TY - JOUR
AU1 - Wang,, Yushan
AU2 - An,, Yu
AU3 - Zhang,, Dandi
AU4 - Yu,, Huiyan
AU5 - Zhang,, Xiaona
AU6 - Wang,, Ying
AU7 - Tao,, Lingwei
AU8 - Xiao,, Rong
AB - Abstract This study aimed to explore the neurotoxic effects of 27-hydroxycholesterol (27-OHC), a major circulating cholesterol active derivative in brain on synaptic structural and functional plasticity in primary hippocampal neurons. Newborn SD rat primary hippocampal neurons were treated with 0, 1, 3, 10, and 30 μM 27-OHC for 24 hours. MTT and CCK-8 assays were used to monitor the cell viability of neurons with different treatments. Neurite morphology was assessed by staining for microtubule-associated protein-2 (MAP2) and analyzed by immunofluorescence. Synaptic ultrastructure was evaluated by transmission electron microscopy. Real-time polymerase chain reaction and Western blot analyses were used to evaluate the expression of key synaptic proteins: synaptophysin (SYP), postsynaptic density protein-95 (PSD-95), synaptosomal-associated protein 25 (SNAP-25), growth-associated protein-43 (GAP-43), MAP2, and activity-regulated cytoskeleton-associated protein (Arc). Treatment with 27-OHC at various doses stimulated cell death and resulted in significant decreases in neurite number and length, alteration of synaptic ultrastructure, and downregulated expression of synaptic proteins in a dose-dependent manner. These results suggest that 27-OHC is deleterious for synaptic structural and functional plasticity, which may partially account for its neurotoxic effects. Hippocampal plasticity, 27-Hydroxycholesterol, Neurite outgrowth, Synaptic proteins INTRODUCTION With dramatically increased life expectancy, the impact of neurodegenerative diseases on the aging population has also risen in parallel (1). Alzheimer disease (AD) is one of these age-related neurodegenerative diseases, the morbidity of which continues increasing at an alarming rate (2). Characterized by an underlying multifactorial and multistep disease process, the cause of AD is still largely unknown (3). However, extensive research, including many large epidemiological studies, has shown that AD is often preceded by some morbidities and vascular disorders (4–7). For example, high serum cholesterol in midlife, which can be caused by dietary intake, has been reported to be associated with an increased risk of AD in later life (8). Moreover, numerous animal and cellular studies have further proved that excess cholesterol may contribute to the pathogenesis of AD (9–12). While the contribution made by altered circulating cholesterol metabolism to the pathogenesis of AD has gained more consensus, an unsolved question is how peripheral cholesterol influences AD pathology, with very poor or no transfer of cholesterol from the peripheral circulation to the brain owing to the impermeability of the blood-brain barrier (BBB) (13). Whereas the BBB is not permeable to cholesterol, it allows the diffusion of some cholesterol oxidation products, oxysterols, into and out of the brain for example 27-hydroxycholesterol (27-OHC) (14). It is an enzymatic production of cholesterol oxidation products that greatly prevails in periphery under physiological conditions (15). In marked contrast to cholesterol itself, 27-OHC has shown much stronger biochemical reactivity as well as proapoptotic and pro-inflammatory effects (16, 17). Our previous studies have reported that 27-OHC may be a sensitive modulator of cholesterol metabolism by regulating cholesterol synthesis and transport in astrocytes (18). Furthermore, 27-OHC also exhibited pro-oxidant effects in astrocytes by regulating Nrf2 signaling pathway (19). Meanwhile, it has been proved that there is a substantial influx of 27-OHC from the circulation into the brain (20) and the brain of AD patients contained markedly increased levels of 27-OHC (21). Mainly for these reasons, scientists tended to consider 27-OHC may act as an important link between circulating cholesterol and the development of AD. This assumption was validated in some in vitro studies. Heverin et al (22) have reported that memory impairments, accompanied by downregulated “memory protein” Arc in the hippocampus, were only observed in wild type mice with dietary cholesterol but not in cholesterol-fed mutant mice (Cyp27−/−) lacking 27-OHC. Mateos et al (23) also found that Arc expression was decreased in hippocampus and cerebral cortex in animals fed with high fat and 27-OHC could decrease Arc levels in rat primary hippocampal neurons. Moreover, Brooks et al (24) have demonstrated that elevated serum cholesterol in rabbits, induced by high-cholesterol diet, is related to increased levels of 27-OHC in the brain and increased neurodegeneration in the hippocampus. The hippocampus is involved in learning and memory processes and seems to be a vulnerable region in neurodegenerative diseases (25). Clinically marked by gradual cognitive impairment and neuropathologically characterized by deposition of extracellular plaques and accumulation of intracellular neurofibrillary tangles, AD is also characterized by selective neuronal death and synaptic loss in specific brain areas such as hippocampus (26). Since neurons can connect to other neurons and cells via synapses to form functional networks by extending neurites (comprised of axons and dendrites) (27), hippocampus-related learning and memory are associated with strengthening of existing synapses and demand intact morphology of synaptic structure, so-called structural and functional plasticity (28–30). Impairments in such synaptic plasticity, including neurite atrophy, the loss of synaptic connections, and downregulated expression of synaptic proteins may underpin hippocampus-related memory and cognitive dysfunction in AD patients (31, 32). A substantial body of evidence using animal models has shown that dietary cholesterol can modulate learning and memory by influencing neurite morphology and synaptic plasticity of hippocampal neurons (33–35). In the light of these findings, cholesterol