TY - JOUR
AU1 - Rast-Somssich, Madlen I
AU2 - Žádníková, Petra
AU3 - Schmid, Stephan
AU4 - Kieffer, Martin
AU5 - Kepinski, Stefan
AU6 - Simon, Rüdiger
AB - Abstract Plant growth and development of new organs depend on the continuous activity of the meristems. In the shoot, patterns of organ initiation are determined by PINFORMED (PIN)-dependent auxin distribution, while the undifferentiated state of meristem cells requires activity of KNOTTED LIKE HOMEOBOX (KNOX) transcription factors. Cell proliferation and differentiation of the root meristem are regulated by the largely antagonistic functions of auxin and cytokinins. It has previously been shown that the transcription factor JAGGED LATERAL ORGANS (JLO), a member of the LATERAL ORGAN BOUNDARY DOMAIN (LBD) family, coordinates KNOX and PIN expression in the shoot and promotes root meristem growth. Here we show that JLO is required for the establishment of the root stem cell niche, where it interacts with the auxin/PLETHORA pathway. Auxin signaling involves the AUX/IAA co-repressor proteins, ARF transcription factors and F-box receptors of the TIR1/AFB1–5 family. Because jlo mutants fail to degrade the AUX/IAA protein BODENLOS, root meristem development is inhibited. We also demonstrate that the expression levels of two auxin receptors, TIR1 and AFB1, are controlled by JLO dosage, and that the shoot and root defects of jlo mutants are alleviated in jlo plants expressing TIR1 and AFB1 from a transgene. The finding that the auxin sensitivity of a plant can be differentially regulated through control of auxin receptor expression can explain how different developmental processes can be integrated by the activity of a key transcription factor. Auxin perception, auxin receptor, JAGGED LATERAL ORGANS, JLO, LBD, root development, TIR1/AFB Introduction Unlike animals, whose basic body structure is defined during embryogenesis, plants have the ability to constantly produce new organs from pools of stem cells that are located primarily at the shoot apical meristem (SAM) and root apical meristem (RAM). The RAM consists of a quiescent center (QC) in the center of the root meristem that has low mitotic activity and serves as an organizer of the meristem (Scheres et al., 1994). The root meristem can be further subdivided into a proximal (relative to the QC) and distal meristem, both consisting of cells with mitotic activity. Maintenance of the RAM requires a tight temporal and spatial regulation balancing production and differentiation of meristematic cells (Morrison and Spradling, 2008; Sozzani and Iyer-Pascuzzi, 2014). The maintenance of the root stem cell niche is assured by transcription factors acting in several parallel pathways. The homeodomain transcription factor WUSCHEL-RELATED HOMEOBOX5 (WOX5) is expressed in the QC and serves to maintain QC and adjacent stem cells (Sarkar et al., 2007). The GRAS family transcription factors SCARECROW (SCR) and SHORTROOT (SHR) (Sabatini et al., 2003) are required for QC establishment and act together in specification of the endodermis, and members of the PLETHORA (PLT) family of AP2-type transcription factors respond to the auxin gradient in the root to control the size of the root meristem (Blilou et al., 2005; Galinha et al., 2007). During postembryonic development, root growth is directed by differential distribution of auxin and the establishment of an auxin concentration maximum at the root tip. Auxin transport is carried out by the influx carriers AUXIN RESISTANT1/LIKE AUX1 (AUX1/LAX), efflux transporters of the PINFORMED (PIN) family, and ABCB/P-GLYCOPROTEIN (PGP) efflux transporters (Benková et al., 2003; Blilou et al., 2005; Vieten et al., 2007; Petrášek and Friml, 2009). Interestingly, auxin itself is a key regulator of its own transport by affecting the expression of its carriers (Vieten et al., 2007; Petrášek and Friml, 2009). At the cellular level, direct interpretation of differential auxin concentrations requires the action of the TRANSPORT INHIBITOR RESPONSE1/AUXIN SIGNALING F-BOX PROTEINS (TIR1/AFB) family. The TIR1/AFB genes encode F-Box proteins that are part of several SCFTIR1/AFB E3 ubiquitin ligase complexes (Skp1·cdc53/cullin·F-boxTIR1/AFB) (Dharmasiri et al., 2005; Parry et al., 2009). It has been shown that the presence of auxin in the binding pocket of TIR1 functions as a ‘molecular glue’ stabilizing the interaction with AUXIN/INDOLE-3-ACETIC ACID (AUX/IAA) co-repressor proteins. Once bound to the SCFTIR1/AFB complexes, AUX/IAAs are ubiquitinated and subsequently degraded by the 26S proteasome (Gray et al., 2001; Dharmasiri et al., 2005; Kepinski and Leyser, 2005; Tan et al., 2007). The turnover of AUX/IAA co-repressors, which interact with DNA-binding ARF proteins, allows the ARFs to exert their function as transcriptional regulators that control the expression of their target genes (Ulmasov et al., 1997, 1999; Liscum and Reed, 2002; Tiwari et al., 2004). Single mutations in members of the TIR/AFB gene family cause a mild auxin-related phenotype, except for the tir1-1 mutant, which is resistant to auxin and displays a shorter root than wild-type plants (Ruegger et al., 1998). Higher order mutants of the TIR/AFB gene family members exhibit severe growth defects and increased auxin resistance (Dharmasiri et al., 2005, Parry et al., 2009). The TIR1/AFB genes are broadly expressed during various stages of plant development and their transcripts are present in overlapping domains, within embryos, seedling roots, emerging lateral roots, vascular bundles in cotyledons and mature leaves, and in mature floral organs (Dharmasiri et al., 2005, Parry et al., 2009). Regardless of their overlapping expression pattern, detailed studies revealed that the TIR1/AFB proteins have distinct biochemical and biological activities, and that TIR1 and AFB2 are the dominant auxin receptors controlling Arabidopsis root development (Parry et al., 2009). Expression of the TIR1/AFB