TY - JOUR
AU - Trottier, N. L.
AB - ABSTRACT To test the hypothesis that reduction in dietary CP concentration coupled with crystalline AA inclusion increases the efficiency of AA use for milk production, mammary AA arteriovenous concentration differences (A-V), AA transport efficiency (A-V/A × 100), and transcript abundance of AA transporters and milk protein genes were determined in lactating sows fed 1 of 3 diets containing 9.5% (Deficient), 13.5% (Ideal), or 17.5% (Standard) CP, with a similar profile of indispensable and dispensable AA. On d 7 and 18, arterial and mammary venous blood and mammary tissue were sampled postfeeding. Transcript abundance of AA transporters b0,+AT (SLC7A9), y+LAT2 (SLC7A6), ATB0,+ (SLC6A14), CAT-1 (SLC7A1), and CAT-2b (SLC7A2) and milk protein β-casein (CSN2) and LALBA (α-lactalbumin) were determined using reverse transcription quantitative PCR. Piglet ADG increased curvilinearly (linear and quadratic, P < 0.03) with increasing percent CP from Deficient to Standard. On d 7, Lys and Arg A-V and transport efficiency increased quadratically (P < 0.05) with increasing percent CP. On d 18, Lys A-V tended to increase (linear, P = 0.08) with increasing percent CP. Increasing CP increased Ile and Val A-V on d 7 (linear, P = 0.05 and P = 0.08, respectively) and Leu and Val on d 18 (linear, P = 0.07 and P = 0.04, respectively). On d 7, plasma concentrations of branched chain AA (BCAA):Lys decreased quadratically (P < 0.05). Expression of genes SLC7A9, SLC7A6, SLC6A14, SLC7A1, SLC7A2, CSN2, and LALBA was unaffected by diet. In conclusion, decreasing the dietary CP from 17.5% to 13.5% with inclusion of crystalline AA did not affect piglet ADG, AA transporter, or milk protein gene expression but increased mammary transport efficiency and A-V of Lys and Arg on d 7 of lactation. This increase was associated with a decrease in plasma concentration of BCAA:Lys, suggesting a competitive mechanism between cationic and BCAA for transport of AA across mammary cells. Introduction Research is increasingly focused on nutritional strategies aimed at reaching an optimal dietary AA profile for better utilization of dietary protein by pigs (NRC, 2012). We have recently reported that AA imbalances created by excesses or deficiencies of dietary AA reduce the efficiency of N utilization in lactating sows, limiting milk protein synthesis and litter growth (Guan et al., 2004; Pérez-Laspiur et al., 2009). In growing pigs, reduction in dietary CP with concomitant inclusion of crystalline AA increases efficiency of Lys utilization and reduces N products excreted into the environment (Otto et al., 2003). However, there is poor mechanistic understanding of the factors that regulate dietary AA utilization efficiency at the cellular level. The intracellular availability of dietary AA is controlled by a coordinated activity of protein carriers located in the cellular membrane that channel AA into the cells (Palacín et al., 1998; Shennan et al., 1997; Broër, 2008). Lysine is the first limiting dietary AA for lactating sows (NRC, 1998), and thus AA transporters involved in Lys uptake are likely to play a key role in the global efficiency of dietary protein use by the mammary gland. We have previously reported an increase in transcript abundance of genes encoding for Lys AA transporters in response to milk demand (Manjarín et al., 2011) and to dietary AA availability (Pérez-Laspiur et al., 2009). Thus, the proportion of AA removed or extracted from the arterial circulation by the mammary gland is a reflection of AA transport rate relative to arterial AA availability. In this study, efficiency of AA transport is defined as the AA extraction rate. We hypothesize that the efficiency of AA transport by the porcine mammary gland increases in response to dietary CP reduction with crystalline AA inclusion and that this increase is mediated via an increase in mRNA abundance of mammary genes encoding for Lys transporters. The objectives of this study were 1) to test if a reduction in dietary CP (%) coupled with crystalline AA inclusion increases the efficiency of Lys utilization by the mammary gland for milk production and 2) to quantify the expression of genes encoding for specific mammary Lys transporters and dominant mammary-synthesized milk proteins. MATERIAL AND METHODS All animal procedures in this study were performed with the approval of the Institutional Animal Care and Use Committee at Michigan State University (AUF number 10/08-162-00). Animals and Tissue Collection Twenty-four multiparous sows (Landrace × Yorkshire) were used in a generalized block design with 3 replications (blocks). Block was defined as a farrowing cycle, with the first and second blocks consisting of 9 sows and the third block consisting of 6 sows. Three sows were removed from the experiment because of low feed intake or catheter-related problems; thus, the first and second blocks contained 8 and 7 sows, respectively. All treatments were represented in each block, but the number of sows per treatment in each block was unbalanced. All sows were individually housed in farrowing crates in a thermally controlled room (20°C) throughout the study. One week before the expected farrowing, sows were assigned by parity to receive 1 of 3 dietary treatments: 1) 9.5% CP (Deficient; n = 8), 13.5% CP (Ideal; n = 6), and 17.5% CP (Standard; n = 7). All sows were fed 2.5 kg·d−1 (as-fed) divided into 2 meals before farrowing. The day after farrowing was considered d 1 of lactation, and sows were fed 1 kg at 0800 and 1600 h. On d 2 and 3 of lactation, sows were fed a total of 3 and 4 kg, respectively, provided in 2 equal meals. For the remainder of the study, a maximum of 5.5 kg·d−1 was provided to ensure equal DM intake among all sows. Sow feed intake was recorded daily throughout lactation. Fresh water was freely available at all times. Sow BW was recorded on d 2 and 18 of lactation. Litters were equalized to 8 piglets weighing approximately 15 kg in total by cross-fostering within 24 h of birth. Litter weight was recorded on d 2 and 18 of lactation, and piglets were weaned on d 21 of lactation. Dietary Treatments and Feed Nutrient Analysis Deficient, Ideal, and Standard diets contained 0.50%, 0.81%, and 1.01% standardized ileal digestible (SID) Lys, respectively (Table 1). Desired CP reductions in Ideal and Deficient diets were achieved by diluting the Standard diet with cornstarch and sucrose, but keeping the soybean meal:corn constant across diets. Crystalline AA were added to the Ideal diet to meet the indispensable AA requirements and the AA:Lys for lactating sows nursing 10 piglets with a predicted ADG of 200 g·d−1, an estimated sow feed intake of 4.61 kg·d−1, and an anticipated lactational BW change of −10 kg (NRC, 1998). Crystalline L-Lys was then added to the Standard diet to be 30% greater than that of the Ideal (i.e., 1.01% vs. 0.81% SID). The Lys amount in the Standard diet was chosen to model industry feeding practices (C. F. M. de Lange, University of Guelph, Guelph, ON; and B. J. Kerr, ARS, USDA, Ames, IA, personal communication). To meet the NRC (1998) AA:Lys ratio and maintain an identical dietary AA profile to that of the Ideal diet, crystalline AA were also included in the Standard diet. Finally, L-Lys was added to the Deficient diet to meet 0.50% SID Lys to achieve similar dietary SID Lys spacing between the Deficient, Ideal, and Standard diets. As for the Standard diet, crystalline AA were included to ensure identical AA:Lys to the Ideal diet. In addition, soybean oil was used to reduce dustiness and improve palatability, and Solka-Floc (International Fiber Corporation, North Tonawanda, NY) was included to balance fiber across diets. Table 1. Ingredient composition of experimental diets (%, as-fed) Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard, 17.5% CP  Yellow corn  30.873  44.322  57.574  Soybean meal  14.911  21.246  27.631  Cornstarch  18.347  17.298  —  Sucrose  18.870  3.391  1.663  Soybean oil  4.768  4.232  5.514  Solka floc1  7.214  4.470  2.560  L-Lys×HCl  0.169  0.243  0.316  dl-Met  0.009  0.013  0.017  L-Thr  0.039  0.056  0.073  L-Trp  0.002  —  —  L-Val  0.045  0.065  0.084  L-Leu  0.001  —  —  L-Ile  0.001  —  —  Dicalcium phosphate  1.842  1.705  1.568  Limestone  1.010  1.055  1.099  Vitamin premix I2  0.600  0.600  0.600  Trace mineral premix3  0.500  0.500  0.500  Vitamin premix II4  0.300  0.300  0.300  NaCl  0.500  0.500  0.500  Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard, 17.5% CP  Yellow corn  30.873  44.322  57.574  Soybean meal  14.911  21.246  27.631  Cornstarch  18.347  17.298  —  Sucrose  18.870  3.391  1.663  Soybean oil  4.768  4.232  5.514  Solka floc1  7.214  4.470  2.560  L-Lys×HCl  0.169  0.243  0.316  dl-Met  0.009  0.013  0.017  L-Thr  0.039  0.056  0.073  L-Trp  0.002  —  —  L-Val  0.045  0.065  0.084  L-Leu  0.001  —  —  L-Ile  0.001  —  —  Dicalcium phosphate  1.842  1.705  1.568  Limestone  1.010  1.055  1.099  Vitamin premix I2  0.600  0.600  0.600  Trace mineral premix3  0.500  0.500  0.500  Vitamin premix II4  0.300  0.300  0.300  NaCl  0.500  0.500  0.500  1Purify cellulose (International Fiber Corporation, North Tonawanda, NY). 2Provided per kilogram of diet: vitamin A, 4,500 IU; vitamin D3, 458 IU; vitamin E, 55 IU; vitamin K, 11 mg; menadione, 3.66 mg; vitamin B12, 0.0275 mg; riboflavin, 3.66 mg; D-pantothenic acid, 14.67 mg; niacin, 22 mg; thiamine, 0.913 mg; and pyridoxine, 0.825 mg. 3Provided per kilogram of diet: Ca, 335 mg as calcium carbonate; Fe, 50 mg as ferrous sulfate; Zn, 50 mg as zinc oxide; Cu, 50 mg as copper sulfate; Se, 150 μg as sodium selenite; and I, 75 μg as potassium iodide. 4Provided per kilogram of diet: vitamin A, 2,756 IU; biotin, 221 μg; choline, 386 mg; and folic acid, 1.65 mg. View Large Table 1. Ingredient composition of experimental diets (%, as-fed) Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard, 17.5% CP  Yellow corn  30.873  44.322  57.574  Soybean meal  14.911  21.246  27.631  Cornstarch  18.347  17.298  —  Sucrose  18.870  3.391  1.663  Soybean oil  4.768  4.232  5.514  Solka floc1  7.214  4.470  2.560  L-Lys×HCl  0.169  0.243  0.316  dl-Met  0.009  0.013  0.017  L-Thr  0.039  0.056  0.073  L-Trp  0.002  —  —  L-Val  0.045  0.065  0.084  L-Leu  0.001  —  —  L-Ile  0.001  —  —  Dicalcium phosphate  1.842  1.705  1.568  Limestone  1.010  1.055  1.099  Vitamin premix I2  0.600  0.600  0.600  Trace mineral premix3  0.500  0.500  0.500  Vitamin premix II4  0.300  0.300  0.300  NaCl  0.500  0.500  0.500  Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard, 17.5% CP  Yellow corn  30.873  44.322  57.574  Soybean meal  14.911  21.246  27.631  Cornstarch  18.347  17.298  —  Sucrose  18.870  3.391  1.663  Soybean oil  4.768  4.232  5.514  Solka floc1  7.214  4.470  2.560  L-Lys×HCl  0.169  0.243  0.316  dl-Met  0.009  0.013  0.017  L-Thr  0.039  0.056  0.073  L-Trp  0.002  —  —  L-Val  0.045  0.065  0.084  L-Leu  0.001  —  —  L-Ile  0.001  —  —  Dicalcium phosphate  1.842  1.705  1.568  Limestone  1.010  1.055  1.099  Vitamin premix I2  0.600  0.600  0.600  Trace mineral premix3  0.500  0.500  0.500  Vitamin premix II4  0.300  0.300  0.300  NaCl  0.500  0.500  0.500  1Purify cellulose (International Fiber Corporation, North Tonawanda, NY). 2Provided per kilogram of diet: vitamin A, 4,500 IU; vitamin D3, 458 IU; vitamin E, 55 IU; vitamin K, 11 mg; menadione, 3.66 mg; vitamin B12, 0.0275 mg; riboflavin, 3.66 mg; D-pantothenic acid, 14.67 mg; niacin, 22 mg; thiamine, 0.913 mg; and pyridoxine, 0.825 mg. 3Provided per kilogram of diet: Ca, 335 mg as calcium carbonate; Fe, 50 mg as ferrous sulfate; Zn, 50 mg as zinc oxide; Cu, 50 mg as copper sulfate; Se, 150 μg as sodium selenite; and I, 75 μg as potassium iodide. 