TY - JOUR
AU - Bright Singh, I S
AB - Abstract A packed bed bioreactor (PBBR) was developed for rapid establishment of nitrification in brackish water hatchery systems in the tropics. The reactors were activated by immobilizing ammonia-oxidizing (AMONPCU-1) and nitrite-oxidizing (NIONPCU-1) bacterial consortia on polystyrene and low-density polyethylene beads, respectively. Fluorescence in situ hybridization demonstrated the presence of autotrophic nitrifiers belong to Nitrosococcus mobilis, lineage of β ammonia oxidizers and nitrite oxidizer Nitrobacter sp. in the consortia. The activated reactors upon integration to the hatchery system resulted in significant ammonia removal (P < 0.01) culminating to its undetectable levels. Consequently, a significantly higher percent survival of larvae was observed in the larval production systems. With spent water the reactors could establish nitrification with high percentage removal of ammonia (78%), nitrite (79%) and BOD (56%) within 7 days of initiation of the process. PBBR is configured in such a way to minimize the energy requirements for continuous operation by limiting the energy inputs to a single stage pumping of water and aeration to the aeration cells. The PBBR shall enable hatchery systems to operate under closed recirculating mode and pave the way for better water management in the aquaculture industry. Introduction On assuming the dimensions of an industry, aquaculture systems are bound to operate under strict environmental safety standards. With high land and water costs, the systems are destined to maintain high biological carrying capacity in relatively little space with minimal water exchange. These requirements led to the advent of recirculating aquaculture systems (RASs) which allowed companies to (1) be competitive in both domestic and world commodity markets by locating production closer to markets, (2) improve environmental control, (3) reduce catastrophic losses due to diseases, (4) avoid violation of environmental regulations on effluent discharge, (5) reduce management and labor costs, and (6) improve product quality and consistency [29]. Driven by the above demands, several attempts have been made to develop and optimize RAS focusing on total ammonia nitrogen (TAN) as the key limiting water quality parameter [18, 31, 33]. The toxic effects of ammonia have been demonstrated for several cultured crustaceans [26, 27, 72] and found more pronounced in early developmental stages. Nitrite is also harmful to larvae as it causes reduction of hemolymph oxyhemocyanin (in Penaeus monodon) with concomitant increase in the partial pressure of oxygen (pO2) in hemolymph and reduced oxygen affinity (P 50) [9]. However, it is less toxic than ammonia [3], and only under conditions of long-term exposure the toxicity is manifested [69] in the reared animals. Likewise, ammonia and nitrite toxicity in Macrobrachium rosenbergii adults and larvae have been investigated by various researchers [7, 8, 43, 65] and felt the need for their regulation for successful larval production. However, nitrate is relatively harmless to the cultured aquatic organisms [62]. In biological ammonia removal systems nitrifying activity of bacteria suspended in seawater has been reported to be extremely low primarily due to their slow growth rate and inhibition of nitrification by free ammonia and nitrite [19]. However, immobilization techniques have been useful to overcome the situation [61] and accordingly, fixed film nitrification biofilters are commonly used for TAN removal in RAS [56, 57, 70]. In such installations attached growth as biofilm offers several advantages over suspended culture-based systems, such as handling convenience, increased process stability to shock loading and prevention of the bacterial population from being washed off [17, 44]. In the light of the emergence of various types of biofilters, a performance rating strategy as well as standards for reporting the performance have been brought out to benefit the customers to choose the most appropriate one [10, 14, 38]. In spite of following such protocols, at least in a few cases, the immobilized nitrifiers in RAS have exhibited low performance, besides demanding too long a start-up period imposing operational difficulties [23, 61]. Therefore, instead of selecting a nitrification system from market it became imperative for the tropics to develop a user-friendly and economically viable technology having the advantages of short start-up time and easiness to integrate to the existing hatchery designs without modifications. Accordingly, a specialized nitrifying packed bed bioreactor (PBBR) (Patent application no. 828/DEL/2000 of 13 September 2000) was developed with indigenous nitrifying bacterial consortia (NBC) and tested for its potential for nitrification in a M. rosenbergii seed production system in support of the industry. Materials and methods Fabrication of the PBBR Cross-sectional view of the nitrifying bioreactors (ammonia oxidizing and nitrite oxidizing) connected serially is given in Fig. 1. Both the reactors have the same configuration consisting of shell made of fiberglass with a base of 30 cm2 and an overall height of 45 cm. A perforated base plate made of Perspex, carrying 30 cm long and 2 cm diameter 9 PVC pipes (airlift pumps) fixed at 10 cm equidistance, is positioned at the base of the reactor. When air gets passed through, the 10 cm3 area filled with the support medium surrounding each airlift pump acts as an aeration cell. The base plate is elevated by 5 cm from the bottom supported by 5 cm long PVC pipes having 3 cm diameter. An inlet pipe is fixed at a water discharge height of 35 cm up from the base of the reactor. The outlet pipe, which emerges from the base of the reactor, bends upward at water discharge height of 35 cm from the base to the next reactor. Fig. 1 Open in new tabDownload slide Cross-sectional view of the bioreactors connected serially (AOB ammonia-oxidizing bioreactor, NOB nitrite-oxidizing bioreactor, BP base plate, FM filter media, OS outer shell, IP inlet pipe, OP outlet pipe, AT aeration tubes, AS air supply) Based on a previous study [1], polystyrene (PS) and low-density polyethylene (LDPE) were selected as suitable support materials for immobilizing ammonia-oxidizing and nitrite-oxidizing consortia, respectively. This selection was based on percentage consumption of NH4–N/NO2–N and production of NO2–N/NO3–N by the immobilized nitrifiers on the beads, cost of the raw material and easiness to mold into beads. The beads were having 5 mm diameter and a surface area of 0.785 cm2 with spikes on the surface. The reactors have been packed with the respective support material; the characteristics are described in Table 1. Filter and media characteristics of the PBBR Filter height (m) 0.45 Water height (m) 0.40 Water discharge height (m) 0.35 Filter volume (L) 40 Total surface area of media (m2) 4.71 Total media volume (m3) 0.023 Specific surface area (m2/m3) 205 Filter height (m) 0.45 Water height (m) 0.40 Water discharge height (m) 0.35 