may elicit changes in synaptic plasticity in hippocampus. However, to date, there are no reports showing different concentrations of 27-OHC influence synaptic plasticity of hippocampal neurons, which may underlie the complicated changes observed in animal studies after treatment with dietary cholesterol. Thus, in this study, we aimed to investigate the changes of cell viability, neurite outgrowth, and expression of key synaptic proteins in rat primary hippocampal neurons exposed to different concentrations of 27-OHC. MATERIALS AND METHODS Chemical Reagents 27-OHC was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Neurobasal medium (catalog number 21103049), B27 supplement (catalog number 17504), Dulbecco’s Modified Eagle’s Medium (DMEM)/F12 medium (catalog number 10565018), fetal bovine serum (FBS) (catalog number 10091148), l-glutamine (catalog number 25030081), 0.25% trypsin (catalog number 15090046), and Hank’s Balanced Salt Solution (catalog number 24020117) were purchased from Gibco (Grand Island, NY). Penicillin-Streptomycin (catalog number KGY0023) was purchased from Keygen (Jiangsu, China). Poly-d-lysine (catalog number P6407, molecular weight 70 000–150 000) was purchased from Sigma-Aldrich (St. Louis, MO). Primary antibodies for Western blot including rabbit anti-synaptophysin (ab32127), mouse anti-PSD-95 (ab13552), rabbit anti-SNAP-25 (ab109105), rabbit anti-GAP-43 (ab75843), rabbit anti-MAP2 (ab32454), and rabbit anti-Arc (ab51243) were purchased from Abcam (Cambridge, UK). Goat anti-mouse and rabbit biotinylated secondary antibodies were obtained from Cell Signaling Technology (Boston, MA). The SV Total RNA Isolation system (catalog number Z3100) was provided by Promega Corporation (Madison, WI). Primary Cultures of Rat Hippocampal Neurons Primary cultures were obtained from the hippocampus of 24-hour-old Sprague-Dawley rats. Animals were obtained from the Academy of Military Medical Sciences. The experiments were approved by the Ethics Committee of Capital Medical University (AEEI-2014-047). New born rats were decapitated and the hippocampi were isolated from brains in precooled Hank’s Balanced Salt Solution. Then, cells were dissociated at 37°C for 25 minutes with 0.25% trypsin (5% CO2). Next, DMEM/F12 medium with 10% FBS was added to stop the enzyme digestion. The cells were allowed to settle down and then centrifuged at 1500g for 5 minutes at room temperature. The supernatant was carefully removed and the cell pellet was suspended in DMEM/F12 medium containing 10% FBS, 100 U/mL penicillin and 100 U/mL streptomycin. Then, the cells were seeded in 6-well dishes coated with poly-d-lysine at a density of 5 × 105 per well. Plating medium was replaced by culturing medium (Neurobasal medium, supplemented with 2% B27 and 0.5 mM l-glutamine) in 24 hours after plating with a full medium change. Half of the medium was changed after 48 hours. To inhibit the growth of glial cells, 5 μM cytosine arabinoside (Sigma-Aldrich) was added 48 hours after plating. 27-OHC Treatment 27-OHC (10 mg) was dissolved in ethanol and diluted to various concentrations (0, 1, 3, 10, and 30 μM) before use. For the purposes of Western blot and the immunofluorescence, cells were cultured for 7 and 10 days, respectively. Cell Viability Assays The cytotoxicity of 27-OHC was determined using the Cell Counting Kit-8 (CCK-8; Beyotime Institute of Biotechnology, Shanghai, China) and 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay (Solarbio, Beijing, China). Neurons were seeded in 96-well plates for 7 days in a humidified incubator. For the CCK-8 assay, neurons were incubated with different concentrations of 27-OHC (0, 0.1, 0.3, 1, 3, 10, 30, and 100 μM) in 96-well plates for 24 hours, followed by addition of 10 µL CCK-8 solution to each well and incubation of the plates for another 4 hours. The optical density of each well was measured at a wavelength of 450 nm. For the MTT assay, neurons were treated with different concentrations of 27-OHC for 24 hours, and 20 µL MTT solution was added to each well. After 4-hour incubation, the mixed medium was removed and 200 µL dimethyl sulfoxide was added, followed by absorption measurement at 570 nm. The experiments were repeated 3 times. Immunofluorescence To examine the effect of 27-OHC treatment on neurite outgrowth, neurons were incubated with media containing different concentrations of 27-OHC for 24 hours. Following the treatment period, hippocampal neurons were washed with phosphate buffered saline (PBS) (pH 7.4) 3 times and then fixed with paraformaldehyde (4%) at room temperature for 30 minutes. Then, the dish was washed again in PBS 3 times and neurons were permeabilized in 0.3% Triton X-100/PBS for 10 minutes and blocked for 45 minutes in blocking solution (PBS plus 10% goat serum at room temperature). Rabbit monoclonal anti MAP-2 antibody (1:200, ab32454, Abcam) diluted in the blocking buffer was applied and incubated overnight at 4°C. Following washing thoroughly with PBS, FITC-conjugated anti-rabbit secondary antibody (Sigma-Aldrich) was applied at 1:100 for fluorescent staining and incubated at 37°C for 1 hour. The nucleus was stained by DAPI (Sigma-Aldrich) for 4 minutes. Neuronal morphology was analyzed using an inverted fluorescence microscope (Nikon, Japan). For the neurite analysis, 10 randomly selected areas of each slide were analyzed with ImagePro-Plus software. Images of neurons were analyzed for the number of neurites, total neurite branch length, and terminal neurite branch length, which was calculated using image measuring software or counted manually. The experiments were repeated 3 times. Ultrastructural Analysis The ultrastructural morphological changes of synapses induced by 27-OHC were characterized by transmission electron microscope (TEM). For TEM observation, 6020 bioriented stretching polyester film (BSPF) was used and neurons were cultured on the culture dish lined with BSPF on the bottom. BSPF and neurons were stripped from the culture dish and cut into