4Provided per kilogram of diet: vitamin A, 2,756 IU; biotin, 221 μg; choline, 386 mg; and folic acid, 1.65 mg. View Large To prevent long-term storage, diets were freshly prepared for each block; thus, diets were mixed in 3 different batches. Diets were sampled from each bag and pooled per diet for each mixing. All pooled samples were finely ground using a sample mill (Cyclotec 1093; Foss Tecator, Eden Prairie, MN). Feed N was analyzed for each sample using a combustion-based N determinator (FP-2000, LECO Corp., St. Joseph, MI) and results were averaged. Amino acid concentrations in the pooled feed samples were analyzed by cation-exchange chromatography coupled with postcolumn ninhydrin derivatization and quantitation (Agricultural Experimental Station, University of Missouri, Columbia, MO). Calculated and analyzed AA concentrations are presented in Table 2. Table 2. Calculated and analyzed energy and nutrient composition of experimental diets (as-fed)1 Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard 17.5% CP  DM, %  93.27  91.39  88.95  ME, kcal/ kg  3320  3320  3320  CP, %  9.50  13.53  17.52  Ether extract, %  6.00  6.00  7.76  NDF, %  11.50  10.70  10.70  ADF, %  1.97  2.82  3.67  Ca, %  0.80  0.80  0.80  Available P, %  0.40  0.40  0.40  Na, %  0.21  0.21  0.21  Cl, %  0.36  0.38  0.41  Total AA, %            Arg  0.66 (0.62)  0.94 (0.96)  1.23 (1.22)      Cys  0.16 (0.15)  0.23 (0.22)  0.30 (0.27)      His  0.27 (0.25)  0.39 (0.39)  0.50 (0.49)      Ile  0.48 (0.43)  0.68 (0.65)  0.88 (0.83)      Leu  0.88 (0.85)  1.25 (1.33)  1.63 (1.67)      Lys  0.66 (0.62)  0.94 (0.99)  1.22 (1.24)      Met  0.17 (0.15)  0.24 (0.23)  0.31 (0.28)      Met + Cys  0.33 (0.30)  0.47 (0.45)  0.61 (0.55)      Phe  0.53 (0.49)  0.76 (0.76)  0.99 (0.96)      Phe + Tyr  0.88 (0.78)  1.26 (1.25)  1.64 (1.61)      Thr  0.43 (0.39)  0.61 (0.60)  0.79 (0.74)      Trp  0.12 (0.10)  0.18 (0.16)  0.23 (0.22)      Tyr  0.35 (0.29)  0.50 (0.49)  0.65 (0.65)      Val  0.58 (0.52)  0.82 (0.79)  1.07 (1.01)  SID AA,2 %            Arg  0.61  0.88  1.14      Cys  0.14  0.20  0.26      His  0.24  0.35  0.45      Ile  0.42  0.60  0.78      Leu  0.79  1.13  1.46      Lys  0.60  0.85  1.11      Met  0.15  0.22  0.29      Met + Cys  0.29  0.42  0.55      Phe  0.48  0.68  0.88      Phe + Tyr  0.79  1.13  1.46      Thr  0.37  0.53  0.69      Trp  0.11  0.16  0.21      Tyr  0.31  0.45  0.58      Val  0.51  0.73  0.95  Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard 17.5% CP  DM, %  93.27  91.39  88.95  ME, kcal/ kg  3320  3320  3320  CP, %  9.50  13.53  17.52  Ether extract, %  6.00  6.00  7.76  NDF, %  11.50  10.70  10.70  ADF, %  1.97  2.82  3.67  Ca, %  0.80  0.80  0.80  Available P, %  0.40  0.40  0.40  Na, %  0.21  0.21  0.21  Cl, %  0.36  0.38  0.41  Total AA, %            Arg  0.66 (0.62)  0.94 (0.96)  1.23 (1.22)      Cys  0.16 (0.15)  0.23 (0.22)  0.30 (0.27)      His  0.27 (0.25)  0.39 (0.39)  0.50 (0.49)      Ile  0.48 (0.43)  0.68 (0.65)  0.88 (0.83)      Leu  0.88 (0.85)  1.25 (1.33)  1.63 (1.67)      Lys  0.66 (0.62)  0.94 (0.99)  1.22 (1.24)      Met  0.17 (0.15)  0.24 (0.23)  0.31 (0.28)      Met + Cys  0.33 (0.30)  0.47 (0.45)  0.61 (0.55)      Phe  0.53 (0.49)  0.76 (0.76)  0.99 (0.96)      Phe + Tyr  0.88 (0.78)  1.26 (1.25)  1.64 (1.61)      Thr  0.43 (0.39)  0.61 (0.60)  0.79 (0.74)      Trp  0.12 (0.10)  0.18 (0.16)  0.23 (0.22)      Tyr  0.35 (0.29)  0.50 (0.49)  0.65 (0.65)      Val  0.58 (0.52)  0.82 (0.79)  1.07 (1.01)  SID AA,2 %            Arg  0.61  0.88  1.14      Cys  0.14  0.20  0.26      His  0.24  0.35  0.45      Ile  0.42  0.60  0.78      Leu  0.79  1.13  1.46      Lys  0.60  0.85  1.11      Met  0.15  0.22  0.29      Met + Cys  0.29  0.42  0.55      Phe  0.48  0.68  0.88      Phe + Tyr  0.79  1.13  1.46      Thr  0.37  0.53  0.69      Trp  0.11  0.16  0.21      Tyr  0.31  0.45  0.58      Val  0.51  0.73  0.95  1Analyzed values are shown in parentheses. 2Standardized ileal digestible. The values were calculated using the AA values and the true digestibility values from NRC (1998). View Large Table 2. Calculated and analyzed energy and nutrient composition of experimental diets (as-fed)1 Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard 17.5% CP  DM, %  93.27  91.39  88.95  ME, kcal/ kg  3320  3320  3320  CP, %  9.50  13.53  17.52  Ether extract, %  6.00  6.00  7.76  NDF, %  11.50  10.70  10.70  ADF, %  1.97  2.82  3.67  Ca, %  0.80  0.80  0.80  Available P, %  0.40  0.40  0.40  Na, %  0.21  0.21  0.21  Cl, %  0.36  0.38  0.41  Total AA, %            Arg  0.66 (0.62)  0.94 (0.96)  1.23 (1.22)      Cys  0.16 (0.15)  0.23 (0.22)  0.30 (0.27)      His  0.27 (0.25)  0.39 (0.39)  0.50 (0.49)      Ile  0.48 (0.43)  0.68 (0.65)  0.88 (0.83)      Leu  0.88 (0.85)  1.25 (1.33)  1.63 (1.67)      Lys  0.66 (0.62)  0.94 (0.99)  1.22 (1.24)      Met  0.17 (0.15)  0.24 (0.23)  0.31 (0.28)      Met + Cys  0.33 (0.30)  0.47 (0.45)  0.61 (0.55)      Phe  0.53 (0.49)  0.76 (0.76)  0.99 (0.96)      Phe + Tyr  0.88 (0.78)  1.26 (1.25)  1.64 (1.61)      Thr  0.43 (0.39)  0.61 (0.60)  0.79 (0.74)      Trp  0.12 (0.10)  0.18 (0.16)  0.23 (0.22)      Tyr  0.35 (0.29)  0.50 (0.49)  0.65 (0.65)      Val  0.58 (0.52)  0.82 (0.79)  1.07 (1.01)  SID AA,2 %            Arg  0.61  0.88  1.14      Cys  0.14  0.20  0.26      His  0.24  0.35  0.45      Ile  0.42  0.60  0.78      Leu  0.79  1.13  1.46      Lys  0.60  0.85  1.11      Met  0.15  0.22  0.29      Met + Cys  0.29  0.42  0.55      Phe  0.48  0.68  0.88      Phe + Tyr  0.79  1.13  1.46      Thr  0.37  0.53  0.69      Trp  0.11  0.16  0.21      Tyr  0.31  0.45  0.58      Val  0.51  0.73  0.95  Item  Deficient, 9.5% CP  Ideal, 13.5% CP  Standard 17.5% CP  DM, %  93.27  91.39  88.95  ME, kcal/ kg  3320  3320  3320  CP, %  9.50  13.53  17.52  Ether extract, %  6.00  6.00  7.76  NDF, %  11.50  10.70  10.70  ADF, %  1.97  2.82  3.67  Ca, %  0.80  0.80  0.80  Available P, %  0.40  0.40  0.40  Na, %  0.21  0.21  0.21  Cl, %  0.36  0.38  0.41  Total AA, %            Arg  0.66 (0.62)  0.94 (0.96)  1.23 (1.22)      Cys  0.16 (0.15)  0.23 (0.22)  0.30 (0.27)      His  0.27 (0.25)  0.39 (0.39)  0.50 (0.49)      Ile  0.48 (0.43)  0.68 (0.65)  0.88 (0.83)      Leu  0.88 (0.85)  1.25 (1.33)  1.63 (1.67)      Lys  0.66 (0.62)  0.94 (0.99)  1.22 (1.24)      Met  0.17 (0.15)  0.24 (0.23)  0.31 (0.28)      Met + Cys  0.33 (0.30)  0.47 (0.45)  0.61 (0.55)      Phe  0.53 (0.49)  0.76 (0.76)  0.99 (0.96)      Phe + Tyr  0.88 (0.78)  1.26 (1.25)  1.64 (1.61)      Thr  0.43 (0.39)  0.61 (0.60)  0.79 (0.74)      Trp  0.12 (0.10)  0.18 (0.16)  0.23 (0.22)      Tyr  0.35 (0.29)  0.50 (0.49)  0.65 (0.65)      Val  0.58 (0.52)  0.82 (0.79)  1.07 (1.01)  SID AA,2 %            Arg  0.61  0.88  1.14      Cys  0.14  0.20  0.26      His  0.24  0.35  0.45      Ile  0.42  0.60  0.78      Leu  0.79  1.13  1.46      Lys  0.60  0.85  1.11      Met  0.15  0.22  0.29      Met + Cys  0.29  0.42  0.55      Phe  0.48  0.68  0.88      Phe + Tyr  0.79  1.13  1.46      Thr  0.37  0.53  0.69      Trp  0.11  0.16  0.21      Tyr  0.31  0.45  0.58      Val  0.51  0.73  0.95  1Analyzed values are shown in parentheses. 2Standardized ileal digestible. The values were calculated using the AA values and the true digestibility values from NRC (1998). View Large Gene Expression Analysis Sample Collection Mammary parenchymal tissue was biopsied from the first and second thoracic glands of all sows 3.5 h postfeeding on d 7 (early) and d 18 (peak) of lactation, according to the method described by Kirkwood et al. (2007). During mammary tissue collection, piglets were isolated in an adjacent pen equipped with a heat lamp. Immediately after the biopsy, mammary tissue was flash frozen in liquid N and later stored at −80°C. Three hours after biopsy, piglets were returned to sows and allowed to nurse. RNA Extraction and cDNA Synthesis Ribonucleic acid was extracted from mammary tissue (PerfectPure RNA Cell and Tissue Kit; PRIME, Gaithersburg, MD) according to the manufacturer's instructions. Isolated RNA was tested for quality and quantity (Agilent Bioanalyzer 2100 with the RNA 6000 Nano Labchip; Agilent Technologies, Palo Alto, CA). The RNA integrity number values ranged from 8.7 to 10 for all samples. Complementary DNA was synthesized using 2 μg of total RNA from each sample as template in reverse transcription reactions [Superscript III reverse transcriptase and oligo(dT)15–18 primer; Invitrogen, Carlsbad, CA], as recommended by the manufacturer. Final cDNA concentration was quantified by spectrophotometry (NanoDrop 1000; Thermo Scientific, Waltham, MA) and then diluted to a working stock of 10 ng·μL−1 and stored at −20°C. Primer Design Primer sequences for reference and target genes are presented in Tables 3 and 4. Throughout this paper, each target gene is referred to by the common name of the protein encoded. Hence, SLC7A9 will be referred to as b0,+AT, SLC7A7 as y+LAT1, SLC7A6 as y+LAT2, SLC6A14 as ATB0,+,SLC7A1 as CAT-1, SLC7A2 as CAT-2b, CSN2 as β-casein, and LALBA as α-lactalbumin. Potential reference genes were selected on the basis of previous studies (Bionaz and Loor, 2007; Tramontana et al., 2008), but the primers used were different from those published to optimize the efficiency of the reverse transcription quantitative PCR (RT-qPCR) reaction in our samples. Primers were designed on the basis of publicly available swine cDNA and expressed sequence tag sequences deposited in the National Center for Biotechnology Information (Primer Express software, version 3.0; Applied Biosystems, Foster City, CA) with default settings. Designed primers were blasted against published swine (Sus scrofa), human (Homo sapiens), bovine (Bos taurus), and rat (Rattus norvegicus) genome sequences, and pairs that showed significant alignment (i.e., high query coverage) with nucleotide sequences other than the protein of interest in any of the species mentioned were discarded. Amplicons from the primer pair were not sequenced in this study. Evaluation of primer-dimer formation was based on the presence of a single peak in the dissociation curve after the RT-qPCR reaction. Primers were not designed to span exon-exon junctions. However, the method used to extract RNA provided a step for DNA digestion by performing on-column DNase treatment (PerfectPure RNADNase, Gaithersburg, MD) to eliminate genomics DNA. Primer pairs were optimized for concentration using a primer optimization matrix (Mikeska and Dobrovic, 2009) and a relative standard curve was used to determine the efficiency (Yuan et al., 2006). The standard curve was constructed using cDNA synthesized from an RNA pool made of all samples using these amounts of cDNA (in duplicate): 40, 20, 10, 5, and 2.5 ng. Efficiency of the RT-qPCR reaction for each gene was calculated from the slope of the standard curve using the formula (10−1/slope – 1) × 100, as described by Yuan et al. (2006). Specific hybridization of the primers was validated by the presence of a unique peak in the dissociation curve at the end of the RT-qPCR amplification. Nontemplate controls were included in all RT-qPCR plates to validate that primers were not amplifying contaminating DNA. Table 3. Reference genes primer information for reverse transcription quantitative PCR (RT-qPCR) assays Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CV872150.1  API5  Apoptosis inhibitor 5  F 502R 568  CTGGAGTGGTGGCAATAATCTCTCCAAGGGAGCTCAGGTTTAGC  99.4  AY610067.1  MRPL39  Mitochondrial ribosomal protein L39  F 540R 601  TCGCTGGAGCTTTCTGCTATGTGTTGGCATCCACTCATCAAG  103.5  NM_001123213.1  VAPB  Vesicle-associated membrane protein-associated protein B/C  F 1012R 072  TGGCGCTGGTGGTTTTGCCTACAAGGCGATCTTCCCTATG  101.9  DQ452569.1  ACTB  β-Actin  F 746R 803  TGCGGGACATCAAGGAGAAGCCATCTCCTGCTCGAAGTC  111.8  AF017079.1  GAPDH  Glyceraldehyde-3-phosphate dehydrogenase  F 376R 429  CGTCCCTGAGACACGATGGTCCCGATGCGGCCAAAT  97.6  XM_001927465.1  RPS23  Ribosomal protein 23  F 52R 15  CCACCGACGGGACCATAACAGGGCTGTGCCCAAATG  99.6  XM_001927648.1  MTG1  Mitochondrial GTPase 1  F 463R 525  GGCAAGTCCTCGCTCATCAACTTGGTGGCTTTTCCTTTCCT  102.7  Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CV872150.1  API5  Apoptosis inhibitor 5  F 502R 568  CTGGAGTGGTGGCAATAATCTCTCCAAGGGAGCTCAGGTTTAGC  99.4  AY610067.1  MRPL39  Mitochondrial ribosomal protein L39  F 540R 601  TCGCTGGAGCTTTCTGCTATGTGTTGGCATCCACTCATCAAG  103.5  NM_001123213.1  VAPB  Vesicle-associated membrane protein-associated protein B/C  F 1012R 072  TGGCGCTGGTGGTTTTGCCTACAAGGCGATCTTCCCTATG  101.9  DQ452569.1  ACTB  β-Actin  F 746R 803  TGCGGGACATCAAGGAGAAGCCATCTCCTGCTCGAAGTC  111.8  AF017079.1  GAPDH  Glyceraldehyde-3-phosphate dehydrogenase  F 376R 429  CGTCCCTGAGACACGATGGTCCCGATGCGGCCAAAT  97.6  XM_001927465.1  RPS23  Ribosomal protein 23  F 52R 15  CCACCGACGGGACCATAACAGGGCTGTGCCCAAATG  99.6  XM_001927648.1  MTG1  Mitochondrial GTPase 1  F 463R 525  GGCAAGTCCTCGCTCATCAACTTGGTGGCTTTTCCTTTCCT  102.7  1Accesion number corresponds to the cDNA or the expressed sequence tag sequence deposited in the National Center for Biotechnology Information (Bethesda, MD) database, from which the primers were designed. 2Direction (F = forward; R = reverse) and hybridization position for each primer (5´ to 3´) within the nucleotide sequence, from which the primers were designed. 