Filter volume (L) 40 Total surface area of media (m2) 4.71 Total media volume (m3) 0.023 Specific surface area (m2/m3) 205 Open in new tab Filter and media characteristics of the PBBR Filter height (m) 0.45 Water height (m) 0.40 Water discharge height (m) 0.35 Filter volume (L) 40 Total surface area of media (m2) 4.71 Total media volume (m3) 0.023 Specific surface area (m2/m3) 205 Filter height (m) 0.45 Water height (m) 0.40 Water discharge height (m) 0.35 Filter volume (L) 40 Total surface area of media (m2) 4.71 Total media volume (m3) 0.023 Specific surface area (m2/m3) 205 Open in new tab Nitrifying bacterial consortia Two types of NBC, ammonia-oxidizing non-penaeid culture-1 (AMONPCU-1) and nitrite-oxidizing non-penaeid culture-1 (NIONPCU-1), developed by enrichment technique from brackish water systems under perpetual salinity regimes around 15 g/L were used after getting optimized growth and culture conditions [2]. This consisted of simple seawater-based medium having 15 g/L salinity supplemented with 10 mg/L substrate ((NH4)2·SO4/NaNO2), 2 mg/L KH2PO4 at an optimum temperature of 28°C and pH 8.5 for ammonia and 7.5 for nitrite oxidizers. After harvesting, the cultures were maintained at 4°C with periodic addition of the substrate ((NH4)2·SO4/NaNO2) and adjustment of pH (using 1% Na2CO3) to the optimum. For generating sufficient biomass in order to facilitate their immobilization in the reactors, both the consortia were acclimated to room temperature (27 ± 0.5°C) in 250 mL conical flasks on a shaker for 7 days, amplified in a 2 L baby fermentor for 1 month and subsequently mass produced in an indigenous NBC production unit (NBCPU) under optimum pH, temperature and salinity. The NBCPU consists of a 200 L fermentor vessel made of polyethylene, fixed with a central 0.5 HP AC/DC agitator (500 W, 0–500 rpm). Provisions have been given for (a) temperature regulation employing a thermo-circulator, (b) pH probe insertion, (c) addition of medium, (d) supply of filter sterilized air and (e) harvesting matured consortium [28]. Fluorescence in situ hybridization (FISH) of the consortia As a preliminary characterization, FISH analysis of the consortia was carried out using seven different nitrifier-specific 16S rRNA-targeted oligonucleotide probes labeled with Cy3, Cy5 or fluorescein (Table 2). The fluorescent oligonucleotide probes were purchased from Thermo Electron Corp. (Germany). The specificity and the hybridization conditions were confirmed with ‘Probebase’ [32]. Actively growing consortia, harvested by centrifugation, were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) containing KH2PO4 and NaCl, prepared in diluted seawater having salinity 15 g/L. The samples were stored at −20°C in a 1:1 mixture of PBS:ethanol until further processing. Hybridizations were performed on six-well Teflon-coated slides (Electron Microscopy Sciences, USA). Prior to the hybridization, the slides were coated with poly-l-lysin, 10 μL of the fixed consortia were spread on to the well, dried at 46°C for 10 min, and dehydrated by successive passage through 50, 80 and 98% ethanol (3 min each). Working solutions of the probes were prepared to obtain a final concentration 5 pmol/μL for CY3/5 and 8.3 pmol/μL for fluorescein-labeled probes. Hybridization buffer (2 mL) containing 360 μL 5 M NaCl, 40 μL 1 M Tris–HCl (pH 8.0), 4 μL 10% SDS and formamide were added according to the probe used (Table 2). For hybridization, 10 μL hybridization buffer was dispensed into the wells, and then 1 μL probe stock solution was added. A hybridization tube was prepared by folding a tissue paper into a 50 mL falcon tube into which the remainder of the hybridization buffer was dispensed. After the addition of probes, the slides were immediately transferred into the hybridization tube and incubated for 1.5 h at 46°C in a hybridization oven (Thermo Electron Corp.). Washing buffer containing 1 M Tris/HCl, 5 M NaCl and 0.5 M EDTA at pH 8 was prepared as per the formamide concentration in the hybridization buffer in a separate 50 mL Falcon tube and made up to 50 mL by adding MilliQ. Finally, 50 μL of 10% (w/v) SDS was added and the washing buffer was preheated at 48°C in a water bath. On elapse of the incubation period, the hybridization slides were taken out and rinsed and transferred to the washing buffer, where the slides were incubated for 10–20 min at 48°C. After the incubation the slides were rinsed with MilliQ water and dried. The cells were counter stained with DAPI having the final concentration of 0.2 μg/mL for 1 min, washed, dried and added an anti-fading mounting fluid (Vectashield, Vector Laboratories Inc., Burlingame, CA). The slides were observed under Olympus BX 51 epifluorescent microscope equipped with a monochromatic camera (Evolution VF, Media Cybernetics Inc., MD, USA). Images were processed using the “Image pro-express” software (Media Cybernetics Inc., MD, USA). Oligonucleotide probes and hybridization conditions applied in this study Probe . Target organisms . Probe sequence (5′–3′) . Fluorescent dye used for labeling . FAa (%) . NaClb (mM) . Reference . NSO190 Ammonia-oxidizing β subclass proteobacteria CGATCCCCTGCTTTTCTCC CY3 55 20 [41] NEU Halophilic and halotolerant members of the genus Nitrosomonas CCCCTCTGCTGCACTCTA CY5 40 56 [66] NSV443 Nitrosospira spp. CCGTGACCGTTTCGTTCCG CY3 30 112 [41] NmV Nitrosococcus mobilis lineage TCCTCAGAGACTACGCGG Fluorescein 35 80 [49] NIT2 Nitrobacter species CGGGTTAGCGCACCGCCT Cy5 40 56 [67] Ntspa712 Phylum Nitrospira CGCCTTCGCCACCGGCCTTCC CY3 50 28 [11] S-Amx-0820-a-A-22 Anaerobic ammonium-oxidizing bacteria AAAACCCCTCTACTTAGTGCCC Fluorescein 40 56 [54] Probe . Target organisms . Probe sequence (5′–3′) . Fluorescent dye used for labeling . FAa (%) . NaClb (mM) . Reference . NSO190 Ammonia-oxidizing β subclass proteobacteria CGATCCCCTGCTTTTCTCC CY3 55 20 [41] NEU Halophilic and halotolerant members of the genus Nitrosomonas CCCCTCTGCTGCACTCTA CY5 40 56 [66] NSV443 Nitrosospira spp. CCGTGACCGTTTCGTTCCG CY3 30 112 [41] NmV Nitrosococcus mobilis lineage TCCTCAGAGACTACGCGG Fluorescein 35 80 [49] NIT2 Nitrobacter species CGGGTTAGCGCACCGCCT Cy5 40 56 [67] Ntspa712 Phylum Nitrospira CGCCTTCGCCACCGGCCTTCC CY3 50 28 [11] S-Amx-0820-a-A-22 Anaerobic ammonium-oxidizing bacteria AAAACCCCTCTACTTAGTGCCC Fluorescein 40 56 [54] aPercentage of formamide in the hybridization buffer bConcentration of the sodium chloride in the washing buffer Open in new tab Oligonucleotide probes and hybridization conditions applied in this study Probe . Target organisms . Probe sequence (5′–3′) . Fluorescent dye used for labeling . FAa (%) . NaClb (mM) . Reference . NSO190 Ammonia-oxidizing β subclass proteobacteria CGATCCCCTGCTTTTCTCC CY3 55 20 [41] NEU Halophilic and halotolerant members of the genus Nitrosomonas CCCCTCTGCTGCACTCTA CY5 40 56 [66] NSV443 Nitrosospira spp. CCGTGACCGTTTCGTTCCG CY3 30 112 [41] NmV Nitrosococcus mobilis lineage TCCTCAGAGACTACGCGG Fluorescein 35 80 [49] NIT2 Nitrobacter species CGGGTTAGCGCACCGCCT Cy5 40 56 [67] Ntspa712 Phylum Nitrospira CGCCTTCGCCACCGGCCTTCC