pieces on 14th day. And then BSPF pieces were fixed in 2.5% glutaraldehyde for 30 minutes and then in 1% osmium tetroxide, step dehydrated in alcohol, impregnated with propylene oxide, embedded in resin, and sectioned with an ultramicrotome. The 80-nm sections were then observed with a JEM-2100 electron microscope (JEOL, Tokyo, Japan) at the voltage of 160 kV and the photos were taken. The experiments were repeated 3 times. Real-time Polymerase Chain Reaction Analysis To quantify the mRNA expression profile of synaptic protein-related genes, the mRNA levels of SYP, PSD-95, SNAP-25, GAP-43, MAP2, and Arc were analyzed by real-time polymerase chain reaction (PCR). For gene expression profiles, total RNA from primary cultures of hippocampal neurons were extracted by SV Total RNA Isolation system (Promega Corporation) according to the manufacture’s instruction. A total of 1 μg of RNA was reverse transcribed into cDNA using Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA) according to the manufacturer’s protocol. The sense and antisense primer sequence for synaptic protein-related genes are shown in the Table. The real-time PCR system contains 0.5 μL sense primer (10 μM solution), 0.5 μL antisense primer (10 μM solution), 10 μL Real-time PCR Master Mix (SYBR Green), 9 μL nucleus-free water, and 1 μL cDNA in each well. Real-time PCR experiments were performed on Real-time PCR Detection System (Bio-Rad, Hercules, CA). The housekeeping gene 18S rRNA served as the reference for standardization. The relative gene expression levels were calculated based on the threshold cycles Ct and determined using the 2−ΔΔCt method. All samples were run in triplicate. TABLE. The Primer Sequences Used for Real-time PCR Primer Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Tm/°C 18SrRNA AAACGGCTACCACATCCA CTCATTCCAATTACAGGG 48 SYN GGACCTCCTGCTCAACAACGA TGCTGCTGTGGGACTTGGTAG 62.3 PSD-95 GTCAACACGGACACCCTAGAA TTGATCTCCATGACCTTTTCG 60 GAP-43 TGGCTCTGCTACTACCGATGC CTTGGAGGACGGCGAGTTATCA 62.3 SNAP-25 GAGCAGGTGAGCGGCATCAT GCACGTTGGTTGGCTTCATCA 62 MAP2 TGGCTCACTTGACAATGCTCAC TTGACCTGCTTGGCGACTGT 61 Arc CAAACAGGGCTCGGTGAAGAAC CTCCTCAGCGTCCACATACAGT 62.3 Primer Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Tm/°C 18SrRNA AAACGGCTACCACATCCA CTCATTCCAATTACAGGG 48 SYN GGACCTCCTGCTCAACAACGA TGCTGCTGTGGGACTTGGTAG 62.3 PSD-95 GTCAACACGGACACCCTAGAA TTGATCTCCATGACCTTTTCG 60 GAP-43 TGGCTCTGCTACTACCGATGC CTTGGAGGACGGCGAGTTATCA 62.3 SNAP-25 GAGCAGGTGAGCGGCATCAT GCACGTTGGTTGGCTTCATCA 62 MAP2 TGGCTCACTTGACAATGCTCAC TTGACCTGCTTGGCGACTGT 61 Arc CAAACAGGGCTCGGTGAAGAAC CTCCTCAGCGTCCACATACAGT 62.3 Abbreviations: SYN, synaptophysin; PSD-95, post synaptic density-95; MAP-2, microtubule-associated protein-2; SNAP-25, synaptosomal-associated protein 25; GAP-43, growth-associated protein-43; Arc, activity-regulated cytoskeleton-associated protein. TABLE. The Primer Sequences Used for Real-time PCR Primer Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Tm/°C 18SrRNA AAACGGCTACCACATCCA CTCATTCCAATTACAGGG 48 SYN GGACCTCCTGCTCAACAACGA TGCTGCTGTGGGACTTGGTAG 62.3 PSD-95 GTCAACACGGACACCCTAGAA TTGATCTCCATGACCTTTTCG 60 GAP-43 TGGCTCTGCTACTACCGATGC CTTGGAGGACGGCGAGTTATCA 62.3 SNAP-25 GAGCAGGTGAGCGGCATCAT GCACGTTGGTTGGCTTCATCA 62 MAP2 TGGCTCACTTGACAATGCTCAC TTGACCTGCTTGGCGACTGT 61 Arc CAAACAGGGCTCGGTGAAGAAC CTCCTCAGCGTCCACATACAGT 62.3 Primer Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Tm/°C 18SrRNA AAACGGCTACCACATCCA CTCATTCCAATTACAGGG 48 SYN GGACCTCCTGCTCAACAACGA TGCTGCTGTGGGACTTGGTAG 62.3 PSD-95 GTCAACACGGACACCCTAGAA TTGATCTCCATGACCTTTTCG 60 GAP-43 TGGCTCTGCTACTACCGATGC CTTGGAGGACGGCGAGTTATCA 62.3 SNAP-25 GAGCAGGTGAGCGGCATCAT GCACGTTGGTTGGCTTCATCA 62 MAP2 TGGCTCACTTGACAATGCTCAC TTGACCTGCTTGGCGACTGT 61 Arc CAAACAGGGCTCGGTGAAGAAC CTCCTCAGCGTCCACATACAGT 62.3 Abbreviations: SYN, synaptophysin; PSD-95, post synaptic density-95; MAP-2, microtubule-associated protein-2; SNAP-25, synaptosomal-associated protein 25; GAP-43, growth-associated protein-43; Arc, activity-regulated cytoskeleton-associated protein. Western Blot Analysis Primary hippocampal neurons were washed with ice-cold PBS (Hyclone, Logan, UT) and harvested and lysed using RIPA (Solarbio) buffer containing 1% phenylmethane sulfonyl fluoride (Solarbio) with vigorous shaking for 30 minutes at 4°C. The whole cell lysates were then centrifuged at 15 000g for 15 minutes at 4°C, and supernatant containing protein was collected for further analysis. The protein concentration was determined using a bicinchoninic acid assay kit (Dingguo Changsheng Biotechnology, Beijing, China). Protein samples (20 μg) were separated through electrophoresis on 10% sodium dodecyl sulfate polyacrylamide gels and transferred onto polyvinylidene fluoride membranes (Millipore, MA). These membranes were blocked with 5% (w/v) nonfat milk powder in Tris-buffered saline (TBS) containing 0.1% (v/v) Tween-20 (TBST) at room temperature for 1 hour. The membranes were subsequently incubated overnight at 4°C with the appropriate primary antibodies including anti-MAP2 (1:1000), anti-GAP-43 (1:50 000), anti-SYP (1:20 000), anti-PSD-95 (1:1000), anti-SNAP-25 (1:1000), and anti-Arc (1:1000). After washing with TBST, the membranes were incubated with appropriate secondary antibodies for 1 hour at room temperature. After rewashing with TBST, enhanced chemiluminescence was used for detection of the target protein and FluoChemFC2 (Alpha Innotech Corporation, San Leandro, CA) was used to take photos and analyze the gray value of protein expression in different groups. β-Actin was used as an internal control. The density of all the bands was quantified with Image J software and normalized based on the control group. Each experiment was repeated 3 times. Statistical Analysis Data analysis was performed with SPSS 18.0 (SPSS, Inc., Chicago, IL). Quantitative variables were tested for normality with Kolmogorov-Smirnov test. Normally distributed data are expressed as mean and standard deviation (mean ± SD). Differences among groups were compared using one-way analysis