3Primer pair efficiency (E) was calculated as E = −1 + 10(-1/slope) × 100. The R2 values for all standard curves for reference and candidate genes were >0.98, indicating excellent linear relationships between quantities of serially diluted cDNA and cycles to threshold when RT-qPCR was performed. View Large Table 3. Reference genes primer information for reverse transcription quantitative PCR (RT-qPCR) assays Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CV872150.1  API5  Apoptosis inhibitor 5  F 502R 568  CTGGAGTGGTGGCAATAATCTCTCCAAGGGAGCTCAGGTTTAGC  99.4  AY610067.1  MRPL39  Mitochondrial ribosomal protein L39  F 540R 601  TCGCTGGAGCTTTCTGCTATGTGTTGGCATCCACTCATCAAG  103.5  NM_001123213.1  VAPB  Vesicle-associated membrane protein-associated protein B/C  F 1012R 072  TGGCGCTGGTGGTTTTGCCTACAAGGCGATCTTCCCTATG  101.9  DQ452569.1  ACTB  β-Actin  F 746R 803  TGCGGGACATCAAGGAGAAGCCATCTCCTGCTCGAAGTC  111.8  AF017079.1  GAPDH  Glyceraldehyde-3-phosphate dehydrogenase  F 376R 429  CGTCCCTGAGACACGATGGTCCCGATGCGGCCAAAT  97.6  XM_001927465.1  RPS23  Ribosomal protein 23  F 52R 15  CCACCGACGGGACCATAACAGGGCTGTGCCCAAATG  99.6  XM_001927648.1  MTG1  Mitochondrial GTPase 1  F 463R 525  GGCAAGTCCTCGCTCATCAACTTGGTGGCTTTTCCTTTCCT  102.7  Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CV872150.1  API5  Apoptosis inhibitor 5  F 502R 568  CTGGAGTGGTGGCAATAATCTCTCCAAGGGAGCTCAGGTTTAGC  99.4  AY610067.1  MRPL39  Mitochondrial ribosomal protein L39  F 540R 601  TCGCTGGAGCTTTCTGCTATGTGTTGGCATCCACTCATCAAG  103.5  NM_001123213.1  VAPB  Vesicle-associated membrane protein-associated protein B/C  F 1012R 072  TGGCGCTGGTGGTTTTGCCTACAAGGCGATCTTCCCTATG  101.9  DQ452569.1  ACTB  β-Actin  F 746R 803  TGCGGGACATCAAGGAGAAGCCATCTCCTGCTCGAAGTC  111.8  AF017079.1  GAPDH  Glyceraldehyde-3-phosphate dehydrogenase  F 376R 429  CGTCCCTGAGACACGATGGTCCCGATGCGGCCAAAT  97.6  XM_001927465.1  RPS23  Ribosomal protein 23  F 52R 15  CCACCGACGGGACCATAACAGGGCTGTGCCCAAATG  99.6  XM_001927648.1  MTG1  Mitochondrial GTPase 1  F 463R 525  GGCAAGTCCTCGCTCATCAACTTGGTGGCTTTTCCTTTCCT  102.7  1Accesion number corresponds to the cDNA or the expressed sequence tag sequence deposited in the National Center for Biotechnology Information (Bethesda, MD) database, from which the primers were designed. 2Direction (F = forward; R = reverse) and hybridization position for each primer (5´ to 3´) within the nucleotide sequence, from which the primers were designed. 3Primer pair efficiency (E) was calculated as E = −1 + 10(-1/slope) × 100. The R2 values for all standard curves for reference and candidate genes were >0.98, indicating excellent linear relationships between quantities of serially diluted cDNA and cycles to threshold when RT-qPCR was performed. View Large Table 4. Target gene primer information for reverse transcription quantitative PCR (RT-qPCR) assays Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CX064558.1  SLC7A6  y+LAT2  F 114R 172  CTGCCGCCTGCATGTGTTGTGCCCCACTTGACATAGG  101.9  NM_001012613.1  SLC7A1  CAT-1  F 1172R 1234  GGGCTGCTGTTTAAGTTTTTGGCGTGGCGATTATTGGTGTTTT  100.4  NM_001110420.1  SLC7A2  CAT-2b  F 1723R 1071  GCCCCAGAATCAGCAAAAAGTAGATGCTGAAGGCTGGCAAAA  110.7  NM_001166042.1  SLC6A14  ATB0,+  F 162R 226  CCGTGGTAACTGGTCCAAAAACCAATCCCACTGCATATCCAA  101.0  NM_001110171.1  SLC7A9  b0,+AT  F 138R 205  CCAGAGCACTGAACCCAAGACTGATGCAGATGCCACTGAACA  97.1  NM_214434.1  CSN2  β-Casein  F 333R 398  CTGTGGTGGTGCCTCTTCTTCGAACAATGGTCTCCTTAGCTTTGG  96.4  NM_214360.1  LALBA  α-Lactalbumin  F 433R 495  CCCGCTGTCTTGCTGCTTAGGTAGCCTTAGGGAAGAGGAGTT  94.5  Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CX064558.1  SLC7A6  y+LAT2  F 114R 172  CTGCCGCCTGCATGTGTTGTGCCCCACTTGACATAGG  101.9  NM_001012613.1  SLC7A1  CAT-1  F 1172R 1234  GGGCTGCTGTTTAAGTTTTTGGCGTGGCGATTATTGGTGTTTT  100.4  NM_001110420.1  SLC7A2  CAT-2b  F 1723R 1071  GCCCCAGAATCAGCAAAAAGTAGATGCTGAAGGCTGGCAAAA  110.7  NM_001166042.1  SLC6A14  ATB0,+  F 162R 226  CCGTGGTAACTGGTCCAAAAACCAATCCCACTGCATATCCAA  101.0  NM_001110171.1  SLC7A9  b0,+AT  F 138R 205  CCAGAGCACTGAACCCAAGACTGATGCAGATGCCACTGAACA  97.1  NM_214434.1  CSN2  β-Casein  F 333R 398  CTGTGGTGGTGCCTCTTCTTCGAACAATGGTCTCCTTAGCTTTGG  96.4  NM_214360.1  LALBA  α-Lactalbumin  F 433R 495  CCCGCTGTCTTGCTGCTTAGGTAGCCTTAGGGAAGAGGAGTT  94.5  1Accesion number corresponds to the cDNA or the expressed sequence tag sequence deposited in the National Center for Biotechnology Information (Bethesda, MD) database, from which the primers were designed. 2Direction (F = forward; R = reverse) and hybridization position for each primer (5´ to 3´) within the nucleotide sequence, from which the primers were designed. 3Primer pair efficiency (E) was calculated as: E = −1 + 10(-1/slope) × 100. The R2 values for all standard curves for reference and candidate genes were >0.98, indicating excellent linear relationships between quantities of serially diluted cDNA and cycles to threshold when RT-qPCR was performed. View Large Table 4. Target gene primer information for reverse transcription quantitative PCR (RT-qPCR) assays Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CX064558.1  SLC7A6  y+LAT2  F 114R 172  CTGCCGCCTGCATGTGTTGTGCCCCACTTGACATAGG  101.9  NM_001012613.1  SLC7A1  CAT-1  F 1172R 1234  GGGCTGCTGTTTAAGTTTTTGGCGTGGCGATTATTGGTGTTTT  100.4  NM_001110420.1  SLC7A2  CAT-2b  F 1723R 1071  GCCCCAGAATCAGCAAAAAGTAGATGCTGAAGGCTGGCAAAA  110.7  NM_001166042.1  SLC6A14  ATB0,+  F 162R 226  CCGTGGTAACTGGTCCAAAAACCAATCCCACTGCATATCCAA  101.0  NM_001110171.1  SLC7A9  b0,+AT  F 138R 205  CCAGAGCACTGAACCCAAGACTGATGCAGATGCCACTGAACA  97.1  NM_214434.1  CSN2  β-Casein  F 333R 398  CTGTGGTGGTGCCTCTTCTTCGAACAATGGTCTCCTTAGCTTTGG  96.4  NM_214360.1  LALBA  α-Lactalbumin  F 433R 495  CCCGCTGTCTTGCTGCTTAGGTAGCCTTAGGGAAGAGGAGTT  94.5  Accesion number1  Gene  Protein  Primer2  Primer (5′ to 3′)  E,3 %  CX064558.1  SLC7A6  y+LAT2  F 114R 172  CTGCCGCCTGCATGTGTTGTGCCCCACTTGACATAGG  101.9  NM_001012613.1  SLC7A1  CAT-1  F 1172R 1234  GGGCTGCTGTTTAAGTTTTTGGCGTGGCGATTATTGGTGTTTT  100.4  NM_001110420.1  SLC7A2  CAT-2b  F 1723R 1071  GCCCCAGAATCAGCAAAAAGTAGATGCTGAAGGCTGGCAAAA  110.7  NM_001166042.1  SLC6A14  ATB0,+  F 162R 226  CCGTGGTAACTGGTCCAAAAACCAATCCCACTGCATATCCAA  101.0  NM_001110171.1  SLC7A9  b0,+AT  F 138R 205  CCAGAGCACTGAACCCAAGACTGATGCAGATGCCACTGAACA  97.1  NM_214434.1  CSN2  β-Casein  F 333R 398  CTGTGGTGGTGCCTCTTCTTCGAACAATGGTCTCCTTAGCTTTGG  96.4  NM_214360.1  LALBA  α-Lactalbumin  F 433R 495  CCCGCTGTCTTGCTGCTTAGGTAGCCTTAGGGAAGAGGAGTT  94.5  1Accesion number corresponds to the cDNA or the expressed sequence tag sequence deposited in the National Center for Biotechnology Information (Bethesda, MD) database, from which the primers were designed. 2Direction (F = forward; R = reverse) and hybridization position for each primer (5´ to 3´) within the nucleotide sequence, from which the primers were designed. 3Primer pair efficiency (E) was calculated as: E = −1 + 10(-1/slope) × 100. The R2 values for all standard curves for reference and candidate genes were >0.98, indicating excellent linear relationships between quantities of serially diluted cDNA and cycles to threshold when RT-qPCR was performed. View Large Reference Gene Selection A relative standard curve (Larionov et al., 2005) was used as the RT-qPCR method to measure relative mRNA abundance of potential reference genes. Relative mRNA amounts from the standard curve were entered directly into software (geNorm, http://medgen.ugent.be/∼jvdesomp/genorm) to select the most stable reference genes within the analyzed set, as described by Vandesompele et al. (2002). Briefly, the expression stability value for each gene was determined as the average pairwise variation of each gene with all other reference genes, whereas the number of reference genes that should be used was calculated by analysis of the pairwise variation between 2 sequential normalization factors. Such normalization factors are based on the geometric mean of the expression of n and n + 1 best reference genes (Vandesompele et al., 2002). RT-qPCR Assay Reverse transcription quantitative PCR reactions were performed (MicroAmp Optical 96-Well Reaction Plates; Applied Biosystems). To each well was added 3 μL (30 ng) of template cDNA, 12.5 μL of SYBR Green master mix (Applied Biosystems), 6 μL each of 10 μM forward and reverse primers and 3.5 μL diethylpyrocarbonate-treated (DEPC-treated) and nuclease-free water (Fisher Scientific, Fair Lawn, New Jersey). Plates were sealed, centrifuged at 400 × g for 1 min at 15°C, and loaded into the system (ABI Prism 7000 Sequence Detection System; Applied Biosystems). The amplification program included 2 initial steps (50°C for 2 min and 95°C for 10 min) followed for 40 cycles (step 3; 95°C for 15 s and 60°C for 1 min) and a dissociation curve (step 4; 95°C for 15 s, 60°C for 1 min, 95°C for 15 s). Data were analyzed with software (7000 RQ Sequence Detection Systems Software, version 2.2.1; Applied Biosystems). RT-qPCR Data Normalization Normalization of target gene expression values was made according to the following formula:  where ΔCtijk is the normalized target gene expression for the jth sow within the ith stage of lactation and the kth diet and CtCijk and CtRijk are the threshold cycle (Ct) values for target and reference genes, respectively. Gene expression results reported as ΔCt values may often be confusing, as increasing ΔCt reflects decreasing mRNA abundance. Thus, subtracting ΔCt values from a constant value before or after statistical analysis allows for simpler interpretation of the data, whereby increasing ΔCt values correspond to increasing mRNA abundance without altering the P-value or the SE. To further simplify the interpretation of results, this constant was selected to be an entire number greater than any ΔCt values among all genes. Consequently, all values presented in the figures are positive. Analysis of AA Transport Efficiency into the Mammary Gland Mammary vein and carotid artery catheters were prepared and surgically inserted in 5 sows per dietary treatment group between d 3 and 4 of lactation, as described by Trottier et al. (1997). The catheters were flushed with a sterile heparinized (20 U·mL−1) saline solution (0.9%) every 12 h and maintained with a heparin block. Sows were fed 1 kg on the night before the sampling day to ensure complete consumption of the meal the next morning. On d 7 and 18 of lactation, all sows were fed 2 kg at 0800 h, followed by blood sampling every 30 min from 0830 to 1130 h, inclusive. Arterial and venous blood (8 mL each) was taken simultaneously in syringes and transferred to sample tubes (0.147 mL of 75 g EDTA·L−1; Becton Dickinson, Franklin Lakes, NJ). The first 3 mL of fluid withdrawn was discarded to eliminate dilution from the heparin block. Blood samples were centrifuged × 600 g within 10 min of collection, and the plasma was stored at −20°C. Determination of free AA in plasma was performed by HPLC using an analytical method based on derivatization of AA with o-phthaldialdehyde (Wu and Meininger, 2008; Li et al., 2011). Plasma samples obtained during the 3.5-h blood collection period were pooled per sow and per day of sampling, and each pool was treated as a sampling unit. Efficiency of AA transport (also called extraction efficiency) was calculated on d 7 and 18 as the percentage of circulating AA taken up by mammary glands per plasma pass:  where Yij is the AA transport efficiency for the jth sow within the ith stage of lactation and A-V is the difference between arterial and venous AA concentrations. Total Mammary Gland DNA Quantification Total DNA was extracted from mammary tissue using cold perchloric acid (Sigma-Aldrich, St. Louis, MO) according to the procedure described by Labarca and Paigen (1980). After extraction, DNA was quantified by spectrophotometry using bisbenzimide (Hoechst 33258, Sigma-Aldrich) and a plate reader (Bio-Tek FL600 with 360/460 nm filter set; Bio-Tek Instruments, Inc., Winooski, VT) and was reported as μg·mg−1 mammary tissue. Statistical Analysis Normality of the residuals was tested using the Shapiro-Wilk test under the UNIVARIATE procedure (SAS Inst. Inc., Cary, NC). Piglet ADG, sow BW loss, litter weight gain, sow feed and protein intake, mammary tissue DNA concentration, ΔCt, plasma AA, A-V and transport efficiency, and plasma branched-chain AA (BCAA): Lys were analyzed using a linear mixed model that included diet, stage of lactation, and their interaction as fixed effects, sow and block as random effects, and sow initial BW and parity as covariates. The statistical model is  where Yij is the variable measured (j) within each stage of lactation (i), μ is the overall mean, αi is the fixed effect of the ith level of diet, γi is the fixed effect of the ith level of stage of lactation, αi × γiis the fixed effect of the ith level of interaction between diet and stage of lactation, βi is the regression coefficient relating the covariate sow initial BW to the variable measured, xij is the initial BW for the jth sow within the ith stage of lactation, x is the overall sow initial BW mean, β2 is the regression coefficient relating the covariate sow parity to the variable measured, yij is the parity for the jth sow within the ith stage of lactation, y is the overall parity mean, bj is the random effect of the sow, cj is the random effect of the block, and eij is the experimental error. Relationships between dietary CP intake, day of lactation, and their interaction were determined using linear and quadratic contrasts. When an interaction was not significant, P-values of main effects (i.e., diet and stage of lactation) are reported. Data are presented as least-squares means ± SE. Significant effects were considered at P ≤ 0.05 and trends at P ≤ 0.1. RESULTS Lactation performance results are presented in Table 5. Feed intake was not affected by dietary CP intake, and both feed and dietary CP intake increased (P < 0.01) from d 7 to 17 of lactation (data not shown). Sow BW and litter size were not different among diets on d 1 or 17. Piglet ADG (linear, P = 0.03; quadratic, P = 0.01) and litter gain (linear, P = 0.07; quadratic, P = 0.01) increased with increasing concentration of dietary CP. There was no effect of diet or stage of lactation