TY - JOUR
AU - Zhou, Yongsheng
AB - Abstract Human mesenchymal stem cells (MSCs) are multipotent progenitor cells that can differentiate into osteoblasts, chondrocytes, and adipocytes. The importance of epigenetic regulation for osteogenic differentiation of MSCs is widely accepted. However, the molecular mechanisms are poorly understood. Here, we show that histone H3K9 acetyltransferase PCAF plays a critical role in osteogenic differentiation of MSCs. Knockdown of PCAF significantly reduced the bone formation both in vitro and in vivo. Mechanistically, PCAF controls BMP signaling genes expression by increasing H3K9 acetylation. Most importantly, PCAF expression is significantly decreased in bone sections of ovariectomized or aged mice. Histone modification enzyme is chemically modifiable; therefore, PCAF may represent a novel therapeutic target for stem cell-mediated regenerative medicine and the treatment of osteoporosis. Osteogenic differentiation induced PCAF expression through SMADs; PCAF promoted activation of BMP2, BMP4, BMPR1B and RUNX2 by increasing H3K9ac, which led to osteogenic differentiation. Open in new tabDownload slide Open in new tabDownload slide P300/CBP-associated factor, H3K9 acetylation, Osteogenic differentiation, Bone morphogenetic protein, Osteoporosis Significance Statement In the present study, histone H3K9 acetyltransferase PCAF was detected to promote osteogenic differentiation of human mesenchymal stem cells in vitro and in vivo. Mechanistically, PCAF controls the expression of bone morphogenetic proteins by increasing H3K9 acetylation. Most importantly, PCAF expression was significantly decreased in bone sections of ovariectomized or aged mice. These data shed light on the function of epigenetic mark H3K9 acetylation and histone acetyltransferase PCAF in the osteogenic lineage commitment of mesenchymal stem cells and osteoporosis. Introduction Human mesenchymal stem cells (MSCs) are multipotent progenitor cells with self-renewal capabilities and multilineage differentiation potentials including osteogenesis, chondrogenesis, and adipogenesis [1-4]. Under certain conditions, MSCs are able to differentiate into osteoblasts and hold significant promise for clinical applications, especially for bone regeneration in skeletal defects, largely due to easy harvest, accessibility and lack of immunogenicity [5, 6]. The therapeutic utility of MSCs hinges upon the understanding of molecular mechanisms that regulate their differentiation [7, 8]. Previous studies have been focused on endeavoring to promote osteogenic differentiation via epigenetic modifications, such as DNA methylation, histone acetylation, and histone methylation [9-11]. Since histone modifications play crucial roles in the osteogenic differentiation, it is of great interest and importance to investigate the individual histone modification enzyme during this process, which may advance our understanding of stem cell fate decision and facilitate the clinical translation of MSCs-mediated bone repair. Bone homeostasis relies on the inverse relation between adipogenesis and osteogenesis in MSCs. Among a variety of signaling and transcription factors involved in osteogenesis, bone morphogenetic protein (BMP) signaling is a central pathway that controls osteogenic differentiation and bone formation. Knockout experiments showed that a critical threshold level of BMP2 and BMP4 signaling is required for differentiation to mature osteoblasts, and this process is mediated by controlling the transition from RUNX2+ to RUNX2+ OSX+ cells [12]. Moreover, mouse genetic studies of BMP receptors have revealed important roles for BMP signaling in controlling bone mass [13, 14]. The expression of constitutively active BMPR1A induced adipogenic differentiation, while constitutive BMP receptor 1B (BMPR1B) activation induced osteogenic differentiation [15]. Even though BMPs are key regulators of osteogenesis, the precise determinants that govern BMP signaling are poorly understood. More recently, stimulatory effects of BMP2 on osteoblastic differentiation have been reported. The phosphorylation of c-AMP response element binding protein (CREB) recruits its coactivator CBP (CREB-binding protein) to the promoter of BMP2, thereby promoting BMP2 transactivation [16]. In addition, histone demethylase KDM6B promotes osteogenic differentiation of human MSCs by removing H3K27 me3 on the promoter regions of BMP2 and BMP4 [17]. It is predicted that factors influencing BMP signaling are potential targets for osteogenic regulation. In the present study, we found that the expression of histone acetyltransferase PCAF was significantly increased after osteogenic induction through Smad signaling. The knockdown of PCAF impaired osteogenic commitment of MSCs both in vitro and in vivo. Mechanistically, PCAF was required for the expression of BMP pathway genes by increasing histone H3K9 acetylation. Notably, we found that PCAF marks was significantly decreased in bone sections of ovariectomized mice or aged mice. These data suggested that therapies targeting PCAF might suppress the chronic metabolic bone disease commonly found in aged people or menopausal women. Materials and Methods Cell Culture and Osteogenic Induction Primary human adipose-derived stem cells and bone marrow MSCs were purchased from ScienCell Research Laboratories (Carlsbad, California, U.S., http://www.sciencellonline.com/). To induce differentiation, MSCs were cultured in osteogenic media containing 100 mM/ml ascorbic acid, 2 mM β-glycerophosphate and 10 nM dexamethasone. All experiments were repeated three times using human MSCs from the three donors, respectively. Retroviral Infection and Plasmid Constructions For viral infection, HEK293T cells at 80% confluence were cotransfected with pLNB vectors with a mutant CBA promoter for gene expression or for shRNAs expressions, and with plasmids psPAX2 (Abcam, Cambridge, U.K., http://www.abcam.com/) and pVSV-G (Clontech, U.S., http://www.clontech.com/) using the PolyJet™ Tranfection Reagent (SignaGen Laboratories, Rockville, Maryland, U.S., http://signagen.com/), according to the manufacturer's instructions. The cell culture supernatant was collected at 36, 48 and 60 hours after transfection, centrifuged and filtered through a 0.45 μm PVDF membrane (Pall Corporation, Port Washington, New York, U.S., http://www.pall.com/main/home.page) to remove cellular debris. The viral particles were then precipitated by centrifugation with PEG-it™ (System Biosciences, SBI, Mountain View, California, U.S., https://www.systembio.com/). The concentrated lentiviral particles were titered, aliquoted and stored at −70°C until ready for use. To facilitate tracking of the knockdown efficiency, we generated lentiviral plasmids for coexpression of red fluorescent protein (RFP) with the target shRNA. We constructed PCAF, SMAD1, and SMAD4 shRNA plasmid with a lentivirus vector expressing RFP. The target sequences for the shRNA were: SMAD1sh, 5′-CTTTCCAGATGCCAGCTGAT-3′; SMAD4sh, 5′-CGAGTTGTATCACC TGGAATT-3′; PCAFsh1, 5′-GCAGATACCAAACAAGTTTAT-3′; PCAFsh2, 5′-GCAGACTTACAGCGAGTCTTT-3′. For