genes is regulated at multiple levels, and they are also subject to post-transcriptional control through microRNA miR393 that negatively regulates TIR1, AFB2, and AFB3 expression in response to pathogen attack (Navarro et al., 2006; Parry et al., 2009). Supporting the biotic stress-dependent regulation of the TIR1/AFB genes it was further shown that miR393 overexpression results in auxin-resistant root growth and that expression of miR393a and miR393b is complementary to that of pTIR1:TIR1-GUS, consistent with miR393 negatively regulating TIR1 expression (Parry et al., 2009). However, miR393 does not contribute to the developmental regulation of the TIR1/AFB genes, as introduction of a mutation into the miR393 target sequence of TIR1, AFB2, and AFB3 does not affect their expression under normal growth conditions (Parry et al., 2009). The precise mechanisms that control differential expression of TIR1/AFB genes in different plant tissues are not yet known. JLO, an LBD family transcription factor, plays an important role in plant development (Borghi et al., 2007). Loss-of-function jlo mutants result in embryonic or seedling lethality. JLO is expressed in embryos, the root meristem and later at the boundaries between organ primordia and the remainder of shoot and organ meristems. JLO misexpression drastically affects organ initiation, leaf development and meristem maintenance (Borghi et al., 2007, Rast and Simon, 2012). Some of these effects could be assigned to the misexpression of KNOX genes in incipient organ primordia, indicating that JLO can regulate meristematic gene functions. JLO shares this function with other LBD proteins, such as ASYMMETRIC LEAVES 2 (AS2). Importantly, JLO and AS2 physically interact in yeast and in planta (Rast and Simon, 2012). Furthermore, JLO can indirectly interact also with ASYMMETRIC LEAVES 1 (AS1) in the presence of AS2, suggesting that at least heterotrimeric complexes of these transcription factors exist in plants (Rast and Simon, 2012). JLO has been shown to be involved in numerous auxin-dependent developmental processes, such as embryonic development, organ primordia initiation and growth, and differentiation of vascular precursors (Borghi et al., 2007; Soyano et al., 2008; Rast and Simon, 2012). The strong patterning defects observed in jlo mutants were previously shown to be due to misregulation of the BODENLOS/MONOPTEROS (BDL/MP) pathway, and a resulting failure in auxin signaling. One consequence of this is the severely reduced expression of PIN and PLT family members in jlo-2 mutant roots (Bureau and Simon, 2008). Here we now show that impaired JLO function results in the stabilization of BDL and, as a consequence, in a misexpression of a number of auxin-regulated genes in addition to a failure to express auxin receptors at normal levels. Both the lack of expression of auxin receptor encoding genes and the resulting stabilization of AUX/IAA proteins in jlo mutants is causal for many of the developmental defects that we observe in jlo mutants. Furthermore, we find that JLO is not only necessary, but also sufficient for the expression of TIR1 and AFB1. Our findings disclose a new regulatory layer to the hierarchy of auxin signaling at the level of auxin perception. Materials and methods Plant material and growth conditions The jlo-2 (Ler, Bureau et al., 2010), plt1-4 (Ler, Aida et al., 2004), plt2-2 (Ler, Aida et al., 2004), and tir1-1 (Col, Ruegger et al., 1998) mutants were obtained from the Nottingham Arabidopsis Stock Centre (NASC). The jlo-3 (pst17018), jlo-4 (pst19766), jlo-5 (pst20504), jlo-6 (pst00432) and jlo-7 (pst13957) mutations are in the Nossen (No-0) background and belong to the RIKEN collection (Rast and Simon, 2012). The origins of marker and other transgenic lines are as follows: DR5rev::GFP (Friml et al., 2003), DII::VENUS (Brunoud et al., 2012); AUX1::AUX1-YFP (Swarup et al., 2004), WOX5::NLS-GFP (Nodine et al., 2007), PLT3::CFP (Galinha et al., 2007), BDL::BDL-GUS (Dharmasiri et al., 2005), TIR1::GUS, TIR1::TIR1-GUS, AFB1::GUS, AFB1::AFB1-GUS (Parry et al., 2009), MP::MP-GFP (Cole et al., 2009), SCR::SCR-YFP (Heidstra et al., 2004), TIR1::TIR1-VENUS (Wang et al., 2016), AFB1::AFB1-VENUS (Stefan Kepinski), and LexA35S::JLO-FLAG (=i35S::JLO-FLAG) (Bureau et al., 2010). The following mutant lines were generated by crossing the strains: plt1-4;plt2-2, jlo-2/+;plt1-4, jlo-2/+;plt2-2, jlo-2/+;plt1-4;plt2-2, jlo-2/+;tir1-1, DR5rev::GFP; jlo-2/+, DII-VENUS;jlo-2/+, AUX1::AUX1-YFP;jlo-2/+, WOX5::NLS-GFP;jlo-2/+, PLT3::CFP;jlo-2/+, BDL::BDL-GUS;jlo-2/+, TIR1::GUS;jlo-2/+, TIR1::GUS;jlo-5, TIR1::GUS;jlo-7, TIR1::TIR1-GUS;jlo-2/+, TIR1::TIR1-GUS;jlo-5, TIR1::TIR1-GUS;jlo-7, AFB1::GUS;jlo-2/+, AFB1::GUS;jlo-5, AFB1::GUS;jlo-7, AFB1::AFB1-GUS;jlo-2/+, AFB1::AFB1-GUS;jlo-5, AFB1::AFB1-GUS;jlo-7, MP::MP-GFP;jlo-2/+, SCR::SCR-YFP;jlo-2/+, TIR1::TIR1-VENUS;jlo-2/+, and AFB1::AFB1-VENUS;jlo-2/+. For JLO misexpression experiments, a i35S::JLO-FLAG line (Col) was crossed into TIR1::GUS, TIR1::TIR1-GUS, AFB1::GUS, AFB1::AFB1-GUS, TIR1::TIR1-VENUS and AFB1::AFB1-VENUS marker lines. Arabidopsis thaliana seeds were surface fume sterilized in a sealed container with 100 ml bleach (chlorine gas) supplemented by 3 ml of 37% HCl for 3 h, then suspended in 0.1% agarose, and plated on a growth medium consisting of half-strength Murashige Skoog salts (Duchefa), 1% sucrose, 0.8% plant agar, MES (pH 5.8), stratified for 2 days in a 4°C dark room, and grown vertically in a growth chamber under constant light conditions at 16 or 21°C. For auxin treatment, seedlings were mounted in liquid MS medium, containing 20 µM of indole-3-acetic acid (IAA) or 10 µM of 2,4-dichlorophenoxyacetic acid (2,4-D). To inhibit protein degradation by proteasome, proteasome inhibitor N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (MG132) was used, and seedlings were pretreated with 50 μM MG132 for 1 h, followed by 1 h incubation in 20 μM IAA. Nicotiana