CY3 50 28 [11] S-Amx-0820-a-A-22 Anaerobic ammonium-oxidizing bacteria AAAACCCCTCTACTTAGTGCCC Fluorescein 40 56 [54] Probe . Target organisms . Probe sequence (5′–3′) . Fluorescent dye used for labeling . FAa (%) . NaClb (mM) . Reference . NSO190 Ammonia-oxidizing β subclass proteobacteria CGATCCCCTGCTTTTCTCC CY3 55 20 [41] NEU Halophilic and halotolerant members of the genus Nitrosomonas CCCCTCTGCTGCACTCTA CY5 40 56 [66] NSV443 Nitrosospira spp. CCGTGACCGTTTCGTTCCG CY3 30 112 [41] NmV Nitrosococcus mobilis lineage TCCTCAGAGACTACGCGG Fluorescein 35 80 [49] NIT2 Nitrobacter species CGGGTTAGCGCACCGCCT Cy5 40 56 [67] Ntspa712 Phylum Nitrospira CGCCTTCGCCACCGGCCTTCC CY3 50 28 [11] S-Amx-0820-a-A-22 Anaerobic ammonium-oxidizing bacteria AAAACCCCTCTACTTAGTGCCC Fluorescein 40 56 [54] aPercentage of formamide in the hybridization buffer bConcentration of the sodium chloride in the washing buffer Open in new tab Activation of the reactors with NBC The beads (substratum) were immersed in 0.1 N HCl for 3 h, washed with 10% Extran (Enviroeuip, Sydney, Australia), rinsed with tap water followed by distilled water and air dried. The reactor 1 was filled with 60,000 PS beads and the reactor 2 with the same number of LDPE. The ammonia-oxidizing and the nitrite-oxidizing consortia (20 L each) were introduced into the reactors 1 and 2, respectively, and airlift pumps operated by supplying 1 L/min to effect adequate circulation of the culture through the beads and to assure supply of O2 and CO2 for activation. Optimum culture conditions, as described under “Nitrifying bacterial consortia”, were maintained in each reactor during the activation period. The substrate concentrations (NH4–N/NO2–N) in both the reactors were made up to 10 mg/L daily by the addition of aqueous ammonium sulfate or sodium nitrite. Evaporation loss was made up by adding distilled water daily. Integration of the bioreactors into M. rosenbergii seed production system The facility used consisted of two larval rearing tanks of 5,000 L capacity, one integrated with the activated reactors and the other without any, used as control. Chlorinated–dechlorinated seawater (salinity 15 g/L) was used for all the experiments. The tanks were initially filled with 2,000 L seawater, freshly hatched mysis of M. rosenbergii, dipped in 0.025 mg/L formalin (SRL, Mumbai, India) for 20 s, 0.03 mg/L iodophore (Growel Formulations, Hyderabad, India) for 20 s and washed in running seawater, were introduced into the tanks at a stocking density of 0.2 million per tank. The process flow diagram of the experimental system is given in Fig. 2. The ammonia-oxidizing and nitrite-oxidizing reactors were connected serially. The influent from the rearing tank was pumped into an overhead tank (282 L) from where water flowed through the two reactors serially by gravitation and got collected in a 140 L collection tank, from where the treated water got into the larval rearing tank. Pumping of the influent from the larval rearing tank was controlled by an automated water level controller (V-guard, Kerala, India) fitted inside the overhead tank. A regulator valve was connected to the overhead tank to maintain a flow rate of 4 L/min to the system attaining a total circulation of 5,760 L/day. Fig. 2 Open in new tabDownload slide Process flow diagram of the reactors integrated into the larval rearing tank (OHT overhead tank with automatic water level controller, AOB ammonia-oxidizing bioreactor, NOB nitrite-oxidizing bioreactor, CT collection tank for the treated water, LRT larval rearing tank) During the experiment, the rearing water was supplemented with 1 mg/L EDTA (Matrix Formulations, Hyderabad, India), 5 mg/L sulfated vitamin C (Matrix Formulations, Hyderabad, India) and 1 mg/L treflan (Growel Formulations, Hyderabad, India). The larvae were fed with freshly hatched Artemia nauplii up to stage 9 (when pleopods with setae appear) and with both Artemia nauplii and egg custard subsequently. The experiment was continued for 17 days till the larvae metamorphosed to post-larvae, and repeated three times for concurrent results. At the end of the experiment the survival was estimated by counting the larvae manually and the relative percentage survival (R.P.S.) was estimated as the following equation [21]: $$ {\text{R}} . {\text{P}} . {\text{S}} .= [1 - (\% \,{\text{mortality in the test tank/}}\% \,{\text{mortality in the control tank}})] \times 100 $$ In another experiment, the reactor was tested for its nitrification potential in spent water after the larval culture. Water from the larval rearing tanks, subsequent to harvest of post-larvae, was collected and stored in a 5,000 L capacity storage tank. This was subsequently circulated through the bioreactor assembly at a rate of 2 L/min. Meanwhile, another system without integration of the reactor was kept as the control. The experiment was repeated three times. Analyses When the reactors were in the activation mode, substrate/product levels were determined daily by estimating ammonia (TAN) [59], nitrite (NO2–N) [5] and nitrate (NO3–N) [60]. The nitrifying biomass was determined gravimetrically by passing 10 mL bacterial suspension from the reactors through pre-weighed cellulose acetate syringe filters of 0.22 μm porosity with a diameter of 13 mm. Water samples from the larval rearing tanks were analyzed once in 3 days for alkalinity, hardness [4], ammonia, nitrite and nitrate as above. The heterotrophic bacterial community of the rearing water was determined once in a week by standard spread plate method employing ZoBell’s Marine Agar 2216 E prepared in diluted seawater of salinity 15 g/L. In spent water nitrification experiments, water quality parameters such as phosphate, sulfate, iron, chloride, dissolved oxygen, BOD [4], ammonia, nitrite and nitrate as above were estimated for 8 days. Statistical analyses The relationship between removal of ammonia and nitrite and the biomass in suspension during the activation mode was estimated by simple correlation coefficient analysis. The nitrification efficiency and significant percent survival of larvae in the control and reactor integrated tanks were estimated by one-way analysis of variance. Least significant difference (LSD) at 0.1% level was calculated for delineation of the two treatments. Results FISH of the consortia Fluorescence in situ hybridization analysis of the two NBC with seven nitrifying bacterial specific probes confirmed the presence of autotrophic nitrifiers (Fig. 3). Most of the nitrifiers observed were in the form of aggregates. FISH of AMONPCU-1 revealed presence of the autotrophic ammonia oxidizer, Nitrosococcus mobilis, lineage of β ammonia oxidizers, and that of NIONPCU-1 the autotrophic nitrite oxidizer, Nitrobacter sp. However, Nitrosomonas, Nitrosospira, anaerobic ammonia oxidizers and nitrite oxidizers belonging to phylum Nitrospira were not detected in both the consortia. Fig. 3 Open in new tabDownload slide Fluorescence in situ hybridization of the nitrifying bacterial consortia (a epifluorescent image of AMONPCU-1 with