on mammary DNA concentration. Table 5. Effect of dietary CP concentration on sow and litter performance and DNA concentration in mammary tissue1   Dietary CP, %  P-value2    9.5,  13.5,  17.5,    Item  Deficient  Ideal  Standard  Linear  Q  No.  8  6  7  —  —  Parity  3.2 ± 0.8  3.5 ± 1.2  3.6 ± 0.9  —  —  Intake, kg /d                Feed  3.61 ± 0.18  3.88 ± 0.21  3.85 ± 0.19  0.37  0.56      Protein  0.34 ± 0.03  0.52 ± 0.03  0.67 ± 0.03  < 0.001  0.69  Sow BW, kg                d 1  228.1 ± 7.7  232.4 ± 9.1  238.3 ± 8.3  0.38  0.94      Loss, d 1 to 18  19.7 ± 4.5  15.2 ± 5.3  25.8 ± 4.8  0.35  0.22  Litter size                d 1  8  8  8  —  —      d 18  8  8  8  —  —  Litter weight, kg                d 1  15.70 ± 0.69  15.50 ± 0.72  15.75 ± 0.71  0.93  0.65      Gain, d 1 to 18  28.8 ± 2.3  36.8 ± 2.5  32.7 ± 2.4  0.07  0.01  Pig ADG, d 1 to 18, g  214.3 ± 12.6  281.5 ± 15.0  253.7 ± 13.8  0.03  0.01  DNA, d 1 to 18, mg/g  1.81 ± 0.07  1.81 ± 0.08  1.93 ± 0.08  0.32  0.54    Dietary CP, %  P-value2    9.5,  13.5,  17.5,    Item  Deficient  Ideal  Standard  Linear  Q  No.  8  6  7  —  —  Parity  3.2 ± 0.8  3.5 ± 1.2  3.6 ± 0.9  —  —  Intake, kg /d                Feed  3.61 ± 0.18  3.88 ± 0.21  3.85 ± 0.19  0.37  0.56      Protein  0.34 ± 0.03  0.52 ± 0.03  0.67 ± 0.03  < 0.001  0.69  Sow BW, kg                d 1  228.1 ± 7.7  232.4 ± 9.1  238.3 ± 8.3  0.38  0.94      Loss, d 1 to 18  19.7 ± 4.5  15.2 ± 5.3  25.8 ± 4.8  0.35  0.22  Litter size                d 1  8  8  8  —  —      d 18  8  8  8  —  —  Litter weight, kg                d 1  15.70 ± 0.69  15.50 ± 0.72  15.75 ± 0.71  0.93  0.65      Gain, d 1 to 18  28.8 ± 2.3  36.8 ± 2.5  32.7 ± 2.4  0.07  0.01  Pig ADG, d 1 to 18, g  214.3 ± 12.6  281.5 ± 15.0  253.7 ± 13.8  0.03  0.01  DNA, d 1 to 18, mg/g  1.81 ± 0.07  1.81 ± 0.08  1.93 ± 0.08  0.32  0.54  1Data are least square means ± SE. 2Q = quadratic. View Large Table 5. Effect of dietary CP concentration on sow and litter performance and DNA concentration in mammary tissue1   Dietary CP, %  P-value2    9.5,  13.5,  17.5,    Item  Deficient  Ideal  Standard  Linear  Q  No.  8  6  7  —  —  Parity  3.2 ± 0.8  3.5 ± 1.2  3.6 ± 0.9  —  —  Intake, kg /d                Feed  3.61 ± 0.18  3.88 ± 0.21  3.85 ± 0.19  0.37  0.56      Protein  0.34 ± 0.03  0.52 ± 0.03  0.67 ± 0.03  < 0.001  0.69  Sow BW, kg                d 1  228.1 ± 7.7  232.4 ± 9.1  238.3 ± 8.3  0.38  0.94      Loss, d 1 to 18  19.7 ± 4.5  15.2 ± 5.3  25.8 ± 4.8  0.35  0.22  Litter size                d 1  8  8  8  —  —      d 18  8  8  8  —  —  Litter weight, kg                d 1  15.70 ± 0.69  15.50 ± 0.72  15.75 ± 0.71  0.93  0.65      Gain, d 1 to 18  28.8 ± 2.3  36.8 ± 2.5  32.7 ± 2.4  0.07  0.01  Pig ADG, d 1 to 18, g  214.3 ± 12.6  281.5 ± 15.0  253.7 ± 13.8  0.03  0.01  DNA, d 1 to 18, mg/g  1.81 ± 0.07  1.81 ± 0.08  1.93 ± 0.08  0.32  0.54    Dietary CP, %  P-value2    9.5,  13.5,  17.5,    Item  Deficient  Ideal  Standard  Linear  Q  No.  8  6  7  —  —  Parity  3.2 ± 0.8  3.5 ± 1.2  3.6 ± 0.9  —  —  Intake, kg /d                Feed  3.61 ± 0.18  3.88 ± 0.21  3.85 ± 0.19  0.37  0.56      Protein  0.34 ± 0.03  0.52 ± 0.03  0.67 ± 0.03  < 0.001  0.69  Sow BW, kg                d 1  228.1 ± 7.7  232.4 ± 9.1  238.3 ± 8.3  0.38  0.94      Loss, d 1 to 18  19.7 ± 4.5  15.2 ± 5.3  25.8 ± 4.8  0.35  0.22  Litter size                d 1  8  8  8  —  —      d 18  8  8  8  —  —  Litter weight, kg                d 1  15.70 ± 0.69  15.50 ± 0.72  15.75 ± 0.71  0.93  0.65      Gain, d 1 to 18  28.8 ± 2.3  36.8 ± 2.5  32.7 ± 2.4  0.07  0.01  Pig ADG, d 1 to 18, g  214.3 ± 12.6  281.5 ± 15.0  253.7 ± 13.8  0.03  0.01  DNA, d 1 to 18, mg/g  1.81 ± 0.07  1.81 ± 0.08  1.93 ± 0.08  0.32  0.54  1Data are least square means ± SE. 2Q = quadratic. View Large Reference genes MTG1, MRPL39, and VAPB had the least average M (stability values) and therefore were selected as the most stable set of genes in porcine mammary tissue (Figure 1). Pairwise variation analysis between sequential normalization factors was below the 0.15 cutoff value, and the optimal number of reference genes was 3. The inclusion of a fourth gene increased (V2/3 = 0.11 and V3/4 = 0.12) the pairwise variation (Figure 2). Expression of genes encoding for b0,+AT, y+LAT2, ATB0,+, CAT-1, CAT-2b, β-casein, and α-lactalbumin was unaffected by diet (Table 6). Table 6. Messenger RNA abundance of genes encoding for AA transporters and mammary synthesized milk proteins in sow mammary tissue quantified by reverse transcription quantitative PCR (RT-qPCR)1   d 7 Dietary CP, %  d 18 Dietary CP, %    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  CAT-1  9.68 ± 0.69  9.61 ± 0.72  10.08 ± 0.71  10.53 ± 0.69  9.29 ± 0.72  9.67 ± 0.71  CAT-2b  5.47 ± 0.57  5.74 ± 0.66  6.58 ± 0.68  5.40 ± 0.57  5.83 ± 0.66  5.59 ± 0.68  ATB0,+  16.87 ± 0.38  16.98 ± 0.43  17.13 ± 0.41  16.97 ± 0.38  16.81 ± 0.43  16.73 ± 0.41  Y+LAT2  7.06 ± 0.56  6.87 ± 0.65  7.66 ± 0.65  6.47 ± 0.56  6.32 ± 0.65  7.04 ± 0.65  b0,+AT  2.61 ± 0.42  3.27 ± 0.45  3.81 ± 0.60  2.94 ± 0.42  3.18 ± 0.45  4.03 ± 0.60  α-Lactalbumin  19.55 ± 0.41  19.92 ± 0.44  19.47 ± 0.43  19.46 ± 0.41  19.91 ± 0.44  20.07 ± 0.43  β-Casein  21.57 ± 0.29  22.05 ± 0.32  21.63 ± 0.31  21.74 ± 0.29  22.22 ± 0.32  22.18 ± 0.31    d 7 Dietary CP, %  d 18 Dietary CP, %    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  CAT-1  9.68 ± 0.69  9.61 ± 0.72  10.08 ± 0.71  10.53 ± 0.69  9.29 ± 0.72  9.67 ± 0.71  CAT-2b  5.47 ± 0.57  5.74 ± 0.66  6.58 ± 0.68  5.40 ± 0.57  5.83 ± 0.66  5.59 ± 0.68  ATB0,+  16.87 ± 0.38  16.98 ± 0.43  17.13 ± 0.41  16.97 ± 0.38  16.81 ± 0.43  16.73 ± 0.41  Y+LAT2  7.06 ± 0.56  6.87 ± 0.65  7.66 ± 0.65  6.47 ± 0.56  6.32 ± 0.65  7.04 ± 0.65  b0,+AT  2.61 ± 0.42  3.27 ± 0.45  3.81 ± 0.60  2.94 ± 0.42  3.18 ± 0.45  4.03 ± 0.60  α-Lactalbumin  19.55 ± 0.41  19.92 ± 0.44  19.47 ± 0.43  19.46 ± 0.41  19.91 ± 0.44  20.07 ± 0.43  β-Casein  21.57 ± 0.29  22.05 ± 0.32  21.63 ± 0.31  21.74 ± 0.29  22.22 ± 0.32  22.18 ± 0.31  1Values correspond to 14 − ΔCt ± SE (n = 4). View Large Table 6. Messenger RNA abundance of genes encoding for AA transporters and mammary synthesized milk proteins in sow mammary tissue quantified by reverse transcription quantitative PCR (RT-qPCR)1   d 7 Dietary CP, %  d 18 Dietary CP, %    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  CAT-1  9.68 ± 0.69  9.61 ± 0.72  10.08 ± 0.71  10.53 ± 0.69  9.29 ± 0.72  9.67 ± 0.71  CAT-2b  5.47 ± 0.57  5.74 ± 0.66  6.58 ± 0.68  5.40 ± 0.57  5.83 ± 0.66  5.59 ± 0.68  ATB0,+  16.87 ± 0.38  16.98 ± 0.43  17.13 ± 0.41  16.97 ± 0.38  16.81 ± 0.43  16.73 ± 0.41  Y+LAT2  7.06 ± 0.56  6.87 ± 0.65  7.66 ± 0.65  6.47 ± 0.56  6.32 ± 0.65  7.04 ± 0.65  b0,+AT  2.61 ± 0.42  3.27 ± 0.45  3.81 ± 0.60  2.94 ± 0.42  3.18 ± 0.45  4.03 ± 0.60  α-Lactalbumin  19.55 ± 0.41  19.92 ± 0.44  19.47 ± 0.43  19.46 ± 0.41  19.91 ± 0.44  20.07 ± 0.43  β-Casein  21.57 ± 0.29  22.05 ± 0.32  21.63 ± 0.31  21.74 ± 0.29  22.22 ± 0.32  22.18 ± 0.31    d 7 Dietary CP, %  d 18 Dietary CP, %    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  CAT-1  9.68 ± 0.69  9.61 ± 0.72  10.08 ± 0.71  10.53 ± 0.69  9.29 ± 0.72  9.67 ± 0.71  CAT-2b  5.47 ± 0.57  5.74 ± 0.66  6.58 ± 0.68  5.40 ± 0.57  5.83 ± 0.66  5.59 ± 0.68  ATB0,+  16.87 ± 0.38  16.98 ± 0.43  17.13 ± 0.41  16.97 ± 0.38  16.81 ± 0.43  16.73 ± 0.41  Y+LAT2  7.06 ± 0.56  6.87 ± 0.65  7.66 ± 0.65  6.47 ± 0.56  6.32 ± 0.65  7.04 ± 0.65  b0,+AT  2.61 ± 0.42  3.27 ± 0.45  3.81 ± 0.60  2.94 ± 0.42  3.18 ± 0.45  4.03 ± 0.60  α-Lactalbumin  19.55 ± 0.41  19.92 ± 0.44  19.47 ± 0.43  19.46 ± 0.41  19.91 ± 0.44  20.07 ± 0.43  β-Casein  21.57 ± 0.29  22.05 ± 0.32  21.63 ± 0.31  21.74 ± 0.29  22.22 ± 0.32  22.18 ± 0.31  1Values correspond to 14 − ΔCt ± SE (n = 4). View Large Figure 1. View largeDownload slide Average expression stability values (M) of potential reference genes API5, MRPL39, VAPB, MTG1, RPS21, ACTB, and GAPDH plotted from least stable (left) to most stable (right). Figure 1. View largeDownload slide Average expression stability values (M) of potential reference genes API5, MRPL39, VAPB, MTG1, RPS21, ACTB, and GAPDH plotted from least stable (left) to most stable (right). Figure 2. View largeDownload slide Pairwise variation (Vn/Vn + 1) between the normalization factors, NFn and NFn+1, to determine the optimal number of reference genes for normalization. Figure 2. View largeDownload slide Pairwise variation (Vn/Vn + 1) between the normalization factors, NFn and NFn+1, to determine the optimal number of reference genes for normalization. Arterial concentration of indispensable AA, A-V difference, and transport efficiency across the mammary gland are presented in Tables 7, 8, and 9, respectively. Arterial concentrations of nonessential AA, A-V difference, and transport efficiency across the mammary gland are presented in Appendixes 1, 2, and 3, respectively. On d 7 and 18 of lactation, Val arterial concentration increased linearly (P < 0.01), whereas Leu increased curvilinearly (linear, P = 0.001; quadratic, P < 0.01) with increasing CP concentration (Table 7). Lysine (linear, P = 0.06) and Ile (linear and quadratic, P = 0.08) tended to increase on d 7, and then Lys increased linearly (P = 0.01) and Ile increased curvilinearly (linear, P = 0.02; quadratic, P = 0.08) on d 18. Arginine tended to increase linearly on both d 7 (P = 0.09) and 18 (P = 0.07) of lactation. Table 7. Effect of dietary CP concentration on AA arterial concentrations (μmol/ L) of AA in lactating sows on d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P–value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4  –  –  –  –  Arg  128.2 ± 16.4  175.1 ± 22.2  173.3 ± 16.8  139.9 ± 16.4  166.7 ± 22.2  189.7 ± 18.4  0.09  0.37  0.07  0.94  His  96.0 ± 6.9  67.7 ± 9.3  80.8 ± 7.0  93.6 ± 6.9  82.7 ± 9.3  87.3 ± 7.7  0.14  0.08  0.54  0.48  Ile  93.2 ± 7.1  79.9 ± 9.8  112.9 ± 7.4  95.6 ± 7.1  88.6 ± 9.8  126.5 ± 7.7  0.08  0.08  0.02  0.08  Leu  124.8 ± 6.1  107.9 ± 8.2  171.5 ± 6.2  126.3 ± 6.1  122.2 ± 8.2  178.4 ± 6.8  0.001  0.002  0.001  0.01  Lys  169.3 ± 19.9  221.8 ± 27.5  226.8 ± 20.6  168.0 ± 19.9  213.5 ± 27.5  255.5 ± 21.7  0.06  0.46  0.01  0.95  Met  45.3 ± 4.6  43.3 ± 5.7  44.3 ± 4.6  38.2 ± 4.6  43.0 ± 5.7  47.2 ± 4.9  0.84  0.79  0.12  0.96  Phe  49.5 ± 5.8  54.3 ± 7.6  80.6 ± 5.9  52.1 ± 5.8  66.7 ± 7.6  87.0 ± 6.2  0.001  0.20  0.001  0.76  Thr  108.4 ± 14.3  107.8 ± 18.4  153.8 ± 14.5  95.3 ± 14.3  108.0 ± 18.4  184.4 ± 15.5  0.02  0.24  0.001  0.13  Trp  54.4 ± 6.4  70.6 ± 9.0  73.6 ± 6.8  51.1 ± 7.3  78.7 ± 10.0  77.7 ± 8.0  0.30  0.94  0.04  0.25  Val  179.7 ± 18.3  192.6 ± 23.0  260.5 ± 18.6  178.4 ± 18.3  200.6 ± 23.0  278.9 ± 19.6  0.01  0.24  0.001  0.23    d 7 Dietary CP, %  d 18 Dietary CP, %  P–value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4  –  –  –  –  Arg  128.2 ± 16.4  175.1 ± 22.2  173.3 ± 16.8  139.9 ± 16.4  166.7 ± 22.2  189.7 ± 18.4  0.09  0.37  0.07  0.94  His  96.0 ± 6.9  67.7 ± 9.3  80.8 ± 7.0  93.6 ± 6.9  82.7 ± 9.3  87.3 ± 7.7  0.14  0.08  0.54  0.48  Ile  93.2 ± 7.1  79.9 ± 9.8  112.9 ± 7.4  95.6 ± 7.1  88.6 ± 9.8  126.5 ± 7.7  0.08  0.08  0.02  0.08  Leu  124.8 ± 6.1  107.9 ± 8.2  171.5 ± 6.2  126.3 ± 6.1  122.2 ± 8.2  178.4 ± 6.8  0.001  0.002  0.001  0.01  Lys  169.3 ± 19.9  221.8 ± 27.5  226.8 ± 20.6  168.0 ± 19.9  213.5 ± 27.5  255.5 ± 21.7  0.06  0.46  0.01  0.95  Met  45.3 ± 4.6  43.3 ± 5.7  44.3 ± 4.6  38.2 ± 4.6  43.0 ± 5.7  47.2 ± 4.9  0.84  0.79  0.12  0.96  Phe  49.5 ± 5.8  54.3 ± 7.6  80.6 ± 5.9  52.1 ± 5.8  66.7 ± 7.6  87.0 ± 6.2  0.001  0.20  0.001  0.76  Thr  108.4 ± 14.3  107.8 ± 18.4  153.8 ± 14.5  95.3 ± 14.3  108.0 ± 18.4  184.4 ± 15.5  0.02  0.24  0.001  0.13  Trp  54.4 ± 6.4  70.6 ± 9.0  73.6 ± 6.8  51.1 ± 7.3  78.7 ± 10.0  77.7 ± 8.0  0.30  0.94  0.04  0.25  Val  179.7 ± 18.3  192.6 ± 23.0  260.5 ± 18.6  178.4 ± 18.3  200.6 ± 23.0  278.9 ± 19.6  0.01  0.24  0.001  0.23  1Data are least-squares means ± SE. 2Q = quadratic. View Large Table 7. Effect of dietary CP concentration on AA arterial concentrations (μmol/ L) of AA in lactating sows on d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P–value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4  –  –  –  –  Arg  128.2 ± 16.4  175.1 ± 22.2  173.3 ± 16.8  139.9 ± 16.4  166.7 ± 22.2  189.7 ± 18.4  0.09  0.37  0.07  0.94  His  96.0 ± 6.9  67.7 ± 9.3  80.8 ± 7.0  93.6 ± 6.9  82.7 ± 9.3  87.3 ± 7.7  0.14  0.08  0.54  0.48  Ile  93.2 ± 7.1  79.9 ± 9.8  112.9 ± 7.4  95.6 ± 7.1  88.6 ± 9.8  126.5 ± 7.7  0.08  0.08  0.02  0.08  Leu  124.8 ± 6.1  107.9 ± 8.2  171.5 ± 6.2  126.3 ± 6.1  122.2 ± 8.2  178.4 ± 6.8  0.001  0.002  0.001  0.01  Lys  169.3 ± 19.9  221.8 ± 27.5  226.8 ± 20.6  168.0 ± 19.9  213.5 ± 27.5  255.5 ± 21.7  0.06  0.46  0.01  0.95  Met  45.3 ± 4.6  43.3 ± 5.7  44.3 ± 4.6  38.2 ± 4.6  43.0 ± 5.7  47.2 ± 4.9  0.84  0.79  0.12  0.96  Phe  49.5 ± 5.8  54.3 ± 7.6  80.6 ± 5.9  52.1 ± 5.8  66.7 ± 7.6  87.0 ± 6.2  0.001  0.20  0.001  0.76  Thr  108.4 ± 14.3  107.8 ± 18.4  153.8 ± 14.5  95.3 ± 14.3  108.0 ± 18.4  184.4 ± 15.5  0.02  0.24  0.001  0.13  Trp  54.4 ± 6.4  70.6 ± 9.0  73.6 ± 6.8  51.1 ± 7.3  78.7 ± 10.0  77.7 ± 8.0  0.30  0.94  0.04  0.25  Val  179.7 ± 18.3  192.6 ± 23.0  260.5 ± 18.6  178.4 ± 18.3  200.6 ± 23.0  278.9 ± 19.6  0.01  0.24  0.001  0.23    d 7 Dietary CP, %  d 18 Dietary CP, %  P–value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4  –  –  –  –  Arg  128.2 ± 16.4  175.1 ± 22.2  173.3 ± 16.8  139.9 ± 16.4  166.7 ± 22.2  189.7 ± 18.4  0.09  0.37  0.07  0.94  His  96.0 ± 6.9  67.7 ± 9.3  80.8 ± 7.0  93.6 ± 6.9  82.7 ± 9.3  87.3 ± 7.7  0.14  0.08  0.54  0.48  Ile  93.2 ± 7.1  79.9 ± 9.8  112.9 ± 7.4  95.6 ± 7.1  88.6 ± 9.8  126.5 ± 7.7  0.08  0.08  0.02  0.08  Leu  124.8 ± 6.1  107.9 ± 8.2  171.5 ± 6.2  126.3 ± 6.1  122.2 ± 8.2  178.4 ± 6.8  0.001  0.002  0.001  0.01  Lys  169.3 ± 19.9  221.8 ± 27.5  226.8 ± 20.6  168.0 ± 19.9  213.5 ± 27.5  255.5 ± 21.7  0.06  0.46  0.01  0.95  Met  45.3 ± 4.6  43.3 ± 5.7  44.3 ± 4.6  38.2 ± 4.6  43.0 ± 5.7  47.2 ± 4.9  0.84  0.79  0.12  0.96  Phe  49.5 ± 5.8  54.3 ± 7.6  80.6 ± 5.9  52.1 ± 5.8  66.7 ± 7.6  87.0 ± 6.2  0.001  0.20  0.001  0.76  Thr  108.4 ± 14.3  107.8 ± 18.4  153.8 ± 14.5  95.3 ± 14.3  108.0 ± 18.4  184.4 ± 15.5  0.02  0.24  0.001  0.13  Trp  54.4 ± 6.4  70.6 ± 9.0  73.6 ± 6.8  51.1 ± 7.3  78.7 ± 10.0  77.7 ± 8.0  0.30  0.94  0.04  0.25  Val  179.7 ± 18.3  192.6 ± 23.0  260.5 ± 18.6  178.4 ± 18.3  200.6 ± 23.0  278.9 ± 19.6  0.01  0.24  0.001  0.23  1Data are least-squares means ± SE. 2Q = quadratic. View Large Table 8. Effect of dietary CP concentration on AA arteriovenous differences (μmol/L) in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  16.4 ± 5.3  58.4 ± 8.8  20.5 ± 5.4  26.4 ± 5.3  40.4 ± 7.2  28.9 ± 6.0  0.61  0.003  0.77  0.16  His  10.8 ± 4.2  10.6 ± 10.0  14.5 ± 4.7  20.5 ± 4.2  23.2 ± 6.7  14.8 ± 4.7  0.57  0.85  0.40  0.48  Ile  15.1 ± 4.3  21.9 ± 5.9  28.9 ± 4.5  24.8 ± 4.3  30.3 ± 5.9  33.3 ± 4.8  0.05  0.99  0.22  0.87  Leu  24.3 ± 5.1  28.4 ± 7.0  35.7 ± 5.2  26.8 ± 5.1  28.7 ± 7.0  44.7 ± 5.6  0.15  0.85  0.04  0.41  Lys  16.9 ± 4.1  35.4 ± 5.5  20.1 ± 4.2  19.0 ± 4.6  28.0 ± 5.5  33.5 ± 5.3  0.59  0.03  0.08  0.80  Met  8.6 ± 2.6  8.9 ± 3.5  7.9 ± 3.0  9.2 ± 2.6  14.1 ± 3.5  10.4 ± 2.8  0.87  0.88  0.76  0.32  Phe  13.3 ± 2.7  12.4 ± 3.7  16.1 ± 2.8  13.9 ± 2.7  17.6 ± 3.7  19.6 ± 3.0  0.49  0.61  0.18  0.85  Thr  22.5 ± 3.9  16.2 ± 6.7  23.9 ± 4.3  22.5 ± 3.9  17.3 ± 5.2  33.5 ± 4.3  0.77  0.34  0.06  0.09  Trp  9.7 ± 4.3  5.05 ± 5.8  14.9 ± 5.9  6.3 ± 4.3  16.1 ± 5.8  17.1 ± 4.8  0.45  0.30  0.18  0.51  Val  25.9 ± 6.1  27.0 ± 8.2  44.3 ± 7.1  27.9 ± 6.1  39.6 ± 8.2  47.2 ± 6.8  0.08  0.43  0.07  0.83    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  16.4 ± 5.3  58.4 ± 8.8  20.5 ± 5.4  26.4 ± 5.3  40.4 ± 7.2  28.9 ± 6.0  0.61  0.003  0.77  0.16  His  10.8 ± 4.2  10.6 ± 10.0  14.5 ± 4.7  20.5 ± 4.2  23.2 ± 6.7  14.8 ± 4.7  0.57  0.85  0.40  0.48  Ile  15.1 ± 4.3  21.9 ± 5.9  28.9 ± 4.5  24.8 ± 4.3  30.3 ± 5.9  33.3 ± 4.8  0.05  0.99  0.22  0.87  Leu  24.3 ± 5.1  28.4 ± 7.0  35.7 ± 5.2  26.8 ± 5.1  28.7 ± 7.0  44.7 ± 5.6  0.15  0.85  0.04  0.41  Lys  16.9 ± 4.1  35.4 ± 5.5  20.1 ± 4.2  19.0 ± 4.6  28.0 ± 5.5  33.5 ± 5.3  0.59  0.03  0.08  0.80  Met  8.6 ± 2.6  8.9 ± 3.5  7.9 ± 3.0  9.2 ± 2.6  14.1 ± 3.5  10.4 ± 2.8  0.87  0.88  0.76  0.32  Phe  13.3 ± 2.7  12.4 ± 3.7  16.1 ± 2.8  13.9 ± 2.7  17.6 ± 3.7  19.6 ± 3.0  0.49  0.61  0.18  0.85  Thr  22.5 ± 3.9  16.2 ± 6.7  23.9 ± 4.3  22.5 ± 3.9  17.3 ± 5.2  33.5 ± 4.3  0.77  0.34  0.06  0.09  Trp  9.7 ± 4.3  5.05 ± 5.8  14.9 ± 5.9  6.3 ± 4.3  16.1 ± 5.8  17.1 ± 4.8  0.45  0.30  0.18  0.51  Val  25.9 ± 6.1  27.0 ± 8.2  44.3 ± 7.1  27.9 ± 6.1  39.6 ± 8.2  47.2 ± 6.8  0.08  0.43  0.07  0.83  1Data are least-squares means ± SE. 2Q = quadratic. View Large Table 8. Effect of dietary CP concentration on AA arteriovenous differences (μmol/L) in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  16.4 ± 5.3  58.4 ± 8.8  20.5 ± 5.4  26.4 ± 5.3  40.4 ± 7.2  28.9 ± 6.0  0.61  0.003  0.77  0.16  His  10.8 ± 4.2  10.6 ± 10.0  14.5 ± 4.7  20.5 ± 4.2  23.2 ± 6.7  14.8 ± 4.7  0.57  0.85  0.40  0.48  Ile  15.1 ± 4.3  21.9 ± 5.9  28.9 ± 4.5  24.8 ± 4.3  30.3 ± 5.9  33.3 ± 4.8  0.05  0.99  0.22  0.87  Leu  24.3 ± 5.1  28.4 ± 7.0  35.7 ± 5.2  26.8 ± 5.1  28.7 ± 7.0  44.7 ± 5.6  0.15  0.85  0.04  0.41  Lys  16.9 ± 4.1  35.4 ± 5.5  20.1 ± 4.2  19.0 ± 4.6  28.0 ± 5.5  33.5 ± 5.3  0.59  0.03  0.08  0.80  Met  8.6 ± 2.6  8.9 ± 3.5  7.9 ± 3.0  9.2 ± 2.6  14.1 ± 3.5  10.4 ± 2.8  0.87  0.88  0.76  0.32  Phe  13.3 ± 2.7  12.4 ± 3.7  16.1 ± 2.8  13.9 ± 2.7  17.6 ± 3.7  19.6 ± 3.0  0.49  0.61  0.18  0.85  Thr  22.5 ± 3.9  16.2 ± 6.7  23.9 ± 4.3  22.5 ± 3.9  17.3 ± 5.2  33.5 ± 4.3  0.77  0.34  0.06  0.09  Trp  9.7 ± 4.3  5.05 ± 5.8  14.9 ± 5.9  6.3 ± 4.3  16.1 ± 5.8  17.1 ± 4.8  0.45  0.30  0.18  0.51  Val  25.9 ± 6.1  27.0 ± 8.2  44.3 ± 7.1  27.9 ± 6.1  39.6 ± 8.2  47.2 ± 6.8  0.08  0.43  0.07  0.83    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  16.4 ± 5.3  58.4 ± 8.8  20.5 ± 5.4  26.4 ± 5.3  40.4 ± 7.2  28.9 ± 6.0  0.61  0.003  0.77  0.16  His  10.8 ± 4.2  10.6 ± 10.0  14.5 ± 4.7  20.5 ± 4.2  23.2 ± 6.7  14.8 ± 4.7  0.57  0.85  0.40  0.48  Ile  15.1 ± 4.3  21.9 ± 5.9  28.9 ± 4.5  24.8 ± 4.3  30.3 ± 5.9  33.3 ± 4.8  0.05  0.99  0.22  0.87  Leu  24.3 ± 5.1  28.4 ± 7.0  35.7 ± 5.2  26.8 ± 5.1  28.7 ± 7.0  44.7 ± 5.6  0.15  0.85  0.04  0.41  Lys  16.9 ± 4.1  35.4 ± 5.5  20.1 ± 4.2  19.0 ± 4.6  28.0 ± 5.5  33.5 ± 5.3  0.59  0.03  0.08  0.80  Met  8.6 ± 2.6  8.9 ± 3.5  7.9 ± 3.0  9.2 ± 2.6  14.1 ± 3.5  10.4 ± 2.8  0.87  0.88  0.76  0.32  Phe  13.3 ± 2.7  12.4 ± 3.7  16.1 ± 2.8  13.9 ± 2.7  17.6 ± 3.7  19.6 ± 3.0  0.49  0.61  0.18  0.85  Thr  22.5 ± 3.9  16.2 ± 6.7  23.9 ± 4.3  22.5 ± 3.9  17.3 ± 5.2  33.5 ± 4.3  0.77  0.34  0.06  0.09  Trp  9.7 ± 4.3  5.05 ± 5.8  14.9 ± 5.9  6.3 ± 4.3  16.1 ± 5.8  17.1 ± 4.8  0.45  0.30  0.18  0.51  Val  25.9 ± 6.1  27.0 ± 8.2  44.3 ± 7.1  27.9 ± 6.1  39.6 ± 8.2  47.2 ± 6.8  0.08  0.43  0.07  0.83  1Data are least-squares means ± SE. 2Q = quadratic. View Large Table 9. Effect of dietary CP concentration on AA transport efficiency [(A-V) /A × 100] in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  12.9 ± 3.2  28.8 ± 5.3  12.9 ± 3.2  19.3 ± 3.2  24.4 ± 4.3  15.8 ± 3.6  0.99  0.03  0.47  0.21  His  11.8 ± 4.6  15.3 ± 10.7  16.7 ± 5.1  22.1 ± 4.6  28.8 ± 7.3  16.4 ± 5.1  0.49  0.93  0.43  0.28  Ile  16.0 ± 3.4  27.1 ± 4.6  25.2 ± 3.4  26.0 ± 3.4  34.5 ± 4.6  25.7 ± 3.7  0.08  0.24  0.96  0.13  Leu  19.4 ± 3.6  26.2 ± 4.9  20.3 ± 3.7  21.3 ± 3.6  25.0 ± 4.9  24.7 ± 4.0  0.85  0.30  0.54  0.74  Lys  9.8 ± 2.1  16.7 ± 2.8  8.6 ± 2.2  12.0 ± 2.4  14.0 ± 2.8  14.4 ± 2.7  0.69  0.05  0.54  0.81  Met  17.6 ± 5.1  21.0 ± 7.0  16.3 ± 5.9  24.8 ± 5.1  32.3 ± 7.0  21.0 ± 5.7  0.87  0.64  0.63  0.28  Phe  27.3 ± 3.8  22.5 ± 5.2  19.4 ± 3.9  28.0 ± 3.8  24.8 ± 5.2  22.3 ± 4.3  0.18  0.90  0.34  0.95  Thr  21.1 ± 3.1  16.0 ± 6.2  16.7 ± 3.5  23.7 ± 3.1  17.0 ± 4.3  18.6 ± 3.5  0.38  0.69  0.31  0.43  Trp  16.1 ± 5.9  8.6 ± 7.9  18.3 ± 7.8  13.4 ± 5.9  21.0 ± 7.9  19.9 ± 6.6  0.80  0.35  0.50  0.61  Val  14.4 ± 2.7  14.1 ± 3.6  16.8 ± 3.1  16.3 ± 2.7  19.3 ± 3.6  16.3 ± 3.0  0.57  0.74  0.99  0.49    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  12.9 ± 3.2  28.8 ± 5.3  12.9 ± 3.2  19.3 ± 3.2  24.4 ± 4.3  15.8 ± 3.6  0.99  0.03  0.47  0.21  His  11.8 ± 4.6  15.3 ± 10.7  16.7 ± 5.1  22.1 ± 4.6  28.8 ± 7.3  16.4 ± 5.1  0.49  0.93  0.43  0.28  Ile  16.0 ± 3.4  27.1 ± 4.6  25.2 ± 3.4  26.0 ± 3.4  34.5 ± 4.6  25.7 ± 3.7  0.08  0.24  0.96  0.13  Leu  19.4 ± 3.6  26.2 ± 4.9  20.3 ± 3.7  21.3 ± 3.6  25.0 ± 4.9  24.7 ± 4.0  0.85  0.30  0.54  0.74  Lys  9.8 ± 2.1  16.7 ± 2.8  8.6 ± 2.2  12.0 ± 2.4  14.0 ± 2.8  14.4 ± 2.7  0.69  0.05  0.54  0.81  Met  17.6 ± 5.1  21.0 ± 7.0  16.3 ± 5.9  24.8 ± 5.1  32.3 ± 7.0  21.0 ± 5.7  0.87  0.64  0.63  0.28  Phe  27.3 ± 3.8  22.5 ± 5.2  19.4 ± 3.9  28.0 ± 3.8  24.8 ± 5.2  22.3 ± 4.3  0.18  0.90  0.34  0.95  Thr  21.1 ± 3.1  16.0 ± 6.2  16.7 ± 3.5  23.7 ± 3.1  17.0 ± 4.3  18.6 ± 3.5  0.38  0.69  0.31  0.43  Trp  16.1 ± 5.9  8.6 ± 7.9  18.3 ± 7.8  13.4 ± 5.9  21.0 ± 7.9  19.9 ± 6.6  0.80  0.35  0.50  0.61  Val  14.4 ± 2.7  14.1 ± 3.6  16.8 ± 3.1  16.3 ± 2.7  19.3 ± 3.6  16.3 ± 3.0  0.57  0.74  0.99  0.49  1Data are least-squares means ± SE. A-V = arterio-venous difference in concentration. 2Q = quadratic. View Large Table 9. Effect of dietary CP concentration on AA transport efficiency [(A-V) /A × 100] in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  12.9 ± 3.2  28.8 ± 5.3  12.9 ± 3.2  19.3 ± 3.2  24.4 ± 4.3  15.8 ± 3.6  0.99  0.03  0.47  0.21  His  11.8 ± 4.6  15.3 ± 10.7  16.7 ± 5.1  22.1 ± 4.6  28.8 ± 7.3  16.4 ± 5.1  0.49  0.93  0.43  0.28  Ile  16.0 ± 3.4  27.1 ± 4.6  25.2 ± 3.4  26.0 ± 3.4  34.5 ± 4.6  25.7 ± 3.7  0.08  0.24  0.96  0.13  Leu  19.4 ± 3.6  26.2 ± 4.9  20.3 ± 3.7  21.3 ± 3.6  25.0 ± 4.9  24.7 ± 4.0  0.85  0.30  0.54  0.74  Lys  9.8 ± 2.1  16.7 ± 2.8  8.6 ± 2.2  12.0 ± 2.4  14.0 ± 2.8  14.4 ± 2.7  0.69  0.05  0.54  0.81  Met  17.6 ± 5.1  21.0 ± 7.0  16.3 ± 5.9  24.8 ± 5.1  32.3 ± 7.0  21.0 ± 5.7  0.87  0.64  0.63  0.28  Phe  27.3 ± 3.8  22.5 ± 5.2  19.4 ± 3.9  28.0 ± 3.8  24.8 ± 5.2  22.3 ± 4.3  0.18  0.90  0.34  0.95  Thr  21.1 ± 3.1  16.0 ± 6.2  16.7 ± 3.5  23.7 ± 3.1  17.0 ± 4.3  18.6 ± 3.5  0.38  0.69  0.31  0.43  Trp  16.1 ± 5.9  8.6 ± 7.9  18.3 ± 7.8  13.4 ± 5.9  21.0 ± 7.9  19.9 ± 6.6  0.80  0.35  0.50  0.61  Val  14.4 ± 2.7  14.1 ± 3.6  16.8 ± 3.1  16.3 ± 2.7  19.3 ± 3.6  16.3 ± 3.0  0.57  0.74  0.99  0.49    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  4          Arg  12.9 ± 3.2  28.8 ± 5.3  12.9 ± 3.2  19.3 ± 3.2  24.4 ± 4.3  15.8 ± 3.6  0.99  0.03  0.47  0.21  His  11.8 ± 4.6  15.3 ± 10.7  16.7 ± 5.1  22.1 ± 4.6  28.8 ± 7.3  16.4 ± 5.1  0.49  0.93  0.43  0.28  Ile  16.0 ± 3.4  27.1 ± 4.6  25.2 ± 3.4  26.0 ± 3.4  34.5 ± 4.6  25.7 ± 3.7  0.08  0.24  0.96  0.13  Leu  19.4 ± 3.6  26.2 ± 4.9  20.3 ± 3.7  21.3 ± 3.6  25.0 ± 4.9  24.7 ± 4.0  0.85  0.30  0.54  0.74  Lys  9.8 ± 2.1  16.7 ± 2.8  8.6 ± 2.2  12.0 ± 2.4  14.0 ± 2.8  14.4 ± 2.7  0.69  0.05  0.54  0.81  Met  17.6 ± 5.1  21.0 ± 7.0  16.3 ± 5.9  24.8 ± 5.1  32.3 ± 7.0  21.0 ± 5.7  0.87  0.64  0.63  0.28  Phe  27.3 ± 3.8  22.5 ± 5.2  19.4 ± 3.9  28.0 ± 3.8  24.8 ± 5.2  22.3 ± 4.3  0.18  0.90  0.34  0.95  Thr  21.1 ± 3.1  16.0 ± 6.2  16.7 ± 3.5  23.7 ± 3.1  17.0 ± 4.3  18.6 ± 3.5  0.38  0.69  0.31  0.43  Trp  16.1 ± 5.9  8.6 ± 7.9  18.3 ± 7.8  13.4 ± 5.9  21.0 ± 7.9  19.9 ± 6.6  0.80  0.35  0.50  0.61  Val  14.4 ± 2.7  14.1 ± 3.6  16.8 ± 3.1  16.3 ± 2.7  19.3 ± 3.6  16.3 ± 3.0  0.57  0.74  0.99  0.49  1Data are least-squares means ± SE. A-V = arterio-venous difference in concentration. 2Q = quadratic. View Large On d 7, Lys and Arg A-V (P < 0.03) and transport efficiency (P < 0.05) increased quadratically, whereas Ile A-V (P = 0.05) and transport efficiency (P = 0.08) increased or tended to increase linearly with increasing percent CP (Tables 8 and 9). Similarly, Val A-V tended to increase linearly (P = 0.08) as dietary CP increased. On d 18, Lys and Val A-V tended to increase linearly (P < 0.08), Leu A-V increased linearly (P = 0.04), and Thr A-V tended to increase curvilinearly (linear, P = 0.06; quadratic, P = 0.09) with increasing percent CP. There was no change in transport efficiency across diets on d 18. Arterial BCAA to Lys ratios are presented in Table 10. Total BCAA:Lys, Leu:Lys and Ile:Lys plasma concentrations decreased and then increased (quadratic, P < 0.03) with increasing percent CP on d 7. Similarly, plasma concentration of Val:Lys decreased initially and then increased (linear, P = 0.05; quadratic, P = 0.09) on d 7 as dietary CP increased. Plasma concentration of Arg:Lys remained unchanged among diets at both d 7 and 18 of lactation. Table 10. Effect of dietary CP concentration on arterial AA ratios in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  AA:Lys  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  BCAA:Lys3  0.78 ± 0.05  0.61 ± 0.06  0.90 ± 0.05  0.79 ± 0.05  0.68 ± 0.06  0.81 ± 0.05  0.12  0.01  0.78  0.14  Ile:Lys  0.55 ± 0.04  0.39 ± 0.06  0.55 ± 0.05  0.58 ± 0.04  0.44 ± 0.06  0.52 ± 0.05  0.90  0.03  0.37  0.12  Leu:Lys  0.74 ± 0.05  0.53 ± 0.07  0.84 ± 0.05  0.75 ± 0.05  0.60 ± 0.07  0.75 ± 0.05  0.16  0.01  0.9  0.06  Val:Lys  1.04 ± 0.08  0.93 ± 0.11  1.33 ± 0.10  1.04 ± 0.08  1.01 ± 0.11  1.18 ± 0.10  0.05  0.09  0.30  0.50  Arg:Lys  0.76 ± 0.07  0.79 ± 0.10  0.76 ± 0.08  0.85 ± 0.07  0.80 ± 0.10  0.78 ± 0.08  0.94  0.82  0.52  0.89    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  AA:Lys  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  BCAA:Lys3  0.78 ± 0.05  0.61 ± 0.06  0.90 ± 0.05  0.79 ± 0.05  0.68 ± 0.06  0.81 ± 0.05  0.12  0.01  0.78  0.14  Ile:Lys  0.55 ± 0.04  0.39 ± 0.06  0.55 ± 0.05  0.58 ± 0.04  0.44 ± 0.06  0.52 ± 0.05  0.90  0.03  0.37  0.12  Leu:Lys  0.74 ± 0.05  0.53 ± 0.07  0.84 ± 0.05  0.75 ± 0.05  0.60 ± 0.07  0.75 ± 0.05  0.16  0.01  0.9  0.06  Val:Lys  1.04 ± 0.08  0.93 ± 0.11  1.33 ± 0.10  1.04 ± 0.08  1.01 ± 0.11  1.18 ± 0.10  0.05  0.09  0.30  0.50  Arg:Lys  0.76 ± 0.07  0.79 ± 0.10  0.76 ± 0.08  0.85 ± 0.07  0.80 ± 0.10  0.78 ± 0.08  0.94  0.82  0.52  0.89  1Data are least-squares means ± SE. 2Q = quadratic. 