benthamiana plants were grown for 4 weeks in a greenhouse under controlled conditions. Induction of transgene expression was performed by spraying with 20 μM β-estradiol and 0.1% Tween 20. Binary constructs and plant transformation For the analysis of the JLO expression pattern, a JLO::GFP line was constructed. For this, the JLO promoter region (3273 bp upstream of the ATG) was synthesized (Life Technologies), introduced into pDONRZeo, and recombined into pMDC161 (Curtis and Grossniklaus, 2003). Subsequent transformation of Arabidopsis thaliana Columbia plants was carried out with the floral dip method (Clough and Bent, 1998). Transgenic plants were selected on MS medium containing hygromycin (15 mg ml–1). The AFB1::AFB1:VENUS reporter was constructed by PCR amplification of a 3 kb promoter region and the AFB1 coding sequence, including all introns, and in frame fusion of the last exon to the VENUS sequences, followed by 2 kb of genomic sequences from the 3′ region of the gene. This fragment was cloned into the pGREEN 0229 backbone and transformed into the afb1-3 mutant background. Primers used were EcoR1/pAFB1F (5′-TCAGAATTCATGGAGAACATAAACGAATCAA CTATAGTC-3′), AFB1/BamH1 (5-CTAGGATCCCTTTAT GGCTAGATGTGAAACTCCATTC-3′), BamH1/Venus (5′-CTAGGATCCGTGAGCAAGGG CGAGGAGCT-3′), VenusStop/Not1 (5′-ATAGCGGCCGCTAC TTGTACAGCTCGTCCATGCCGAGA-3′), Not1-3′-AFB1 (5′-TATGCGGCCGCACTTGCTGCTTCAGTCATATTTT CCTTTCC-3′) and 3′-AFB1/Not1 (5′-TTAGCGGCCGCATG TGATTATTGACTATGTTTACCCTGC-3′). For 2x35S::TIR1-FLAG and 2x35S::AFB1-FLAG transgene construction, the TIR1 (AT3g62980) and AFB1 (At4g03190) coding region without stop codons were amplified from Col-0 genomic DNA with the primers TIR1 fwd (5′-ATGCAGAAGCGAA TAGCCTTGTCGT-3′), TIR1 rev (5′-TTATAATCCGTTA GTAGTAATGATT-3′), AFB1 fwd (5′-ATGGGTCTCCGA TTCCCACCTAAGG-3′), and AFB1 rev (5′-TTACTTTATGGCTAG ATGTGAAACT-3′). The C-terminal FLAG tag (GCCTCGTCAGTGATAAAACGAGAAGACTACAA) and the attB recombination sites were added via PCR-mediated ligation. According to the manufacturer’s instructions (Gateway manual; Invitrogen) the PCR fragment was recombined into pDONR221 and finally into the binary plant transformation vector pMDC32 (Curtis and Grossniklaus, 2003). Subsequent transformation of Arabidopsis thaliana jlo-2/+ plants was carried out with the floral dip method (Clough and Bent, 1998). Transgenic plants were selected on MS medium containing hygromycin (15 mg ml–1) and kanamycin (25 mg ml–1). For protein interaction studies, attB sites were added via PCR-mediated ligation to coding regions of JLO, BDL, or MP. PCR products were introduced into pDONR201 and eventually recombined into pABindGFP, pABindCherry, or pABindFRET (Bleckmann et al., 2010). Binary vectors were transformed in Agrobacterium tumefaciens GV3101 pMP90 (Koncz et al., 1984) according to the manufacturer’s instructions (Invitrogen). Abaxial leaf sides of Nicotiana benthamiana plants were infiltrated as described in Bleckmann et al. (2010). Transgene expression was induced 48 h after infiltration by spraying with 20 µM β-estradiol, 0.1% Tween 20 and analysed within 12 h after induction. EFRET measurements via acceptor photobleaching Nicotiana benthamiana leaf epidermal cells were examined with a ×40, 1.3 numerical aperture Zeiss oil-immersion objective using a Zeiss LSM 510 Meta confocal microscope. Förster resonance energy transfer efficiency (EFRET) was measured via green fluorescent protein (GFP) fluorescence intensity increase after photobleaching of the acceptor mCherry (Bleckmann et al., 2010). The percentage change of the GFP intensity directly before and after bleaching was analysed as EFRET=(GFPafter–GFPbefore)/GFPafter×100. All photobleaching experiments were performed in the nucleus. A minimum of 25 measurements were performed for each experiment. Significance was analysed using Student’s t-test. Gene expression analysis Reporter gene analysis was performed in the F3 generation after genetic crossing. To detect β-glucuronidase (GUS) activity, 5-day-old seedlings were incubated in reaction buffer containing 0.1M sodium phosphate buffer (pH 7), 1mM ferricyanide, 1mM ferrocyanide, 0.1% Triton X-100 and 1mgml−1 X-Gluc for 10 min to 8h in dark at 37°C. Afterwards, chlorophyll was removed by destaining in 70% ethanol and seedlings were cleared with 70% (w/v) chloral hydrate–10% (v/v) glycerol solution. Analysis of fluorescence reporter expression was performed using a Zeiss LSM780 confocal microscope. Counterstaining of root cell walls was achieved by mounting roots in 10 µM propidium iodide (PI). The RNeasy Plant Mini Kit (Qiagen) was used for RNA extraction from roots. RNA was treated with DNase (Fermentas) and transcribed into cDNA using SuperScriptII (Invitrogen). Quantitative reverse transcription PCR (qRT-PCR) was performed in triplicates using the Mesa Blue Sybr Mix (Eurogentec) and a Chromo4 real-time PCR machine (Bio-Rad). Oligonucleotide sequences are given in Supplementary Table S1 at JXB online. Expression levels were normalized to the reference gene At4g34270 (Czechowski et al. 2005). The JLO misexpression experiments were performed as described in (Rast and Simon, 2012). Phenotypic analysis and microscopy Root architecture was studied with the modified pseudo-Schiff propidium iodide (mPSPI) method (Truernit et al., 2008) and imaged with a Zeiss LSM 780 laser scanning microscope. Image acquisition was carried out with an Axiocam HR camera attached to a Zeiss Axioscope II microscope. For root length analysis, seedlings were photographed and root lengths were measured with ImageJ (http://rsb.info.nih.gov/ij). Scanning electron microscopy (SEM) analysis of SAMs was performed as described previously (Kwiatkowska, 2004). Briefly, the images showing the surface of individual shoot apices were obtained using replicas (dental polymer molds) taken from the surface of individual shoot apices. Epoxy resin casts prepared from these molds were sputter-coated and were