0·01, between control and LPS or C. albicans treatments; #P < 0·05, between absence or presence of the PI3K inhibitor (I). Role of caspase-1 on the release of IL-1β in M-DM from patients with cirrhosis and healthy donors Next, we planned to explore the role of caspase-1 on the increments of secreted IL-1β induced by LPS and C. albicans stimulation. Incubation of ascites M-DM with the specific caspase-1 inhibitor YVAD (Fig. 5) completely blocked the basal and LPS-induced release of IL-1β, whereas an incomplete blockage could be registered for that induced by C. albicans. Viability assessed by MTT method in M-DM treated with the caspase-1 inhibitor did not vary significantly from untreated controls after 24 h in culture (data not shown). Fig. 5 Open in new tabDownload slide Effect of caspase-1 inhibitor in the interleukin (IL)-1β release from ascites monocyte-derived macrophages (M-DM). Peritoneal M-DM were isolated from patients with cirrhosis and ascites (n = 5) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans. IL-1β content was determined by enzyme-linked immunosorbent assay (ELISA) in the presence or absence of the caspase-1 inhibitor YVAD in ascites M-DM. Results are expressed as pg IL-1β/106 cells and represented as histogram. Wilcoxon's signed-rank test: **P < 0·01, between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01, between absence and presence of the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibitor. Fig. 5 Open in new tabDownload slide Effect of caspase-1 inhibitor in the interleukin (IL)-1β release from ascites monocyte-derived macrophages (M-DM). Peritoneal M-DM were isolated from patients with cirrhosis and ascites (n = 5) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans. IL-1β content was determined by enzyme-linked immunosorbent assay (ELISA) in the presence or absence of the caspase-1 inhibitor YVAD in ascites M-DM. Results are expressed as pg IL-1β/106 cells and represented as histogram. Wilcoxon's signed-rank test: **P < 0·01, between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01, between absence and presence of the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibitor. Furthermore, we planned to explore the role of PI3K inhibition on the basal and LPS- or C. albicans-induced expression of caspase-1. For this purpose, we analysed the CASP1 gene expression levels in M-DM from ascites and blood controls. The results shown in Fig. 6a demonstrated that peritoneal M-DM from cirrhotic patients exhibited significantly lower CASP1 gene expression levels than M-DM from healthy donors. As expected, LPS stimulation significantly increased the expression of CASP1 mRNA in both cell groups (Fig. 6b,c), while its expression did not vary in response to C. albicans stimulation in both M-DM types. The possible existence of a faster modulation and recovery to basal levels of CASP1 gene expression in response to C. albicans was discarded after analysis at shorter incubation times (4 and 6 h, data not shown). Inhibition of PI3K induced a significant reduction of CASP1 mRNA in LPS-stimulated M-DM from both groups and in blood M-DM basal levels, while there were no significant variations in the rest of the assayed conditions (Fig. 6b,c). Fig. 6 Open in new tabDownload slide Caspase-1 modulation in response to phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibition in ascites and control monocyte-derived macrophages (M-DM). M-DM were isolated from the ascites of patients with cirrhosis (n = 10) or from the blood of healthy donors (n = 6) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans in the presence or absence of the PI3K inhibitor LY294002. The CASP1 gene expression was evaluated by quantitative reverse transcription–polymerase chain reaction (qRT–PCR) and normalized to GAPDH expression. Results of basal CASP1 expression between both M-DM populations are referred to ascites basal levels, normalized as 1, and represented as histogram (a). Results of CASP1 gene expression in ascites M-DM (b) and blood M-DM (c) populations are referred to their basal levels, normalized as 1, and represented as histograms. Densitometric analysis of results obtained by Western blot for caspase-1 protein expression and normalized to β-actin expression, in cell lysates of ascites M-DM (filled bars) and blood M-DM (empty bars), are referred to the ascites basal levels, normalized as 1, and represented as histograms (d). A representative Western blot of lysates and cell culture supernatants of ascites M-DM in the presence or absence of the PI3K inhibitor, indicating the expression of precursor and mature form of caspase-1 is shown. β-actin was used as loading control (e). Wilcoxon's signed-rank test: ** P < 0·01;, ***P < 0·001 between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01; ###P < 0·001 between absence and presence of the PI3K inhibitor; aP < 0·05 between blood and