TY - JOUR
AU - Cao,, Bing
AB - Abstract Cervical cancer is one of the most common cancers in the world while its pathological mechanisms are not well-elucidated. Long non-coding RNA (lncRNA) has been implicated in cancer development. The dysregulation of lncRNA myocardial infarction-associated transcript (MIAT) has been reported in several cancers while its role in cervical cancer is not described yet. In this study, the role of MIAT in cervical cancer was explored. We evaluated the expression of MIAT in cervical cancer tissues and cell lines. Furthermore, we explored the effects of MIAT on proliferation and invasion of cervical cancer using cell model and animal transplantation model. We also evaluated the effects of MIAT on activation of PI3K/Akt/mTOR signalling pathway. Our results show that MIAT was up-regulated in cervical cancer tissues and cell lines. Knocking down MIAT resulted in decreased cell proliferation, migration and invasion of cervical cancer cells and suppression of tumour growth in mice. Mechanically, knocking down MIAT suppressed the activation of PI3K/Akt signalling pathway. In conclusion, MIAT promotes cell proliferation and invasion in cervical cancer. cervical cancer, long non-coding RNA, MIAT, proliferation Cervical cancer, a type of cancers occurs in the cells of the cervix, is the third most common cancer in women (1). Cervical cancer is one of major causes of death in female and threatens the women’s health. Understanding the progression and development of cervical cancer could provide useful information for prevention and treatment of this disease. Persistent human papillomavirus (HPV) infection is one major risk factor for cervical cancer. HPV oncoproteins E6 and E7 could inactive and degrade tumour suppressor p53 and retinoblastoma and result in deregulation of cell cycle and chromosomal aberrations and mutations, which are the major drivers of cervical cancer (2). Therefore, searching for reagents which could prevent cell proliferation in cervical cancer has been focussed (3–5). Long non-coding RNAs (lncRNAs) are RNAs with length more than 200 nucleotides but they are not translated into protein (6). RNA Polymerase II is responsible for the transcription of major lncRNAs and the expression of lncRNAs is cell type specific. LncRNA has been shown to regulate gene expression by multiple mechanisms including epigenetic silencing, mRNA splicing and lncRNA–miRNA interaction (7, 8). LncRNAs are implicated in multiple biological functions including DNA damage, apoptosis, cell development and cancer development (9). Dysregulation of lncRNAs has been described in various types of cancers. For example, overexpression of lncRNA MALAT1 was found in non-small cell lung cancer (NSCLC) patients (10). Depletion of MALAT1 in lung carcinoma cells resulted in impaired cell motility and metastasis in mice (11). Recently, the dysregulation of lncRNA Myocardial infarction-associated transcript (MIAT) was found in various diseases including myocardial infarction (MI) (12), ischaemic stroke (13) and cataract (14). For example, in an epidemiological study, Ishii et al. (12) analysed 52,608 haplotype-based single-nucleotide polymorphism (SNP) markers and identified that SNPs in MIAT was associated with MI. More interestingly, up-regulated MIAT was identified in several cancers, such as NSCLC (15), neuroendocrine prostate cancer (16) and chronic lymphocytic leukaemia (17). MIAT could promote cell invasion of NSCLC by promoting zinc finger E-box binding homeobox 1 expression by sponging miRNA-150 (15). Until now, the precise role of MIAT in cervical cancer is not described and the possible underlying mechanism is not elucidated. In this study, we explored the effects of MIAT on cervical cancer. Materials and Methods Clinical samples In total, 64 pairs of cervix cancer (CC) tissues and adjacent non-tumour tissues were isolated from CC patients at the Liaocheng people’s Hospital. Prior to surgery, all the patients did not receive any chemotherapy or radiotherapy. The Federation International of Gynecology and Obstetrics (FIGO) staging system was used for sample staging, which was confirmed by a senior pathologist. This study was approved by Liaocheng people’s Hospital. Written informed consent was obtained from each participant. The clinicopathological factors in cervical cancer were summarized in Table I. Table I. LncRNA MIAT expression and clinicopathological factors in cervical cancer patients (n = 64) Variable . MIAT . P-value . Low