observed by scanning electron microscope (LEO435VP). Images were processed in ImageJ software and assembled in Adobe Illustrator. Chromatin immunoprecipitation assay We took advantage of a previously described Arabidopsis inducible overexpression line, i35S::JLO-FLAG, that carries an estradiol-inducible JLO-FLAG transgene (Bureau et al., 2010). A monoclonal antibody directed against the FLAG epitope of the JLO–FLAG fusion protein was used in a chromatin immunoprecipitation (ChIP) experiment, which was performed as described in Schubert et al. (2006) using 1 g of tissue seedlings at 5 days after germination (DAG) and monoclonal ANTI-FLAG® M2 antibodies (Sigma-Aldrich). Inducible production of the JLO–FLAG fusion protein was previously confirmed by Western blotting with an anti-FLAG-antibody (Bureau et al., 2010). Nuclear extracts derived from i35S::JLO-FLAG seedlings aged 5 DAG at 24 h after induction of JLO–FLAG expression were sonicated to obtain DNA fragments ranging from 250 to 500 bp. After immunoprecipitation, the enrichment of the TIR1 and AFB1 promoters was estimated by qPCR to define the regions of the TIR1 and AFB1 promoter showing enrichments of percentage input yield compared with adjacent promoter regions and with wild-type control. Input and immunoprecipitation DNA was diluted 1:10, and 2 μl was used for real-time PCR. The SYBR Green II Master kit was used for all qPCRs, and ACTIN2 was utilized as negative controls. Oligonucleotides were designed in the program Prime3 (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi, for oligonucleotides, see Supplementary Table S2). To analyse the ChIP enrichment from qPCR data, the percentage input method was used. ChIP data were obtained from single experiments, but similar data were acquired from three independent experiments. Values for immunoprecipitation were referenced to input values. Six primer sets for TIR1 and three for AFB1 were used to estimate the relative enrichment of their promoters and other primer pairs for introns and for coding regions of respective genes. Primers were designed to amplify regions of a promoter of approximately 200 bp and cover the whole promoter sequence located 2446 bp upstream of the transcriptional start site (TSS) for TIR1 and 1238 bp upstream of the TSS for AFB1 (see Supplementary Fig. S1). Results Establishment and maintenance of the root stem cell niche depends on JLO JAGGED LATERAL ORGANS (JLO), a transcription factor from the LATERAL ORGAN BOUNDARY DOMAIN (LBD) family, was shown to be required for precise pattern formation from embryogenesis onwards, as loss-of-function jlo mutants arrest embryogenesis at the globular stage or display seedling lethality (Borghi et al., 2007; Bureau et al., 2010). The roots of the strong jlo-2 mutants remain short and, from the fifth day after germination (DAG) onwards cease to develop further (Bureau et al., 2010, Fig. 1A, B). In contrast to wild-type roots, the meristem of jlo-2 mutants appears disorganized and a structurally distinct QC with surrounding stem cells cannot be readily identified (Fig. 1C, D, G, H, J) (Bureau et al., 2010). This severe disruption of development in jlo-2 mutants confounds functional analysis of later developmental stages, and we therefore analysed a series of phenotypically milder jlo alleles (jlo-3 to jlo-7) that retain some residual JLO function (Rast and Simon, 2012). Distal to the QC, wild-type roots maintain a single layer of columella stem cells (CSCs) that gives rise to four to five layers of differentiated columella cells (CCs), which contain starch granules (Fig. 1G and Supplementary Fig. S2). The CSC layer appears as two cell tiers following the immediate division of the CSCs. Analysis of homozygous jlo-3 and jlo-5 to jlo-7, which are weak alleles of jlo with residual function, revealed that an increased percentage of jlo-5, jlo-6 and jlo-7 roots carried two CSC layers (n≥50 for each, P<0,001); jlo-3 mutants were like wild-type, while jlo-2 mutants maintained one or no CSCs (Fig. 1H–J and Supplementary Fig. S2A–D). This suggests that the differentiation of CSC daughter cells into columella cells in jlo-5 to jlo-7 mutants is delayed (where JLO activity is reduced), but precocious in jlo-2 (where JLO activity is almost absent). In wild-type, CSCs are maintained by the homeodomain transcription factor WOX5, which is in turn regulated by CDF4 (Pi et al., 2015) and by auxin (Sarkar et al., 2007; Ding and Friml, 2010; Tian et al., 2014). WOX5 is expressed in the QC and controls the number of CSC layers in a dosage-dependent manner (Sarkar et al., 2007; Ding and Friml, 2010). We therefore asked if WOX5 expression was affected by the presence of JLO. In contrast to wild-type, WOX5 expression in jlo-2 mutant roots expands from the QC into the adjacent stem cells (Fig. 1K, L) and we found increased WOX5 transcript levels in roots of the jlo-2 and jlo-5 to jlo-7 mutants, but not in jlo-3 (Fig. 1M). Thus, JLO represses WOX5 expression outside of the QC in wild-type; however, the differential response of CSCs to altered JLO dosage cannot be simply explained through regulation of WOX5 alone. We therefore studied the expression pattern of JLO in more detail to investigate if JLO could regulate WOX5 in the QC or surrounding cells. A transgenic JLO reporter line (pJLO::GFP) showed expression in the root vascular bundle, commencing immediately proximal to the quiescent center (QC) in the vascular initials (Fig. 1E, F). At approximately 250 μm from the root tip GFP signal was discernible in the metaxylem cells (Fig. 1F). In addition, JLO was highly expressed in the second and third CC layer (Fig. 1E). Thus, the expression patterns of JLO and WOX5 do not overlap, but rather appear mutually exclusive, suggesting that JLO could serve to repress WOX5 outside of the QC during normal development. Fig. 1. Open in new tabDownload slide Phenotype of jlo mutants and JLO::GFP expression. (A, B) Phenotype of wild-type (A) and jlo-2 mutant seedlings (B). The inset in (B) shows a higher magnification of a jlo-2 mutant seedling. (C, D) Root tip of wild-type (C) and jlo-2 mutant seedlings (D), stained with propidium iodide (PI; red signal on cell walls). (E, F) Expression of JLO::GFP reporter in the root tip (E) and in a root cross-section at approximately 250 μm from the tip (F), PI stained, green signal from GFP. (G–I) Differentiation status of distal root meristems of wild-type (G), jlo-2 mutant (H), and jlo-5 mutant (I), mPSPI staining of cell walls and starch granules, columella stem cells (red arrowheads), quiescent center (blue arrowheads), and columella cells (yellow arrowheads). (J) Quantification of columella stem cell (CSC) number as percentage of wild-type, jlo-2/+, jlo-2, jlo-3, jlo-5, jlo-6, and jlo-7 mutant seedlings. (K, L) Expression of WOX5::NLS-GFP reporter in the root tip of wild-type (k) and jlo-2 mutant seedlings (L), stained with PI. (M) WOX5 transcript levels were analysed by qRT-PCR in roots of wild-type, jlo-2/+, jlo-2, jlo-3, jlo-5, jlo-6, and jlo-7 seedlings. All seedlings were analysed at 5 days after germination. CSC, columella stem cell; MNE, mean normalized expression; WT, wild-type. Asterisks mark a significant difference from wild-type (*P≤0.01, analysed by Student’s t-test). Scale bars: 50 µm. Error bars in (M) indicate standard error. JLO acts with the auxin/PLETHORA pathway in root meristem maintenance QC specification and WOX5 expression require the activity of two GRAS family transcription factors, SCARECROW (SCR) and SHORTROOT (SHR) (Sabatini et al., 2003; Sarkar et al., 2007). Mutations in either gene result in a premature differentiation of root meristem cells and loss of QC function. We asked if JLO function is mediated by either SHR or SCR. Therefore, we monitored SCR expression using a SCR::SCR-YFP reporter construct. In wild-type, SCR–YFP signals are detectable in the root endodermis, the endodermis/cortex initial and the QC (Fig. 2A). Roots of homozygous jlo-2 mutants showed SCR expression in cells of the presumptive QC, as well as in a single cell layer directly adjacent to the vascular tissues, which thus likely has endodermis identity (Fig. 2B). Using quantitative reverse transcription PCR (qRT-PCR), we then showed that neither SCR nor SHR expression levels, which mutually promote the expression of each other, are altered in jlo-2 mutant roots (Fig. 2C), indicating that JLO regulates WOX5 expression and root meristem maintenance independent of the SCR/SHR pathway. Fig. 2. Open in new tabDownload slide Genetic interaction between JLO, SCR, and PLT. (A, B) Expression of an SCR::SCR-YFP reporter in wild-type (A) and jlo-2 (B) mutant roots, stained with PI. Arrowheads mark the QC. (C, D) qRT-PCR analysis of SCR, SHR expression (C) and PLT/BBM (D) expression in roots of wild-type, jlo-2/+, and jlo-2. (E–O) Root length of the indicated seedling genotypes. Quantitative measurements of root length (E), representation of the wild-type (F), plt1-4 (G), jlo-2/+;plt1-4 (H), jlo-2;plt1-4 (I), plt2-2 (J), jlo-2/+;plt2-2 (K), jlo-2;plt2-2 (L), plt1-4;plt2-2 (M), jlo-2/+;plt1-4;plt2-2 (N), and jlo-2;plt1-4;plt2-2 (O) mutant seedlings. The inset in (O) shows a higher magnification of a jlo-2;plt1-4;plt2-2 triple mutant seedling. All seedlings were analysed at 5 days after germination. MNE, mean normalized expression; WT, wild-type. Scale bars: 50 µm in (A–E) and 2 mm in (F–O). Error bars in (C–E) indicate standard error. Asterisks mark a significant difference from wild-type (*P≤0.01, analysed by Student’s t-test). Another pathway promoting QC identity and root meristem maintenance comprises members of the PLETHORA (PLT) family (also called AINTEGUMENTA-LIKE) of AP2-type transcription factors (Blilou et al., 2005) and is auxin dependent. We previously found that genes belonging to the PLT family (PLT1, PLT2, and BABYBOOM (BBM)/PLT4) are expressed at lower levels in jlo-2 roots, and that PLT1, 2, and 4 are transcriptionally up-regulated upon inducible JLO overexpression (Bureau et al., 2010). In wild-type, PLT3 is highly expressed in the stem cell niche and the CCs at the basal root tip, and expressed in a gradient in epidermal and vascular tissues (see Supplementary Fig. S3A). In a jlo-2 mutant background, PLT3 is expressed in a similar pattern but at lower levels (Supplementary Fig. S3B). Importantly, qRT-PCR analysis with RNA prepared from whole seedlings at 5 DAG showed a down-regulation of all four PLT genes in jlo-2 mutants, and even showed a reduction in expression of all genes in jlo-2/+ heterozygous seedlings by approximately 40% (Fig. 2D). Thus, the expression of all four PLT genes tested here is highly sensitive to the dosage of JLO throughout the plant. The PLT genes contribute redundantly and in a dosage-dependent manner to root growth and RAM maintenance. Therefore, single mutants display only mild phenotypes while roots of double or triple mutants show strong patterning defects (Aida et al., 2004; Galinha et al., 2007), and the RAM disorganization of various plt/bbm allelic combinations partially resembles that observed in jlo-2 mutants. Thus, reduction of PLT activity could be causal for the developmental defects of jlo mutants. To further disclose the genetic relationship between JLO and the PLT genes, we created double and multiple mutant combinations of jlo-2/+ with the plt1-4 and plt2-2 loss-of-function alleles (see Supplementary Table S3). The F3 progeny of jlo-2/+;plt1-4, jlo-2/+;plt2-2, and jlo-2/+;plt1-4;plt2-2 plants were examined at 5 DAG. Compared with plants homozygous for mutations in individual PLT genes, root length and meristem organization were stepwise further reduced when the plt mutants were combined with jlo-2 heterozygous and homozygous plants (Fig. 2E–O, Supplementary Fig. S3C–J). Thus, in all mutant combinations analysed, we found that jlo mutants enhanced all phenotypes of plt mutants. Since PLT genes