ascites. Fig. 6 Open in new tabDownload slide Caspase-1 modulation in response to phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibition in ascites and control monocyte-derived macrophages (M-DM). M-DM were isolated from the ascites of patients with cirrhosis (n = 10) or from the blood of healthy donors (n = 6) and stimulated for 24 h with lipopolysaccharide (LPS) or heat-killed Candida albicans in the presence or absence of the PI3K inhibitor LY294002. The CASP1 gene expression was evaluated by quantitative reverse transcription–polymerase chain reaction (qRT–PCR) and normalized to GAPDH expression. Results of basal CASP1 expression between both M-DM populations are referred to ascites basal levels, normalized as 1, and represented as histogram (a). Results of CASP1 gene expression in ascites M-DM (b) and blood M-DM (c) populations are referred to their basal levels, normalized as 1, and represented as histograms. Densitometric analysis of results obtained by Western blot for caspase-1 protein expression and normalized to β-actin expression, in cell lysates of ascites M-DM (filled bars) and blood M-DM (empty bars), are referred to the ascites basal levels, normalized as 1, and represented as histograms (d). A representative Western blot of lysates and cell culture supernatants of ascites M-DM in the presence or absence of the PI3K inhibitor, indicating the expression of precursor and mature form of caspase-1 is shown. β-actin was used as loading control (e). Wilcoxon's signed-rank test: ** P < 0·01;, ***P < 0·001 between control and LPS or C. albicans treatments; #P < 0·05; ##P < 0·01; ###P < 0·001 between absence and presence of the PI3K inhibitor; aP < 0·05 between blood and ascites. Next, we analysed by Western blot the cellular content of active caspase-1 in M-DM obtained from the ascites of cirrhotic patients or the blood of healthy donors. Results shown in Fig. 6d revealed that, in contrast with the CASP1 mRNA expression data, the caspase-1 basal protein levels were higher, although non-significantly, in ascites M-DM than those of control M-DM from blood. Furthermore, the increase of caspase-1 protein expression induced by LPS stimulation did not reach statistical significance in any cell group. In turn, the inhibition of PI3K reduced the LPS-stimulated caspase-1 levels significantly in blood M-DM, which is consistent with the corresponding CASP1 mRNA expression levels (Fig. 6c), although this was not the case for ascites M-DM. We could also register higher intracellular levels of active caspase-1 in ascites M-DM compared with the control M-DM population in all assayed conditions, which were statistically significant after LPS and C. albicans stimulation, and in response to PI3K-I alone or in combination with LPS. Representative Western blots from cell lysates of ascitic M-DM (Fig. 6e) show that (i) the intracellular caspase-1 protein is mainly in its active form, (ii) the results from cell culture supernatants revealed that caspase-1 was also secreted by these cells and (iii) that the PI3K inhibitor slightly enhanced its release, similar to what happened with the IL-1β. Discussion Liver cirrhosis is a difficult disease to treat, with a high morbidity and mortality rate [24]. There is great interest in the search to identify novel targets for the rational development of drugs able to modulate the balance of pro- and anti-inflammatory immune responses to provide therapeutic tools for many chronic diseases including, among others, rheumatoid arthritis, chronic inflammatory bowel disease and liver cirrhosis [25]. In this respect, among the 11 members of the IL-1 family, IL-1β is already a therapeutic target for a growing number of systemic and local inflammatory processes called autoinflammatory diseases, such as familial Mediterranean fever and others cryopyrinopathies, as well as chronic inflammatory diseases such as, among others, gout, rheumatoid arthritis, type 2 diabetes and recurrent pericarditis. In these processes, neutralization of IL-1β or its receptor results in a rapid and sustained improvement of disease severity [26,27]. Macrophages have a prominent role in the pathogenesis of chronic liver diseases [1,3,4]. We have recently described that the basal ‘alert’ state of peritoneal macrophages from patients with cirrhosis and non-infected ascites regarding production of both proinflammatory IL-6 and TNF-α and anti-inflammatory IL-10 cytokines can be modulated pharmacologically by inhibiting some of the MAPK and PI3K–Akt intracellular intermediates [9]. In this paper we have focused on the role of MEK1, JNK and p38 MAPK as well as PI3K–Akt pathways in the generation of the potent inflammatory initiating cytokine IL-1β in peritoneal M-DM of patients with advanced stages of liver cirrhosis compared with M-DM from the blood of healthy controls using specific inhibitors. As described above, 14 