CY3-labeled probe NSO190 targeting β ammonia oxidizers; b epifluorescent image of AMONPCU-1 with fluorescein-labeled probe NmV targeting Nitrosococcus mobilis lineage; c epifluorescent image of NIONPCU-1 with CY5-labeled probe NIT2 targeting Nitrobacter sp.) Activation of the reactors Activation kinetics of PBBR during the period of immobilization of the consortia, AMONPCU-1 and NIONPCU-1, are presented in Fig. 4. In both the reactors nitrification could be established within 24 h of initiation of the process and there was progressive reduction in the suspended biomass and increase in NO2–N and NO3–N, respectively. The system was monitored for 7 days, during which there was reduction of more than 90% of the bacterial biomass from the activation medium with 78% TAN and 75.3% NO2–N removal. There was negative correlation between the percentage removal of TAN (r = − 0.96, P < 0.01), NO2–N (r = − 0.93, P < 0.01) and the suspended biomass. Average ammonia and nitrite removal rates in the reactor at the end of the activation period were 46.82 mg TAN/(m2 day) and 45.14 mg NO2–N/(m2 day). Fig. 4 Open in new tabDownload slide Activation kinetics of PBBR immobilized with nitrifying consortia developed for M. rosenbergii hatchery systems Integration of the reactors into the hatchery system The minimum and maximum values of pH, temperature, salinity, alkalinity, hardness and total bacterial count in the rearing water of the experimental and control tanks during each treatment are summarized in Table 3. Heterotrophic bacterial community expressed as colony forming units (CFUs) in ZoBell’s Marine Agar in the control tank increased substantially and there was no remarkable difference in the other water quality parameters between the tanks. The extent of nitrification during the period is presented in Fig. 5. In the control tanks TAN exhibited progressive increase with its subsequent decline and concomitant increase of NO2–N after 14 days; however, NO3–N was never found built up in the system. Meanwhile, there was significant TAN removal (P < 0.01) in the experimental tanks with significant (P < 0.05) NO2–N removal. Within 8 days both TAN and NO2–N concentrations were below detectable levels. NO3–N exhibited progressive increase to 7.6 mg/L within 17 days of the experiment. Physico-chemical and microbial quality of rearing water in the hatchery during the experiment Water quality parameters . Test tank . Control tank . pH 7.5–8.0 7.5–8.0 Salinity (g/L) 14–15 14–15 Temperature (°C) 28–31 28–31 Alkalinity (mg CaCO3/L) 64–70 66–70 Hardness (mg CaCO3/L) 2,876–2,900 2,987–2,900 Total heterotrophic community in ZoBell’s Marine Agar (CFU/mL) 2.51 × 105 to 4.21 × 107 1.91 × 105 to 1.14 × 109 Water quality parameters . Test tank . Control tank . pH 7.5–8.0 7.5–8.0 Salinity (g/L) 14–15 14–15 Temperature (°C) 28–31 28–31 Alkalinity (mg CaCO3/L) 64–70 66–70 Hardness (mg CaCO3/L) 2,876–2,900 2,987–2,900 Total heterotrophic community in ZoBell’s Marine Agar (CFU/mL) 2.51 × 105 to 4.21 × 107 1.91 × 105 to 1.14 × 109 Open in new tab Physico-chemical and microbial quality of rearing water in the hatchery during the experiment Water quality parameters . Test tank . Control tank . pH 7.5–8.0 7.5–8.0 Salinity (g/L) 14–15 14–15 Temperature (°C) 28–31 28–31 Alkalinity (mg CaCO3/L) 64–70 66–70 Hardness (mg CaCO3/L) 2,876–2,900 2,987–2,900 Total heterotrophic community in ZoBell’s Marine Agar (CFU/mL) 2.51 × 105 to 4.21 × 107 1.91 × 105 to 1.14 × 109 Water quality parameters . Test tank . Control tank . pH 7.5–8.0 7.5–8.0 Salinity (g/L) 14–15 14–15 Temperature (°C) 28–31 28–31 Alkalinity (mg CaCO3/L) 64–70 66–70 Hardness (mg CaCO3/L) 2,876–2,900 2,987–2,900 Total heterotrophic community in ZoBell’s Marine Agar (CFU/mL) 2.51 × 105 to 4.21 × 107 1.91 × 105 to 1.14 × 109 Open in new tab Fig. 5 Open in new tabDownload slide Nitrification in M. rosenbergii hatchery system integrated with PBBR The overall percent survival of larvae in the control and test tanks was estimated and presented in Table 4. The tank with the reactor exhibited significantly higher (P < 0.001) percentage survival (LSD at 0.1% = 15.19) with an average R.P.S. of 22.86%. Larval survival after the integration of PBBR into the M. rosenbergii hatchery system Treatment . % survival . Average % survival . Relative % survival . ANOVA . Source of variation . df . Mean sum of squares . P . Control tank 18 18.33 ± 1.53 22.86 Between treatments 1 522.67 <0.001 17 20 Test tank 36 37 ± 2.65 Within treatment 4 4.67 35 40 Treatment . % survival . Average % survival . Relative % survival . ANOVA . Source of variation . df . Mean sum of squares . P . Control tank 18 18.33 ± 1.53 22.86 Between treatments 1 522.67 <0.001 17 20 Test tank 36 37 ± 2.65 Within treatment 4 4.67 35 40 Open in new tab Larval survival after the integration of PBBR into the M. rosenbergii hatchery system Treatment . % survival . Average % survival . Relative % survival . ANOVA . Source of variation . df . Mean sum of squares . P . Control tank 18 18.33 ± 1.53 22.86 Between treatments 1 522.67 <0.001 17 20 Test tank 36 37 ± 2.65 Within treatment 4 4.67 35 40 Treatment . % survival . Average % survival . Relative % survival . ANOVA . Source of variation . df . Mean sum of squares . P . Control tank 18 18.33 ± 1.53 22.86 Between treatments 1 522.67 <0.001 17 20 Test tank 36 37 ± 2.65 Within treatment 4 4.67 35 40 Open in new tab The average water quality parameters of the spent water are given in Table 5. TAN, NO2–N and NO3–N were lower in the experimental tanks than in those of the controls (fourth day) indicating higher percentage removal of TAN (78%), NO2–N (79%) and BOD (56%). Mean water quality parameters of the spent water from hatchery during the experiment Parameter . Control tank . Test tank . Salinity (g/L) 15.33 ± 0.47 15 ± 0.41 pH 8.09 ± 0.07 8.36 ± 0.12 Eh 110 ± 0.82 104.33 ± 16.46 Ammonia (mg/L) 3.71 ± 0.43 0.83 ± 1.46 Nitrite (mg/L) 2 ± 0.23 0.43 ± 0.55 Nitrate (mg/L) 0.3 ± 0.09 13.28 ± 6.57 Phosphate (mg/L) 0.03 ± 0.04 0.02 ± 0.01 Sulfate (mg/L) 15.93 ± 1.23 13.35 ± 0.37 Alkalinity (mg CaCO3/L) 79.33 ± 0.94 79.83 ± 5.34 Hardness (mg CaCO3/L) 2,483.33 ± 107.81 2,672.83 ± 134.64 Chloride (mg/L) 10,273.513 ± 295.31 10,505.83 ± 504.00 DO (mg/LO2) 5.73 ± 0.39 5.81 ± 0.64 BOD (mg/LO2) 0.71 ± 0.018 0.31 ± 0.29 Parameter . Control tank . Test tank . Salinity (g/L) 15.33 ± 0.47 15 ± 0.41 pH 8.09 ± 0.07 8.36 ± 0.12 Eh 110 ± 0.82 104.33 ± 16.46 Ammonia (mg/L) 3.71 ± 0.43 0.83 ± 1.46 Nitrite (mg/L) 2 ± 0.23 0.43 ± 0.55 Nitrate (mg/L) 0.3 ± 0.09 13.28 ± 6.57 Phosphate (mg/L) 0.03 ± 0.04 0.02 ± 0.01 Sulfate (mg/L) 15.93 ± 1.23 13.35 ± 0.37 Alkalinity (mg CaCO3/L) 79.33 ± 0.94 79.83 ± 5.34 Hardness (mg CaCO3/L) 2,483.33 ± 107.81 2,672.83 ± 134.64 Chloride (mg/L) 10,273.513 ± 295.31 10,505.83 ± 504.00 DO (mg/LO2) 5.73 ± 0.39 5.81 ± 0.64 BOD (mg/LO2) 0.71 ± 0.018 0.31 ± 0.29 Open in new tab Mean water quality parameters of the spent water from hatchery during the experiment Parameter . Control tank . Test tank . Salinity (g/L) 15.33 ± 0.47 15 ± 0.41 pH 8.09 ± 0.07 8.36 ± 0.12 Eh 110 ± 0.82 