3Branched chain AA (BCAA) is the average of Leu, Val, and Ile. View Large Table 10. Effect of dietary CP concentration on arterial AA ratios in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  AA:Lys  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  BCAA:Lys3  0.78 ± 0.05  0.61 ± 0.06  0.90 ± 0.05  0.79 ± 0.05  0.68 ± 0.06  0.81 ± 0.05  0.12  0.01  0.78  0.14  Ile:Lys  0.55 ± 0.04  0.39 ± 0.06  0.55 ± 0.05  0.58 ± 0.04  0.44 ± 0.06  0.52 ± 0.05  0.90  0.03  0.37  0.12  Leu:Lys  0.74 ± 0.05  0.53 ± 0.07  0.84 ± 0.05  0.75 ± 0.05  0.60 ± 0.07  0.75 ± 0.05  0.16  0.01  0.9  0.06  Val:Lys  1.04 ± 0.08  0.93 ± 0.11  1.33 ± 0.10  1.04 ± 0.08  1.01 ± 0.11  1.18 ± 0.10  0.05  0.09  0.30  0.50  Arg:Lys  0.76 ± 0.07  0.79 ± 0.10  0.76 ± 0.08  0.85 ± 0.07  0.80 ± 0.10  0.78 ± 0.08  0.94  0.82  0.52  0.89    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5,  d 7  d 18  AA:Lys  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  BCAA:Lys3  0.78 ± 0.05  0.61 ± 0.06  0.90 ± 0.05  0.79 ± 0.05  0.68 ± 0.06  0.81 ± 0.05  0.12  0.01  0.78  0.14  Ile:Lys  0.55 ± 0.04  0.39 ± 0.06  0.55 ± 0.05  0.58 ± 0.04  0.44 ± 0.06  0.52 ± 0.05  0.90  0.03  0.37  0.12  Leu:Lys  0.74 ± 0.05  0.53 ± 0.07  0.84 ± 0.05  0.75 ± 0.05  0.60 ± 0.07  0.75 ± 0.05  0.16  0.01  0.9  0.06  Val:Lys  1.04 ± 0.08  0.93 ± 0.11  1.33 ± 0.10  1.04 ± 0.08  1.01 ± 0.11  1.18 ± 0.10  0.05  0.09  0.30  0.50  Arg:Lys  0.76 ± 0.07  0.79 ± 0.10  0.76 ± 0.08  0.85 ± 0.07  0.80 ± 0.10  0.78 ± 0.08  0.94  0.82  0.52  0.89  1Data are least-squares means ± SE. 2Q = quadratic. 3Branched chain AA (BCAA) is the average of Leu, Val, and Ile. View Large DISCUSSION Numerous studies have focused on optimizing dietary Lys intake by the lactating sow to maximize litter growth (Richert et al., 1997; Dourmad et al., 1998; NRC, 1998; Touchette et al., 1998; Yang et al., 2000; Kim et al., 2009), but very little attention has been paid to the mechanisms that regulate the efficiency of Lys utilization for milk protein production. Such knowledge may allow the design of strategies to further optimize dietary Lys utilization for litter growth and reduce N losses to the environment. The first step in the global efficiency of Lys utilization for milk production involves Lys uptake by mammary cells, a process mediated by transporter proteins located in cellular membranes (Shennan et al., 1997; Shennan and Peaker, 2000). In this study, we assessed if Lys transport across the mammary gland is impacted by dietary CP when fed in an optimum profile of indispensable AA outlined by NRC (1998). On the basis of the ADG, sow BW loss, and feed intake response in this study, the predicted SID Lys requirements were 0.82%, 0.91%, and 0.85% for the Deficient, Ideal, and Standard diets, respectively (NRC, 2012). Diets contained 0.60%, 0.85%, and 1.11% SID Lys, indicating that Lys supply was markedly deficient, minimally deficient, and in excess in the Deficient, Ideal, and Standard diets, respectively. However, such predictions, in particular that for the Ideal diet, are not based on empirically derived responses in a reduced-CP diet, and it is likely that the Ideal diet fed in this study allowed for increased Lys utilization. For instance, net Lys uptake (data not shown) to ADG ratio was estimated at 0.099, 0.093, and 0.095 for the Deficient, Ideal, and Standard diets, respectively. The ADG responses to dietary CP observed in this study are similar to those reported by Guan et al. (2004) and Pérez-Laspiur et al. (2009). However, in those studies, Lys requirement was only met in an 18% CP diet; hence, ADG was only maximized at a greater CP concentration (18%) than reported in the present study. Similar to this study, Guan et al. (2004) reported A-V and extraction efficiency of Lys and Arg to be maximized at the greatest ADG. Previous research of the mechanisms behind the increased Lys and Arg extraction in response to greater ADG is limited. Pérez-Laspiur et al. (2009) reported a linear decrease in mammary tissue expression of the gene (SLC7A2) encoding for CAT-2b in response to increasing dietary Lys and CP from deficient to excess. In this experiment, we further explored if other genes responsible for Lys and Arg transport respond to dietary Lys and Arg availability when fed in an ideal profile and reduced-CP diets. Proteins known to facilitate Lys transport into mammalian epithelial cells include those of the y+ system of the AA transporter family specific for cationic AA (Palacín et al., 1998; Shennan and Peaker, 2000), 2 of which we have identified in lactating porcine mammary tissue, namely, CAT-1 and CAT-2b (Pérez-Laspiur et al., 2004, 2009). Lysine may also be transported by the shared systems with BCAA, such as systems B0,+ , b0,+, and y+L; of these systems, we have shown that protein ATB0,+ and, more recently, proteins b0,+ AT and y+LAT2, are expressed in porcine mammary tissue and regulated at a pretranslational level (Pérez-Laspiur et al., 2004, 2009; Manjarín et al., 2011). In the present study, expression of CAT-1, CAT-2b, ATB0,+, b0,+, and y+LAT2 genes remained unchanged among diets and across stages of lactation, despite an increase in Lys and Arg transport efficiency with reduction of CP from 17.5% (Standard) to 13.5% (Ideal). This change in transport efficiency was likely unrelated to an increase in mammary cell numbers because mammary DNA concentration remained constant across diets and throughout lactation. Our previous studies in vivo (Pérez-Laspiur et al., 2009) and that of others in vitro (Satsu et al., 1998) showed adaptive regulation of CAT-2b and ATB0,+ gene expression in response to reduced CP intake. However, a reduction in total Lys (analyzed) from 1.24% (Standard) to 0.99% (Ideal) or 0.62% (Deficient) in the present study may not have been sufficient to cause change in AA transporter gene expression. In the study by Pérez-Laspiur et al. (2009), adaptive regulation was observed at dietary total Lys of 0.60%, a value close to that of the Deficient diet fed in this experiment, but the concentration of SID Lys was less in the diet used in this experiment than in the experiment by Pérez-Laspiur et al. (2009). Likewise, transcript abundance of the dominant milk proteins α-lactalbumin and β-casein remained unchanged across diets at both d 7 and 18 of lactation, indicating that changes, if any, in milk protein gene expression occurred either earlier in lactation or at a posttranscriptional level (i.e., protein translation or activity). In fact, we have previously shown that upregulation of Lys transporters and milk protein genes in porcine mammary tissue in response to milk demand takes place between prepartum and d 5 of lactation (Manjarín et al., 2011). In addition, studies in rat muscle tissue indicated that dietary AA may regulate mRNA translation and protein synthesis via activation of mammalian target of the rapamycin pathway (mTOR; O'Connor et al., 2003; Kimball and Jefferson, 2006; Hundal and Taylor, 2009). In this regard, studies in dairy cows indicate a key role of the mTOR pathway in overall protein translation regulation in lactation (Hayashi and Proud, 2007; Hayashi et al., 2009; Burgos et al., 2010), and gene expression of mTOR pathway-related kinases has been shown in the porcine mammary gland (Manjarín et al., 2011). Therefore, the observed greater Lys and Arg transport efficiency and piglet ADG in the present study may be due to an upregulation of AA transporter genes at the protein level. Changes in Lys transport efficiency by the mammary gland were opposite of changes in the BCAA:Lys arterial ratio. Feeding our ideal AA profile in the 13.5% CP diet decreased the arterial BCAA:Lys and increased the efficiency of Lys transport by the mammary gland on d 7 of lactation, compared with the diets containing 9.5% or 17.5% CP. In contrast, on d 18 of lactation, both the arterial concentration of BCAA:Lys and the Lys transport efficiency remained unchanged across diets. The physiologic mechanisms behind the arterial change in BCAA:Lys ratio are unclear as dietary SID BCAA:Lys was kept constant across diets. Sows fed the Ideal diet possibly had greater peripheral uptake of dietary BCAA, leading to a reduced arterial BCAA:Lys ratio. Metabolism of BCAA largely takes place in extrahepatic tissues, such as muscle and adipose tissue (Herman et al, 2010), as hepatocytes lack the enzyme BCAA aminotransferase involved in the first step of BCAA oxidation (Nelson and Cox, 2008; Li et al., 2009). In fact, sow BW loss was numerically less for those fed the Ideal diet compared with BW of sows fed the Standard and Deficient diets, indicative of less skeletal muscle protein mobilization. Increased mammary BCAA transport because of greater protein intake has been previously shown in lactating sows (Guan et al., 2002) and cows (Bequette et al., 1996), with no increase in milk protein yield. As such, Bequette et al. (1996) hypothesized that excess BCAA taken up by the mammary gland may be oxidized in the tissue, likely decreasing the efficiency of dietary AA utilization into milk protein. This extraordinary potential for oxidative catabolism of BCAA by the mammary gland may negatively affect the efficiency of Lys and Arg transport into the mammary cells via competitive events at the AA transporter level. For instance, the AA transporter ATB0,+ mediates intracellular transport of both cationic and neutral AA in epithelial cells (Broër, 2008) and shows greater affinity for BCAA (Sloan and Mager, 1999). As mentioned, we have shown in this experiment and previously (Pérez-Laspiur et al., 2004, 2009) that ATB0,+ transcript is remarkably high in porcine mammary tissue. Although all diets had a similar SID BCAA:Lys, the arterial BCAA:Lys was considerably greater for both the Deficient and Standard diets compared with the Ideal diet on d 7 of lactation. Therefore, increased arterial BCAA:Lys associated with Deficient and Standard diets may have increased the competitive advantage of BCAA relative to Arg and Lys for uptake via the ATB0,+ transporter, consequently decreasing Lys and Arg transport efficiency by the porcine mammary gland. Cationic and neutral AA also share y+LAT2, an AA transporter that is also highly expressed in porcine mammary cells (Manjarín et al., 2011). In contrast to ATB0,+, y+LAT2 functions as an obligatory exchanger between cationic and large neutral AA, promoting the efflux of cationic AA from the cells (Broër, 2008). In this regard, greater concentrations of Leu and Val were shown to inhibit Lys uptake and increase Lys efflux from rat mammary explants (Shennan et al., 1994; Calvert and Shennan, 1996) and porcine mammary tissue (Guan et al., 2002), respectively. Thus, in addition to the likely preferential uptake of BCAA via ATB0,+, an increased arterial BCAA:Lys associated with Deficient and Standard diets may have facilitated Lys and Arg efflux from the mammary cells in exchange for BCAA via y+LAT2 transporter, contributing to decreased Lys and Arg transport efficiency by the porcine mammary gland. The fact that Arg transport efficiency also increased in response to feeding the Ideal diet on d 7 of lactation indicates a pivotal role for Arg in porcine mammary glands. For instance, Guan et al. (2004) also reported a greater Arg A-V in response to decreasing dietary CP from an excessive amount of 24% to the requirement at 18%, and Nielsen et al. (2002) reported an increase in Arg mammary uptake associated with larger litter size. Arginine is not thought to limit milk protein synthesis in the sow (NRC, 1998). However, recent work indicates that this AA is involved in numerous functions in mammary tissue directly related to milk yield (Kim and Wu, 2009). Arginine is the substrate for synthesis of vasodilator nitric oxide (Wu and Morris 1998), and blood flow to the mammary gland was the main driving variable for increased mammary AA uptake in response to litter size in the study by Nielsen et al. (2002). However, in this study, the greater efficiency of Arg transport associated with the Ideal diet did not appear to be associated with a greater blood flow. When plasma blood flow is estimated on the basis of the Fick principle (Guan et al., 2004) with an average Lys concentration in milk of 0.386% (7.01% Lys in true milk protein and 5.41% true milk protein in the milk) and a calculated milk production based on litter weight gain and piglet initial BW as outlined by Noblet and Etienne (1989), values are 8,095 L/d for the Deficient diet and 6,188 L·d−1 for the Standard diet compared with 5,671 L·d−1 for the Ideal diet. These estimates are similar to those previously reported by Guan et al. (2004), who also demonstrated greater blood flow in sows fed diets containing either a deficit or surfeit amount of CP. Guan et al. (2004) suggested that the mammary gland compensates for the decrease in Lys A-V by increasing blood flow, driving the uptake of nonlimiting AA and thus contributing to metabolic inefficiency and possibly increasing the energy requirement. It is therefore possible that energy limited milk protein synthesis in the Deficient diet, resulting in decreased