of the 20 patients included in this study were the subject of another recently published study [9]. The current analysis in the same cohort of patients demonstrated that the increase of IL-1β registered by PI3K inhibition could not be attributed to a potential variability of the samples, as this specific inhibitor concomitantly decreased the IL-6 and TNF-α and blocked the IL-10 release in that population, which validates our results. Additionally, under the current experimental conditions, stratification according the aetiology does not modify the overall findings of this work because, as we have reported recently, there were no significant differences in basal, LPS- or C. albicans-stimulated IL-1β secretion respect to the cirrhotic alcoholic or HCV aetiology [22]. Our present results show that there were no significant differences in both IL-1β secreted protein and IL1B mRNA basal levels between both M-DM assayed populations (although the tendency of the latter was higher for ascites M-DM). They also responded efficiently to LPS or C. albicans stimulation. None the less, as expected based on the current literature [28], the IL-1β response (protein and mRNA) of healthy blood M-DM was higher than that achieved by M-DM from cirrhotic ascites, probably because of their different state of differentiation. In line with our previous results related to TNF-α, we have observed that the increment of secreted IL-1β induced by heat-killed C. albicans was significantly higher than that induced by LPS [9]. Additionally, our results confirm and extend the prominent role played by the MAPK, ERK1/2 and JNK in the proinflammatory signature of baseline and stimulated ascitic M-DM, as inhibition of MEK1 and JNK significantly decreased its IL-1β basal (only in M-DM from ascites, which present an ‘alert state’) and LPS- and C. albicans-induced levels (in both M-DM populations). In contrast, p38 MAPK does not seem to play a significant role in the basal or activated secretion of IL-1β in these M-DM populations, because its inhibition did not produce significant effects. These findings are also consistent with our previous results related to proinflammatory cytokines IL-6 and TNF-α [9]. Notably, inhibition of PI3K by LY294002 globally enhanced the release of IL-1β, confirming the down-regulatory role of the PI3K–Akt pathway on the expression and secretion of this proinflammatory cytokine in human monocytes [29]. Regarding the effect of inhibition of PI3K in M-DM from cirrhotic ascites compared with control cells, we found that the increased secretion of IL-1β induced by LY294002 was more pronounced in both LPS- (6·9 versus 1·5-fold increments) and C. albicans-stimulated M-DM from ascites, supporting the ‘alert state’ of this population. Related to the results of PI3K inhibition on IL1B gene expression, Molnarfi et al. [23] described that it did not affect IL-1β mRNA steady-state levels in blood monocytes activated by LPS. Herein, we found a tendency to increase, albeit non-statistically, the basal and LPS-stimulated IL1B mRNA, while it did not increase, but reduced the IL-1β mRNA expression induced by C. albicans. These results demonstrated that the large increase of the secreted IL-1β induced by inhibition of the PI3K–Akt pathway could not be attributed to modulation of IL1B gene expression. Western blot analysis of peritoneal M-DM lysates and cell culture supernatants revealed that the PI3K inhibitor induced the release of both forms of IL-1β (pro-IL-1β and mature form) outside the cell, which explains the results obtained from secreted IL-1β by ELISA. The present work also confirms the different dependence on the intracellular signalling pathways elicited by each microbial stimulus [11,30]; i.e. the increase of secreted IL-1β induced by LPS in M-DM from ascites was more sensitive to PI3K inhibition than that induced by C. albicans (6·9- versus 2·3-fold increments, respectively). Altogether, the results point out that the role of PI3K is to retain the pool of IL-1β inside the cell (which is common for the two stimuli assayed), while its role in the expression of IL1B gene seems to be different when it is induced by LPS recognized by CD14/TLR-4, or by a particulate microorganism recognized mainly by lectin-like receptors. Related to the role of PI3K–Akt in the balance of pro- and anti-inflammatory cytokines, it has been described in LPS-stimulated PBMC cells that the constitutive active glycogen synthase kinase 3β (GSK3β) favours the gene induction of pro- versus anti-inflammatory cytokines. Then, TLR-4 dampens its own proinflammatory response by rapid induction (within minutes) of PI3K–Akt-mediated phosphorylation of GSK3β on Ser9. This inhibits its activity, decreases the proinflammatory cytokines TNF-α and IL-12 and increases IL-10 [31]. However, blood monocytes from patients with decompensated cirrhosis present a defect in