gene overexpression, the Flag-PCAF and Flag-PCAF (deletion 579–608) were cloned into the pLNB vector with a mutant CBA promoter and the lentiviral viruses were packaged as above. Alkaline Phosphatase (ALP) Staining and Quantification Cells were seeded in six-well plates, and ALP activity was determined by staining with nitroblue tetrazolium and 5-bromo-4-chroro-3-indolyl phosphate on the 7th day after osteogenic differentiation. For quantification of ALP activity, cells were rinsed twice with phosphate-buffered saline (PBS), trypsinized, and then scraped into ddH2O. This was followed by three cycles of freezing and thawing. ALP activity was determined at 405 nm using p-nitrophenyl phosphate (pNPP) as the substrate. A 50 µl sample was mixed with 50 µl of pNPP (1 mg/ml) in 1 M diethanolamine buffer containing 0.5 mM MgCl2 (pH 9.8) and incubated at 37°C for 15 minutes on a bench shaker. The reaction was stopped by the addition of 25 µl of 3 M NaOH/100 µl of reaction mixture. Enzyme activities were quantified by absorbance measurements at 405 nm. Total protein contents were determined using the bicinchoninic acid method using the Pierce (Thermo Fisher Scientific, Rockford, Illinois, U.S., http://www.thermofisher.com/cn.html) protein assay kit in aliquots of the same samples. The samples were read at 562 nm and calculated against a series of bovine serum albumin standards. ALP levels were normalized to the total protein content at the end of the experiment. Alizarin Red Staining and Quantification Analysis of mineralization was determined by Alizarin Red staining. Cells were first rinsed with Milli-Q water, fixed for 30 minutes in 70% ethanol at 4°C and then rinsed with Milli-Q water. Calcium deposition was then visualized after incubation with 2% Alizarin Red S pH 4.2. Alizarin Red S was extracted by destaining with hexadecyl pyridinium chloride monohydrate, and mineral accumulation was quantified on a microplate reader at 562 nm. Western Blotting Western blotting was performed as described previously [18]. We obtained the primary antibodies from the following sources: monoclonal antibody to H3K9 acetylation (Cell Signaling, Danvers, MA, USA, http://www.cellsignal.com/); monoclonal antibody to H3 (Cell Signaling, Danvers, MA, USA, http://www.cellsignal.com/); monoclonal antibody to PCAF (Cell Signaling, Danvers, MA, USA, http://www.cellsignal.com/); monoclonal antibody to actin (Sigma, St. Louis, MO, USA, http://www.sigmaaldrich.com/); and monoclonal antibody to flag (Sigma, St. Louis, MO, USA, http://www.sigmaaldrich.com/). Real-Time Quantitative PCR (RT-qPCR) We extracted total RNA using Trizol (Invitrogen, Carlsbad, CA, USA, http://www.thermofisher.com). We synthesized 0.5–2 μg aliquots of RNAs using random hexamers and reverse transcriptase (Takara, Kusatsu, Shiga, Japan, http://www.takara-bio.com/). We performed the RT-qPCR reactions using the QuantiTect SYBR Green PCR kit (Qiagen, Duesseldorf, German, https://www.qiagen.com/cn/) and Life Multi-color Real-time PCR Detection System. The primer sequences were as follows: Human GAPDH, (F) AAGGAGTAAGACCCCTGGACCA, (R) GCAACTGTGAGCAGGGGAGATT; RUNX2, (forward) 5′-ACTACCAGCCACCGAGACCA-3′, (reverse) 5′-ACTGCTTGCAGCCTTAAATGACTCT-3′; BGLAP, (forward) 5′-CA CCATGAGAGCCCTCACACTC-3′, (reverse) 5′-CCTGCTTGGACACA AAGGCTGC-3′; SPP1, (forward) 5′-CAAACGCCGACCAAGGAAAA-3′, (reverse) 5′-TGCCTAGGAGGCAAAAGCAA-3′; ALP, (forward) 5′-TGTGTGGGGTGAAGGCCAAT-3′, (reverse) 5′-TCGTGGTGGTCACAATGCCC-3′; BMP2, (forward) 5′-GACTGCGGTCTCCTAAAGGTCG-3′, (reverse) 5′-CTGGGGAAGCAGCAACGCTA-3′; BMP4, (forward) 5′-AGGCCGAAAGCTGTTCACCG-3′, (reverse) 5′-TACGGAATGGCTCCATGTTCCC-3′; BMPR1A, (forward) 5′-TTCCCTGGGGTCCGGACTTA-3′, (reverse) 5′-ACGACTCCTCCAAGATGTGGC-3′; BMPR1B, (forward) 5′-AGCCTGCCATAAGTGAGAAGCAAA-3′, (reverse) 5′-GGTGGTGGCATTTACAACGCA-3′; PCAF, (forward) 5′-AGGTTCCCCATGGATCTGAAAACC-3′, (reverse) 5′-AAAGACTCGCTGTAAGTCTGCCA-3′; GCN5, (forward) 5′-ATCTGGGCGTCTACCTGGCA-3′, (reverse) 5′-ACAGGAATCTGCCATCCCCAGA-3′, Pcaf, (forward) 5′-ACCTCGGTACGAAACCACAA-3′; (reverse) 5′-TGAAGACCGAGCGAACGAAT-3′. Chromatin Immunoprecipitation (ChIP) Assay Briefly, 2 × 107 cells were crosslinked with 1% formaldehyde, resuspended in lysis buffer (1% sodium dodecyl sulfate [SDS], 10 mM EDTA, and 50 mM Tris-HCl [pH 8.0]) on ice for 3 minutes and fragmented by sonication in RIPA ChIP buffer (0.5 mM EGTA, 140 mM NaCl, 10 mM Tris-HCl, pH 7.5, 1% TritonX-100, 0.01% SDS, 1 mM EDTA and protease inhibitor). Soluble chromatin was then diluted and subjected to immunoprecipitation with the indicated antibodies [PCAF (Abcam, Cambridge, UK, http://www.abcam.com/), H3K9ac (Abcam, Cambridge, UK, http://www.abcam.com/), H3 (Abcam, Cambridge, UK, http://www.abcam.com/)]. Immune complexes were then precipitated with Protein A/G dynabeads, washed sequentially with RIPA ChIP and TE (50 mM NaCl, 5 mM EDTA, and 50 mM Tris-HCl [pH 8.0]) buffer. After the crosslinking was reversed, immune complexes containing DNA were purified and eluted. The precipitated DNA was subjected to RT-qPCR analysis. Sequences of ChIP primers were as follows: BMP2, (forward) 5′-TAGGAGAGCGAGGGGAGAG-3′, (reverse) 5′-CTCGCCAGTTGAAAGCACC-3′; BMP4, (forward) 5′-CTCTTTCCCTCCCTCGCTTT-3′, (reverse) 5′-GAGGAGGGAAGGAGGGAGG-3′; RUNX2, (forward): 5′-GGAGATCATCGCCGACCA-3′, (reverse) 5′-CACCGAGCACAGGAAGTTG-3′; BMPR1B, (forward) 5′-TTCTTACATCCGGGTGTGCT-3′, (reverse) 5′-GGCACCAGGTTTAACAGCAA-3′. Bone Formation In Vivo Nude mouse implantation was performed as described [19]. Briefly, 2 × 106 cells were mixed with Bio-Oss Collagen (Geistlich, Switzerland, http://www.geistlich-pharma.com/en/) and then transplanted subcutaneously into the dorsa of nude mice. Two transplantation sites were prepared in each mouse and transplanted with three groups of cells: MSC/Scrsh, MSC/PCAF sh#1, and MSC/PCAF sh#2. After 6 weeks, transplants were harvested and prepared for histological analysis. All animal work of this study was approved by the Peking University Biomedical Ethics Committee Experimental Animal Ethics Branch. Specimens of each group were harvested at 6 weeks after implantation, and animals in each group were sacrificed by CO2 asphyxiation. The bone constructs were fixed in 4% paraformaldehyde and then decalcified for 10 days in 10% EDTA (pH 7.4). After decalcification, the specimens were dehydrated and subsequently embedded in paraffin. Sections (5-µm thickness) were stained with hematoxylin and eosin (H&E) and Masson's trichrome stain. Micro CT Analysis of Mice C57BL/6 mice were obtained from The Jackson Laboratory (Bar Harbor, Maine, U.S., https://www.jax.org/). Mice were maintained in a pathogen-free facility on a 12 hour light/dark cycle with water and food provided ad libitum. Five-month-old mice were sham-operated (sham) or ovariectomized (OVX). The OVX mice presented osteoporosis as described previously [20]. Mice were allowed 3 months to recover from the ovariectomy surgery and then sacrificed for the related assays. Osteoporosis is also an age-related marker in mice [21]; therefore, female 2-month-old mice (young) and 16-month-old mice (old) were also studied. The proximal