act redundantly, this could indicate that JLO acts fully through the PLT pathway. However, JLO may also affect the regulation of other, PLT-independent processes and target genes. JLO regulates the earliest steps of auxin signaling The fact that impaired JLO function affects the expression of PLT family members but not SHR or SCR genes, together with JLO-dependent restriction of WOX5 expression, could suggest that JLO acts specifically in an auxin-dependent pathway to control root meristem development. This assumption is consistent with the misexpression of a number of auxin-regulated target genes in jlo mutant backgrounds. These genes not only include members of the PIN family of auxin efflux carrier, as previously shown (Bureau et al., 2010, Rast and Simon, 2012), but also AUX1, a member of the AUX/LAX family of auxin influx carriers that act to stabilize the auxin gradient (Marchant et al. 2002; Bainbridge et al., 2008). Monitoring the expression of an AUX1::AUX1-YFP reporter gene in jlo-2 mutant background revealed an essentially unaltered expression pattern compared with wild-type, but an overall reduction in expression level (see Supplementary Fig. S4A, B). Thus, JLO function is essential to facilitate both active auxin export and auxin import. To further reveal whether JLO regulates auxin-dependent gene expression or auxin signaling, we assessed the overall auxin response in jlo-2 mutants. The transcriptional response to auxin can be monitored using the DR5rev::GFP reporter, which consists of several ARF-binding sites driving the expression of GFP (Ulmasov et al., 1997; Sabatini et al., 1999; Benková et al., 2003; Heisler et al., 2005), while the DII-VENUS sensor (Brunoud et al., 2012) allows the monitoring of local degradation of AUX/IAAs depending on auxin levels and perception. Auxin is transported through the root stele toward the basal root tip to generate a maximum at the QC, the surrounding initials and the CC. Consistent with this, we observed reduced DII-VENUS signals in the root stele and an absence of signals at the tip of wild-type roots (Fig. 3A) indicating a local, auxin-dependent degradation of the fusion protein. The DR5rev:GFP reporter appeared to be expressed in a mostly complementary pattern (Fig. 3G). Treatment of wild-type roots with natural auxin (IAA) or synthetic auxin analogues (2,4-D) resulted in a strong reduction of DII-VENUS signals (Fig. 3B, C) while the DR5rev:GFP expression was up-regulated (Fig. 3H, I). We then investigated DII-VENUS signals and DR5rev:GFP expression in homozygous jlo-2 mutants. We found that DII-VENUS protein was expressed in the mutant roots (Fig. 3D), overlapping with a strongly reduced maximum of DR5rev:GFP expression (Fig. 3J). Moreover, the DII-VENUS protein abundance and DR5rev:GFP expression showed no clear response to artificially increased auxin contents in a jlo-2 mutant background (Fig. 3E, F, K, L). These results indicate that JLO regulates both auxin-dependent gene expression and auxin signaling, as JLO function is required for proper auxin response in the root tip and additionally seems to be necessary to mediate AUX/IAA degradation. Fig. 3. Open in new tabDownload slide JLO is required for the response to auxin. (A–C) Expression of DII-VENUS in untreated wild-type roots (A), in wild-type roots treated with auxin (IAA) for 1 h (B) and in wild-type roots treated with synthetic auxin (2,4-D) for 6 h (C). (D–F) Expression of DII-VENUS in untreated jlo-2 roots (D), in jlo-2 roots treated with auxin (IAA) for 1 h (E), and in jlo-2 roots treated with synthetic auxin (2,4-D) for 6 h (F). (G–I) Expression of DR5rev::GFP in untreated wild-type roots (G), in wild-type roots treated with auxin (IAA) for 1 h (H), and in wild-type roots treated with synthetic auxin (2,4-D) for 6 h (I). (J–L) Expression of DR5rev::GFP in untreated jlo-2 roots (J), in jlo-2 roots treated with auxin (IAA) for 1 h (K) and in jlo-2 roots treated with synthetic auxin (2,4-D) for 6 h (L). All seedlings were analysed at 5 days after germination. 2,4-D, 2,4-dichlorophenoxyacetic acid; IAA, indole-3-acetic acid; mock, untreated seedlings. Scale bars: 50 µm. JLO mediates AUX/IAA degradation to allow auxin-induced gene expression Previous genetic studies indicated that JLO acts in the BDL/MP pathway to regulate auxin-induced gene expression programs. However, the discrete hierarchy of the genes remained unclear (Bureau et al., 2010). Interestingly, mp loss-of-function and bdl gain-of-function mutants lose the embryonic root and carry reduced hypocotyls and vascular systems (Hardtke and Berleth, 1998; Hamann et al., 2002), similar to jlo loss-of-function mutants (Bureau et al., 2010). This raises three possibilities: (1) JLO may be a transcriptional regulator of MP or BDL expression, (2) JLO may physically interact with the BDL and/or MP proteins, and (3) because the bdl gain-of-function mutation causes a stabilization of the BDL protein, JLO could be required for auxin-dependent BDL degradation (Hamann et al., 2002). To distinguish between these possibilities, we first assayed MP and BDL expression in the jlo-2 mutant background. We observed unaltered expression of an MP::MP-GFP and a BDL::BDL-GUS reporter in jlo-2 mutant roots compared with wild-type (Bureau et al., 2010; Fig. 4A, H, O, P). qRT-PCR analysis also confirmed no significant alterations in MP or BDL transcript levels in jlo-2 mutants (Fig. 4Q). Thus, JLO does not regulate MP or BDL transcription. Fig. 4. Open in new tabDownload slide The AUX/IAA protein BODENLOS is stabilized in jlo-2 mutants. (A–G) Expression of BDL::BDL-GUS in untreated wild-type roots (A), in wild-type roots treated with auxin (IAA) (B), MG132 and auxin (C), 2,4-D for 1 h (D), 2,4-D for 2 h (E), 2,4-D for 4 h (F), and 2,4-D for 6 h (G). (H–N) Expression of BDL::BDL-GUS in untreated jlo-2 roots (H), jlo-2 treated with auxin (IAA) (I), MG132 and auxin (J), 2,4-D for 1 h (K), 2,4-D for 2 h (L), 2,4-D for 4 h (M), and 2,4-D for 6 h (N). (O, P) Expression of an MP::MP-GFP reporter in the root tip of wild-type (O) and jlo-2 (P). (Q) MP and BDL transcript levels analysed by qRT-PCR in roots of wild-type, jlo-2/+, and jlo-2 seedlings. (R–U) FRET-based protein interaction analysis. Co-localization of fluorescent protein tagged BDL, MP, or JLO in N. benthamiana epidermis cells: (R) co-localization of BDL–GFP and MP–mCherry, (S) co-localization of JLO–GFP and BDL–mCherry, and (T) co-localization of JLO–GFP and MP–mCherry. (U) EFRET measured after transient expression of FP-tagged protein in epidermis cells of N. benthamiana. Intramolecular EFRET obtained by direct fusion of GFP to mCherry (black column) and GFP background fluctuation (white column) were calculated as positive and negative controls. All seedlings were analysed at 5 days after germination. 