PI3K–Akt-mediated GSK3β phosphorylation which results in unrestricted ‘proinflammatory’ activity of the enzyme [32]. In this regard, our previous and present results on PI3K inhibition (which has the opposite effect of GSK3β inhibition, used by Coant et al. [32]) do not attribute common behaviour in gene transcription and expression of all proinflammatory cytokines tested, TNF-α, IL-6 and IL-10 in M-DM from ascites [9,29]. These results also point towards a critical counterbalanced cross-talking between activating signals mediated by the MAPKs ERK1/2 and JNK, and inhibitory signals produced by PI3K–Akt on the release of IL-1β in peritoneal macrophages from the ascites of cirrhotic patients when triggered through TLR-4. However, intracellular signals triggered through lectin receptors alone or associated with others are less dependent on the regulatory role of PI3K, at least in this cell population. Most of the secreted IL-1β in monocytes and macrophages is dependent on the inflammasome complex assembly which processes pro-caspase-1 to its mature active form, caspase-1 [28]. It has been described that LPS is able to induce NF-κB-dependent transcription of the IL1B gene and secretion of IL-1β in peripheral blood monocytes, while it does not induce inflammasome activation in macrophages in the absence of specific triggering ligands, such as adenosine triphosphate (ATP), reactive oxygen species (ROS), flagellin, pore-forming toxins, etc. [28]. Conversely, as well as phagocytosis, C. albicans is able to induce inflammasome activation in the absence of other DAMPs or PAMPs [33]. Our results on LPS- and C. albicans-induced IL-1β in control M-DM obtained from blood monocytes confirm this fact. However, the LPS-induced increase of IL-1β in M-DM of ascites (probably with a high content of resident macrophages) in the absence of a second signal can be related to their ‘alert or primed’ state of activation prior to stimulation. It has been described recently that inflammasome activation seems to be a component of the liver pathophysiology in ALD, as the increased IL-1β was caused by up-regulation of caspase-1 activity and inflammasome activation, and was involved in the pathogenesis of alcohol-induced liver steatosis in mice [12]. Furthermore, components of caspase-1-inflammasome complex (NALP3 complex) are involved in the proteolytic activation and secretion of IL-1β in HCV-infected human hepatoma cells [34]. Also as described above, the expression of several regulators of fibrosis such as MMP-9, MMP-13 and TIMP is dependent upon IL-1β [13]. Nevertheless, the specific role of caspase-1 versus other caspases or proteases in liver fibrosis remains to be fully understood [14]. Based on these findings we analysed the caspase-1 implication in the IL-1β release in peritoneal M-DM from cirrhotic patients. Our results revealed that a specific caspase-1 inhibitor blocked completely the basal and LPS-induced release of IL-1β, whereas only a partial blockage could be obtained for the C. albicans-induced IL-1β release, suggesting the participation of caspase-1-dependent and -independent mechanisms in response to C. albicans, or also that the remaining caspase-1 could suffice to process the pro-IL-1β available inside the cell. In this regard, fungal and mycobacterial-induced pro-IL-1β processing has been described through the dectin-1 triggered mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1)–caspase-8–adaptor protein ASC non-canonical inflammasome complex [35]. Our results also showed that the expression of caspase-1 protein did not correlate well with those of gene expression, i.e. the basal levels of CASP1 expression in peritoneal M-DM from cirrhotic patients were significantly lower than those of M-DM from healthy controls, while the active caspase-1 protein levels were statistically similar in both populations. This could reflect differences at post-transcriptional or translational levels between both M-DM populations. In addition, the levels of pro-caspase-1 in ascites M-DM were very low compared to cleaved caspase-1, which could be indicative of a basal inflammasome activation in this cell population. Furthermore, while only stimulation with LPS increased the CASP1 gene expression, it did not achieve statistical significance on the levels of the mature caspase-1 protein in any M-DM population. Inhibition of PI3K did not have effect on the caspase-1 basal and C. albicans-stimulated levels in cell lysates of both M-DM populations, while it noticeably reduced its expression only in LPS-stimulated blood M-DM. Therefore, as this effect is not consistent with the increase of the extracellular release of IL-1β, it seems to indicate that the remaining intracellular content of caspase-1 must be enough to process IL-1β in all cases. Furthermore, caspase-1 is also secreted by ascitic M-DM, and the PI3K inhibitor enhanced this release, which