active AA transport. In regard to Arg extraction as discussed before, Mateo et al. (2008) reported that maintenance dietary supplementation with Arg enhanced the production of milk by the sow and piglet growth and, as such, an increased extraction of Arg by mammary tissue may have led to greater mammary cellular Arg availability. Amino acid transporter CAT-1 may offer a unique port of entry for Arg in the mammary tissue. The CAT-1 is highly specific for Arg and Lys transport (Sloan and Mager, 1999), and we have recently demonstrated that CAT-1 mRNA is highly abundant in mammary tissue (Manjarín et al., 2011). Additionally, Arg is also involved in the synthesis of polyamines, which are regulators of protein synthesis and lactogenesis (Wu and Morris, 1998; Meininger and Wu, 2002) and Pro, an indispensable AA for the young pig (Ball et al., 1986; Wu et al., 2011). In summary, decreasing the dietary CP from 17.5% to 13.5% with inclusion of crystalline AA to achieve an “ideal” AA profile did not affect piglet ADG or mRNA abundance of genes encoding for AA transporters and milk proteins during lactation. However, compared with 17.5% CP, a diet with 13.5% CP increased mammary Lys and Arg transport efficiency and decreased plasma concentration of BCAA:Lys in early lactation (i.e., d 7). These results indicate that efficiency of dietary AA utilization for litter growth is independent of transcription of genes encoding for milk proteins or AA transporter and may involve competitive inhibition between cationic and BCAA at the mammary cell membrane interface. These observations contribute to our understanding of the potential mechanisms behind improvement in dietary N utilization in diets containing an optimum AA balance and provide tools to better implement the concept of ideal protein in lactating sows at the farm level. LITERATURE CITED Ball R. O. Atkinson J. L. Bayley H. S. 1986. Proline as an essential amino acid for the young pig. Br J Nutr  55: 659– 668. Google Scholar CrossRef Search ADS PubMed  Bequette B. J. Metcalf J. A. Wray-Cahen D. Backwell F. R. Sutton J. D. Lomax M. A. MacRae J. C. Lobley G. E. 1996. Leucine and protein metabolism in the lactating dairy cow mammary gland: Responses to supplemental dietary crude protein intake. J. Dairy Res.  63: 209– 222. Google Scholar CrossRef Search ADS PubMed  Bionaz M. Loor J. J. 2007. Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle. Physiol. Genomics  29: 312– 319. Google Scholar CrossRef Search ADS PubMed  Broër S. 2008. Amino acid transport across mammalian intestinal and renal epithelia. Physiol. Rev.  88: 249– 286. Google Scholar CrossRef Search ADS PubMed  Burgos S. A. Dai M. Cant J. P. 2010. Nutrient availability and lactogenic hormones regulate mammary protein synthesis through the mammalian target of rapamycin signaling pathway. J. Dairy Sci.  93: 153– 161. Google Scholar CrossRef Search ADS PubMed  Calvert D. T. Shennan D. B. 1996. Evidence for an interaction between cationic and neutral amino acids at the blood-facing aspect of the lactating rat mammary epithelium. J. Dairy Res.  63: 25– 33. Google Scholar CrossRef Search ADS PubMed  Dourmad J. Y. Noblet J. Etienne M. 1998. Effect of protein and lysine supply on performance, nitrogen balance, and body composition changes of sows during lactation. J. Anim. Sci.  76: 542– 550. Google Scholar CrossRef Search ADS PubMed  Guan X. Bequette B. J. Calder G. Ku P. K. Ames K. N. Trottier N. L. 2002. Amino acid availability affects amino acid flux and protein metabolism in the porcine mammary gland. J. Nutr.  132: 1224– 1234. Google Scholar CrossRef Search ADS PubMed  Guan X. Pettigrew J. E. Ku P. K. Ames K. N. Bequette B. J. Trottier N. L. 2004. Dietary protein concentration affects plasma arteriovenous difference of amino acids across the porcine mammary gland. J. Anim. Sci.  82: 2953– 2963. Google Scholar CrossRef Search ADS PubMed  Hayashi A. A. Nones K. Roy N. C. McNabb W. C. Mackenzie D. S. Pacheco D. McCoard S. 2009. Initiation and elongation steps of mRNA translation are involved in the increase in milk protein yield caused by growth hormone administration during lactation. J. Dairy Sci.  92: 1889– 1899. Google Scholar CrossRef Search ADS PubMed  Hayashi A. A. Proud C. G. 2007. The rapid activation of protein synthesis by growth hormone requires signaling through mTOR. Am. J. Physiol. Endocrinol. Metab.  292: E1647– E1655. Google Scholar CrossRef Search ADS PubMed  Herman M. A. She P. Peroni O. D. Lynch C. J. Kahn B. B. 2010. Adipose tissue branched-chain amino acid (BCAA) metabolism modulates circulating BCAA levels. J. Biol. Chem.  285: 11,348– 11,356. Google Scholar CrossRef Search ADS   Hundal H. S. Taylor P. M. 2009. Amino acid transceptors: Gate keepers of nutrient exchange and regulators of nutrient signaling. Am. J. Physiol. Endocrinol. Metab.  296: E603– E613. Google Scholar CrossRef Search ADS PubMed  Kim S. W. Hurley W. L. Han I. K. Easter R. A. 1999. Changes in tissue composition associated with mammary gland growth during lactation in sows. J. Anim. Sci.  77: 2510– 2516. Google Scholar CrossRef Search ADS PubMed  Kim S. W. Wu G. 2009. Regulatory role for amino acids in mammary gland growth and milk synthesis. Amino Acids  37: 89– 95. Google Scholar CrossRef Search ADS PubMed  Kimball S. R. Jefferson L. S. 2006. New functions for amino acids: Effects on gene transcription and translation. Am. J. Clin. Nutr.  83: 500S– 507S. Google Scholar PubMed  Kirkwood R. N. Pérez-Laspiur J. Ames N. K. Moore J. B. Cegielski A. Trottier N. L. 2007. Mammary gland biopsy does not affect lactation performance in sows. Can. J. Anim. Sci.  87: 281– 284. Google Scholar CrossRef Search ADS   Labarca C. Paigen K. 1980. A simple, rapid and sensitive DNA assay procedure. Anal. Biochem.  102: 344– 352. Google Scholar CrossRef Search ADS PubMed  Larionov A. Krause A. Miller W. 2005. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics  6: 62– 77. Google Scholar CrossRef Search ADS PubMed  Li P. Knabe D. A. Kim S. W. Lynch C. J. Hutson S. M. Wu G. 2009. Lactating porcine mammary tissue catabolizes branched-chain amino acids for glutamine and aspartate synthesis. J. Nutr.  139: 1502– 1509. Google Scholar CrossRef Search ADS PubMed  Li X. L. Rezaei R. Li P. Wu G. 2011. Composition of amino acids in feed ingredients for animal diets. Amino Acids  40: 1159– 1168. Google Scholar CrossRef Search ADS PubMed  Manjarín R. Steibel J. P. Zamora V. Am-in N. Kirkwood R. N. Ernst C. W. Weber P. S. Taylor N. P. Trottier N. L. 2011. Transcript abundance of amino acid transporters, β-casein and α-lactalbumin in mammary tissue of peri-parturient, lactating and post-weaned sows. J. Dairy Sci.  94: 3467– 3476. Google Scholar CrossRef Search ADS PubMed  Mateo R. D. Wu G. Moon H. K. Carroll J. A. Kim S. W. 2008. Effects of dietary arginine supplementation during gestation and lactation on the performance of lactating primiparous sows and nursing piglets. J. Anim. Sci.  86: 827– 835. Google Scholar CrossRef Search ADS PubMed  Meininger C.J. Wu G. 2002. Regulation of endothelial cell proliferation by nitric oxide. Methods Enzymol.  352: 280– 295. Google Scholar CrossRef Search ADS PubMed  Mikeska T. Dobrovic A. 2009. Validation of a primer optimisation matrix to improve the performance of reverse transcription - quantitative real-time PCR assays. BMC Res. Notes  2: 112– 117. Google Scholar CrossRef Search ADS PubMed  Nelson D.L. Cox M.M. 2008. Amino acid oxidation and the production of urea. Pag. 679 in Principles of Biochemistry, ed. Freeman, New York, NY. Nielsen T. T. Trottier N. L. Stein H. H. Bellaver C. Easter R. A. 2002. The effect of litter size and day of lactation on amino acid uptake by the porcine mammary gland. J. Anim. Sci.  80: 2402– 2411. Google Scholar PubMed  Noblet J. Etienne M. 1989. Estimation of sow milk nutrient output. J. Anim. Sci.  67: 3352– 3359. Google Scholar CrossRef Search ADS PubMed  NRC 1998. Nutrient Requirements of Swine. 10th rev. ed. Natl. Acad. Press, Washington, DC. NRC 2012. Nutrient Requirements of Swine. 11th rev. ed. Natl. Acad. Press, Washington, DC. O'Connor P. M. J. Kimball S. R. Suryawan A 2003. Regulation of translation initiation by insulin and amino acids in skeletal muscle of neonatal pigs. Am. J. Physiol.  285: E40– E53. Otto E. R. Yokoyama M. Ku P. K. Ames N. K. Trottier N. L. 2003. Nitrogen balance and ileal amino acid digestibility in growing pigs fed diets reduced in protein concentration. J. Anim. Sci.  81: 1743– 1753. Google Scholar CrossRef Search ADS PubMed  Palacín M. Estevez R. Bertran J. Zorzano A. 1998. Molecular biology of mammalian AA transporters. Physiol. Rev.  78: 969– 1054. Google Scholar CrossRef Search ADS PubMed  Pérez-Laspiur J. P. Burton J. L. Weber P. S. D. Kirkwood R. N. Trottier N. L. 2004. Short communication: AA transporters in porcine mammary gland during lactation. J. Dairy Sci.  87: 3235– 3237. Google Scholar CrossRef Search ADS PubMed  Pérez-Laspiur J. P. Burton J. L. Weber P. S. D. Moore J. Kirkwood R. N. Trottier N. L. 2009. Dietary protein intake and stage of lactation differentially modulate AA transporter mRNA abundance in porcine mammary tissue. J. Nutr.  139: 1677– 1684. Google Scholar CrossRef Search ADS PubMed  Richert B. T. Tokach M. D. Goodband R. D. Nelssen J. L. Campbell R. G. Kershaw S. 1997. The effect of dietary lysine and valine fed during lactation on sow and litter performance. J. Anim. Sci.  75: 1853– 1860. Google Scholar CrossRef Search ADS PubMed  Satsu H. Watanabe H. Arai S. Shimizu M. 1998. System B0,+-mediated regulation of lysine transport in Caco-2 human intestinal cells. Amino Acids  14: 379– 384. Google Scholar CrossRef Search ADS PubMed  Shennan D. B. McNeillie S. A. Jamieson E. A. Calvert D. T. 1994. Lysine transport in lactating rat mammary tissue: Evidence for an interaction between cationic and neutral amino acids. Acta Physiol. Scand.  151: 461– 466. Google Scholar CrossRef Search ADS PubMed  Shennan D. B. Millar I. D. Calvert D. T. 1997. Mammary-tissue amino acid transport systems. Proc. Nutr. Soc.  56: 177– 191. Google Scholar CrossRef Search ADS PubMed  Shennan D. B. Peaker M. 2000. Transport of milk constituents by the mammary gland. Physiol. Rev.  80: 925– 951. Google Scholar CrossRef Search ADS PubMed  Sloan J. L. Mager S. 1999. Cloning and functional expression of a human Na+ and Cl− dependent neutral and cationic amino acid transporter B0,+. J. Biol. Chem.  274: 23,740– 23,745. Google Scholar CrossRef Search ADS   Touchette K. J. Allee G. L. Newcomb M. D. Boyd R. D. 1998. The lysine requirement of lactating primiparous sows. J. Anim. Sci.  76: 1091– 1097. Google Scholar CrossRef Search ADS PubMed  Tramontana S. Bionaz M. Sharma A. Graugnard D. E. Cutler E. A. Ajmone-Marsan P. Hurley W. L. Loor J. J. 2008. Internal controls for quantitative polymerase chain reaction of swine mammary glands during pregnancy and lactation. J. Dairy Sci.  91: 3057– 3066. Google Scholar CrossRef Search ADS PubMed  Trottier N. L. Shipley C. F. Easter R. A. 1997. Plasma AA uptake by the mammary gland of the lactating sow. J. Anim. Sci.  75: 1266– 1278. Google Scholar CrossRef Search ADS PubMed  Vandesompele J. De Preter K. Pattyn F. Poppe B. Van Roy N. De Paepe A. Speleman F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol.  3:research0034- research0034.11. Wu G. Bazer F. W. Burghardt R. C. Johnson G. A. Kim S. W. Knabe D. A. Li P. Li X. L. McKnight J. R. Satterfield M. C. Spencer T. E. 2011. Proline and hydroxyproline metabolism: Implications for animal and human nutrition. Amino Acids  40: 1053– 1063. Google Scholar CrossRef Search ADS PubMed  Wu G. Meininger C. J. 2008. Analysis of citrulline, arginine, and methylarginines using high-performance liquid chromatography. Methods Enzymol.  