femur and tibia thoroughly dissected free of soft tissue was fixed with 4% paraformaldehyde for 24 hours and subsequently washed with 10% sucrose solution. Twelve hours later, images were scanned at a resolution of 8.82 μm, with tube voltage of 80 kV, tube current of 500 μA and exposure time of 1,500 ms. A typical examination consisted of a scout view, selection of the examination volume, automatic positioning, measurement, offline reconstruction, and evaluation. Two-dimensional images were used to generate 3D reconstructions using multimodal 3D visualization software (Inveon Research Workplace, Siemens, Munich, Germany) supplied by the micro-CT system. To evaluate the mass and microarchitecture in bone between different groups, micro-CT was undertaken using an Inveon MM system (Siemens). Images were acquired at an effective pixel size of 8.82 μm, voltage of 80 kV, current of 500 μA and exposure time of 1,500 ms in each of the 360 rotational steps. Parameters were calculated using an Inveon Research Workplace (Siemens) as follows: bone volume/total volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp) in the trabecular region (1–2 mm distal to the proximal epiphysis) according to guidelines set by the American Society for Bone and Mineral Research [22]. Histology and Immunofluorescence Staining of Bone Sections Bones were fixed in 4% paraformaldehyde at 4°C under constant agitation for 3 days. Bones were then decalcified in 14% EDTA solution (EDTA dissolved in Milli-Q water, and the pH was adjusted to 7.1 with ammonium hydroxide) at 4°C or RT under constant agitation for 3–5 days (fresh 14% EDTA solution was exchanged every 34 hours). Bones were then washed in PBS for 2 hours, soaked in 30% sucrose in PBS at 4°C under constant agitation overnight and finally embedded in optimal cutting temperature (OCT) compound. Free-floating sections (30-µm thick) were processed for immunohistochemistry as described previously [23] with minor modifications. The anti-PCAF antibody (Abcam, 1:100) was applied overnight at 4°C. The secondary antibody used was Alexa Fluor 546 labeled-goat anti-rabbit IgG (Invitrogen, 1:2000). Cell nuclei were counter stained with Hoechst 33358 (Invitrogen). Fluorescence images were acquired with a confocal laser scanning microscope (LSM510; Oberkochen, Germany, http://www.zeiss.com/carl-zeiss-jena/en_de/home.html). Statistical Analysis All statistical analyses were performed using the GraphPad scientific software for Windows (San Diego, California, U.S.). Comparisons between two groups were analyzed by independent two-tailed Student's t-tests, and comparisons between more than two groups were analyzed by one-way ANOVA followed by a Tukey's post hoc test. Data were expressed as the mean ± standard deviation (SD) of 3–10 experiments per group. p values <.05 were considered statistically significant. Results PCAF Expression Is Increased by Osteogenic Induction Through Smad in MSCs To investigate potential roles of histone H3K9 acetyltransferases in osteogenic differentiation of MSCs, we investigated expressions of PCAF and GCN5 in MSCs after osteogenic induction. As shown in Supporting Information Fig. S1A, S1B, the extracellular matrix mineralization was significantly increased as determined by Alizarin Red S staining and quantification at 2 weeks after osteogenic induction. Then the total RNA was extracted from both control cells and induced cells. The RT-qPCR revealed that the expression of both PCAF and GCN5 was significantly induced after osteogenic differentiation (Supporting Information Fig. S1C). To better understand the role that PCAF and GCN5 play in the osteogenic differentiation, we further analyzed the endogenous expression profile of PCAF and GCN5 in MSCs after osteogenic differentiation at 0 day, 3 days, 7 days, and 14 days. As shown in Fig. 1A–1C, increased expression of PCAF and GCN5 was paralleled by upregulation of osteogenic marker RUNX2, as determined by RT-qPCR. Figure 1 Open in new tabDownload slide PCAF expression is increased by osteogenic induction through Smad in mesenchymal stem cells (MSCs). (A–C): MSCs were treated with osteogenic media for 0 day, 3 days, 7 days, and 14 days, then the mRNA expression of RUNX2 (A), GCN5 (B), and PCAF (C) was assessed by RT-qPCR. (D): Immunoblotting was performed to determine the expression of GCN5 and PCAF in MSCs at 14 days after osteogenic induction. (E): The knockdown of SMAD1 by shRNA. SMAD1 expression was examined by western blot analysis. (F): The knockdown of SMAD1 inhibited PCAF expression. PCAF mRNA was detected by RT-qPCR. (G): The knockdown of SMAD1 inhibited PCAF expression, but not GCN5 expression, as determined by western blotting. (H): The knockdown of SMAD4 by shRNA. SMAD4 expression was examined by western blot analysis. (I): The knockdown of SMAD4 inhibited PCAF expression. PCAF mRNA was detected by RT-qPCR. All data are shown as mean ± SD, n = 3. **, p < .01 and ***, p < .001. Abbreviations: om, osteogenic media; pm, proliferation media. Figure 1 Open in new tabDownload slide PCAF expression is increased by osteogenic induction through Smad in mesenchymal stem cells (MSCs). (A–C): MSCs were treated with osteogenic media for 0 day, 3 days, 7 days, and 14 days, then the mRNA expression of RUNX2 (A), GCN5 (B), and PCAF (C) was assessed by RT-qPCR. (D): Immunoblotting was performed to determine the expression of GCN5 and PCAF in MSCs at 14 days after osteogenic induction. (E): The knockdown of SMAD1 by shRNA. SMAD1 expression was examined by western blot analysis. (F): The knockdown of SMAD1 inhibited PCAF expression. PCAF mRNA was detected by RT-qPCR. (G): The knockdown of SMAD1 inhibited PCAF expression, but not GCN5 expression, as determined by western blotting. (H): The knockdown of SMAD4 by shRNA. SMAD4 expression was examined by western blot analysis. (I): The knockdown of SMAD4 inhibited PCAF expression. PCAF mRNA was detected by RT-qPCR. All data are shown as mean ± SD, n = 3. **, p < .01 and ***, p < .001. Abbreviations: om, osteogenic media; pm, proliferation media. A similar pattern was also observed at protein level, as indicated by western blot analysis (Fig. 1D). In addition, BMP2 treatment promoted the PCAF expression effectively, but not GCN5 expression, as shown in Supporting Information Fig. S1D, S1E. BMP/SMAD signaling is a key regulator for osteogenic differentiation of stem cells, we next examined whether the induction of PCAF was dependent on SMAD signaling. Lentiviruses expressing SMAD1 shRNA was generated to knockdown SMAD1. Western blot analysis and fluorescent staining showed that SMAD1 was effectively depleted in MSCs expressing SMAD1 shRNA compared with MSCs expressing scramble shRNA (Fig. 1E; Supporting Information Fig. S1F). As shown in Fig. 1F, 1G; Supporting Information Fig. S1G, knockdown of SMAD1 dramatically reduced the expressions of PCAF, but not GCN5 in MSCs cultured in osteogenic media. Furthermore, the knockdown of SMAD4, another key factor associated with BMP signaling, also inhibited PCAF but not GCN5 expressions induced by osteogenic induction (Fig. 1H, 1I; Supporting