2,4-D, 2,4-dichlorophenoxyacetic acid; EFRET, FRET efficiency; IAA, indole-3-acetic acid; MG132, N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (proteasome inhibitor); MNE, mean normalized expression; mock, untreated seedlings; WT, wild-type. Asterisks mark a significant difference from controls (*P≤0.01, analysed by Student’s t-test). Scale bars: 50 µm for (A–P) and 10 µm for (R–T). Error bars in (Q) and (U) indicate standard error. To assay for protein interactions in planta, JLO, MP, and BDL were transiently expressed in Nicotiana benthamiana leaf epidermal cells as fusions to the fluorescent proteins GFP or mCherry. Interaction between proteins was then determined by measuring fluorescent donor dequenching after acceptor bleaching, which is an indicator of Förster resonance energy transfer (FRET) between interacting proteins. Apparent FRET efficiencies (EFRET) between the GFP and mCherry pairs were then calculated as the percentage increase of GFP fluorescence after photobleaching of mCherry (Albertazzi et al., 2009; Bleckmann et al., 2010). All fusion proteins were found to be localized in the cytoplasm and enriched in the nucleoplasm (Fig. 4R–T). Therefore, we performed all photobleaching experiments and EFRET measurements in the nucleus. We found, consistent with previously published yeast GAL4 interaction studies, a clear MP/BDL (EFRET=15.7 ± 2.0; Weijers et al., 2006) interaction in both reciprocal GFP–mCherry combinations (Fig. 4U). However, we could not detect a significant protein interaction between JLO and MP (EFRET=2.2 ± 0.2) or BDL (EFRET=2.5 ± 0.4) (Fig. 4U). Together, our results indicate that JLO neither regulates MP or BDL expression nor interacts directly with either of them at the protein level. We next examined the possibility that impaired JLO function interferes with auxin-dependent BDL degradation. To this end we modified the auxin content in wild-type and jlo-2 mutant roots that express a BDL–GUS fusion protein from its endogenous promoter. Consistent with previously published results (Dharmasiri et al., 2005), we found that the BDL–GUS protein is destabilized by a 1 h treatment with 20 µm IAA in wild-type roots (100%; n=69; Fig. 4B), while mock treated controls showed a GUS staining in the root stele (100%; n=67; Fig. 4A). Additional application of the proteasome inhibitor MG132 confirmed that this auxin-dependent BDL degradation requires the proteasome. Wild-type roots that were pretreated with MG132, followed by incubation in 20 µM IAA for 1 h, displayed GUS signals comparable to the untreated controls (100%; n=32; Fig. 4C). In contrast, in 78% of the analysed jlo-2 roots (n=139), GUS signals were still present after 1 h IAA treatment (Fig. 4I). Our results also showed that pretreatment with MG132 only slightly increased the number of GUS stained jlo-2 roots after IAA application (82%; n=48; Fig. 4J). We then used the transport-independent auxin analogue 2,4-D in our GUS assay to exclude that the deficiency in BDL–GUS degradation is simply due to a failure to transport the exogenously applied auxin. Within a 1–6 h treatment, we found a drastic reduction in BDL–GUS signals in the wild-type control (n≥25 for each experiment; Fig. 4D–G), but not in homozygous jlo-2 mutants (n≥25; Fig. 4K–N). Since loss of JLO function causes a stabilization of the BDL–GUS fusion protein, we concluded that JLO function is required to mediate AUX/IAA degradation to eventually allow ARF activity and regulation of auxin-induced gene expression programs. JLO mediates auxin perception through the TIR1/AFB1-signaling pathway Our results provide evidence that JLO is required for AUX/IAA degradation in response to auxin. Members of the TIR1/AFB family of auxin receptors directly link auxin perception to the degradation of AUX/IAA proteins (Dharmasiri et al., 2005; Kepinski and Leyser 2005). We used qRT-PCR assays to analyse if the expression levels of the six TIR1/AFB genes (TIR1, AFB1, to AFB5) is altered in the jlo-2 mutant background. When RNA from whole seedlings at 5 DAG was analysed, we found a significant reduction of TIR1 and AFB1 RNA levels, while expression of AFB2 to AFB5 remained unaffected (Fig. 5R). Fig. 5. Open in new tabDownload slide JLO controls expression of TIR1 and AFB1 in Arabidopsis roots. (A–H) Expression of TIR1::GUS (A, B), AFB1::GUS (C, D) transcriptional reporter, and TIR1::TIR1:GUS (E, F), AFB1::AFB1:GUS (G, H) translational reporter lines in the root tips of wild-type (A, C, E, G) or jlo-2 (B, D, F, H). (I–P) Expression of TIR1::TIR1:VENUS (I–L) and AFB1::AFB1:VENUS (M–P) transcriptional reporter in the root tips of wild-type (I, J, M, N) or jlo-2 (K, L, O, P). (J, L, N, P) Cross-sections at approximately 250 μm from the tip. Roots were stained with PI. (Q) Root length of plants treated with 0.2 µM 2,4-D, given as percentage of length of untreated seedlings of the same genotypes. (R) TIR1 and AFB1-5 transcript levels analysed by qRT-PCR in roots of wild-type, jlo-2/+, and jlo-2 seedlings, given as percentage of wild-type levels. All seedlings were analysed at 5 days after germination. 