of variance (ANOVA) and post hoc comparisons were evaluated using the LSD-t test (Fisher's Least Significant Difference test). All the statistical tests were 2-sided and a significant level was set at p < 0.05. RESULTS The Effects of 27-OHC on Cell Viability The initial set of experiments was designed to investigate whether 27-OHC affects cell viability. Neuronal cells were exposed to a broad range of 27-OHC concentrations, and cell viability was quantified using the MTT assay and CCK-8 assay (Fig. 1A, B). Seven different concentrations (0.1, 0.3, 1, 3, 10, 30, and 100 μM) were employed to study the effects of 27-OHC-induced neuronal death. The results indicated that 27-OHC treatment ranging from 0.1 to 0.3 μM did not affect the cell viability. However, neurotoxic effects appeared at higher concentrations. From a higher concentration of 1 μM to the highest concentration of 100 μM, when compared to the control group, incubations with 27-OHC resulted in a significant reduction in viability (F = 32.610, p < 0.001 for MTT; F = 41.681, p < 0.001 for CCK-8). These findings demonstrated that significant impairment was induced when 27-OHC were left for 24 hours in the culture at doses higher than 1 μM whereas nontoxic effects of 27-OHC were observed at low concentration for neuronal primary cells. Therefore, we chose treatment concentration of 1–30 μM to identify the neurotoxic effects of 27-OHC in all subsequent experiments. FIGURE 1. View largeDownload slide The cell viability of primary hippocampal neurons cells of the control group and different treatment of 0.1, 0.3, 1, 3, 10, 30, and 100 μM 27-OHC groups by MTT (A) and CCK-8 (B). Data were shown as mean ± SD. *p < 0.05 compared with control group, **p < 0.01 compared with control group. FIGURE 1. View largeDownload slide The cell viability of primary hippocampal neurons cells of the control group and different treatment of 0.1, 0.3, 1, 3, 10, 30, and 100 μM 27-OHC groups by MTT (A) and CCK-8 (B). Data were shown as mean ± SD. *p < 0.05 compared with control group, **p < 0.01 compared with control group. The Effects of 27-OHC on Neurite Outgrowth in Hippocampal Neurons To test the effects of 27-OHC on neurite outgrowth, we performed immunofluorescence to investigate whether 27-OHC could regulate neurite morphology in hippocampal neurons. Cells were photographed and quantified neurite outgrowth induced by the application of different concentrations of 27-OHC (0–30 μM) at 10 days in vitro, at a stage where neurites mature by elongating and branching. The number of neurites, total neurite branch length, and terminal neurite branch length was measured after an additional 24 hours with treatment of 27-OHC. As shown in Figure 2A–C, incubation of neurons with 27-OHC (0–30 μM) for 24 hours resulted in a dose-dependent atrophy in neurite outgrowth, of which the neurite number was significantly decreased (F = 14.019, p < 0.001) and terminal neurite branch length (F = 114.488, p < 0.001) was significantly shorten, leading to a net atrophy of total neurite branch length (F = 27.350, p < 0.001). A similar pattern was also observed in Figure 3, which was stained by synaptic markers MAP2 for neurites. The cultured hippocampal neurons had very simple dendritic structure and reduced dendritic complexity after treatment of 27-OHC, indicating that 27-OHC contributes importantly to inhibition of neurite extension in hippocampal neurons. FIGURE 2. View largeDownload slide Total neurite branch length (A), the number of neurites (B), and terminal neurite branch length (C) in hippocampal neurons treated with 1, 3, 10, and 30 μM 27-OHC. All data are presented as the means ± SD. **p < 0.01 compared with the control group. #p < 0.05 compared with the 27-OHC 1 μM group; ##p < 0.01 compared with the 27-OHC 1 μM group. &&p < 0.01 compared with the 27-OHC 3 μM group. FIGURE 2. View largeDownload slide Total neurite branch length (A), the number of neurites (B), and terminal neurite branch length (C) in hippocampal neurons treated with 1, 3, 10, and 30 μM 27-OHC. All data are presented as the means ± SD. **p < 0.01 compared with the control group. #p < 0.05 compared with the 27-OHC 1 μM group; ##p < 0.01 compared with the 27-OHC 1 μM group. &&p < 0.01 compared with the 27-OHC 3 μM group. FIGURE 3. View largeDownload slide Neurite outgrowth of primary hippocampal neurons in different groups by inverted fluorescence microscope (×200) and the merged images of MAP2 and DAPI (scale bar = 10 μm). FIGURE 3. View largeDownload slide Neurite outgrowth of primary hippocampal neurons in different groups by inverted fluorescence microscope (×200) and the merged images of MAP2 and DAPI (scale bar = 10 μm). The Effects of 27-OHC on Ultrastructure of Synapses in Hippocampal Neurons The pathological features of ultrastructure of synapse in hippocampus were observed with TEM. Representative TEM images of the control group and 27-OHC-exposed group are shown in Figure 4, respectively. In the control group, normal synapse ultrastructure was observed: a clear synaptic cleft and postsynaptic density (PSD) in the postsynaptic membrane (Fig. 4A). However, the thickness of PSD in the synapses decreased after 30 μM 27-OHC treatment (Fig. 4B). These results suggested that 27-OHC treatment-induced reduction of synaptic transmission. FIGURE 4. View largeDownload slide The ultrastructure of synapses on electron micrograph (×10 000) in the hippocampal neurons with or without 27-OHC treatment. The position of the thickness of PSD is indicated by white arrow. (A) Electron micrograph from control group. (B) Electron micrograph from 30 μM 27-OHC treatment group demonstrating the thinner postsynaptic density in comparison to control group. FIGURE 4. View largeDownload slide The ultrastructure of synapses on electron micrograph (×10 000) in the hippocampal neurons with or without 27-OHC treatment. The position of the thickness of PSD is indicated by white arrow. (A) Electron micrograph from control group. (B) Electron micrograph from 30 μM 27-OHC