104.33 ± 16.46 Ammonia (mg/L) 3.71 ± 0.43 0.83 ± 1.46 Nitrite (mg/L) 2 ± 0.23 0.43 ± 0.55 Nitrate (mg/L) 0.3 ± 0.09 13.28 ± 6.57 Phosphate (mg/L) 0.03 ± 0.04 0.02 ± 0.01 Sulfate (mg/L) 15.93 ± 1.23 13.35 ± 0.37 Alkalinity (mg CaCO3/L) 79.33 ± 0.94 79.83 ± 5.34 Hardness (mg CaCO3/L) 2,483.33 ± 107.81 2,672.83 ± 134.64 Chloride (mg/L) 10,273.513 ± 295.31 10,505.83 ± 504.00 DO (mg/LO2) 5.73 ± 0.39 5.81 ± 0.64 BOD (mg/LO2) 0.71 ± 0.018 0.31 ± 0.29 Parameter . Control tank . Test tank . Salinity (g/L) 15.33 ± 0.47 15 ± 0.41 pH 8.09 ± 0.07 8.36 ± 0.12 Eh 110 ± 0.82 104.33 ± 16.46 Ammonia (mg/L) 3.71 ± 0.43 0.83 ± 1.46 Nitrite (mg/L) 2 ± 0.23 0.43 ± 0.55 Nitrate (mg/L) 0.3 ± 0.09 13.28 ± 6.57 Phosphate (mg/L) 0.03 ± 0.04 0.02 ± 0.01 Sulfate (mg/L) 15.93 ± 1.23 13.35 ± 0.37 Alkalinity (mg CaCO3/L) 79.33 ± 0.94 79.83 ± 5.34 Hardness (mg CaCO3/L) 2,483.33 ± 107.81 2,672.83 ± 134.64 Chloride (mg/L) 10,273.513 ± 295.31 10,505.83 ± 504.00 DO (mg/LO2) 5.73 ± 0.39 5.81 ± 0.64 BOD (mg/LO2) 0.71 ± 0.018 0.31 ± 0.29 Open in new tab Discussion Proper selection and sizing of biofilters are critical to the technical and economic viability of RAS [38]. In saltwater systems RAS plays an important role in the production of healthy and properly sized fingerlings [16] and has significant implications in maintaining the required water quality as the system demands operations under oligotrophic conditions. The PBBR described here are packed with plastic media having specific surface area of 205 m2/m3. This is comparable to those in trickling filters used in aquaculture [25]. The plastic beads with spikes on the surface provide high void ratios that avoid clogging [15] increase the aeration within the system; poor aeration reduces nitrification capacity of the biofilter [71]. As a matter of fact most of the biofilters on recirculation systems have been focusing on aerobic fixed films [30, 52, 58] and in several systems plastic media used to be the substrata for immobilization [22, 52, 56]. In the present case plastic beads have been used due to its reusability and inertness besides the cost factor and preferential acceptability by the NBC for attachment and growth. The NBC used here originated from a brackish water environment by enrichment with confirmed nitrification potential and designated as AMONPCU-1 and NIONPCU-1 [2]. Transmission electron microscopic observations demonstrated characteristic cyst formation and intracytoplasmic membranes similar to autotrophic nitrifiers [28]. Using FISH the consortia could be partially characterized, demonstrating the presence of N. mobilis, lineage of β ammonia oxidizers and Nitrobacter sp. in AMONPCU-1 and NIONPCU-1, respectively. Where as, other nitrifiers such as Nitrosomonas, Nitrosospira, phylum Nitrospira, and anaerobic ammonia oxidizers were not observed. In literature oligonucleotide probe-based FISH, targeting signature regions of the 16S rRNA of ammonia and nitrite-oxidizing bacteria, has been successfully applied for phylogenetic identification in environmental and engineered systems [24, 41, 45, 55, 68]. Rowan et al. [51] studied the composition and diversity of ammonia-oxidizing bacterial communities in a biological aerated filter (BAF) and a trickling filter and all the samples analyzed appeared to be dominated by AOB most closely related to N. mobilis. As a general principle low concentration of nutrients in aquaculture systems [48] results in slow growth of nitrifiers and low bacterial yield to form effective biofilm by natural process. This necessitates activated bioreactors with high attached bacterial density for optimal performance. Under such situations the time required for activating the reactors becomes a crucial factor for their successful and timely starting up and operation. To satisfy this requirement, NBC were used for activating the reactors by which nitrification could be established within 24 h of initiation and attained 78% ammonia and 75.3% nitrite removal by the seventh day. Attachment of the NBC and formation of biofilm were irreversible, which demonstrated the soundness of the technology. Wherever such activations had not been carried out, 2–3 months were reported for the establishment of nitrification in marine [39] and 2–3 weeks in freshwater systems [40]. On integrating the PBBR to the larval rearing system, ammonia oxidation was established within a day and it took 8 days for nitrite oxidation. Meanwhile, in the control larval rearing systems 14 days were required for the initiation of nitrification. The delay in establishing active nitrite oxidation in the reactor integrated system suggests a consequence of lower multiplication rate of nitrite oxidizers compared to that of ammonia oxidizers [47]. Under the ‘nitrifying bioreactor integrated mode’ the maximum average TAN and NO2–N concentrations in the larval rearing tanks were 0.18 and 0.25 mg/L, respectively, the values typical of any marine system. It has to be emphasized that marine larval rearing systems demand TAN and NO2–N levels below 0.1 mg/L well below the maximum limit (0.3 mg N/L) under the oligotrophic category [37]. During the progression of the experiment the NO3–N concentrations increased progressively up to 7.6 mg/L, however, it remained well below the toxic levels for M. rosenbergii larval culture [34]. Management of ammonia in the larval rearing systems of M. rosenbergii is important as significantly lower survival rates (0–20%) of larvae were noticed at total ammonia concentrations ranging from 1 to 8 mg/L with 0.43–3.41 mg/L non-ionic ammonia at pH 9 [35]. The higher relative percent survival (22.86%) obtained in the reactor integrated experimental system proved the impact of the technology in enhancing the larval survival. Under oligotrophic conditions ammonia diffuses into a relatively thin vertically homogenous biofilm that is dominated by autotrophs, principally due to low BOD (<5 g/m3) of the culture water [36]. Such a situation could be observed here where organic loading to the system was as low as 0.31 mg/L BOD. On the basis of the above BOD–nitrification relationship, it may be inferred that there has been minimal heterotrophic inhibition of nitrification [53, 73] in the reactors as also evidenced by the progressive increase in the rate of nitrification from the day of initiation. Since nitrification reactions occur in the biofilm and not in the bulk fluid [42], the substrate utilization rate depends on local substrate concentrations within the biofilm. At such local reaction sites, reactant concentrations are depressed and products elevated [6]. This warranted circulation of water through the cartridge with the biofilm, and the rate of TAN removal could be theoretically proportional to the rate of circulation. That was why the reactors were designed to have both vertical and horizontal flow of water through the aeration cells for providing oxic conditions. Zhu and Chen [74] established that the turbulence caused by diffused air substantially improved the nitrification efficiency of fixed film biofilters. Tschui et al. [63] ascertained