expression (n = 29) . High expression (n = 35) . Age (years)  <50 12 14 1.0000  ≥50 17 21 Tumour size (maximum diameters)  <4 cm 20 11 0.0053  ≥4 cm 9 24 Histology  Squamous 19 23 0.3402  Adenocarcinoma 10 12 FIGO stage  Ib–IIa 16 10 0.0420  IIb–IIIa 13 25 Lymph node metastasis  No 19 11 0.0114  Yes 10 24 Variable . MIAT . P-value . Low expression (n = 29) . High expression (n = 35) . Age (years)  <50 12 14 1.0000  ≥50 17 21 Tumour size (maximum diameters)  <4 cm 20 11 0.0053  ≥4 cm 9 24 Histology  Squamous 19 23 0.3402  Adenocarcinoma 10 12 FIGO stage  Ib–IIa 16 10 0.0420  IIb–IIIa 13 25 Lymph node metastasis  No 19 11 0.0114  Yes 10 24 Chi-square test. Bold numbers mean p value less than 0.05. Open in new tab Table I. LncRNA MIAT expression and clinicopathological factors in cervical cancer patients (n = 64) Variable . MIAT . P-value . Low expression (n = 29) . High expression (n = 35) . Age (years)  <50 12 14 1.0000  ≥50 17 21 Tumour size (maximum diameters)  <4 cm 20 11 0.0053  ≥4 cm 9 24 Histology  Squamous 19 23 0.3402  Adenocarcinoma 10 12 FIGO stage  Ib–IIa 16 10 0.0420  IIb–IIIa 13 25 Lymph node metastasis  No 19 11 0.0114  Yes 10 24 Variable . MIAT . P-value . Low expression (n = 29) . High expression (n = 35) . Age (years)  <50 12 14 1.0000  ≥50 17 21 Tumour size (maximum diameters)  <4 cm 20 11 0.0053  ≥4 cm 9 24 Histology  Squamous 19 23 0.3402  Adenocarcinoma 10 12 FIGO stage  Ib–IIa 16 10 0.0420  IIb–IIIa 13 25 Lymph node metastasis  No 19 11 0.0114  Yes 10 24 Chi-square test. Bold numbers mean p value less than 0.05. Open in new tab Cell culture Human cervical epithelial cells H8, human cervical cancer cells SiHa, CaSki, HeLa and C33A cells were purchased from ATCC (Gaithersburg, MD, USA) and maintained in Dulbecco's Modified Eagle Medium containing 10% inactive foetal bovine serum (FBS, Gibco, Grand Island, NY, USA), 100 U/ml penicillin and 100 U/ml streptomycin (Thermo Fisher, Waltham, MA, USA). Lentivirus transduction Lentivirus encoding MIAT short hairpin RNA (shRNA) and control empty vector were purchased from Genepharma (Beijing, China). For transduction, H8, CaSki and SiHa cells were seeded in 6-well plates. Next day when the cell confluence became 80–90%, the cells were transduced with lentivirus with multiplicity of infection (MOI) = 20, together with 8 µg/ml hexadimethrine bromide (Sigma, St Louis, MO, USA). Forty-eight hours post-transduction, cells were harvested for further analysis. Cell counting kit-8 assay Cell proliferation was evaluated by using Cell counting kit-8 (CCK-8) assay (Dojindo, Tokyo, Japan). Briefly, H8, CaSki and SiHa cells were seeded in 96-well plate and cultured overnight. Next day, the cells were transduced with lentivirus expressing MIAT shRNA or control lentivirus. Forty-eight hours post-transduction, 100 µl/ml medium CCK-8 reagent was added to each well. The absorbance was read 2 h post-incubation at 450 nm in a microplate reader (Thermo Fisher). Colony formation assay Transduced cervical CaSki and SiHa cells were planted in 6-well plates (1,000 cells/well) and cultured for an additional 2 weeks. Then cells were fixed with methanol, stained with crystal violet and counted. Cell migration assays Cell invasion was performed using 24-well transwell plates with 8 µm pore Matrigel-coated membrane (Corning Inc, Corning, NY). Briefly, lentivirus-transduced CaSki, SiHa or C33A cells in serum-free medium were seeded into the upper chambers. Complete medium containing 20% FBS was added to the lower chambers. Forty-eight hours post-incubation, the cells on the top surface of the membrane were removed by a cotton swab, the cells on the bottom surface of the membrane were fixed with methanol, stained with crystal violet and then counted under microscope. Wound-healing assay For wound-healing assay, lentivirus-transduced CaSki, SiHa or C33A cells were grown in 6-well plates. When the cell confluence reached >90%, the cell monolayer was scratched using a 200 µl tip. Phosphate-buffered saline was used to wash away the cell debris. After wash, cells were further cultured in medium containing 2% FBS. Forty-eight hours later, representative pictures were taken and wound distance were measured. Quantitative real-time (qRT) PCR Total RNA was extracted from cells and tumour tissues using Trizol reagent (Thermo Fisher). Reverse transcription was performed using real-time (RT)-PCR cDNA Synthesis Kits to synthesize cDNA (Thermo Fisher). SYBR Green PCR Master Mix (Thermo Fisher) was used for quantitative PCR which