treatment group demonstrating the thinner postsynaptic density in comparison to control group. The Effects of 27-OHC on Expression of Synaptic Proteins We reasoned that the reduction on cell viability after the treatment with 27-OHC should be accompanied by changes in the machinery responsible for neurotransmission, including synaptic proteins. Therefore, we selected SYP, PSD-95, SNAP-25, GAP-43, MAP2, and Arc as representative protein markers that represented pre and postsynaptic function to explore the differential expression profile of synaptic proteins, on both mRNA transcription (Fig. 5) and protein levels (Figs. 6 and 7) in neuronal cultures incubated with different concentrations of 27-OHC (up to 30 μM) for 24 hours. We found that the mRNA and protein levels of all the synaptic proteins were significantly downregulated (p < 0.001) in the presence of 27-OHC in a concentration-dependent manner. FIGURE 5. View largeDownload slide The mRNA levels of SYN (A), PSD-95 (B), GAP-43 (C), SNAP-25 (D), MAP2 (E), and Arc (F) in hippocampal neurons treated with 1, 3, 10, and 30 μM 27-OHC. Untreated cells were taken as control. All data are presented as the means ± SE. *p < 0.05 compared with the control group; **p < 0.01 compared with the control group. #p < 0.05 compared with the 27-OHC 1 μM group; ##p < 0.01 compared with the 27-OHC 1 μM group. &p < 0.05 compared with the 27-OHC 3 μM group; &&p < 0.01 compared with the 27-OHC 3 μM group. FIGURE 5. View largeDownload slide The mRNA levels of SYN (A), PSD-95 (B), GAP-43 (C), SNAP-25 (D), MAP2 (E), and Arc (F) in hippocampal neurons treated with 1, 3, 10, and 30 μM 27-OHC. Untreated cells were taken as control. All data are presented as the means ± SE. *p < 0.05 compared with the control group; **p < 0.01 compared with the control group. #p < 0.05 compared with the 27-OHC 1 μM group; ##p < 0.01 compared with the 27-OHC 1 μM group. &p < 0.05 compared with the 27-OHC 3 μM group; &&p < 0.01 compared with the 27-OHC 3 μM group. FIGURE 6. View largeDownload slide Representative Western blots illustrating expression of SYN, PSD-95, SNAP-25, Arc, MAP2, and GAP-43 with 1, 3, 10, and 30 μM 27-OHC. Untreated cells were taken as control. Measurements were normalized with the β-actin blots. FIGURE 6. View largeDownload slide Representative Western blots illustrating expression of SYN, PSD-95, SNAP-25, Arc, MAP2, and GAP-43 with 1, 3, 10, and 30 μM 27-OHC. Untreated cells were taken as control. Measurements were normalized with the β-actin blots. FIGURE 7. View largeDownload slide The protein levels of SYN (A), PSD-95 (B), GAP-43 (C), SNAP-25 (D), MAP2 (E), and Arc (F) in hippocampal neurons treated with 1, 3, 10, and 30 μM 27-OHC. Untreated cells were taken as control. All data are presented as the means ± SE. *p < 0.05 compared with the control group; **p < 0.01 compared with the control group. #p < 0.05 compared with the 27-OHC 1 μM group; ##p < 0.01 compared with the 27-OHC 1 μM group. &p < 0.05 compared with the 27-OHC 3 μM group; §p < 0.05 compared with the 27-OHC 10 μM group. FIGURE 7. View largeDownload slide The protein levels of SYN (A), PSD-95 (B), GAP-43 (C), SNAP-25 (D), MAP2 (E), and Arc (F) in hippocampal neurons treated with 1, 3, 10, and 30 μM 27-OHC. Untreated cells were taken as control. All data are presented as the means ± SE. *p < 0.05 compared with the control group; **p < 0.01 compared with the control group. #p < 0.05 compared with the 27-OHC 1 μM group; ##p < 0.01 compared with the 27-OHC 1 μM group. &p < 0.05 compared with the 27-OHC 3 μM group; §p < 0.05 compared with the 27-OHC 10 μM group. DISCUSSION As a typical pathological hallmark of AD, synaptic loss is correlated with cognitive impairment (36, 37). The pathogenesis of synaptic damage in AD is characterized by loss of plasticity accompanied with aberrant sprouting and neuritic disorganization, which fails to maintain synaptic connectivity and eventually results in loss of synapse and neurodegeneration (38). Cholesterol is an essential cell membrane component that was involved in the function and stability of synapse (39, 40). Several studies have shown that dietary cholesterol altered memory and synaptic structural and functional plasticity by animal experiments (41, 42). It is tempting to speculate that the dysregulated metabolism of 27-OHC might be part of the mechanism linking hypercholesterolemia and cognitive impairment based on accumulating evidence, which has demonstrated that higher levels of 27-OHC had cytotoxic, pro-oxidant, pro-inflammatory, and pro-amyloidogenic effects (19, 43, 44). However, the direct effect of 27-OHC on synaptic plasticity has not been investigated. In this study, how excess levels of 27-OHC might mediate the synaptic mechanisms responsible for neurodegeneration was demonstrated in vitro for the first time. In this study, 27-OHC treatment was shown to significantly reduce cell viability in a dose-dependent manner over a dose of 1 μM, which is similar to that of the mammalian brain (45). On the physiological level in the order of micromoles, 27-OHC is part of a complex regulatory molecule involving cholesterol metabolism. However, 27-OHC concentrations have been shown to be elevated in brains of AD patients and reach the millimolar range in atherosclerosis (46). The development of pathological hallmarks of AD may be triggered or exacerbated by increased 27-OHC levels. To circumvent endocrine 27-OHC effects, we used an in vitro system with primary murine hippocampal cultures. In addition to the data we present here, we have also demonstrated that 5, 10, and 20 μM 27-OHC significantly decreased cell viability and induce cytotoxicity in C6 rat glioma cell line (18) and human neuroblastoma cells SH-SY5Y (47). Nevertheless, in all previous investigations on the cytotoxic effects of 27-OH, relatively higher oxysterol concentrations were used. In this study, 27-OHC was adopted with a broader concentration range including the proximal concentration in AD brains. Moreover, using primary