that nitrification rates could be increased with increased water velocities along with increased airflow. This sort of stronger turbulence in the reactor cartridge decreases the laminar boundary layer and simultaneously enhances diffusion. Such highly aerated systems reduce the chances for the generation of anaerobic pockets with in the reactor. RAS adoption for larvae, fry and fingerling production is driven by bio-security issues [46, 50] and water recirculation dramatically reduces the possibility of pathogen introduction [12, 20]. In this context integration of PBBR for nitrification of hatchery spent water with high percentage removal of ammonia (78%), and nitrite (79%) by fourth day strengthens the possibility of reuse of water with limited discharge and reduced intake paving the way for bio-security. Packed bed biofilter systems have been utilized in a variety of formats for recirculating shrimp production systems because of their economic feasibility [13, 64]. The PBBR designed and evaluated here was configured in such a way that the flow of water could be maintained by gravitational force and the energy needed could be restricted to pumping water to the reservoir tank and to operate an air pump to effect aeration. If nitrification is not completed during a single circulation, there is provision to recirculate it through the treatment system over and again. However, such requirements might be overcome by increasing the biomass of the nitrifying consortia used for activation of the reactors or by enhancing the hydraulic retention time. Another specialty of the package is upgradeability of the system with different types of filters for removal of particulate matter and UV disinfection equipment for elimination of pathogens which might enter the system accidentally. The PBBR evaluated here shall enable hatchery systems to operate as closed recirculation systems, maintaining water quality during the operation and minimizing discharge of spent water. Collectively the technology shall pave way for better water management in the aquaculture industry. Besides, by integrating the reactors during larval production significantly high percentage larval survival also could be obtained. The PBBR designed here is flexible as it is interchangeable between prawn (salinity 15 g/L) and shrimp (salinity 30 g/L) larval rearing systems by replacing the NBC depending on the salinity [2]. A modification of the system can be used for shrimp maturation facility too as recirculation is one of its prime requirements for maturation in the perspectives of water quality and bio-security. Acknowledgments This work was carried out with the financial assistance from Department of Biotechnology (BT/AA/03/10/79/94 and BT/DRI 794/AAQ/03/092/99) and Department of Science and Technology (SR/SO/AS-15/2003) Government of India. Matsyafed Shrimp Hatchery, Quilon, Kerala is thankfully acknowledged for extending the larval rearing facility for the demonstration and validation. Acknowledge Dr. Valsamma Joseph, Lecturer, National Centre for Aquatic Animal Health, Cochin University of Science and Technology for the analysis of the data. References 1. Achuthan C (2000) Development of bioreactors for nitrifying water in closed system hatcheries of penaeid and non-penaeid prawns. PhD Thesis, Cochin University of Science and Technology, Kochi, India, 116 pp 2. Achuthan C , Rejish Kumar VJ, Manju NJ, Philip R, Bright Singh IS Development of nitrifying bacterial consortia for immobilizing in nitrifying bioreactors designed for penaeid and non-penaeid larval rearing systems in the tropics Indian J Mar Sci 2006 35 240 248 Google Scholar OpenURL Placeholder Text WorldCat 3. Alcaraz G , Chiappa-Carrara X, Espinoza V, Vanegas C Acute toxicity of ammonia and nitrite to white shrimp Penaeus setiferus postlarvae J World Aquacult Soc 1999 30 90 97 10.1111/j.1749-7345.1999.tb00321.x Google Scholar Crossref Search ADS WorldCat 4. Standard methods for the examination of water and wastewater 1998 20 Washington American Public Health Association Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 5. Bendschneider K , Robinson RJ A spectrophotometric method for the determination of nitrite in seawater J Mar Res 1952 11 87 96 Google Scholar OpenURL Placeholder Text WorldCat 6. Boller M , Gujer W, Tschui M Parameters affecting nitrifying biofilm reactors Water Sci Technol 1994 29 1 11 Google Scholar Crossref Search ADS WorldCat 7. Cavalli RO , Berghe EV, Lavens P, Thuy TTN, Wille M, Sorgeloos P Ammonia toxicity as a criterion for the evaluation of larval quality in the prawn Macrobrachium rosenbergii Comp Biochem Physiol 2000 C125 333 343 Google Scholar OpenURL Placeholder Text WorldCat 8. Chen JC , Lee Y Effects of nitrite on mortality, ion regulation and acid–base balance of Macrobrachium rosenbergii at different external chloride concentrations Aquat Toxicol 1997 39 291 305 10.1016/S0166-445X(97)00029-5 Google Scholar Crossref Search ADS WorldCat 9. Cheng SY , Chen JC Hemolymph oxygen content, oxyhemocyanin, protein levels and ammonia excretion in the shrimp Penaeus monodon exposed to ambient nitrite Comp Physiol B 1995 164 530 535 Google Scholar OpenURL Placeholder Text WorldCat 10. Colt J , Lamoureux J, Patterson R, Rogers G Reporting standards for biofilter performance studies Aquacult Eng 2006 34 377 388 10.1016/j.aquaeng.2005.09.002 Google Scholar Crossref Search ADS WorldCat 11. Daims H , Nielsen JL, Nielsen PH, Schleifer KH, Wagner M In situ characterization of Nitrospira like nitrite-oxidizing bacteria active in wastewater treatment plants Appl Environ Microbiol 2001 67 5273 5284 10.1128/AEM.67.11.5273-5284.2001 Google Scholar Crossref Search ADS PubMed WorldCat 12. Davis JT (1990) Red drum brood stock and hatchery production. SRAC Publication, No. 323, Mississippi, 4 pp 13. Davis DA , Arnold CR The design, management and production of recirculating raceway system for the production of marine shrimp Aquacult Eng 1998 17 193 211 10.1016/S0144-8609(98)00015-6 Google Scholar Crossref Search ADS WorldCat 14. Drennen DC II, Hosle KC, Francis M, Weaver D, Aneshansley E, Beckman G, Johnson CH, Cristina CM Standardized evaluation and rating of biofilters. II. Manufacturer’s and user’s perspective Aquacult Eng 2006 34 403 416 10.1016/j.aquaeng.2005.07.001 Google Scholar Crossref Search ADS WorldCat 15. Eding EH , Kamstra A, Verreth JAJ, Huisman EA, Klapwijk A Design and operation of nitrifying trickling filters in recirculating aquaculture: a review Aquacult Eng 2006 34 234 260 10.1016/j.aquaeng.2005.09.007 Google Scholar Crossref Search ADS WorldCat 16. Fielder S, Allan GL (1997) Inland production of marine fish. In: Hyde K (ed) The new rural industries: a hand book for farmers and investors. Rural Industries Research and Development Corporation, Australian Government, pp 108–113 17. Fitch MW , Pearson N, Richards G, Burken JG Biological fixed film systems Water Environ Res 1998 70 495 518 10.2175/106143098X134226 Google Scholar Crossref Search ADS WorldCat 18. Fontenot Q , Bonvillain C, Kilgen M, Boopathy R Effects