Information Fig. S1H, S1I). PCAF Is Required for Osteogenic Differentiation In Vitro Since PCAF expression was increased after osteogenic induction, we next explored whether PCAF play a role in osteogenic differentiation of MSCs. We first established PCAF stable knockdown MSCs using lentiviral vectors expressing a short hairpin RNA (shRNA). To rule out off target effects, two shRNA sequences against PCAF were designed. The knockdown efficiency was confirmed by fluorescent staining and western blotting (Supporting Information Fig. S2A; Fig. 2A). After culturing the MSCs in osteogenic media for 7 days, ALP activity was detected and found to be significantly suppressed by PCAF knockdown (Fig. 2B, 2C). Since the ALP activity increases and then decreases during the osteogenic differentiation, to be sure that our observation is not due to a shift of the activity curve to longer or shorter times, we examined the ALP activity after culturing the MSCs in osteogenic media for 0 day, 4 days, 7 days, 10 days, 12 days, and 14 days. As shown in Supporting Information Fig. S2B, the ALP activity increased after osteogenic induction at 7 days, while decreased after 12 days of osteogenic differentiation. Moreover, the extracellular matrix mineralization, as determined by Alizarin Red S staining and quantification, was also impaired in PCAF knockdown cells at 2 weeks after osteogenic induction (Fig. 2D, 2E). To confirm that PCAF depletion inhibited osteogenic differentiation, we investigated several osteogenic markers when MSCs were treated with osteogenic induction. As shown in Fig. 2F–2H; Supporting Information Fig. S2C, in contrast to the control cells, knockdown of PCAF resulted in significantly decreased mRNA expression levels of SPP1, BGLAP, ALP, and RUNX2. Taken together, these results indicated that PCAF is required for osteogenic differentiation in vitro. Figure 2 Open in new tabDownload slide Knockdown of PCAF inhibits osteogenic differentiation in vitro. (A): Knockdown of PCAF was validated by western blotting. (B, C): PCAF knockdown decreased ALP activity in mesenchymal stem cells (MSCs). Control or PCAF knockdown MSCs were treated with proliferation or osteogenic media for 7 days for ALP staining (B), and cellular extracts were prepared to quantify ALP activity (C). (D, E): Knockdown of PCAF inhibited mineralization of MSCs. Cells with or without PCAF knockdown were treated with proliferation or osteogenic media for 14 days, and then calcium deposition was observed using Alizarin Red S staining (D) and quantified (E). Knockdown of PCAF inhibited the expression of BGLAP (F), SPP1 (G), and ALP (H) in MSCs, as determined by RT-qPCR. All data are shown as mean ± SD, n = 3. ***, p < .001. Abbreviations: ALP, alkaline phosphatase; om: osteogenic media; pm: proliferation media. Figure 2 Open in new tabDownload slide Knockdown of PCAF inhibits osteogenic differentiation in vitro. (A): Knockdown of PCAF was validated by western blotting. (B, C): PCAF knockdown decreased ALP activity in mesenchymal stem cells (MSCs). Control or PCAF knockdown MSCs were treated with proliferation or osteogenic media for 7 days for ALP staining (B), and cellular extracts were prepared to quantify ALP activity (C). (D, E): Knockdown of PCAF inhibited mineralization of MSCs. Cells with or without PCAF knockdown were treated with proliferation or osteogenic media for 14 days, and then calcium deposition was observed using Alizarin Red S staining (D) and quantified (E). Knockdown of PCAF inhibited the expression of BGLAP (F), SPP1 (G), and ALP (H) in MSCs, as determined by RT-qPCR. All data are shown as mean ± SD, n = 3. ***, p < .001. Abbreviations: ALP, alkaline phosphatase; om: osteogenic media; pm: proliferation media. The Regulation of Osteogenic Differentiation by PCAF Is Dependent on Its HAT Activity In order to further confirm the function of PCAF in the osteogenic differentiation process, we next established the PCAF rescue cell line with the vector, flag-PCAF (wild-type, WT) and flag-PCAF mutant (deletion 579–608, lacking the histone acetyltransferase activity) [24] (Fig. 3A; Supporting Information Fig. S3A). As shown in Fig. 3B, 3C, only WT PCAF but not the catalytic mutant PCAF could promote the ALP activity in response to osteogenic stimulation. Similarly, when MSCs were treated with differentiation media at 2 weeks, only WT PCAF could enhance the formation of mineralization nodules (Fig. 3D, 3E). Thus, the regulation of osteogenic differentiation by PCAF appeared to be dependent on its HAT activity. In addition, we detected the expression of osteogenesis-associated genes in the PCAF rescue cell line under osteogenic induction. These genes were only upregulated in WT PCAF-overexpressing cells compared with the control cells and mutant PCAF-overexpressing cells (Fig. 3F–3H; Supporting Information Fig. S3B). Together, these results indicated that the HAT activity of PCAF is indispensable for the regulation of osteogenic differentiation. Figure 3 Open in new tabDownload slide The acetyltransferase activity of PCAF is indispensable for the regulation of osteogenic differentiation. (A): Rescue of WT or mutant PCAF cell line was validated by western blotting. (B, C): Overexpression of WT PCAF increased ALP activity of mesenchymal stem cells (MSCs). Control, WT or mutant PCAF rescue cells were treated with proliferation or osteogenic media for 7 days for ALP staining (B), and cellular extracts were prepared to quantify ALP activity (C). (D, E) Overexpression of WT PCAF promoted mineralization in MSCs. Cells with WT or mutant PCAF overexpression were treated with proliferation or osteogenic media for 14 days, and then calcium deposition was observed using Alizarin Red S staining (D) and quantified (E). Overexpression of WT PCAF promoted expression of BGLAP (F), RUNX2 (G), and SPP1 (H) in MSCs, as determined by RT-qPCR. All data are shown as mean ± SD, n = 3. **, p < .01 and ***, p < .001. Abbreviations: ALP, alkaline phosphatase; om: osteogenic media; pm: proliferation media. Figure 3 Open in new tabDownload slide The acetyltransferase activity of PCAF is indispensable for the regulation of osteogenic differentiation. (A): Rescue of WT or mutant PCAF cell line was validated by western blotting. (B, C): Overexpression of WT PCAF increased ALP activity of mesenchymal stem cells (MSCs). Control, WT or mutant PCAF rescue cells were treated with proliferation or osteogenic media for 7 days for ALP staining (B), and cellular extracts were prepared to quantify ALP activity (C). (D, E) Overexpression of WT PCAF promoted mineralization in MSCs. Cells with WT or mutant PCAF overexpression were treated with proliferation or osteogenic media for 14 days, and then calcium deposition was observed using Alizarin Red S staining (D) and quantified (E). Overexpression of WT PCAF promoted expression of BGLAP (F), RUNX2 (G), and SPP1 (H) in MSCs, as determined by RT-qPCR. All data are shown as mean ± SD, n = 3. **, p < .01 and ***, p < .001. Abbreviations: ALP, alkaline phosphatase; om: osteogenic media; pm: proliferation media. PCAF Are Required for MSC-Mediated Bone