was performed on QuantStudio™ 3 RT-PCR System. RNU6B was used as the endogenous internal control for miRNA. glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control for gene expression. Primers used for RT-PCR were MIAT Forward: 5′-TCCCATTCCCGGAAGCTAGA-3′; Reverse: 5′-ATGCTATCACCTCCCCTGTGTG-3′. RNU6B Forward: 5′- GCTTCGGCAGCACATATACTAAAAT-3′; Reverse: 5′- CGCTTCACG AATTTGCGTGTCAT-3′. Ki67 Forward: 5′-ACGCCTGGTTACTATCAAAAGG-3′; Reverse: 5′-CAGACCCATTTACTTGTGTTGGA-3′. Proliferating cell nuclear antigen (PCNA) Forward: 5′-CCTGCTGGGATATTAGCTC CA-3′; Reverse: 5′-CAGCGGTAGGTGTCGAAGC-3′. GAPDH Forward: 5′- AAGTTCAAC GGCACAGTCAAGG-3′, Reverse: 5′- CATACTCAGCACCAGCATCACC -3′. Western blot Total proteins from lentivirus-transduced CaSki and SiHa cells were extracted using protein extraction kit (Thermo Fisher). Proteins were loaded onto sodium dodecyl sulphate gel and transferred to polyvinylidene fluoride membrane. After blocked with 5% non-fat milk at room temperature for 1 h, membranes were incubated with primary antibodies overnight at 4°C. Primary antibodies used in this study were anti-phospho-PI3 kinase antibody (Thermo Fisher), anti-PI3 kinase antibody (Cell Signaling Technology, Danvers, MA), anti-Phospho-Akt antibody (Cell Signaling Technology), anti-Akt antibody (Cell Signaling Technology), anti-cyclin D3 (Abcam), anti-CDK2 (Abcam), anti-Phospho-mammalian target of rapamycin (mTOR) (Abcam), anti-mTOR (Abcam) and anti-GAPDH (Cell Signaling Technology). After washed with 0.05% Tween-20 in tris-buffered saline for three times, membranes were incubated with horse radish peroxidase-conjugated secondary antibodies at room temperature for 1 h. Immuno-reactive bands were detected by the chemiluminescent substrate (Bio-rad, Hercules, CA, USA). ImageJ was used for density analysis. Flow cytometry Forty-eight hours post-lentivirus transduction, CaSki and SiHa cells were harvested by trypsinization. After wash with PBS and centrifuge, the cell pellets were fixed in 70% ethanol for 2 h on ice. After two times wash with PBS and centrifuge, the cell pellets were suspended in propidium iodide staining solution (Thermo Fisher) and incubated at room temperature for 30 min. Then cells were pelleted and washed with PBS, and subjected to flow cytometry analysis. Xenograft mouse model Five-week-old nude mice were purchased from experiment animal centre of Shanghai (Shanghai, China) and maintained under pathogen-free conditions. All the animal experiments were approved by the Animal Care Committee in Liaocheng people’s Hospital. For tumour xenograft mouse, lentivirus-transduced SiHa cells were subcutaneously injected into either side of flank area. Tumour growth was evaluated every 7 days. Forty-two days post-injection, mice were sacrificed and tumour tissues were harvested. Statistical analysis Student’s t test or one-way analysis of variance analysis followed by a Tukey’s post hoc test was used to determine the difference. Statistical difference was considered as significant only when P < 0.05. Results Up-regulation of MIAT expression in cervical cancer First, we compared the expression of MIAT between normal tissues and cervical cancer tissues. As shown in Fig. 1a, by comparing the cervical cancer and adjacent normal tissues, we found that MIAT expression was significantly increased in tumour tissues. In addition, the expression of MIAT in tumour tissues with bigger size (≥4 cm) was significantly higher than that in tumour tissues with small size (<4 cm; Fig. 1B). We also compared the MIAT expression between tumour tissues from Ib to IIa stage patients and tumour tissues from IIb to IIIa stage patients. As shown in Fig. 1C, MIAT expression was significantly up-regulated in tumour tissues from IIb to IIIa stage patients. Last, we compared the MIAT expression between tumour tissues from patients without lymph node metastasis and tumour tissues from patient with lymph node metastasis. As shown in Fig. 1D, MIAT expression was significantly up-regulated in tumour tissues from patient with lymph node metastasis. Taken together, we identified that MIAT was up-regulated in cervical cancer and with a positive correlation with cancer severity. Fig. 1. Open in new tabDownload slide Relative expression levels of lncRNA MIAT in cervical cancer. (A) MIAT expression was up-regulated in cervical cancer tissues. MIAT expression was measured by qRT-PCR and normalized to adjacent tissues. MIAT expression was significantly higher in patients with bigger tumour size (B), advanced