hippocampal neurons is a more convenient experimental model than undifferentiated neuroblastoma cells, since primary neurons accompanied with the many morphologic and biochemical features are quite similar to normal “neuronal” cells (48). It has been reported that neuronal morphology and formation of synaptic contacts between neurons are important cellular mechanisms responsible for long-term memory formation (49). The large numbers of neurites with multiple branches promote a complex network. In this study, 27-OHC significantly reduced neurite outgrowth in a dose-dependent manner, which may destroy the basal requirement for memory formation by suppressing the ability to form neuronal networks. The cultured neurons after treatment with 27-OHC have very simple neurite structure with fewer branches stained by MAP2. Since long-term memory formation is structurally associated with synapse, the neurite outgrowth-inhibiting effect of 27-OHC may reduce the neuronal connectivity and be detrimental to memory. Moreover, we studied the ultrastructure of synapses in hippocampus, the morphological base for memory, by TEM, as synaptic morphology changes were accompanied with changes in synaptic strength. PSD is a microscopic structure containing various scaffolding and signaling proteins and it is located beneath the postsynaptic membrane of synapses. The PSD includes a variety of receptors, channels, and signaling molecules which couple synaptic activity with postsynaptic biochemistry (50). PSD thickness was measured as microstructural parameters representing synaptic structural plasticity. In our study, decreased PSD thickness in the 30 μM 27-OHC group may have reduced signal transduction across the synaptic membrane, owing to the fact that a thinner PSD indicates a decrease in synaptic strength. Therefore, we have demonstrated important changes in the synaptic structural plasticity induced by 27-OHC treatment in this work. We also demonstrated that treatment with 27-OHC caused significant downregulation of several key synaptic proteins, whose decreased levels may be responsible for the impairment of memory exhibited in AD owing to synaptic modification and memory consolidation (51). These proteins, which are widely present at pre and postsynaptic membranes and vesicles, are thought to play important roles in the transfer, docking, and content release of synaptic vesicles; this correlates with learning and memory abilities (50, 52–55). Downregulated expression of synaptic proteins as determined by real-time PCR and Western blot was consistent with reduced intensity of MAP2 staining detected by immunofluorescence and the decrease in the thickness of PSD observed by TEM, presenting both morphological and functional consequences. In agreement with our results, Mateos et al (23) have demonstrated that Arc protein was downregulated by high fat diet in vivo and by 27-OHC in vitro, proposing that Arc downregulation caused by 27-OHC may be one of the mechanisms by which hypercholesterolemia contributes to neurodegenerative diseases. Furthermore, brains of deceased AD patients, as well as transgenic mice models for AD, had significantly higher levels of 27-OHC (45). In addition, it has been suggested that the risk of developing AD can be lowered by inhibiting cholesterol synthesis with statins (56). Simultaneously, Jin et al (27) have shown that atorvastatin, a cholesterol-lowering agent, may positively influence synaptic plasticity by promoting formation of neurites in cultured cortical neurons, thereby diminishing AD-like pathology. Taken together, our results further provided evidence that 27-OHC may be a negative additive factor in AD pathology, including the disruption of key synaptic proteins responsible for synaptic plasticity. We acknowledge several limitations of this study. First, there is underlying species difference in primary rodent and human neurons response to oxysterols (57). Therefore, interpretation of the results for this study should be done with caution since comparisons need to be made using both primary neurons. Second, the downregulated expression of synaptic proteins is not enough to elucidate mechanisms of the observed effects on 27-OHC on synaptic plasticity and the structural study of synapses was also limited. Further work is needed to more fully define the molecular pathways and more sophisticated structural elements should be evaluated. Nevertheless, our results support the hypothesis of a correlation between cholesterol and AD that may be mediated by 27-OHC. In conclusion, we found that 27-OHC dose-dependently affected synaptic structural and functional plasticity in rat hippocampal neuronal cultures, with a cellular mechanism possibly involving reduced cell viability, impaired neurite outgrowth, a permanent change of synaptic ultrastructure together with downregulated pre and postsynaptic proteins. Our results support a possible link between excessive 27-OHC and disruption of synaptic plasticity, which could be part of the mechanisms behind the relationship between hypercholesterolemia and AD. This work was supported by the State Key Program of the National Natural Science Foundation of China (Grant No. 81330065) and National Natural Science Foundation of China (Grant No. 81673149). Footnotes The authors have no duality or conflicts of interest to declare. REFERENCES 1 Brewster P , Barnes L , Haan M , et al. . Progress and future challenges in aging and diversity research in the United States . Alzheimers Dement 2018 ;pii: S1552-5260(18)33494-0. doi: 10.1016/j.jalz.2018.07.221. [Epub ahead of print] 2 Rajan KB , Weuve J , Barnes LL , et al. . Prevalence and incidence of clinically diagnosed Alzheimer's disease dementia from 1994 to 2012 in a population study. Alzheimers Dement 2019;15:1–7 3 Kivipelto M , Mangialasche F , Ngandu T. Lifestyle interventions to prevent cognitive impairment, dementia and Alzheimer disease . Nat Rev Neurol 2018 ; 14 : 653 – 66 Google Scholar Crossref Search ADS PubMed 4 Blom K , Emmelot-Vonk