of temperature, salinity, and carbon:nitrogen ratio on sequencing batch reactor treating shrimp aquaculture wastewater Bioresour Technol 2007 98 1700 1703 10.1016/j.biortech.2006.07.031 Google Scholar Crossref Search ADS PubMed WorldCat 19. Furukawa K , Ike A, Ryu S, Fujita M Nitrification of NH4–N polluted seawater by immobilized acclimated marine nitrifying sludge (AMNS) J Ferment Bioeng 1993 76 515 520 10.1016/0922-338X(93)90251-3 Google Scholar Crossref Search ADS WorldCat 20. Goldburg RJ , Elliot MS, Naylor MA Marine aquaculture in the United States: environmental impacts and policy options 2001 Arlington Pew Oceans Commission 44 Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 21. Gram L , Melchiorsen J, Spanggaard B, Huber I, Nielsen TF Inhibition of Vibrio anguillarum by Pseudomonas fluorescens AH2, a possible probiotic treatment of fish Appl Environ Microbiol 1999 65 969 973 Google Scholar Crossref Search ADS PubMed WorldCat 22. Gross A , Nemirovsky A, Zilberg D, Khaimov A, Brenner A, Snir E, Ronen Z, Nejidat A Soil nitrifying enrichments as biofilter starters in intensive recirculating saline water aquaculture Aquaculture 2003 223 51 62 10.1016/S0044-8486(03)00067-X Google Scholar Crossref Search ADS WorldCat 23. Jae-Koan S , Jung H, Kim MR, Kim BJ, Nam SW, Kim SK Nitrification performance of nitrifiers immobilized in PVA (polyvinyl alcohol) for a marine recirculating aquarium system Aquacult Eng 2001 24 181 194 10.1016/S0144-8609(01)00063-2 Google Scholar Crossref Search ADS WorldCat 24. Juretschko S , Timmermann G, Schmid M, Schleifer KH, Pommerening-Röser A, Koops HP, Wagner M Combined molecular and conventional analysis of nitrifying bacterium diversity in activated sludge: Nitrosococcus mobilis and Nitrospira-like bacteria as dominant populations Appl Environ Microbiol 1998 64 3042 3051 Google Scholar Crossref Search ADS PubMed WorldCat 25. Kamstra A , van der Heul JW, Nijhof M Performance and optimization of trickling filters on eel farms Aquacult Eng 1998 17 175 192 10.1016/S0144-8609(98)00014-4 Google Scholar Crossref Search ADS WorldCat 26. Kır M , Kumlu M, Eroldo OT Effects of temperature on acute toxicity of ammonia to Penaeus semisulcatus juveniles Aquaculture 2004 241 479 489 10.1016/j.aquaculture.2004.05.003 Google Scholar Crossref Search ADS WorldCat 27. Koo JG , Kim SG, Jee JH, Kim JM, Bai SC, Kang JC Effects of ammonia and nitrite on survival, growth and moulting in juvenile tiger crab, Orithyia sinica (Linnaeus) Aquacult Res 2005 36 79 85 10.1111/j.1365-2109.2004.01187.x Google Scholar Crossref Search ADS WorldCat 28. Kumar VJR, Achuthan C, Manju NJ, Philip R, Bright Singh IS (2008) Mass production of nitrifying bacterial consortia for the rapid establishment of nitrification in saline recirculating aquaculture systems. World J Microbiol Biotechnol (in press) 29. Lee PG A review of automated control systems for aquaculture and design criteria for their implementation Aquacult Eng 1995 14 205 227 10.1016/0144-8609(94)00002-I Google Scholar Crossref Search ADS WorldCat 30. Lekang OI , Kleppe H Efficiency of nitrification in trickling filters using different filter media Aquacult Eng 2000 21 181 199 10.1016/S0144-8609(99)00032-1 Google Scholar Crossref Search ADS WorldCat 31. Losordo TM, Westers H (1994) System carrying capacity and flow estimation. In: Timmons MB, Losordo TM (eds) Aquaculture water reuse systems: engineering design and management. Elsevier, pp 9–60 32. Loy A , Maixner F, Wagner M, Horn M probeBase—an online resource for rRNA-targeted oligonucleotide probes: new features Nucleic Acids Res 2007 35 D800 D804 10.1093/nar/gkl856 Google Scholar Crossref Search ADS PubMed WorldCat 33. Lyssenko C , Wheaton F Impact of positive ramp short-term operating disturbances on ammonia removal by trickling and submerged-upflow biofilters for intensive recirculating aquaculture Aquacult Eng 2005 35 26 37 10.1016/j.aquaeng.2005.08.002 Google Scholar Crossref Search ADS WorldCat 34. Mallasen M , Valenti WC, Ismael D Effects of nitrate concentration on larval development of the giant river prawn, Macrobrachium rosenbergii J Appl Aquacult 2004 14 55 69 10.1300/J028v14n03_05 Google Scholar Crossref Search ADS WorldCat 35. Mallasen M , Valenti WC Larval development of the giant river prawn Macrobrachium rosenbergii at different ammonia concentrations and pH values J World Aquacult Soc 2005 36 32 41 Google Scholar Crossref Search ADS WorldCat 36. Malone RF, DeLosReyes AA (1997) Categories of recirculating aquaculture systems. In: Timmons MB, Losordo T (Eds) Advances in aquacultural engineering: proceedings from the Aquacultural Engineering Society (AES) technical sessions at the fourth international symposium on tilapia in aquaculture, Coronado Springs Resort, Walt Disney World, Orlando, 9–12 November 1997, pp 197–208 37. Malone RF , Beecher LE Use of floating bead filters to recondition recirculating waters in warmwater aquaculture production systems Aquacult Eng 2000 22 57 74 10.1016/S0144-8609(00)00032-7 Google Scholar Crossref Search ADS WorldCat 38. Malone RF , Pfeiffer JP Rating fixed film nitrifying biofilters used in recirculating aquaculture systems Aquacult Eng 2006 34 389 402 10.1016/j.aquaeng.2005.08.007 Google Scholar Crossref Search ADS WorldCat 39. Manthe DP , Malone RF Chemical addition for accelerated biological filter acclimation in closed bluecrab shedding systems Aquacult Eng 1987 6 227 236 10.1016/0144-8609(87)90006-9 Google Scholar Crossref Search ADS WorldCat 40. Masser MP, Rakocy J, Losordo TM (1999) Recirculating aquaculture tank production systems. Management of recirculating systems. SRAC Publication No. 452, United States Department of Agriculture, 12 pp 41. Mobarry BK , Wagner M, Urbain V, Rittmann BE, Stahl DA Phylogenetic probes for analyzing abundance and spatial organization of nitrifying bacteria Appl Environ Microbiol 1996 62 2156 2162 Google Scholar Crossref Search ADS PubMed WorldCat 42. Moreau M , Liu Y, Capdeville B, Audic JM, Calvez L Kinetic behaviour of heterotrophic and autotrophic biofilms in waste water treatment process Water Sci Technol 1994 29 385 391 Google Scholar Crossref Search ADS WorldCat 43. Naqvi AA , Adhikari S, Pillai BR, Sarangi N Effect of ammonia–N on growth and feeding Macrobrachium rosenbergii (De-Man) Aquacult Res 2007 38 847 851 10.1111/j.1365-2109.2007.01736.x Google Scholar Crossref Search ADS WorldCat 44. Nogueira R , Lazarova V, Manem J, Melo LF Influence of dissolved oxygen on the nitrification kinetics in a circulating bed biofilm reactor Bioprocess Eng 1998 19 441 449 10.1007/s004490050546 Google Scholar Crossref Search ADS WorldCat 45. Okabe S , Satoh H, Watanabe Y In situ analysis of nitrifying biofilms as determined by in situ hybridization and the use of microelectrodes Appl Environ Microbiol 1999 65 3182 3191 Google Scholar Crossref Search ADS PubMed WorldCat 46. Otoshi CA , Arce SM, Moss SM Growth and reproductive performance of broodstock shrimp reared in a biosecure recirculating aquaculture system versus a flow-through pond Aquacult Eng 2003 29 93 107 