FIGO stage (C) and lymph node metastasis (D). Data were presented as mean ± SD with all points. ***P < 0.001 between the indicated groups. Fig. 1. Open in new tabDownload slide Relative expression levels of lncRNA MIAT in cervical cancer. (A) MIAT expression was up-regulated in cervical cancer tissues. MIAT expression was measured by qRT-PCR and normalized to adjacent tissues. MIAT expression was significantly higher in patients with bigger tumour size (B), advanced FIGO stage (C) and lymph node metastasis (D). Data were presented as mean ± SD with all points. ***P < 0.001 between the indicated groups. Knocking down MIAT repressed cell proliferation of cervical cancer cells Next, we explored the potential effects of MIAT on cervical cancer. First, we investigated the expression of MIAT in different cervical cancer cells. As shown in Fig. 2A, the expression levels of MIAT in cervical cancer cells including SiHa, CaSki, HeLa and C33A were significantly higher than that in normal cervical cell H8. SiHa cells had the highest expression level of MIAT and CaSki had the second highest expression level. Therefore, we used these two cells for future study. To evaluate MIAT’s effects, we knocked down the endogenous MIAT by transducing CaSki and SiHa cells with lentivirus expressing MIAT shRNA. As shown in Fig. 2B, expressing MIAT shRNA significantly decreased MIAT level in both CaSki and SiHa cells. Transduction of lentivirus expressing MIAT shRNA resulted in decreased cell viability in both CaSki (Fig. 2C) and SiHa (Fig. 2D) cells when compared with transduction of lentivirus expressing control shRNA and the difference became significant at Days 3 and 4 post-transduction. Correspondingly, knocking down MIAT by lentivirus transduction resulted in significantly decreased cell colony numbers of both CaSki and SiHa cells (Fig. 2E and F). Knocking down MIAT also resulted in inhibition of cell proliferation in normal cervical cell H8, which became significant only on Day 4 post-lentivirus transduction (Supplementary Fig. S1A). Overexpression of MIAT promoted cell migration and invasion of C33A cells (Supplementary Fig. S1B and C). To further determine whether the effect of MIAT on proliferation reflected cell cycle arrest, we monitored the expression of cyclin D3 and Cdk2 after MIAT knocking down. Knocking down MIAT resulted in increased percentage of G0/G1 cells, and decreased percentage of S and G2/M cell by flow cytometry analysis (Supplementary Fig. S2A). In addition, knocking down MIAT decreased cyclin D3 and Cdk2 in both CaSki and SiHa cells, further confirmed that knocking down MIAT resulted in cell cycle arrest. Collectively, our data demonstrated that knocking down MIAT significantly decreased cell viability and proliferation. Fig. 2. Open in new tabDownload slide MIAT knockdown repressed cell proliferation in cervical cancer cell lines. (A) qRT-PCR was used to analyse the expressions of MIAT among different cervical cancer cell lines (H8 was used as negative control). (B) Knockdown efficiency of MIAT in CaSki and SiHa cells. (C, D) CCK-8 assay was used to explore the cell viability of CaSki and SiHa cells transfected with sh-MIAT or sh-negative control (NC). (E, F) Colony formation showed knockdown of MIAT significantly suppressed proliferation of CaSki and SiHa cells. Data are presented as mean ± SD. *P < 0.05, **P < 0.01 and ***P < 0.001 compared with negative control. Fig. 2. Open in new tabDownload slide MIAT knockdown repressed cell proliferation in cervical cancer cell lines. (A) qRT-PCR was used to analyse the expressions of MIAT among different cervical cancer cell lines (H8 was used as negative control). (B) Knockdown efficiency of MIAT in CaSki and SiHa cells. (C, D) CCK-8 assay was used to explore the cell viability of CaSki and SiHa cells transfected with sh-MIAT or sh-negative control (NC). (E, F) Colony formation showed knockdown of MIAT significantly suppressed proliferation of CaSki and SiHa cells. Data are presented as mean ± SD. *P < 0.05, **P < 0.01 and ***P < 0.001 compared with negative control. Knocking down MIAT decreased cervical cancer cell migration and invasion Next, we investigated whether MIAT affects cell migration and invasion of CaSki and SiHa cells. First, we performed the transwell assay to evaluate the effect of MIAT on migration and invasion of CaSki and SiHa cells. As shown in Fig. 3A and B, there were significantly decreased cell numbers of migrated and invaded cells in CaSki and SiHa cells transduced