MH , Koek HL. The influence of vascular risk factors on cognitive decline in patients with dementia: A systematic review . Maturitas 2013 ; 76 : 113 – 7 Google Scholar Crossref Search ADS PubMed 5 Ren L , Bai L , Wu Y , et al. . Prevalence of and risk factors for cognitive impairment among elderly without cardio- and cerebrovascular diseases: A population-based study in Rural China . Front Aging Neurosci 2018 ; 10 : 62 Google Scholar Crossref Search ADS PubMed 6 Peng SL , Chen X , Li Y , et al. . Age-related changes in cerebrovascular reactivity and their relationship to cognition: A four-year longitudinal study . Neuroimage 2018 ; 174 : 257 – 62 Google Scholar Crossref Search ADS PubMed 7 Gonzalez HM , Tarraf W , Harrison K , et al. . Midlife cardiovascular health and 20-year cognitive decline: Atherosclerosis Risk in Communities Study results . Alzheimers Dement 2018 ; 14 : 579 – 89 Google Scholar Crossref Search ADS PubMed 8 Anstey KJ , Ashby-Mitchell K , Peters R. Updating the evidence on the association between serum cholesterol and risk of late-life dementia: Review and meta-analysis . JAD 2017 ; 56 : 215 – 28 Google Scholar Crossref Search ADS PubMed 9 Sun JH , Yu JT , Tan L. The role of cholesterol metabolism in Alzheimer’s disease . Mol Neurobiol 2015 ; 51 : 947 – 65 Google Scholar Crossref Search ADS PubMed 10 Refolo LM , Malester B , LaFrancois J , et al. . Hypercholesterolemia accelerates the Alzheimer’s amyloid pathology in a transgenic mouse model . Neurobiol Dis 2000 ; 7 : 321 – 31 Google Scholar Crossref Search ADS PubMed 11 Arenas F , Garcia-Ruiz C , Fernandez-Checa JC. Intracellular cholesterol trafficking and impact in neurodegeneration . Front Mol Neurosci 2017 ; 10 : 382 Google Scholar Crossref Search ADS PubMed 12 Nam KN , Mounier A , Wolfe CM , et al. . Effect of high fat diet on phenotype, brain transcriptome and lipidome in Alzheimer’s model mice . Sci Rep 2017 ; 7 : 4307 Google Scholar Crossref Search ADS PubMed 13 Bjorkhem I , Meaney S. Brain cholesterol: Long secret life behind a barrier . Arterioscler Thromb Vasc Biol 2004 ; 24 : 806 – 15 Google Scholar Crossref Search ADS PubMed 14 Bjorkhem I , Cedazo-Minguez A , Leoni V , et al. . Oxysterols and neurodegenerative diseases . Mol Aspects Med 2009 ; 30 : 171 – 9 Google Scholar Crossref Search ADS PubMed 15 Brown AJ , Jessup W. Oxysterols: Sources, cellular storage and metabolism, and new insights into their roles in cholesterol homeostasis . Mol Aspects Med 2009 ; 30 : 111 – 22 Google Scholar Crossref Search ADS PubMed 16 Poli G , Sottero B , Gargiulo S , et al. . Cholesterol oxidation products in the vascular remodeling due to atherosclerosis . Mol Aspects Med 2009 ; 30 : 180 – 9 Google Scholar Crossref Search ADS PubMed 17 Vejux A , Lizard G. Cytotoxic effects of oxysterols associated with human diseases: Induction of cell death (apoptosis and/or oncosis), oxidative and inflammatory activities, and phospholipidosis . Mol Aspects Med 2009 ; 30 : 153 – 70 Google Scholar Crossref Search ADS PubMed 18 An Y , Zhang DD , Yu HL , et al. . 27-Hydroxycholesterol regulates cholesterol synthesis and transport in C6 glioma cells . Neurotoxicology 2017 ; 59 : 88 – 97 Google Scholar Crossref Search ADS PubMed 19 Ma WW , Li CQ , Yu HL , et al. . The oxysterol 27-hydroxycholesterol increases oxidative stress and regulate Nrf2 signaling pathway in astrocyte cells . Neurochem Res 2015 ; 40 : 758 – 66 Google Scholar Crossref Search ADS PubMed 20 Heverin M , Meaney S , Lutjohann D , et al. . Crossing the barrier: Net flux of 27-hydroxycholesterol into the human brain . J Lipid Res 2005 ; 46 : 1047 – 52 Google Scholar Crossref Search ADS PubMed 21 Shafaati M , Marutle A , Pettersson H , et al. . Marked accumulation of 27-hydroxycholesterol in the brains of Alzheimer’s patients with the Swedish APP 670/671 mutation . J Lipid Res 2011 ; 52 : 1004 – 10 Google Scholar Crossref Search ADS PubMed 22 Heverin M , Maioli S , Pham T , et al. . 27-Hydroxycholesterol mediates negative effects of dietary cholesterol on cognition in mice . Behav Brain Res 2015 ; 278 : 356 – 9 Google Scholar Crossref Search ADS PubMed 23 Mateos L , Akterin S , Gil-Bea FJ , et al. . Activity-regulated cytoskeleton-associated protein in rodent brain is down-regulated by high fat diet in vivo and by 27-hydroxycholesterol in vitro . Brain Pathol 2009 ; 19 : 69 – 80 Google Scholar Crossref Search ADS PubMed 24 Brooks SW , Dykes AC , Schreurs BG. A high-cholesterol diet increases 27-hydroxycholesterol and modifies estrogen receptor expression and neurodegeneration in rabbit hippocampus . J Alzheimers Dis 2017 ; 56 : 185 – 96 Google Scholar Crossref Search ADS PubMed 25 Seo MK , Lee CH , Cho HY , et al. . Effects of antidepressant drugs on synaptic protein levels and dendritic outgrowth in hippocampal neuronal cultures . Neuropharmacology 2014 ; 79 : 222 – 33 Google Scholar Crossref Search ADS PubMed 26 Mattson MP. Pathways towards and away from Alzheimer’s disease . Nature 2004 ; 430 : 631 – 9 Google Scholar Crossref Search ADS PubMed 27 Jin Y , Sui HJ , Dong Y , et al. . Atorvastatin enhances neurite outgrowth in cortical neurons in vitro via up-regulating the Akt/mTOR and Akt/GSK-3beta signaling pathways . Acta Pharmacol Sin 2012 ; 33 : 861 – 72 Google Scholar Crossref Search ADS PubMed 28 Matsuo N , Reijmers L , Mayford M. Spine-type-specific recruitment of newly synthesized AMPA receptors with learning . Science 2008 ; 319 : 1104 – 7 Google Scholar Crossref Search ADS PubMed 29 Xu T , Yu X , Perlik AJ , et al. . Rapid formation and selective stabilization of synapses for enduring motor memories . Nature 2009 ; 462 : 915 – 9 Google Scholar Crossref Search ADS PubMed 30 Yang G , Pan F , Gan WB. Stably maintained dendritic spines are associated with lifelong memories . Nature 2009 ; 462 : 920 – 4 Google Scholar Crossref Search ADS PubMed 31 Babic M , Zinsmaier KE. Memory, synapse stability, and beta-adducin . Neuron 2011 ; 69 : 1039 – 41 Google Scholar Crossref Search ADS PubMed 32 Holtmaat A , Svoboda