10.1016/S0144-8609(03)00048-7 Google Scholar Crossref Search ADS WorldCat 47. Paller MH An analytical model for predicting the carrying capacity of submerged biofilters used in aquaculture J Appl Aquacult 1992 1 1 25 10.1300/J028v01n03_01 Google Scholar Crossref Search ADS WorldCat 48. Piedrahita RH Reducing the potential environmental impacts of tank aquaculture effluents through intensification and recirculation Aquaculture 2003 226 35 44 10.1016/S0044-8486(03)00465-4 Google Scholar Crossref Search ADS WorldCat 49. Pommerening-Röser A , Rath G, Koops HP Phylogenetic diversity within the genus Nitrosomonas Syst Appl Microbiol 1996 19 344 351 Google Scholar Crossref Search ADS WorldCat 50. Pruder GD Biosecurity: application in aquaculture Aquacult Eng 2004 32 3 10 10.1016/j.aquaeng.2004.05.002 Google Scholar Crossref Search ADS WorldCat 51. Rowan AK , Snape JR, Fearnside D, Barer MR, Curtis TP, Head IM Composition and diversity of ammonia-oxidising bacterial communities in wastewater treatment reactors of different design treating identical wastewater FEMS Microbiol Ecol 2003 43 195 206 10.1111/j.1574-6941.2003.tb01059.x Google Scholar Crossref Search ADS PubMed WorldCat 52. Sandu SI , Boardman GD, Watten BJ, Brazil BL Factors influencing the nitrification efficiency of fluidized bed filter with a plastic bead medium Aquacult Eng 2002 26 41 59 10.1016/S0144-8609(02)00003-1 Google Scholar Crossref Search ADS WorldCat 53. Satoh H , Okabe S, Norimatsu N, Watanabe Y Significance of substrate C/N ratio on structure and activity of nitrifying biofilms determined by in situ hybridization and use of microelectrodes Water Sci Technol 2000 41 317 321 Google Scholar Crossref Search ADS WorldCat 54. Schmid M , Twachtmann U, Klein M, Strous M, Juretschko S, Jetten MSM, Metzger JW, Schleifer KH, Wagner M Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation Syst Appl Microbiol 2000 23 93 106 Google Scholar Crossref Search ADS PubMed WorldCat 55. Schramm A , De Beer D, Van Den Heuvel JC, Ottengraf S, Amann R Microscale distribution of populations and activities of Nitrosospira and Nitrospira spp. along a macroscale gradient in a nitrifying bioreactor: quantification by in situ hybridization and the use of microsensors Appl Environ Microbiol 1999 65 3690 3696 Google Scholar Crossref Search ADS PubMed WorldCat 56. Seo JK , Jung IH, Kim MR, Kim BJ, Nam SW, Kim SK Nitrification performance of nitrifiers immobilized in PVA (polyvinyl alchohol) for a marine recirculating aquarium system Aquacult Eng 2001 24 181 194 10.1016/S0144-8609(01)00063-2 Google Scholar Crossref Search ADS WorldCat 57. Shnel N , Barak Y, Ezer T, Dafni Z, Van Rijn J Design and performance of a zero discharge tilapia recirculating system Aquacult Eng 2002 24 181 194 Google Scholar OpenURL Placeholder Text WorldCat 58. Singh S , Ebeling J, Wheaton F Water quality trails in four recirculating aquacultural systems configurations Aquacult Eng 1999 20 75 84 10.1016/S0144-8609(99)00003-5 Google Scholar Crossref Search ADS WorldCat 59. Solorzano L Determination of ammonia in natural waters by the phenol hypochlorite method Limnol Oceanogr 1969 14 799 801 10.4319/lo.1969.14.5.0799 Google Scholar Crossref Search ADS WorldCat 60. Strickland JDH , Parsons TR A practical handbook of seawater analysis 1968 2 Canada Fish Res Board 310 Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 61. Sung-Koo K , Kong I, Lee BH, Kang L, Lee MG, Suh KH Removal of ammonium–N from a recirculation aquaculture system using an immobilized nitrifier Aquacult Eng 2000 21 139 150 10.1016/S0144-8609(99)00026-6 Google Scholar Crossref Search ADS WorldCat 62. Tomasso JR Toxicity of nitrogenous wastes to aquaculture animals Rev Fish Sci 1994 2 291 314 10.1080/10641269409388560 Google Scholar Crossref Search ADS WorldCat 63. Tschui M , Boller M, Gujer W, Eugster J, Mader C, Stengel C Tertiary nitrification in aerated pilot biofilters Water Sci Technol 1994 29 53 60 Google Scholar Crossref Search ADS WorldCat 64. Tseng KF , Su HM, Su MS Culture of Penaeus monodon in a recirculating system Aquacult Eng 1998 17 138 147 10.1016/S0144-8609(98)00011-9 Google Scholar Crossref Search ADS WorldCat 65. Wang WN , Wang AL, Zhang YJ, Li ZH, Wang JX, Sun RY Effects of nitrite on lethal and immune response of Macrobrachium nipponense Aquaculture 2004 232 679 686 10.1016/j.aquaculture.2003.08.018 Google Scholar Crossref Search ADS WorldCat 66. Wagner M , Rath G, Amann R, Koops HP, Schleifer KH In situ identification of ammonia-oxidizing bacteria Syst Appl Microbiol 1995 18 251 264 Google Scholar Crossref Search ADS WorldCat 67. Wagner M , Rath G, Koops HP, Flood J, Amann R In situ analysis of nitrifying bacteria in sewage treatment plants Water Sci Technol 1996 34 237 244 10.1016/0273-1223(96)00514-8 Google Scholar Crossref Search ADS WorldCat 68. Wagner M , Noguera DR, Juretschko S, Rath G, Koops HP, Schleifer KH Combining fluorescent in situ hybridization (FISH) with cultivation and mathematical modeling to study population structure and function of ammonia oxidizing bacteria in activated sludge Water Sci Technol 1998 37 441 449 10.1016/S0273-1223(98)00143-7 Google Scholar Crossref Search ADS WorldCat 69. Wheaton F , Hochheimer J, Kaiser GE Brune DE, Tomasso JR Fixed film nitrification filters for aquaculture Aquaculture and water quality 1991 Baton Rouge World Aquaculture Society 272 303 Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 70. Wheaton FW , Hochheimer JN, Kaiser GE, Krones MJ, Libey GS, Easter CC Timmons MB, Losordo TM Nitrification filters principles Aquaculture water reuse systems: engineering design and management 1994 Amsterdam Elsevier 101 126 Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 71. Wik T Trickling filter and biofilm reactor modeling Rev Environ Sci Biotechnol 2003 2 193 212 10.1023/B:RESB.0000040470.48460.bb Google Scholar Crossref Search ADS WorldCat 72. Young-Lai WW , Daures CM, Charmantier G Effect of ammonia on survival and osmoregulation in different life stages of the lobster Homarus americanus Mar Biol (Berl) 1991 110 293 300 10.1007/BF01313716 Google Scholar Crossref Search ADS WorldCat 73. Zhu S , Chen S Effects of organic carbon on nitrification rate in fixed film biofilters Aquacult Eng 2001 25 1 13 10.1016/S0144-8609(01)00071-1 Google Scholar Crossref Search ADS WorldCat 74. Zhu S , Chen S Effects of air-diffusion turbulent flow on nitrification rate in fixed film biofilters: a comparison study N Am J Aquaculture 2003 65 240 247 10.1577/C02-015 Google Scholar Crossref Search ADS WorldCat © Society for Industrial Microbiology 2009 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model) © Society for Industrial Microbiology 2009
TI - Activated packed bed bioreactor for rapid nitrification in brackish water hatchery systems
JF - Journal of Industrial Microbiology and Biotechnology
DO - 10.1007/s10295-008-0504-9
DA - 2009-03-01
UR - https://www.deepdyve.com/lp/oxford-university-press/activated-packed-bed-bioreactor-for-rapid-nitrification-in-brackish-qrAdeqDPMp
SP - 355
EP - 365
VL - 36
IS - 3
DP - DeepDyve
ER -