with lentivirus expressing MIAT shRNA. In addition, in a cell wound-healing assay, CaSki and SiHa cells transduced with lentivirus expressing MIAT shRNA exhibited significantly decreased degree of wound closure when compared with cells transduced with control lentivirus (Fig. 3C and D). Taken together, we demonstrated that knocking down MIAT decreased cervical cancer cell migration and invasion. Fig. 3. Open in new tabDownload slide MIAT knockdown repressed cell migration and invasion in cervical cancer cell lines. (A, B) Transwell assays showed the repression of cell invasion of CaSki and SiHa cells due to knockdown of MIAT. Scale bar: 100 μm. (C, D) Wound-healing assays showed the repression of cell migration of CaSki and SiHa cells due to knockdown of MIAT. Data are presented as mean ± SD. *P < 0.05, **P < 0.01 compared with negative control. Fig. 3. Open in new tabDownload slide MIAT knockdown repressed cell migration and invasion in cervical cancer cell lines. (A, B) Transwell assays showed the repression of cell invasion of CaSki and SiHa cells due to knockdown of MIAT. Scale bar: 100 μm. (C, D) Wound-healing assays showed the repression of cell migration of CaSki and SiHa cells due to knockdown of MIAT. Data are presented as mean ± SD. *P < 0.05, **P < 0.01 compared with negative control. Knocking down MIAT repressed cervical cancer cell growth in vivo Next, we explored whether knocking down MIAT affects tumour growth in vivo. We transplanted SiHa cells transduced with lentivirus expressing MIAT shRNA or control shRNA and monitored the tumour growth. As shown in Fig. 4A, expressing MIAT shRNA significantly decreased MIAT level in tumour. Transplantation of SiHa cells expressing MIAT shRNA resulted in decreased tumour size and the tumour size difference became significant at Days 28, 36 and 42 post-transplantation (Fig. 4B) in mice. Correspondingly, transplantation of SiHa cells expressing MIAT shRNA resulted in significantly decreased tumour weight (Fig. 4C). In addition, we detected significantly decreased expression levels of cancer proliferation marker Ki67 (Fig. 4D) and PCNA (Fig. 4E) in tumour from mice transplanted with SiHa cells expressing MIAT shRNA. Taken together, our data demonstrated that knocking down MIAT repressed tumour growth. Fig. 4. Open in new tabDownload slide MIAT knockdown repressed cervical cancer cell growth in vivo. (A) The relative expression levels of MIAT in tumour tissues obtained from mice after 6 weeks of injection were detected by qRT-PCR. (B) Representative images of the xenograft tumours from SiHa cells transfected with sh-MIAT or sh-NC after 6 weeks. Tumour growth curves determined every 7 days after 1 week of injection. (C) The tumour weight was measured after 6 weeks of injection. (D, E) qRT-PCR was used to determine the expressions of Ki67 and PCNA in tumour obtained from mice after 6 weeks of injection (n = 6 for each group). Data are presented as mean ± SD. *P < 0.05, **P < 0.01 compared with negative control. Fig. 4. Open in new tabDownload slide MIAT knockdown repressed cervical cancer cell growth in vivo. (A) The relative expression levels of MIAT in tumour tissues obtained from mice after 6 weeks of injection were detected by qRT-PCR. (B) Representative images of the xenograft tumours from SiHa cells transfected with sh-MIAT or sh-NC after 6 weeks. Tumour growth curves determined every 7 days after 1 week of injection. (C) The tumour weight was measured after 6 weeks of injection. (D, E) qRT-PCR was used to determine the expressions of Ki67 and PCNA in tumour obtained from mice after 6 weeks of injection (n = 6 for each group). Data are presented as mean ± SD. *P < 0.05, **P < 0.01 compared with negative control. Knocking down MIAT suppressed activation of phosphatidylinositol 3'-kinase/protein kinase B (PI3K/Akt) pathway in cervical cancer cell Next, we explored the effects of knocking down MIAT on activation of PI3K/Akt/mTOR signalling pathway, which has been shown to be essential in tumour cells survival and proliferation (18). As shown in Fig. 5A–D, the protein levels of phosphorylated-PI3K, -Akt and -mTOR were obviously decreased in CaSki and SiHa cells expressing MIAT shRNA when compared with cells expressing control shRNA. After quantitation, we found significantly decreased phosphorylation of PI3K (Fig. 5B), Akt (Fig. 5C) and mTOR (Fig. 5D) in CaSki and SiHa cells expressing MIAT shRNA, indicating decreased activation of PI3K/Akt signalling pathway in MIAT knockdown cells. Fig. 5. Open