Formation In Vivo To verify our in vitro findings, we examined whether the knockdown of PCAF affected MSC-mediated bone formation in vivo. H&E staining showed that PCAF knockdown cells formed less bone tissues than control cells (Fig. 4A, 4B; Supporting Information Fig. S4A). Consistent with the observations from H&E staining, the osteogenic differentiation potential was markedly decreased for hybrids containing PCAF sh/MSCs compared with control cells, as detected by Masson’ trichrome staining (Fig. 4C; Supporting Information Fig. S4B). As a whole, these results indicated the novel role of PCAF in bone formation in vivo. Figure 4 Open in new tabDownload slide PCAF is required for mesenchymal stem cells (MSC)-mediated bone formation in vivo. (A): Knockdown of PCAF reduced MSC-mediated bone formation in vivo, as determined by H&E staining of histological sections from implanted MSC-scaffold hybrids. Scale bar represents 100 µm. (B): Quantitative measurements of bone-like tissues demonstrated that, at 6 weeks after implantation, the area of bone formation was significantly decreased in PCAF knockdown cells compared with control cells. (C): Masson's trichrome staining of histological sections from implanted MSC-scaffold hybrids. Scale bar represents 100 µm. (D): Knockdown of PCAF promoted adipogenic differentiation of MSCs by oil red staining. All data are shown as the mean ± SD, n = 3. **, p < .01 and ***, p < .001. Figure 4 Open in new tabDownload slide PCAF is required for mesenchymal stem cells (MSC)-mediated bone formation in vivo. (A): Knockdown of PCAF reduced MSC-mediated bone formation in vivo, as determined by H&E staining of histological sections from implanted MSC-scaffold hybrids. Scale bar represents 100 µm. (B): Quantitative measurements of bone-like tissues demonstrated that, at 6 weeks after implantation, the area of bone formation was significantly decreased in PCAF knockdown cells compared with control cells. (C): Masson's trichrome staining of histological sections from implanted MSC-scaffold hybrids. Scale bar represents 100 µm. (D): Knockdown of PCAF promoted adipogenic differentiation of MSCs by oil red staining. All data are shown as the mean ± SD, n = 3. **, p < .01 and ***, p < .001. Inhibition of Adipocyte Lineage Commitment of MSCs by PCAF As normal bone homeostasis relies on the balance between osteogenesis and adipogenesis in differentiating MSCs, an osteogenic lineage commitment could be coupled with an inhibition of adipogenic differentiation. To explore the potential role of PCAF in regulating adipogenic differentiation of MSCs, PCAF sh MSCs and control cells were grown in adipogenic-inducing media, after 3 weeks of culture, we performed Oil-Red-O staining to detect the lipid droplets. As shown in Fig. 4D, we observed increase of adipogenesis in PCAF sh MSCs as compared with control cells. In addition, the depletion of PCAF enhanced the mRNA level of the master adipogenic transcription factor PPAR-γ, as shown in Supporting Information Fig. S4C. PCAF Acetylates Histone H3K9 At Promoters of BMP Pathway Genes In order to explore the molecular mechanisms underlying the regulation of osteogenic differentiation by PCAF, we performed RT-qPCR analysis to assess the expression of key genes associated with osteogenic differentiation of MSCs. As shown in Supporting Information Fig. S5A, PCAF knockdown with both shRNAs led to reduction in the expressions of a subset of BMP signaling genes, including BMP2, BMP4, BMPR1B, RUNX2. However, overexpression of WT PCAF, but not a PCAF mutant caused a significant increase in the indicated genes (Supporting Information Fig. S5B). Based on these data, we extended our investigation to determine whether PCAF associates with promoters of BMP pathway genes, using chromatin immunoprecipitation (ChIP) analysis. Compared with the IgG negative control signals, we detected obvious PCAF occupancy at the indicated promoters (Fig. 5A–5D). To further confirm PCAF binding to the indicated gene promoter, we observed that the knockdown of PCAF reduced PCAF binding to the BMP2, BMP4, BMPR1B, and RUNX2 promoters by ChIP assays (Supporting Information Fig. S5C–S5F). Consistently, decreased binding of PCAF at the promoter regions was associated with decreased appearance of its substrate, H3K9 ac, which is a hallmark of gene activation (Fig. 5E–5H). Collectively, these results suggested that PCAF was recruited to promoters of BMP pathway genes to acetylate H3K9 and activate BMP signaling. To further determine the functional connection between PCAF and BMP signaling in osteogenic differentiation, we examined the effect of BMP2 on osteogenesis in PCAF-knockdown cells. As shown in Supporting Information Fig. S6A, S6B, treatment of PCAF knockdown cells with BMP2, could reverse the ALP activity caused by PCAF deficiency. Moreover, knockdown of SMAD1 alters PCAF-controlled RUNX2 expression in MSCs, as shown in Supporting Information Fig. S6C, S6D. It is well-known that BMP signaling regulates cells function via Smads, collectively, our data suggested that PCAF promotes osteogenic differentiation through the BMP/SMAD signaling pathway. Figure 5 Open in new tabDownload slide PCAF acetylates histone H3K9 at promoters of BMP pathway genes. (A–D): Endogenous PCAF is recruited to the promoters of BMP2 (A), BMP4 (B), BMPR1B (C), and RUNX2 (D). (E–H) ChIP analysis detected H3K9 acetylation at the promoters of BMP2 (E), BMP4 (F), BMPR1B (G), and RUNX2 (H) in WT and PCAF knockdown mesenchymal stem cells (MSCs). Antibodies to acetylated H3K9 (AcH3K9) and to H3 were used, and acetylated H3K9 levels are shown relative to total H3 levels. All data are shown as mean ± SD, n = 3. **, p < .01 and ***, p < .001. Abbreviations: BMP, bone morphogenetic protein. Figure 5 Open in new tabDownload slide PCAF acetylates histone H3K9 at promoters of BMP pathway genes. (A–D): Endogenous PCAF is recruited to the promoters of BMP2 (A), BMP4 (B), BMPR1B (C), and RUNX2 (D). (E–H) ChIP analysis detected H3K9 acetylation at the promoters of BMP2 (E), BMP4 (F), BMPR1B (G), and RUNX2 (H) in WT and PCAF knockdown mesenchymal stem cells (MSCs). Antibodies to acetylated H3K9 (AcH3K9) and to H3 were used, and acetylated H3K9 levels are shown relative to total H3 levels. All data are shown as mean ± SD, n = 3. **, p < .01 and ***, p < .001. Abbreviations: BMP, bone morphogenetic protein. PCAF Is Decreased in Bone Sections of Osteoporotic Mice Previously, the ovariectomized (OVX) mice were verified to display significantly increased adipogenesis and decreased osteogenesis in their bone marrow with osteoporosis [25]. To evaluate the possible functional significance of PCAF in bone remodeling in vivo, we produced OVX mice as an animal model of postmenopausal osteoporosis. Compared with sham-operated mice, OVX mice exhibited significantly increased adipose tissues and decreased trabecular bones, as shown in Fig. 6A–C; Supporting Information Fig. S7A, S7B. Next we examined whether PCAF was impaired during osteoporosis, using immunohistochemistry staining. While PCAF in femur bone sections stained very strongly in sham-operated