440: 177– 189. Google Scholar CrossRef Search ADS PubMed  Wu G. Morris S. M. 1998. Arginine metabolism: Nitric oxide and beyond. Biochem. J.  336: 1– 17. Google Scholar CrossRef Search ADS PubMed  Yang H. Pettigrew J. E. Johnston L. J. Shurson G. C. Wheaton J. E. White M. E. Koketsu Y. Sower A. F. Rathmacher J. A. 2000. Effects of dietary Lys intake during lactation on blood metabolites, hormones, and reproductive performance in primiparous sows. J. Anim. Sci.  78: 1001– 1009. Google Scholar CrossRef Search ADS PubMed  Yuan J. S. Reed A. Chen F. Stewart C. N. 2006. Statistical analysis of real-time PCR data. BMC Bioinformatics  7: 85– 97. Google Scholar CrossRef Search ADS PubMed  Appendix 1 Effect of dietary CP concentration on AA arterial concentrations (μmol/L) in lactating sows at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  575.7 ± 37.6  487.0 ± 50.4  306.4 ± 38.3  637.9 ± 37.6  558.8 ± 50.4  391.0 ± 42.2  0.001  0.45  0.001  0.47  Asn  62.2 ± 12.1  99.7 ± 15.3  91.7 ± 12.2  62.1 ± 12.1  93.6 ± 15.3  103.2 ± 13.0  0.05  0.16  0.02  0.49  Asp  27.8 ± 4.8  22.8 ± 6.4  26.2 ± 4.9  25.2 ± 4.8  25.0 ± 6.4  27.7 ± 5.3  0.80  0.54  0.70  0.83  Cit  68.2 ± 8.5  72.4 ± 10.9  50.1 ± 8.6  76.3 ± 8.5  62.2 ± 10.9  58.7 ± 9.2  0.09  0.26  0.12  0.65  Gln  515.3 ± 40.7  562.5 ± 54.3  423.3 ± 41.5  419.0 ± 40.7  447.7 ± 54.3  441.8 ± 44.9  0.10  0.14  0.68  0.77  Glu  271.0 ± 32.8  206.8 ± 43.8  148.4 ± 33.6  239 ± 32.8  171.3 ± 43.8  145.8 ± 34.2  0.01  0.95  0.04  0.65  Gly  583.7 ± 58.0  470.7 ± 78.1  539.1 ± 59.2  655.5 ± 58.0  526.4 ± 78.1  581.3 ± 64.8  0.58  0.33  0.40  0.32  Ser  103.1 ± 6.7  95.5 ± 8.9  104.7 ± 6.9  107.5 ± 6.7  113.2 ± 8.9  118.3 ± 7.3  0.84  0.39  0.22  0.97  Tyr  58.9 ± 7.7  73.4 ± 10.6  99.8 ± 8.0  52.5 ± 7.7  87.5 ± 10.6  109.28 ± 8.3  0.01  0.64  0.001  0.61    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  575.7 ± 37.6  487.0 ± 50.4  306.4 ± 38.3  637.9 ± 37.6  558.8 ± 50.4  391.0 ± 42.2  0.001  0.45  0.001  0.47  Asn  62.2 ± 12.1  99.7 ± 15.3  91.7 ± 12.2  62.1 ± 12.1  93.6 ± 15.3  103.2 ± 13.0  0.05  0.16  0.02  0.49  Asp  27.8 ± 4.8  22.8 ± 6.4  26.2 ± 4.9  25.2 ± 4.8  25.0 ± 6.4  27.7 ± 5.3  0.80  0.54  0.70  0.83  Cit  68.2 ± 8.5  72.4 ± 10.9  50.1 ± 8.6  76.3 ± 8.5  62.2 ± 10.9  58.7 ± 9.2  0.09  0.26  0.12  0.65  Gln  515.3 ± 40.7  562.5 ± 54.3  423.3 ± 41.5  419.0 ± 40.7  447.7 ± 54.3  441.8 ± 44.9  0.10  0.14  0.68  0.77  Glu  271.0 ± 32.8  206.8 ± 43.8  148.4 ± 33.6  239 ± 32.8  171.3 ± 43.8  145.8 ± 34.2  0.01  0.95  0.04  0.65  Gly  583.7 ± 58.0  470.7 ± 78.1  539.1 ± 59.2  655.5 ± 58.0  526.4 ± 78.1  581.3 ± 64.8  0.58  0.33  0.40  0.32  Ser  103.1 ± 6.7  95.5 ± 8.9  104.7 ± 6.9  107.5 ± 6.7  113.2 ± 8.9  118.3 ± 7.3  0.84  0.39  0.22  0.97  Tyr  58.9 ± 7.7  73.4 ± 10.6  99.8 ± 8.0  52.5 ± 7.7  87.5 ± 10.6  109.28 ± 8.3  0.01  0.64  0.001  0.61  1Data are least-squares means ± SE. 2Q = quadratic. View Large Effect of dietary CP concentration on AA arterial concentrations (μmol/L) in lactating sows at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  575.7 ± 37.6  487.0 ± 50.4  306.4 ± 38.3  637.9 ± 37.6  558.8 ± 50.4  391.0 ± 42.2  0.001  0.45  0.001  0.47  Asn  62.2 ± 12.1  99.7 ± 15.3  91.7 ± 12.2  62.1 ± 12.1  93.6 ± 15.3  103.2 ± 13.0  0.05  0.16  0.02  0.49  Asp  27.8 ± 4.8  22.8 ± 6.4  26.2 ± 4.9  25.2 ± 4.8  25.0 ± 6.4  27.7 ± 5.3  0.80  0.54  0.70  0.83  Cit  68.2 ± 8.5  72.4 ± 10.9  50.1 ± 8.6  76.3 ± 8.5  62.2 ± 10.9  58.7 ± 9.2  0.09  0.26  0.12  0.65  Gln  515.3 ± 40.7  562.5 ± 54.3  423.3 ± 41.5  419.0 ± 40.7  447.7 ± 54.3  441.8 ± 44.9  0.10  0.14  0.68  0.77  Glu  271.0 ± 32.8  206.8 ± 43.8  148.4 ± 33.6  239 ± 32.8  171.3 ± 43.8  145.8 ± 34.2  0.01  0.95  0.04  0.65  Gly  583.7 ± 58.0  470.7 ± 78.1  539.1 ± 59.2  655.5 ± 58.0  526.4 ± 78.1  581.3 ± 64.8  0.58  0.33  0.40  0.32  Ser  103.1 ± 6.7  95.5 ± 8.9  104.7 ± 6.9  107.5 ± 6.7  113.2 ± 8.9  118.3 ± 7.3  0.84  0.39  0.22  0.97  Tyr  58.9 ± 7.7  73.4 ± 10.6  99.8 ± 8.0  52.5 ± 7.7  87.5 ± 10.6  109.28 ± 8.3  0.01  0.64  0.001  0.61    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  575.7 ± 37.6  487.0 ± 50.4  306.4 ± 38.3  637.9 ± 37.6  558.8 ± 50.4  391.0 ± 42.2  0.001  0.45  0.001  0.47  Asn  62.2 ± 12.1  99.7 ± 15.3  91.7 ± 12.2  62.1 ± 12.1  93.6 ± 15.3  103.2 ± 13.0  0.05  0.16  0.02  0.49  Asp  27.8 ± 4.8  22.8 ± 6.4  26.2 ± 4.9  25.2 ± 4.8  25.0 ± 6.4  27.7 ± 5.3  0.80  0.54  0.70  0.83  Cit  68.2 ± 8.5  72.4 ± 10.9  50.1 ± 8.6  76.3 ± 8.5  62.2 ± 10.9  58.7 ± 9.2  0.09  0.26  0.12  0.65  Gln  515.3 ± 40.7  562.5 ± 54.3  423.3 ± 41.5  419.0 ± 40.7  447.7 ± 54.3  441.8 ± 44.9  0.10  0.14  0.68  0.77  Glu  271.0 ± 32.8  206.8 ± 43.8  148.4 ± 33.6  239 ± 32.8  171.3 ± 43.8  145.8 ± 34.2  0.01  0.95  0.04  0.65  Gly  583.7 ± 58.0  470.7 ± 78.1  539.1 ± 59.2  655.5 ± 58.0  526.4 ± 78.1  581.3 ± 64.8  0.58  0.33  0.40  0.32  Ser  103.1 ± 6.7  95.5 ± 8.9  104.7 ± 6.9  107.5 ± 6.7  113.2 ± 8.9  118.3 ± 7.3  0.84  0.39  0.22  0.97  Tyr  58.9 ± 7.7  73.4 ± 10.6  99.8 ± 8.0  52.5 ± 7.7  87.5 ± 10.6  109.28 ± 8.3  0.01  0.64  0.001  0.61  1Data are least-squares means ± SE. 2Q = quadratic. View Large Appendix 2 Effect of dietary CP concentration on AA arteriovenous differences (μmol/L) in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  39.8 ± 17.2  34.3 ± 20.8  37.7 ± 18.1  76.8 ± 17.3  51.7 ± 20.8  43.9 ± 17.3  0.94  0.87  0.22  0.74  Asn  8.7 ± 5.9  29.2 ± 7.9  18.0 ± 6.0  15.1 ± 5.9  18.9 ± 7.9  25.0 ± 6.6  0.28  0.11  0.28  0.90  Asp  3.6 ± 4.5  11.7 ± 6.0  7.0 ± 4.6  5.5 ± 4.5  3.2 ± 6.0  10.9 ± 5.0  0.61  0.38  0.44  0.50  Cit  2.8 ± 3.8  5.0 ± 6.3  2.1 ± 3.8  3.8 ± 3.8  19.9 ± 5.1  2.5 ± 4.2  0.90  0.72  0.82  0.02  Gln  65.4 ± 17.9  77.4 ± 24.6  73.3 ± 18.5  58.1 ± 17.9  83.2 ± 24.6  91.2 ± 19.7  0.76  0.79  0.24  0.77  Glu  65.8 ± 10.3  80.7 ± 13.6  48.2 ± 10.4  78.0 ± 10.3  63.2 ± 13.6  50.6 ± 11.3  0.20  0.14  0.08  0.94  Gly  15.6 ± 23.0  34.1 ± 30.9  25.3 ± 23.5  44.7 ± 23.0  24.3 ± 30.9  16.2 ± 25.9  0.77  0.71  0.43  0.87  Ser  28.9 ± 4.7  39.6 ± 6.3  34.3 ± 4.8  34.3 ± 4.7  41.5 ± 6.3  39.9 ± 5.3  0.43  0.31  0.44  0.57  Tyr  9.8 ± 2.9  11.5 ± 4.0  14.0 ± 3.4  16.3 ± 2.9  21.5 ± 4.0  17.3 ± 3.3  0.38  0.94  0.82  0.34    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  39.8 ± 17.2  34.3 ± 20.8  37.7 ± 18.1  76.8 ± 17.3  51.7 ± 20.8  43.9 ± 17.3  0.94  0.87  0.22  0.74  Asn  8.7 ± 5.9  29.2 ± 7.9  18.0 ± 6.0  15.1 ± 5.9  18.9 ± 7.9  25.0 ± 6.6  0.28  0.11  0.28  0.90  Asp  3.6 ± 4.5  11.7 ± 6.0  7.0 ± 4.6  5.5 ± 4.5  3.2 ± 6.0  10.9 ± 5.0  0.61  0.38  0.44  0.50  Cit  2.8 ± 3.8  5.0 ± 6.3  2.1 ± 3.8  3.8 ± 3.8  19.9 ± 5.1  2.5 ± 4.2  0.90  0.72  0.82  0.02  Gln  65.4 ± 17.9  77.4 ± 24.6  73.3 ± 18.5  58.1 ± 17.9  83.2 ± 24.6  91.2 ± 19.7  0.76  0.79  0.24  0.77  Glu  65.8 ± 10.3  80.7 ± 13.6  48.2 ± 10.4  78.0 ± 10.3  63.2 ± 13.6  50.6 ± 11.3  0.20  0.14  0.08  0.94  Gly  15.6 ± 23.0  34.1 ± 30.9  25.3 ± 23.5  44.7 ± 23.0  24.3 ± 30.9  16.2 ± 25.9  0.77  0.71  0.43  0.87  Ser  28.9 ± 4.7  39.6 ± 6.3  34.3 ± 4.8  34.3 ± 4.7  41.5 ± 6.3  39.9 ± 5.3  0.43  0.31  0.44  0.57  Tyr  9.8 ± 2.9  11.5 ± 4.0  14.0 ± 3.4  16.3 ± 2.9  21.5 ± 4.0  17.3 ± 3.3  0.38  0.94  0.82  0.34  1Data are least-squares means ± SE. 2Q = quadratic. View Large Effect of dietary CP concentration on AA arteriovenous differences (μmol/L) in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  39.8 ± 17.2  34.3 ± 20.8  37.7 ± 18.1  76.8 ± 17.3  51.7 ± 20.8  43.9 ± 17.3  0.94  0.87  0.22  0.74  Asn  8.7 ± 5.9  29.2 ± 7.9  18.0 ± 6.0  15.1 ± 5.9  18.9 ± 7.9  25.0 ± 6.6  0.28  0.11  0.28  0.90  Asp  3.6 ± 4.5  11.7 ± 6.0  7.0 ± 4.6  5.5 ± 4.5  3.2 ± 6.0  10.9 ± 5.0  0.61  0.38  0.44  0.50  Cit  2.8 ± 3.8  5.0 ± 6.3  2.1 ± 3.8  3.8 ± 3.8  19.9 ± 5.1  2.5 ± 4.2  0.90  0.72  0.82  0.02  Gln  65.4 ± 17.9  77.4 ± 24.6  73.3 ± 18.5  58.1 ± 17.9  83.2 ± 24.6  91.2 ± 19.7  0.76  0.79  0.24  0.77  Glu  65.8 ± 10.3  80.7 ± 13.6  48.2 ± 10.4  78.0 ± 10.3  63.2 ± 13.6  50.6 ± 11.3  0.20  0.14  0.08  0.94  Gly  15.6 ± 23.0  34.1 ± 30.9  25.3 ± 23.5  44.7 ± 23.0  24.3 ± 30.9  16.2 ± 25.9  0.77  0.71  0.43  0.87  Ser  28.9 ± 4.7  39.6 ± 6.3  34.3 ± 4.8  34.3 ± 4.7  41.5 ± 6.3  39.9 ± 5.3  0.43  0.31  0.44  0.57  Tyr  9.8 ± 2.9  11.5 ± 4.0  14.0 ± 3.4  16.3 ± 2.9  21.5 ± 4.0  17.3 ± 3.3  0.38  0.94  0.82  0.34    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.50,  13.50,  17.50,  9.50,  13.50,  17.50,  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  39.8 ± 17.2  34.3 ± 20.8  37.7 ± 18.1  76.8 ± 17.3  51.7 ± 20.8  43.9 ± 17.3  0.94  0.87  0.22  0.74  Asn  8.7 ± 5.9  29.2 ± 7.9  18.0 ± 6.0  15.1 ± 5.9  18.9 ± 7.9  25.0 ± 6.6  0.28  0.11  0.28  0.90  Asp  3.6 ± 4.5  11.7 ± 6.0  7.0 ± 4.6  5.5 ± 4.5  3.2 ± 6.0  10.9 ± 5.0  0.61  0.38  0.44  0.50  Cit  2.8 ± 3.8  5.0 ± 6.3  2.1 ± 3.8  3.8 ± 3.8  19.9 ± 5.1  2.5 ± 4.2  0.90  0.72  0.82  0.02  Gln  65.4 ± 17.9  77.4 ± 24.6  73.3 ± 18.5  58.1 ± 17.9  83.2 ± 24.6  91.2 ± 19.7  0.76  0.79  0.24  0.77  Glu  65.8 ± 10.3  80.7 ± 13.6  48.2 ± 10.4  78.0 ± 10.3  63.2 ± 13.6  50.6 ± 11.3  0.20  0.14  0.08  0.94  Gly  15.6 ± 23.0  34.1 ± 30.9  25.3 ± 23.5  44.7 ± 23.0  24.3 ± 30.9  16.2 ± 25.9  0.77  0.71  0.43  0.87  Ser  28.9 ± 4.7  39.6 ± 6.3  34.3 ± 4.8  34.3 ± 4.7  41.5 ± 6.3  39.9 ± 5.3  0.43  0.31  0.44  0.57  Tyr  9.8 ± 2.9  11.5 ± 4.0  14.0 ± 3.4  16.3 ± 2.9  21.5 ± 4.0  17.3 ± 3.3  0.38  0.94  0.82  0.34  1Data are least-squares means ± SE. 2Q = quadratic. View Large Appendix 3 Effect of dietary CP concentration on AA transport efficiency (A-V/A × 100) in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5, Standard  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  6.8 ± 2.7  7.0 ± 3.3  13.5 ± 2.8  11.6 ± 2.7  9.4 ± 3.3  10.7 ± 2.7  0.14  0.45  0.83  0.66  Asn  15.9 ± 6.5  32.2 ± 8.8  18.5 ± 6.7  26.0 ± 6.5  20.8 ± 8.8  23.1 ± 7.4  0.78  0.18  0.78  0.72  Asp  8.4 ± 14.5  34.5 ± 19.4  24.7 ± 14.8  20.0 ± 14.5  11.5 ± 19.4  39.5 ± 16.2  0.44  0.44  0.39  0.44  Cit  3.7 ± 5.3  6.0 ± 8.9  2.4 ± 5.5  5.5 ± 5.3  25.1 ± 7.2  4.2 ± 6.0  0.86  0.78  0.87  0.04  Gln  12.9 ± 3.9  13.5 ± 5.3  17.4 ± 4.0  12.6 ± 3.9  18.8 ± 5.3  21.0 ± 4.3  0.44  0.80  0.18  0.76  Glu  27.6 ± 7.3  39.6 ± 9.3  34.8 ± 7.4  37.5 ± 7.3  36.4 ± 9.3  37.9 ± 7.8  0.37  0.37  0.97  0.89  Gly  2.5 ± 3.8  6.8 ± 5.0  4.1 ± 3.8  7.2 ± 3.8  6.8 ± 5.0  3.1 ± 4.2  0.77  0.57  0.48  0.79  Ser  28.6 ± 4.2  41.5 ± 5.8  32.0 ± 4.4  32.2 ± 4.2  37.5 ± 5.8  33.9 ± 4.8  0.59  0.13  0.80  0.52  Tyr  18.0 ± 3.5  17.6 ± 4.8  12.4 ± 4.1  33.0 ± 3.5  25.5 ± 4.8  15.0 ± 3.9  0.37  0.63  0.01  0.73    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5, Standard  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  6.8 ± 2.7  7.0 ± 3.3  13.5 ± 2.8  11.6 ± 2.7  9.4 ± 3.3  10.7 ± 2.7  0.14  0.45  0.83  0.66  Asn  15.9 ± 6.5  32.2 ± 8.8  18.5 ± 6.7  26.0 ± 6.5  20.8 ± 8.8  23.1 ± 7.4  0.78  0.18  0.78  0.72  Asp  8.4 ± 14.5  34.5 ± 19.4  24.7 ± 14.8  20.0 ± 14.5  11.5 ± 19.4  39.5 ± 16.2  0.44  0.44  0.39  0.44  Cit  3.7 ± 5.3  6.0 ± 8.9  2.4 ± 5.5  5.5 ± 5.3  25.1 ± 7.2  4.2 ± 6.0  0.86  0.78  0.87  0.04  Gln  12.9 ± 3.9  13.5 ± 5.3  17.4 ± 4.0  12.6 ± 3.9  18.8 ± 5.3  21.0 ± 4.3  0.44  0.80  0.18  0.76  Glu  27.6 ± 7.3  39.6 ± 9.3  34.8 ± 7.4  37.5 ± 7.3  36.4 ± 9.3  37.9 ± 7.8  0.37  0.37  0.97  0.89  Gly  2.5 ± 3.8  6.8 ± 5.0  4.1 ± 3.8  7.2 ± 3.8  6.8 ± 5.0  3.1 ± 4.2  0.77  0.57  0.48  0.79  Ser  28.6 ± 4.2  41.5 ± 5.8  32.0 ± 4.4  32.2 ± 4.2  37.5 ± 5.8  33.9 ± 4.8  0.59  0.13  0.80  0.52  Tyr  18.0 ± 3.5  17.6 ± 4.8  12.4 ± 4.1  33.0 ± 3.5  25.5 ± 4.8  15.0 ± 3.9  0.37  0.63  0.01  0.73  1Data are least square means ± SE. A-V = arterio-venous difference in concentration 2Q = quadratic. View Large Effect of dietary CP concentration on AA transport efficiency (A-V/A × 100) in porcine mammary gland at d 7 and 18 of lactation1   d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5, Standard  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  6.8 ± 2.7  7.0 ± 3.3  13.5 ± 2.8  11.6 ± 2.7  9.4 ± 3.3  10.7 ± 2.7  0.14  0.45  0.83  0.66  Asn  15.9 ± 6.5  32.2 ± 8.8  18.5 ± 6.7  26.0 ± 6.5  20.8 ± 8.8  23.1 ± 7.4  0.78  0.18  0.78  0.72  Asp  8.4 ± 14.5  34.5 ± 19.4  24.7 ± 14.8  20.0 ± 14.5  11.5 ± 19.4  39.5 ± 16.2  0.44  0.44  0.39  0.44  Cit  3.7 ± 5.3  6.0 ± 8.9  2.4 ± 5.5  5.5 ± 5.3  25.1 ± 7.2  4.2 ± 6.0  0.86  0.78  0.87  0.04  Gln  12.9 ± 3.9  13.5 ± 5.3  17.4 ± 4.0  12.6 ± 3.9  18.8 ± 5.3  21.0 ± 4.3  0.44  0.80  0.18  0.76  Glu  27.6 ± 7.3  39.6 ± 9.3  34.8 ± 7.4  37.5 ± 7.3  36.4 ± 9.3  37.9 ± 7.8  0.37  0.37  0.97  0.89  Gly  2.5 ± 3.8  6.8 ± 5.0  4.1 ± 3.8  7.2 ± 3.8  6.8 ± 5.0  3.1 ± 4.2  0.77  0.57  0.48  0.79  Ser  28.6 ± 4.2  41.5 ± 5.8  32.0 ± 4.4  32.2 ± 4.2  37.5 ± 5.8  33.9 ± 4.8  0.59  0.13  0.80  0.52  Tyr  18.0 ± 3.5  17.6 ± 4.8  12.4 ± 4.1  33.0 ± 3.5  25.5 ± 4.8  15.0 ± 3.9  0.37  0.63  0.01  0.73    d 7 Dietary CP, %  d 18 Dietary CP, %  P-value2    9.5,  13.5,  17.5,  9.5,  13.5,  17.5, Standard  d 7  d 18  Item  Deficient  Ideal  Standard  Deficient  Ideal  Standard  Linear  Q  Linear  Q  No.  5  3  5  5  3  5  —  —  —  —  Ala  6.8 ± 2.7  7.0 ± 3.3  13.5 ± 2.8  11.6 ± 2.7  9.4 ± 3.3  10.7 ± 2.7  0.14  0.45  0.83  0.66  Asn  15.9 ± 6.5  32.2 ± 8.8  18.5 ± 6.7  26.0 ± 6.5  20.8 ± 8.8  23.1 ± 7.4  0.78  0.18  0.78  0.72  Asp  8.4 ± 14.5  34.5 ± 19.4  24.7 ± 14.8  20.0 ± 14.5  11.5 ± 19.4  39.5 ± 16.2  0.44  0.44  0.39  0.44  Cit  3.7 ± 5.3  6.0 ± 8.9  2.4 ± 5.5  5.5 ± 5.3  25.1 ± 7.2  4.2 ± 6.0  0.86  0.78  0.87  0.04  Gln  12.9 ± 3.9  13.5 ± 5.3  17.4 ± 4.0  12.6 ± 3.9  18.8 ± 5.3  21.0 ± 4.3  0.44  0.80  0.18  0.76  Glu  27.6 ± 7.3  39.6 ± 9.3  34.8 ± 7.4  37.5 ± 7.3  36.4 ± 9.3  37.9 ± 7.8  0.37  0.37  0.97  0.89  Gly  2.5 ± 3.8  6.8 ± 5.0  4.1 ± 3.8  7.2 ± 3.8  6.8 ± 5.0  3.1 ± 4.2  0.77  0.57  0.48  0.79  Ser  28.6 ± 4.2  41.5 ± 5.8  32.0 ± 4.4  32.2 ± 4.2  37.5 ± 5.8  33.9 ± 4.8  0.59  0.13  0.80  0.52  Tyr  18.0 ± 3.5  17.6 ± 4.8  12.4 ± 4.1  33.0 ± 3.5  25.5 ± 4.8  15.0 ± 3.9  0.37  0.63  0.01  0.73  1Data are least square means ± SE. A-V = arterio-venous difference in concentration 2Q = quadratic. View Large American Society of Animal Science
TI - Effect of amino acids supply in reduced crude protein diets on performance, efficiency of mammary uptake, and transporter gene expression in lactating sows
JO - Journal of Animal Science
DO - 10.2527/jas.2011-4338
DA - 2012-09-01
UR - https://www.deepdyve.com/lp/oxford-university-press/effect-of-amino-acids-supply-in-reduced-crude-protein-diets-on-pufE40ZiXh
SP - 3088
EP - 3100
VL - 90
IS - 9
DP - DeepDyve
ER -