in new tabDownload slide MIAT knockdown down-regulated PI3K/Akt/mTOR pathway in cervical cancer cell lines. (A) Western blotting was used to measure the expressions of PI3K/Akt/mTOR pathway-related proteins in CaSki and SiHa cells transfected with sh-MIAT or sh-NC. Relative expressions were presented in (B–D). Data are presented as mean ± SD. **P < 0.01 compared with negative control. Fig. 5. Open in new tabDownload slide MIAT knockdown down-regulated PI3K/Akt/mTOR pathway in cervical cancer cell lines. (A) Western blotting was used to measure the expressions of PI3K/Akt/mTOR pathway-related proteins in CaSki and SiHa cells transfected with sh-MIAT or sh-NC. Relative expressions were presented in (B–D). Data are presented as mean ± SD. **P < 0.01 compared with negative control. Discussion Cervical cancer is one of the most common cancer over the world (19). The development of cervical cancer is a multistep process while the pathological mechanisms are not well-elucidated (20). In addition, effective diagnostic method and treatment of cervical cancer have yet to be identified. Recent years, the importance of lncRNAs in diseases has attracted attention and the dysregulation of lncRNA in cancer has been described to play critical role in tumour occurrence and development (21). The lncRNA MIAT is a disease-associated lncRNA and is dysregulated in multiple diseases. In cancer, MIAT is found to be up-regulated. For example, Zhang et al. (15) reported that in NSCLC tissues, the MIAT expression was significantly increased compared with normal tissue and knocking down MIAT inhibited the invasion of NSCLC cells. Crea et al. (16) found increased expression of MIAT in prostatic adenocarcinoma. These previous studies strongly suggested that MIAT played important roles in malignances. However, the expression and function of MIAT remains unclear in cervical cancer. In this study, we evaluated the expression of MIAT in cervical cancer tissue and found significant up-regulation of MIAT in cervical cancer tissue. In addition, the up-regulation of MIAT was positively associated with cancer severity. High expression of MIAT was associated with advanced FIGO stage and lymph node metastasis. Correspondingly, we also observed up-regulated expression of MIAT in cervical cancer cells lines. Knocking down MIAT by expressing MIAT shRNA resulted in suppression of cervical cancer cell proliferation, migration and invasion both in vitro and in vivo. The suppression of cell proliferation by knocking down MIAT could be caused by cell cycle arrest as we found that in CaSki and SiHa cells transduced with lentivirus expressing MIAT siRNA, the cells were arrested at G0/G1 stage and the cell cycle markers including cyclin D3 and CDK2 were remarkably reduced. Interestingly, in normal epithelial cell H8 cells, knocking down MIAT also resulted in inhibition of cell proliferation but the inhibition effects were not as strong as these in cancer cells. These findings suggested that MIAT played essential role in regulation of cell proliferation. In cancer cells, the highly up-regulated MIAT was dominantly responsible for the rapid proliferation of cancer cells. Once knocking down MIAT, it could dramatically affect the proliferation of cancer cells. PI3K–Akt–mTOR signalling pathway has been known to control multiple key cellular processes including metabolism, proliferation and growth. In cancer, this pathway is identified to be dysregulated. When growth factor binds to and activates its receptor, PI3K is recruited to the membrane and then recruit a subset of signalling proteins including Akt. Akt mediates the activation and inhibition of several targets and finally results in cell survival, growth and proliferation (22). Aberrant activation of the PI3K/Akt/mTOR pathway was found in many human cancers, which contributes to the survival and proliferation of tumour cells (23, 24). Recent studies demonstrated that lncRNAs regulated the activation of PI3K/Akt signalling pathway. For example, Tang et al. (25) reported that lncRNA DANCR up-regulated PI3K/Akt signalling and promoted triple negative breast cancer proliferation and tumourigenesis. Koirala et al. described that lncRNA AK023958 was up-regulated in breast cancer and positively regulated Akt, which contributed to breast tumour progression. Zhu et al. (26) demonstrated that overexpressing lncRNA MALAT1-activated PI3K/Akt pathway and promoted proliferation, migration and invasion of gastric cancer. In this study, we found that