mice, the expressions of PCAF was detected very weakly in OVX mice (Fig. 6D, 6E). In aged mice, adipogenesis is also increased in bone marrow whereas osteoblastogenesis is reduced [26]. Compared with younger, 2-month-old mice, we observed that adipose tissues were significantly increased in the bone marrows of 16-month old mice, and micro CT showed that the trabecular bone was significantly reduced in 16-month-old mice compared with the 2-month-old mice (Fig. 6F–6H; Supporting Information Fig. S7C, S7D). To further confirm that PCAF is associated with osteogenic differentiation, we also examined their status in aged mice. In contrast to the 2-month-old mice, immunohistochemistry and confocal microscopy of femur sections in 16-month-old mice showed decreased PCAF staining (Fig. 6I, 6J). Figure 6 Open in new tabDownload slide PCAF are decreased in bone sections of osteoporotic mice. (A): Representative micro CT image and H&E staining of bone loss in OVX mice. Scale bar for micro CT and H&E represents 1 mm and 20 µm, respectively. (B): Trabecular number was reduced in OVX mice. (C): Bone volume was reduced in OVX mice. (D): Histology and immunofluorescence of sections from OVX mice showed decreased PCAF expression compared with sham mice. Scale bar represents 50 µm. (E): Quantification of normalized PCAF signals in (D). (F): Representative micro CT image and H&E staining of bone loss in 2-month-old mice and 16-month-old mice. Scale bar for micro CT and H&E represents 1 mm and 20 µm, respectively. (G, H): Trabecular number (G), and bone volume fraction (H) were detected in 2-month-old mice and 16-month-old mice. (I): Immunofluorescence staining of PCAF in bone tissues of 2-month-old mice, and 16-month-old mice. Scale bar represents 50 µm. (J): Quantification of normalized PCAF signals in (I). All data are shown as mean ± SD, n = 3. *, p < .05, **, p < .01, and ***, p < .001. Figure 6 Open in new tabDownload slide PCAF are decreased in bone sections of osteoporotic mice. (A): Representative micro CT image and H&E staining of bone loss in OVX mice. Scale bar for micro CT and H&E represents 1 mm and 20 µm, respectively. (B): Trabecular number was reduced in OVX mice. (C): Bone volume was reduced in OVX mice. (D): Histology and immunofluorescence of sections from OVX mice showed decreased PCAF expression compared with sham mice. Scale bar represents 50 µm. (E): Quantification of normalized PCAF signals in (D). (F): Representative micro CT image and H&E staining of bone loss in 2-month-old mice and 16-month-old mice. Scale bar for micro CT and H&E represents 1 mm and 20 µm, respectively. (G, H): Trabecular number (G), and bone volume fraction (H) were detected in 2-month-old mice and 16-month-old mice. (I): Immunofluorescence staining of PCAF in bone tissues of 2-month-old mice, and 16-month-old mice. Scale bar represents 50 µm. (J): Quantification of normalized PCAF signals in (I). All data are shown as mean ± SD, n = 3. *, p < .05, **, p < .01, and ***, p < .001. In addition, we isolated MSCs from sham mice, OVX-ed mice, 2-month-old mice, and 16-month-old mice separately. Mouse MSCs used in our studies are nestin-positive cells (Supporting Information Fig. S7E, S7F). RT-qPCR revealed that the expression of Pcaf was decreased in MSCs from OVX-ed compared with those from sham mice (Supporting Information Fig. S7G). Compared with 2-month-old mice, MSCs from 16-month-old mice also displayed significantly reduced Pcaf expression (Supporting Information Fig. S7H). Discussion The fate decision and lineage differentiation of MSCs is a complex biological process orchestrated by multiple layers of regulation including epigenetic, transcriptional and post-transcriptional ways. It has becoming increasingly clear that the chromatin modifications play crucial roles during these processes [27]. Modified histone domains have been identified as epigenetic signatures that either mark for gene activation, such as acetylated histone H3K9 and trimethylated histone H3K4, or mark for gene repression, such as trimethylated H3K9 and H3K27 [28, 29]. In the present study, we detected that both H3K9 acetyltransferase GCN5 and PCAF were induced after osteogenic differentiation. Interestingly, GCN5 was identified to regulate osteogenic commitment of MSCs independent of its HAT activity in our previous study [19]; but the HAT activity of PCAF is indispensable for the regulation of osteogenic differentiation in this work. In addition, we detected that PCAF played a critical role in osteogenic differentiation by increasing H3K9 acetylation on BMP signaling genes. More importantly, given the inverse relationship between osteogenic and adipogenic lineage commitment, we found that PCAF was abnormally decreased in bone sections of osteoporotic mice. Together, our findings highlighted that PCAF-mediated chromatin modification played an important role in the osteogenic differentiation and in the metabolic bone disease. Recently, accumulating evidence has showed that histone modification enzymes contribute to normal skeletal development and bone formation. For instance, Sirt6-deficient mice exhibits low bone mineral density; HDAC2 mutant mice and HDAC3 knockout mice exhibit severe bone defects such as reduced body size resulting from impaired endochondral bone formation [30-32]; Moreover, H3K4me3 demethylase RBP2 was reported to regulate osteogenic differentiation in vitro and in vivo [33], and histone demethylases KDM4B and KDM6B play critical roles in osteogenic commitment of MSCs by removing H3K9me3 and H3K27me3 [17]. However, little is known about the role of histone acetyltransferase in osteoblast differentiation and bone formation. Here, we provide evidence that PCAF has a stimulative effect on osteogenic differentiation of MSCs. Consistent with our findings, one early study show that PCAF acetylates Runx2 to promote osteoblast differentiation [34]. The novelty of our work lies in: First, PCAF expression increased during the osteogenic process through Smad signaling. Second, the regulation of osteogenic differentiation by PCAF is dependent on its HAT activity. Third, PCAF regulates osteogenic differentiation by increasing H3K9 acetylation on BMP signaling genes. Additionally, we found that PCAF knockdown significantly impaired bone formation in vivo. Finally, we detected that PCAF expression was decreased in bone sections of osteoporotic mice. Our results revealed the detailed underlying molecular mechanism by which PCAF regulates osteogenic differentiation, on the other hand, we first verified that PCAF might play important roles in the development of osteoporosis by influencing the determination of MSCs’ fate. Most importantly, our present work shed light on the function of epigenetic mark H3K9 acetylation and histone acetyltransferase PCAF in the MSCs lineage commitment and metabolic bone disease. PCAF is a member of the GNAT (GCN5-related N-acetyltransferase) family of protein acetyltransferases [35]. This histone acetyltransferase has roles in regulation of transcription, cell cycle progression, and differentiation [24, 36, 37]. Functional