enables its contribution to activate the pro-IL-1β released by these cells. In conclusion, this work shows that inhibition of MEK1 and JNK reduced the basal and stimulated IL-1β secretion, while the p38 MAPK inhibitor had no effect on that process. On the contrary, inhibition of PI3K increased the secretion of IL-1β in stimulated M-DM, and this effect was mediated mainly by the enhancement of the release of intracellular IL-1β and caspase-1 content towards the extracellular medium. The mechanisms involved in the enhancement of this unconventional secretion route by PI3K inhibition remain to be elucidated. Hence, these data, together with previous results, indicate the inhibitors of MEK1 and JNK as potential therapeutic tools for pharmaceutical intervention to diminish hepatic damage by reducing the inflammatory response mediated by IL-1β, IL-6 and TNF-α associated with liver failure. Conversely, PI3K–Akt inhibitors are discarded as potential therapy in hepatic fibrosis, as these drugs could enhance the inflammatory response by increasing the IL-1β release and suppressing the production of IL-10. Acknowledgements This study was funded by grant 11926/PI/09 from the Fundación Séneca, Comunidad Autónoma de la Región de Murcia, Spain. Ana Tapia-Abellán was supported by the Fundación Séneca (12302/FPI/09), Comunidad Autónoma de la Región de Murcia, Spain. Disclosure The authors have no conflicts of interest to disclose. References 1 Ramachandran P , Iredale JP. Macrophages: central regulators of hepatic fibrogenesis and fibrosis resolution . J Hepatol 2012 ; 56 : 1417 – 1419 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Zimmermann HW , Trautwein C, Tacke F. Functional role of monocytes and macrophages for the inflammatory response in acute liver injury . Front Physiol 2012 ; 3 : 56 . doi: 10.3389/fphys.2012.00056 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Dasarathy S . Inflammation and liver . J Parenter Enteral Nutr 2008 ; 32 : 660 – 666 . Google Scholar Crossref Search ADS WorldCat 4 Heymann F , Trautwein C, Tacke F. Monocytes and macrophages as cellular targets in liver fibrosis . Inflamm Allergy Drug Targets 2009 ; 8 : 307 – 318 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Sparwasser T , Miethke T, Lipford G et al. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-alpha-mediated shock . Eur J Immunol 1997 ; 27 : 1671 – 1679 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Jouault T , Sarazin A, Martinez-Esparza M, Fradin C, Sendid B, Poulain D. Host responses to a versatile commensal: PAMPs and PRRs interplay leading to tolerance or infection by Candida albicans . Cell Microbiol 2009 ; 11 : 1007 – 1015 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Heller J , Sogni P, Barriere E et al. Effects of lipopolysaccharide on TNF-alpha production, hepatic NOS2 activity, and hepatic toxicity in rats with cirrhosis . J Hepatol 2000 ; 33 : 376 – 381 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Ruiz-Alcaraz AJ , Martinez-Esparza M, Cano R et al. Peritoneal macrophage priming in cirrhosis is related to ERK phosphorylation and IL-6 secretion . Eur J Clin Invest 2011 ; 41 : 8 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Tapia-Abellan A , Ruiz-Alcaraz AJ, Hernandez-Caselles T et al. Role of MAP kinases and PI3K–Akt on the cytokine inflammatory profile of peritoneal macrophages from the ascites of cirrhotic patients . Liver Int 2013 ; 33 : 552 – 560 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Dinarello CA . Immunological and inflammatory functions of the interleukin-1 family . Annu Rev Immunol 2009 ; 27 : 519 – 550 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Latz E , Xiao TS, Stutz A. Activation and regulation of the inflammasomes . Nat Rev Immunol 2013 ; 13 : 397 – 411 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Petrasek J , Bala S, Csak T et al. IL-1 receptor antagonist ameliorates inflammasome-dependent alcoholic steatohepatitis in mice . J Clin Invest 2012 ; 122 : 3476 – 3489 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Gieling RG , Wallace K, Han YP. Interleukin-1 participates in the progression from liver injury to fibrosis . Am J Physiol Gastrointest Liver Physiol 2009 ; 296 : G1324 – G1331 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Szabo G , Csak T. Inflammasomes in liver diseases . J Hepatol 2012 ; 57 : 642 – 654 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Albillos A , Cuervas-Mons V, Millan I et al. Ascitic fluid polymorphonuclear cell count and serum to ascites albumin gradient in the diagnosis of bacterial peritonitis . Gastroenterology 1990 ; 98 : 134 – 140 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Rangel-Frausto MS , Pittet D, Costigan M, Hwang T, Davis CS, Wenzel RP. The natural history of the systemic inflammatory response syndrome (SIRS). A prospective study . JAMA 1995 ; 273 : 117 – 123 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Mazzaferro V , Regalia E, Doci R et al. Liver transplantation for the treatment of small hepatocellular carcinomas in patients with cirrhosis . N Engl J Med 1996 ; 334 : 693 – 699 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Runyon BA . Paracentesis of ascitic fluid. A safe procedure . Arch Intern Med 1986 ; 146 : 2259 – 2261 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Runyon BA , Canawati HN, Akriviadis EA. Optimization of ascitic fluid culture technique . Gastroenterology 1988 ; 95 : 1351 – 1355 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Mosmann T . Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays . J Immunol Methods 1983 ; 65 : 55 – 63 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Simera I , Moher D, Hoey J, Schulz KF, Altman DG. A catalogue of reporting guidelines for health research . Eur J Clin Invest 2010 ; 40 : 35 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Tapia-Abellan A , Martinez-Esparza M, Ruiz-Alcaraz AJ et al. The peritoneal macrophage inflammatory profile in cirrhosis depends on the alcoholic or hepatitis C viral etiology and is related to ERK phosphorylation . BMC Immunol 2012 ; 13 : 42 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Molnarfi N , Gruaz L, Dayer JM, Burger D. Opposite regulation of IL-1beta and secreted IL-1 receptor antagonist production by phosphatidylinositide-3 kinases in human monocytes activated by lipopolysaccharides or contact with T cells . J Immunol 2007 ; 178 : 446 – 454 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Chen CM , Yoon YH, Yi HY, Lucas DL. Alcohol and hepatitis C mortality among males and females in the United States: a life table analysis . Alcohol Clin Exp Res 2007 ; 31 : 285 – 292 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Alessandri AL , Sousa LP, Lucas CD, Rossi AG, Pinho V, Teixeira MM. Resolution of inflammation: mechanisms and opportunity for drug development . Pharmacol Ther 2013 ; 139 : 189 – 212 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Braddock M , Quinn A. Targeting IL-1 in inflammatory disease: new opportunities for therapeutic intervention . Nat Rev Drug Discov 2004 ; 3 : 330 – 339 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Dinarello CA . Interleukin-1 in the pathogenesis and treatment of inflammatory diseases . Blood 2011 ; 117 : 3720 – 3732 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Netea MG , Nold-Petry CA, Nold MF et al. Differential requirement for the activation of the inflammasome for processing and release of IL-1beta in monocytes and macrophages . Blood 2009 ; 113 : 2324 – 2335 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Antoniv TT , Ivashkiv LB. Interleukin-10-induced gene expression and suppressive function are selectively modulated by the PI3K–Akt–GSK3 pathway . Immunology 2011 ; 132 : 567 – 577 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Kawai T , Akira S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity . Immunity 2011 ; 34 : 637 – 650 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Martin M , Rehani K, Jope RS, Michalek SM. Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3 . Nat Immunol 2005 ; 6 : 777 – 784 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Coant N , Simon-Rudler M, Gustot T et al. Glycogen synthase kinase 3 involvement in the excessive proinflammatory response to LPS in patients with decompensated cirrhosis . J Hepatol 2011 ; 55 : 784 – 793 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Cheng SC , van de Veerdonk FL, Lenardon M et al. The dectin-1/inflammasome pathway is responsible for the induction of protective T-helper 17 responses that discriminate between yeasts and hyphae of Candida albicans . J Leukoc Biol 2011 ; 90 : 357 – 366 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Burdette D , Haskett A, Presser L, McRae S, Iqbal J, Waris G. Hepatitis C virus activates interleukin-1beta via caspase-1–inflammasome complex . J Gen Virol 2012 ; 93 : 235 – 246 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Gringhuis SI , Kaptein TM, Wevers BA et al. Dectin-1 is an extracellular pathogen sensor for the induction and processing of IL-1beta via a noncanonical caspase-8 inflammasome . Nat Immunol 2012 ; 13 : 246 – 254 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes These authors contributed equally to this work. © 2014 British Society for Immunology This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Regulatory role of PI3K-protein kinase B on the release of interleukin-1β in peritoneal macrophages from the ascites of cirrhotic patients
JO - Clinical & Experimental Immunology
DO - 10.1111/cei.12428
DA - 2014-11-07
UR - https://www.deepdyve.com/lp/oxford-university-press/regulatory-role-of-pi3k-protein-kinase-b-on-the-release-of-interleukin-sBYTtEthAP
SP - 525
EP - 536
VL - 178
IS - 3
DP - DeepDyve
ER -