knocking down MIAT significantly decreased the activation of PI3K/Akt/mTOR pathway. The mechanism of how MIAT regulated PI3K/Akt pathway in cervical cancer need to be elucidated. Mechanistically, lncRNA could act as a miRNA sponge to regulate miRNA expression. MiRNA is known to regulate gene expression by pairing to the 3′ untranslated region (27). It has been described that MIAT-targeted miR150-5p to regulate endothelial cell function (28) and to modulate the function of osteosarcoma cells (29). Fu et al. (30) described that MIAT interacted with miR-34a and epigenetically controlled the miR-34a expression. Knocking down MIAT enhanced miR-34-a expression and inactivated PI3K/Akt signalling, which resulted in sensitization of lung cancer cells. Therefore, the microRNAs could be a mediator between the regulation of MIAT on PI3K/Akt signalling in our case. Identifying the potential miRNA targets of MIAT could provide us useful information to understand underlying mechanism. Conclusion MIAT was up-regulated in human cervical cancer tissues and cells line. MIAT promoted cervical cancer proliferation and invasion in vitro and in vivo. Moreover, inhibition of MIAT resulted in decreased activation of PI3K/Akt pathway. Supplementary Data Supplementary Data are available at JB Online. Conflict of Interest None declared. References 1 Jemal A. , Bray F., Center M.M., Ferlay J., Ward E., Forman D. ( 2011 ) Global cancer statistics . CA Cancer J. Clin . 61 , 69 – 90 Google Scholar Crossref Search ADS PubMed WorldCat 2 Klingelhutz A.J. , Roman A. ( 2012 ) Cellular transformation by human papillomaviruses: lessons learned by comparing high- and low-risk viruses . Virology 424 , 77 – 98 Google Scholar Crossref Search ADS PubMed WorldCat 3 Guo F. , Li Y., Wang J., Li Y., Li Y., Li G. ( 2013 ) Stanniocalcin1 (STC1) inhibits cell proliferation and invasion of cervical cancer cells . PLoS One 8 , e53989 Google Scholar Crossref Search ADS PubMed WorldCat 4 Wang G. , Lei L., Zhao X., Zhang J., Zhou M., Nan K. ( 2015 ) Calcitriol inhibits cervical cancer cell proliferation through downregulation of HCCR1 expression . Oncol. Res. 22 , 301 – 309 Google Scholar Crossref Search ADS WorldCat 5 Li H. , Li H., Qu H., Zhao M., Yuan B., Cao M., Cui J. ( 2015 ) Suramin inhibits cell proliferation in ovarian and cervical cancer by downregulating heparanase expression . Cancer Cell Int. 15 , 52 Google Scholar Crossref Search ADS PubMed WorldCat 6 Kung J.T. , Colognori D., Lee J.T. ( 2013 ) Long noncoding RNAs: past, present, and future . Genetics 193 , 651 – 669 Google Scholar Crossref Search ADS PubMed WorldCat 7 Fatica A. , Bozzoni I. ( 2014 ) Long non-coding RNAs: new players in cell differentiation and development . Nat. Rev. Genet. 15 , 7 – 21 Google Scholar Crossref Search ADS PubMed WorldCat 8 Gibb E.A. , Brown C.J., Lam W.L. ( 2011 ) The functional role of long non-coding RNA in human carcinomas . Mol. Cancer 10 , 38 Google Scholar Crossref Search ADS PubMed WorldCat 9 Wilusz J.E. , Sunwoo H., Spector D.L. ( 2009 ) Long noncoding RNAs: functional surprises from the RNA world . Genes Dev . 23 , 1494 – 1504 Google Scholar Crossref Search ADS PubMed WorldCat 10 Ji P. , Diederichs S., Wang W., Boing S., Metzger R., Schneider P.M., Tidow N., Brandt B., Buerger H., Bulk E., Thomas M., Berdel W.E., Serve H., Muller-Tidow C. ( 2003 ) MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer . Oncogene 22 , 8031 – 8041 Google Scholar Crossref Search ADS PubMed WorldCat 11 Gutschner T. , Hammerle M., Eissmann M., Hsu J., Kim Y., Hung G., Revenko A., Arun G., Stentrup M., Gross M., Zornig M., MacLeod A.R., Spector D.L., Diederichs S. ( 2013 ) The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells . Cancer Res . 73 , 1180 – 1189 Google Scholar Crossref Search ADS PubMed WorldCat 12 Ishii N. , Ozaki K., Sato H., Mizuno H., Saito S., Takahashi A., Miyamoto Y., Ikegawa S., Kamatani N., Hori M., Saito S., Nakamura Y., Tanaka T. ( 2006 ) Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction . J. Hum. Genet . 51 , 1087 – 1099 Google Scholar Crossref Search ADS PubMed WorldCat 13 Zhu M. , Li N., Luo P., Jing W., Wen X., Liang C., Tu J. ( 2018 ) Peripheral blood leukocyte expression of lncRNA MIAT and its diagnostic and prognostic value in ischemic stroke . J. Stroke Cerebrovasc. Dis . 