K. Experience-dependent structural synaptic plasticity in the mammalian brain . Nat Rev Neurosci 2009 ; 10 : 647 – 58 Google Scholar Crossref Search ADS PubMed 33 Boleman SL , Graf TL , Mersmann HJ , et al. . Pigs fed cholesterol neonatally have increased cerebrum cholesterol as young adults . J Nutr 1998 ; 128 : 2498 – 504 Google Scholar Crossref Search ADS PubMed 34 Koudinov AR , Koudinova NV. Essential role for cholesterol in synaptic plasticity and neuronal degeneration . FASEB J 2001 ; 15 : 1858 – 60 Google Scholar Crossref Search ADS PubMed 35 Sparks DL , Martin TA , Gross DR , et al. . Link between heart disease, cholesterol, and Alzheimer’s disease: A review . Microsc Res Tech 2000 ; 50 : 287 – 90 Google Scholar Crossref Search ADS PubMed 36 DeKosky ST , Scheff SW , Styren SD. Structural correlates of cognition in dementia: Quantification and assessment of synapse change . Neurodegeneration 1996 ; 5 : 417 – 21 Google Scholar Crossref Search ADS PubMed 37 Scheff SW , Price DA , Schmitt FA , et al. . Hippocampal synaptic loss in early Alzheimer’s disease and mild cognitive impairment . Neurobiol Aging 2006 ; 27 : 1372 – 84 Google Scholar Crossref Search ADS PubMed 38 Jansen D , Janssen CI , Vanmierlo T , et al. . Cholesterol and synaptic compensatory mechanisms in Alzheimer’s disease mice brain during aging . JAD 2012 ; 31 : 813 – 26 Google Scholar Crossref Search ADS PubMed 39 Petrov AM , Kasimov MR , Zefirov AL. Brain cholesterol metabolism and its defects: Linkage to neurodegenerative diseases and synaptic dysfunction . Acta Nat 2016 ; 8 : 58 – 73 40 Ya BL , Liu WY , Ge F , et al. . Dietary cholesterol alters memory and synaptic structural plasticity in young rat brain . Neurol Sci 2013 ; 34 : 1355 – 65 Google Scholar Crossref Search ADS PubMed 41 Dufour F , Liu QY , Gusev P , et al. . Cholesterol-enriched diet affects spatial learning and synaptic function in hippocampal synapses . Brain Res 2006 ; 1103 : 88 – 98 Google Scholar Crossref Search ADS PubMed 42 Wang D , Zheng W. Dietary cholesterol concentration affects synaptic plasticity and dendrite spine morphology of rabbit hippocampal neurons . Brain Res 2015 ; 1622 : 350 – 60 Google Scholar Crossref Search ADS PubMed 43 Bjorkhem I , Heverin M , Leoni V , et al. . Oxysterols and Alzheimer’s disease . Acta Neurol Scand Suppl 2006 ; 185 : 43 – 9 Google Scholar Crossref Search ADS PubMed 44 Gamba P , Guglielmotto M , Testa G , et al. . Up-regulation of beta-amyloidogenesis in neuron-like human cells by both 24- and 27-hydroxycholesterol: Protective effect of N-acetyl-cysteine . Aging Cell 2014 ; 13 : 561 – 72 Google Scholar Crossref Search ADS PubMed 45 Heverin M , Bogdanovic N , Lutjohann D , et al. . Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer’s disease . J Lipid Res 2004 ; 45 : 186 – 93 Google Scholar Crossref Search ADS PubMed 46 Brown AJ , Jessup W. Oxysterols and atherosclerosis . Atherosclerosis 1999 ; 142 : 1 – 28 Google Scholar Crossref Search ADS PubMed 47 Wang H , Yuan L , Ma W , et al. . The cytotoxicity of 27-hydroxycholesterol in co-cultured SH-SY5Y cells and C6 cells . Neurosci Lett 2016 ; 632 : 209 – 17 Google Scholar Crossref Search ADS PubMed 48 Redova M , Chlapek P , Loja T , et al. . Influence of LOX/COX inhibitors on cell differentiation induced by all-trans retinoic acid in neuroblastoma cell lines . Int J Mol Med 2010 ; 25 : 271 – 80 Google Scholar PubMed 49 Hensel N , Schon A , Konen T , et al. . Fibroblast growth factor 23 signaling in hippocampal cells: Impact on neuronal morphology and synaptic density . J Neurochem 2016 ; 137 : 756 – 69 Google Scholar Crossref Search ADS PubMed 50 Chen X , Nelson CD , Li X , et al. . PSD-95 is required to sustain the molecular organization of the postsynaptic density . J Neurosci 2011 ; 31 : 6329 – 38 Google Scholar Crossref Search ADS PubMed 51 Park SW , Seo MK , McIntyre RS , et al. . Effects of olanzapine and haloperidol on mTORC1 signaling, dendritic outgrowth, and synaptic proteins in rat primary hippocampal neurons under toxic conditions . Neurosci Lett 2018 ; 686 : 59 – 66 Google Scholar Crossref Search ADS PubMed 52 McIntyre CK , Miyashita T , Setlow B , et al. . Memory-influencing intra-basolateral amygdala drug infusions modulate expression of Arc protein in the hippocampus . Proc Natl Acad Sci U S A 2005 ; 102 : 10718 – 23 Google Scholar Crossref Search ADS PubMed 53 Mullany PM , Lynch MA. Evidence for a role for synaptophysin in expression of long-term potentiation in rat dentate gyrus . Neuroreport 1998 ; 9 : 2489 – 94 Google Scholar Crossref Search ADS PubMed 54 Low P , Norlin T , Risinger C , et al. . Inhibition of neurotransmitter release in the lamprey reticulospinal synapse by antibody-mediated disruption of SNAP-25 function . Eur J Cell Biol 1999 ; 78 : 787 – 93 Google Scholar Crossref Search ADS PubMed 55 Yan XX , Cai Y , Zhang XM , et al. . BACE1 elevation is associated with aberrant limbic axonal sprouting in epileptic CD1 mice . Exp Neurol 2012 ; 235 : 228 – 37 Google Scholar Crossref Search ADS PubMed 56 Geifman N , Brinton RD , Kennedy RE , et al. . Evidence for benefit of statins to modify cognitive decline and risk in Alzheimer’s disease . Alzheimers Res Ther 2017 ; 9 : 10 Google Scholar Crossref Search ADS PubMed 57 Kim WS , Chan SL , Hill AF , et al. . Impact of 27-hydroxycholesterol on amyloid-beta peptide production and ATP-binding cassette transporter expression in primary human neurons . J Alzheimers Dis 2009 ; 16 : 121 – 31 Google Scholar Crossref Search ADS PubMed © 2019 American Association of Neuropathologists, Inc. All rights reserved. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - 27-Hydroxycholesterol Alters Synaptic Structural and Functional Plasticity in Hippocampal Neuronal Cultures
JF - Journal of Neuropathology & Experimental Neurology
DO - 10.1093/jnen/nlz002
DA - 2019-03-01
UR - https://www.deepdyve.com/lp/oxford-university-press/27-hydroxycholesterol-alters-synaptic-structural-and-functional-ozzdXPrLAO
SP - 238
VL - 78
IS - 3
DP - DeepDyve
ER -