and structural characterization of PCAF acetyltransferase activity indicated that Lysines 9 and 14 of histone H3 are the preferred substrates, and these residues appear to play a critical role in promoting the association of histone H3 with PCAF [38, 39]. There is also increasing evidence that PCAF modulates nonhistone proteins [40-43] including hypoxia-inducible factor 1α (Hif-1α) [44] and Notch [45]. In the present study, we generated PCAF wild type and PCAF mutant (deletion 579–608, lacking the histone acetyltransferase activity) rescue cells, only WT PCAF but not the catalytically mutant PCAF is capable of promoting osteogenic differentiation. Our data also showed that PCAF positively regulates BMP signaling via histone H3K9 acetylation. These finding supported the role of histone acetyltransferase PCAF in gene expression via modulation of chromatin [46]. In addition to histone acetylation, histone methylation has recently been identified as a key modulator of MSC lineage specification as well [17, 33]. The regulation of MSC lineage specification by SET domain-containing histone lysine methyltransferases (KMTs) and JmjC domain-containing histone lysine demethylases (KDMs) has been well studied [47]. However, whether there is a connection between acetylation and methylation of histone is still vague and whether histone acetylation and methylation may cooperate with each other during the lineage commitment of MSCs needs further investigation. Osteoporosis is one of the most common bone metabolic diseases and is associated with a shift in MSCs lineage commitment [48, 49]. Our immunostaining analysis revealed decreased PCAF expression in bone sections of osteoporotic mice. These results indicated that PCAF might play important roles in the development of osteoporosis by influencing the determination of MSCs’ fate. Histone acetyltransferase is chemically modifiable; therefore, PCAF may have potentials as a therapeutic target for stem cell-mediated regenerative medicine, as well as treatment of osteoporosis. Acknowledgments This study was supported by grants from the National Natural Science Foundation of China (No. 81500822, No. 81570953), the Program for New Century Excellent Talents in University from Ministry of Education (NCET-11-0026), the PKU School of Stomatology for Talented Young Investigators (PKUSS20140109), and the Construction Program for National Key Clinical Specialty from National Health and Family Planning Commission of China (2011). Author Contributions P.Z.: conception and design, collection and/or assembly of data, data analysis and interpretation, and manuscript writing; Y.L.: data analysis and interpretation; C.J.: collection and/or assembly of data; M.Z.: collection and/or assembly of data; L.L.: administrative support; X.Z.: administrative support; H.L.: collection and/or assembly of data; Y.Z.: conception and design, financial support, manuscript writing, and final approval of manuscript. Disclosure of Potential Conflicts of Interest The authors indicate no potential conflicts of interest. References 1 Bianco P , Robey PG, Simmons PJ. Mesenchymal stem cells: Revisiting history, concepts, and assays . Cell Stem Cell 2008 ; 2 : 313 – 319 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Caplan AI. Adult mesenchymal stem cells for tissue engineering versus regenerative medicine . J Cell Physiol 2007 ; 213 : 341 – 347 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Levi B , Longaker MT. Concise review: Adipose-derived stromal cells for skeletal regenerative medicine . Stem Cells (Dayton, Ohio) 2011 ; 29 : 576 – 582 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Teitelbaum SL. Stem cells and osteoporosis therapy . Cell Stem Cell 2010 ; 7 : 553 – 554 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Caplan AI , Bruder SP. Mesenchymal stem cells: building blocks for molecular medicine in the 21st century . Trends Mol Med 2001 ; 7 : 259 – 264 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Kon E , Filardo G, Roffi A et al. Bone regeneration with mesenchymal stem cells . Clin Cases Miner Bone Metab 2012 ; 9 : 24 – 27 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 7 Medici D , Shore EM, Lounev VY et al. Conversion of vascular endothelial cells into multipotent stem-like cells . Nat Med 2010 ; 16 : 1400 – 1406 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Huebsch N , Arany PR, Mao AS et al. Harnessing traction-mediated manipulation of the cell/matrix interface to control stem-cell fate . Nat Mater 2010 ; 9 : 518 – 526 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Villagra A , Gutierrez J, Paredes R et al. Reduced CpG methylation is associated with transcriptional activation of the bone-specific rat osteocalcin gene in osteoblasts . J Cell Biochem 2002 ; 85 : 112 – 122 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Lee HW , Suh JH, Kim AY et al. Histone deacetylase 1-mediated histone modification regulates osteoblast differentiation . Mol Endocrinol 2006 ; 20 : 2432 – 2443 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Wei Y , Chen YH, Li LY et al. CDK1-dependent phosphorylation of EZH2 suppresses methylation of H3K27 and promotes osteogenic differentiation of human mesenchymal stem cells . Nat Cell Biol 2011 ; 13 : 87 – 94 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Bandyopadhyay A , Tsuji K, Cox K et al. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis . PLoS Genet 2006 ; 2 : e216 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Kamiya N , Ye L, Kobayashi T et al. Disruption of BMP signaling in osteoblasts through type IA receptor (BMPRIA) increases bone mass . J Bone Miner Res 2008 ; 23 : 2007 – 2017 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Kamiya N , Kobayashi T, Mochida Y et al. Wnt inhibitors Dkk1 and sost are downstream targets of BMP signaling through the type IA receptor (BMPRIA) in osteoblasts . J Bone Miner Res 2010 ; 25 : 200 – 210 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Chen D , Ji X, Harris MA et al. Differential roles for bone morphogenetic protein (BMP) receptor type IB and IA in differentiation and specification of mesenchymal precursor cells to osteoblast and adipocyte lineages . J Cell Biol 1998 ; 142 : 295 – 305 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Shim JH , Greenblatt MB, Singh A et al. Administration of BMP2/7 in utero partially reverses Rubinstein-taybi syndrome-like skeletal defects induced by Pdk1 or cbp mutations in mice . J Clin Invest 2012 ; 122 : 91 – 106 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Ye L , Fan Z, Yu B et al. Histone demethylases KDM4B and KDM6B promotes osteogenic differentiation of human MSCs . Cell Stem Cell 2012 ; 11 : 50 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Zhang P , Tu B, Wang H et al. Tumor suppressor p53 cooperates with SIRT6 to regulate gluconeogenesis by promoting FoxO1 nuclear exclusion . Proc Natl Acad Sci U S A 2014 ; 111 : 10684 – 10689 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Zhang P , Liu Y, Jin C et al. Histone acetyltransferase GCN5 regulates osteogenic differentiation of mesenchymal stem cells by inhibiting NF-kappaB . J Bone Miner Res 2016 ; 31 : 391 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Ducy P , Desbois C, Boyce B et al. Increased bone formation in osteocalcin-deficient mice . Nature 1996 ; 382 : 448 – 452 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Weiss A , Arbell I, Steinhagen-Thiessen E et al. Structural changes in aging bone: osteopenia in the proximal femurs of female mice . Bone 1991 ; 12 : 165 – 172 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Bouxsein ML , Boyd SK, Christiansen BA et al. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography . J Bone Miner Res 2010 ; 25 : 1468 – 1486 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Kennedy J , Baris C, Hoyland JA et al. Immunofluorescent localization of estrogen receptor-alpha in growth plates of rabbits, but not in rats, at sexual maturity . Bone 1999 ; 24 : 9 – 16 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Puri PL , Sartorelli V, Yang XJ et al. Differential roles of p300 and PCAF acetyltransferases in muscle differentiation . Mol Cell 1997 ; 1 : 35 – 45 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Chang J , Wang Z, Tang E et al. Inhibition of osteoblastic bone formation by nuclear factor-kappaB . Nat Med 2009 ; 15 : 682 – 689 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Muruganandan S , Roman AA Sinal CJ. Adipocyte differentiation of bone marrow-derived mesenchymal stem cells: Cross talk with the osteoblastogenic program . Cell Mol Life Sci 2009 ; 66 : 236 – 253 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Teven CM , Liu X, Hu N et al. Epigenetic regulation of mesenchymal stem cells: a focus on osteogenic and adipogenic differentiation . Stem Cells Int 2011 ; 2011 : 201371 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Shi Y. Histone lysine demethylases: Emerging roles in development, physiology and disease . Nat Rev Genet 2007 ; 8 : 829 – 833 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Agger K , Christensen J, Cloos PA et al. The emerging functions of histone demethylases . Curr Opin Genet Dev 2008 ; 18 : 159 – 168 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Mostoslavsky R , Chua KF, Lombard DB et al. Genomic instability and aging-like phenotype in the absence of mammalian SIRT6 . Cell 2006 ; 124 : 315 – 329 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Razidlo DF , Whitney TJ, Casper ME et al. Histone deacetylase 3 depletion in osteo/chondroprogenitor cells decreases bone density and increases marrow fat . PloS One 2010 ; 5 : e11492 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Zimmermann S , Kiefer F, Prudenziati M et al. Reduced body size and decreased intestinal tumor rates in HDAC2-mutant mice . Cancer Res 2007 ; 67 : 9047 – 9054 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Ge W , Shi L, Zhou Y et al. Inhibition of osteogenic differentiation of human adipose-derived stromal cells by retinoblastoma binding protein 2 repression of RUNX2-activated transcription . Stem Cells 2011 ; 29 : 1112 – 1125 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Wang CY , Yang SF, Wang Z et al. PCAF acetylates Runx2 and promotes osteoblast differentiation . J Bone Miner Metab 2013 ; 31 : 381 – 389 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Yang XJ , Ogryzko VV, Nishikawa J et al. A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A . Nature 1996 ; 382 : 319 – 324 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Xenaki G , Ontikatze T, Rajendran R et al. PCAF is an HIF-1alpha cofactor that regulates p53 transcriptional activity in hypoxia . Oncogene 2008 ; 27 : 5785 – 5796 . Google Scholar Crossref Search ADS PubMed WorldCat 37 Zheng X , Gai X, Ding F et al. Histone acetyltransferase PCAF up-regulated cell apoptosis in hepatocellular carcinoma via acetylating histone H4 and inactivating AKT signaling . Mol Cancer 2013 ; 12 : 96 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Schiltz RL , Mizzen CA, Vassilev A et al. Overlapping but distinct patterns of histone acetylation by the human coactivators p300 and PCAF within nucleosomal substrates . J Biol Chem 1999 ; 274 : 1189 – 1192 . Google Scholar Crossref Search ADS PubMed WorldCat 39 Poux AN , Marmorstein R. Molecular basis for Gcn5/PCAF histone acetyltransferase selectivity for histone and nonhistone substrates . Biochemistry 2003 ; 42 : 14366 – 14374 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Imhof A , Yang XJ, Ogryzko VV et al. Acetylation of general transcription factors by histone acetyltransferases . Curr Biol 1997 ; 7 : 689 – 692 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Liu L , Scolnick DM, Trievel RC et al. p53 sites acetylated in vitro by PCAF and p300 are acetylated in vivo in response to DNA damage . Mol Cell Biol 1999 ; 19 : 1202 – 1209 . Google Scholar Crossref Search ADS PubMed WorldCat 42 Sartorelli V , Puri PL, Hamamori Y et al. Acetylation of MyoD directed by PCAF is necessary for the execution of the muscle program . Mol Cell 1999 ; 4 : 725 – 734 . Google Scholar Crossref Search ADS PubMed WorldCat 43 Itoh S , Ericsson J, Nishikawa J et al. The transcriptional co-activator P/CAF potentiates TGF-beta/smad signaling . Nucleic Acids Res 2000 ; 28 : 4291 – 4298 . Google Scholar Crossref Search ADS PubMed WorldCat 44 Lim JH , Lee YM, Chun YS et al. Sirtuin 1 modulates cellular responses to hypoxia by deacetylating hypoxia-inducible factor . Mol Cell 2010 ; 38 : 864 – 878 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Guarani V , Deflorian G, Franco CA et al. Acetylation-dependent regulation of endothelial notch signalling by the SIRT1 deacetylase . Nature 2011 ; 473 : 234 – 238 . Google Scholar Crossref Search ADS PubMed WorldCat 46 Herrera JE , Schiltz RL Bustin M. The accessibility of histone H3 tails in chromatin modulates their acetylation by P300/CBP-associated factor . J Biol Chem 2000 ; 275 : 12994 – 12999 . Google Scholar Crossref Search ADS PubMed WorldCat 47 Deng P , Chen QM, Hong C et al. Histone methyltransferases and demethylases: regulators in balancing osteogenic and adipogenic differentiation of mesenchymal stem cells . Int J Oral Sci 2015 ; 7 : 197 – 204 . Google Scholar Crossref Search ADS PubMed WorldCat 48 Rosen CJ , Bouxsein ML. Mechanisms of disease: Is osteoporosis the obesity of bone? Nat Clin Pract Rheumatol 2006 ; 2 : 35 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Rodriguez JP , Astudillo P, Rios S et al. Involvement of adipogenic potential of human bone marrow mesenchymal stem cells (MSCs) in osteoporosis . Curr Stem Cell Res Ther 2008 ; 3 : 208 – 218 . Google Scholar Crossref Search ADS PubMed WorldCat © 2016 AlphaMed Press This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Histone H3K9 Acetyltransferase PCAF Is Essential for Osteogenic Differentiation Through Bone Morphogenetic Protein Signaling and May Be Involved in Osteoporosis
JO - Stem Cells
DO - 10.1002/stem.2424
DA - 2016-09-01
UR - https://www.deepdyve.com/lp/oxford-university-press/histone-h3k9-acetyltransferase-pcaf-is-essential-for-osteogenic-qS5BklbN8i
SP - 2332
EP - 2341
VL - 34
IS - 9
DP - DeepDyve
ER -