27 , 326 – 337 Google Scholar Crossref Search ADS PubMed WorldCat 14 Shen Y. , Dong L.F., Zhou R.M., Yao J., Song Y.C., Yang H., Jiang Q., Yan B. ( 2016 ) Role of long non-coding RNA MIAT in proliferation, apoptosis and migration of lens epithelial cells: a clinical and in vitro study . J. Cell. Mol. Med. 20 , 537 – 548 Google Scholar Crossref Search ADS PubMed WorldCat 15 Zhang H.Y. , Zheng F.S., Yang W., Lu J.B. ( 2017 ) The long non-coding RNA MIAT regulates zinc finger E-box binding homeobox 1 expression by sponging miR-150 and promoteing cell invasion in non-small-cell lung cancer . Gene 633 , 61 – 65 Google Scholar Crossref Search ADS PubMed WorldCat 16 Crea F. , Venalainen E., Ci X., Cheng H., Pikor L., Parolia A., Xue H., Nur Saidy N.R., Lin D., Lam W., Collins C., Wang Y. ( 2016 ) The role of epigenetics and long noncoding RNA MIAT in neuroendocrine prostate cancer . Epigenomics 8 , 721 – 731 Google Scholar Crossref Search ADS PubMed WorldCat 17 Sattari A. , Siddiqui H., Moshiri F., Ngankeu A., Nakamura T., Kipps T.J., Croce C.M. ( 2016 ) Upregulation of long noncoding RNA MIAT in aggressive form of chronic lymphocytic leukemias . Oncotarget 7 , 54174 – 54182 Google Scholar Crossref Search ADS PubMed WorldCat 18 Vara J.Á.F. , Casado E., de Castro J., Cejas P., Belda-Iniesta C., González-Barón M. ( 2004 ) PI3K/Akt signalling pathway and cancer . Cancer Treat. Rev . 30 , 193 – 204 Google Scholar Crossref Search ADS PubMed WorldCat 19 Schiffman M. , Castle P.E., Jeronimo J., Rodriguez A.C., Wacholder S. ( 2007 ) Human papillomavirus and cervical cancer . Lancet 370 , 890 – 907 Google Scholar Crossref Search ADS PubMed WorldCat 20 Refaei M. , Dehghan Nayeri N., Khakbazan Z., Yazdkhasti M., Shayan A. ( 2018 ) Exploring Effective Contextual factors for regular cervical cancer screening in iranian women: a qualitative study . Asian Pac. J. Cancer Prev . 19 , 533 – 539 Google Scholar PubMed OpenURL Placeholder Text WorldCat 21 Peng L. , Yuan X., Jiang B., Tang Z., Li G.C. ( 2016 ) LncRNAs: key players and novel insights into cervical cancer . Tumor Biol. 37 , 2779 – 2788 Google Scholar Crossref Search ADS WorldCat 22 Janku F. , Yap T.A., Meric-Bernstam F. ( 2018 ) Targeting the PI3K pathway in cancer: are we making headway? Nat. Rev. Clin. Oncol. 15 , 273 – 291 Google Scholar Crossref Search ADS PubMed WorldCat 23 Cheng H. , Shcherba M., Pendurti G., Liang Y., Piperdi B., Perez-Soler R. ( 2014 ) Targeting the PI3K/AKT/mTOR pathway: potential for lung cancer treatment . Lung Cancer Manag . 3 , 67 – 75 Google Scholar Crossref Search ADS PubMed WorldCat 24 Fumarola C. , Bonelli M.A., Petronini P.G., Alfieri R.R. ( 2014 ) Targeting PI3K/AKT/mTOR pathway in non small cell lung cancer . Biochem. Pharmacol . 90 , 197 – 207 Google Scholar Crossref Search ADS PubMed WorldCat 25 Tang J. , Zhong G., Zhang H., Yu B., Wei F., Luo L., Kang Y., Wu J., Jiang J., Li Y., Wu S., Jia Y., Liang X., Bi A. ( 2018 ) LncRNA DANCR upregulates PI3K/AKT signaling through activating serine phosphorylation of RXRA . Cell Death Dis. 9 , 1167 Google Scholar Crossref Search ADS PubMed WorldCat 26 Zhu K. , Ren Q., Zhao Y. ( 2019 ) lncRNA MALAT1 overexpression promotes proliferation, migration and invasion of gastric cancer by activating the PI3K/AKT pathway . Oncol. Lett. 17 , 5335 – 5342 Google Scholar PubMed OpenURL Placeholder Text WorldCat 27 Shukla G.C. , Singh J., Barik S. ( 2011 ) MicroRNAs: processing, maturation, target recognition and regulatory functions . Mol. Cell Pharmacol . 3 , 83 – 92 Google Scholar PubMed OpenURL Placeholder Text WorldCat 28 Yan B. , Yao J., Liu J.Y., Li X.M., Wang X.Q., Li Y.J., Tao Z.F., Song Y.C., Chen Q., Jiang Q. ( 2015 ) lncRNA-MIAT regulates microvascular dysfunction by functioning as a competing endogenous RNA . Circ. Res. 116 , 1143 – 1156 Google Scholar Crossref Search ADS PubMed WorldCat 29 Jin H. , Jin X., Chai W., Yin Z., Li Y., Dong F., Wang W. ( 2018 ) Long non-coding RNA MIAT competitively binds miR-150-5p to regulate ZEB1 expression in osteosarcoma . Oncol. Lett. 17 , 1229 – 1236 Google Scholar PubMed OpenURL Placeholder Text WorldCat 30 Fu Y. , Li C., Luo Y., Li L., Liu J., Gui R. ( 2018 ) Silencing of long non-coding RNA MIAT sensitizes lung cancer cells to gefitinib by epigenetically regulating miR-34a . Front. Pharmacol . 9 , 82 Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Long non-coding RNA MIAT promotes cervical cancer proliferation and migration
JF - The Journal of Biochemistry
DO - 10.1093/jb/mvaa037
DA - 2020-08-01
UR - https://www.deepdyve.com/lp/oxford-university-press/long-non-coding-rna-miat-promotes-cervical-cancer-proliferation-and-jlkrpL3Sf1
SP - 183
EP - 190
VL - 168
IS - 2
DP - DeepDyve
ER -