2,4-D, 2,4-dichlorophenoxyacetic acid; MNE, mean normalized expression; mock, untreated seedlings; WT, wild-type. Asterisks mark a significant difference from wild-type (*P≤0.01, analysed by Student’s t-test). Scale bars: 50 µm. Bars in (Q, R) indicate standard error. We then monitored the TIR1 and AFB1 expression in wild-type, jlo-2, jlo-5, and jlo-7 mutant embryos and roots using transcriptional and translational reporter lines (Fig. 5A–P; Supplementary Fig. S5A–N). TIR1 and AFB1 are broadly expressed throughout the root meristem of wild-type plants from embryogenesis onwards (n≥35; Fig. 5A, C, E, G, I, M and Supplementary Fig. S5A, D, G, J; Parry et al., 2009). In comparison, we found strongly reduced TIR1 and AFB1 expression in homozygous jlo-2, jlo-5, and jlo-7 mutant roots, both at the transcriptional and protein level (n≥35, Fig. 5B, D, F, H, K, O and Supplementary Fig. S5). Root cross-sections at approximately 250 μm from the tip of TIR1::TIR1-VENUS (Wang et al., 2016) showed broad TIR1 expression in all root cell layers (n=15, Fig. 5J), which was down-regulated in jlo-2 (n=15, Fig. 5L). AFB1 is predominantly expressed in epidermal cells and the procambium (Fig. 5N), and expression levels are strongly reduced in all cell types in the jlo-2 mutant (Fig. 5P). To analyse if JLO is not only required for wild-type TIR1 and AFB1 expression levels, but also sufficient to up-regulate TIR1 and/or AFB1, we used an estradiol-inducible JLO transgene (Bureau et al., 2010). Induced expression of a JLO–FLAG fusion protein in wild-type roots was sufficient to cause a 3.6-fold up-regulation of TIR1 RNA levels within 2 h after induction, and a 2.4-fold up-regulation of AFB1 transcript levels. The AFB2 to AFB5 RNA levels were not affected by induced JLO misexpression (see Supplementary Fig. S6Q). Analysis of the reporter lines revealed that upon JLO induction, TIR1 and AFB1 were expressed in their normal patterns, but at higher levels (Fig. 6A–P and Supplementary Fig. S6). However, unlike wild-type plants, cells of the lateral root cap show TIR1 expression (n≥35, Fig. 6B, F, K and Supplementary Fig. S6A–H). Furthermore, root cross-sections of TIR1::TIR1-VENUS disclosed increased TIR1 expression in endodermal and vascular tissues (n=15, Fig. 6K, L). Likewise, the AFB1 expression domain extended from the procambium to the adjacent vascular and ground tissues (Fig. 6D, H, O and Fig. 5I–P). Together these results suggest that of the six TIR1/AFB genes, JLO primarily promotes AFB1 and TIR1 expression during root development. Fig. 6. Open in new tabDownload slide JLO misexpression rapidly induces TIR1 and AFB1 expression. Estradiol-inducible expression of a FLAG tagged JLO protein up-regulated expression levels of TIR1 and AFB1 in roots. (A, B) TIR1::GUS and (C, D) AFB1::GUS transcriptional reporter, (E, F) TIR1::TIR1:GUS, and (G, H) AFB1::AFB1:GUS translational reporter at 0 or 24 h after estradiol-induced (HAI) expression of JLO-FLAG (I–L) TIR1::TIR1:VENUS and (M–P) AFB1::AFB1:VENUS translational reporter at 0 or 24 HAI. (J, L, N, P) Root cross-sections at approximately 250 μm from the tip. Fluorescent reporter lines were stained with PI (red), VENUS expression in green. All seedlings were analysed at 5 days after germination. JLO–FLAG expression was induced with 20 μM β-estradiol. Scale bars: 50 μm. Given that TIR1 expression is strongly reduced in jlo mutants, we asked if the reduction in TIR1 levels can be causal for the jlo mutant phenotypes. We therefore generated double mutants between jlo-2 and tir1-1 (Ruegger et al., 1998) and studied their genetic interaction (see Supplementary Table S4). Segregation analysis revealed no significant enhancement of the jlo-2 mutation by tir1-1 under normal growth conditions, and jlo-2;tir1-1 double mutants were phenotypically indistinguishable from jlo-2 single mutants (Fig. 5Q). Consistent with previously published results, the synthetic auxin analogue 2,4-D induces root stunting in wild-type, while tir1-1 mutant roots are resistant and elongate their roots when grown on media containing 0.2 µM 2,4-D (Fig. 5B; Ruegger et al., 1998). Similarly, jlo-2/+ roots were less sensitive to the effects of 2,4-D (Fig. 5Q). Elimination of TIR1 function from jlo-2/+ mutants further decreased the auxin response, measured as root length reduction. However, the observed auxin response was similar in both jlo-2 and jlo-2;tir1-1 mutants (Fig. 5Q). This indicates that loss of TIR1 function does not further affect auxin responses when the seedling is already lacking JLO function. Taking the above data together, we hypothesized that JLO acts as an upstream transcriptional regulator of TIR1 and AFB1 expression in the auxin signaling cascade. The short root phenotype of jlo mutants is then partly due to an auxin insensitivity caused by the lack of TIR1 and AFB1. To test this, we expressed the coding sequences of TIR1 and AFB1 in Arabidopsis wild-type and jlo-2 mutant seedlings from the cauliflower mosaic virus 35S promoter (CaMV35S). F3 progeny of Arabidopsis wild-type and jlo-2 mutant seedlings that carry 2x35S::TIR1-FLAG and 2x35S::AFB1-FLAG transgenes were examined at 5 DAG. Constitutive expression of TIR1 or AFB1 did not change the phenotype during vegetative development of wild-type (Fig. 7D, E, H). At 5 DAG, wild-type roots are 30.7 ± 0.28 mm (n=48) long, while jlo-2 roots remain short (2.8 ± 0.16 mm, n=53, Fig. 7C, H; Bureau et al., 2010). The 2x35S::TIR1-FLAG and 2x35S::AFB1-FLAG transgenes in jlo-2 mutant background caused an increase in root growth to 6.9 ± 0.5 mm and 5.5 ± 0.31 mm, respectively (n≥57, Fig. 7F, G, H). Thus, JLO-independent expression of either TIR1 or AFB1 was sufficient to at least partially restore jlo-2 root development. Fig. 7. Open in new tabDownload slide JLO-independent transgenic expression of TIR1 or AFB1 can rescue jlo-2 mutant phenotypes. Seedlings 5 days after germination of (A) wild-type, (B) jlo-2/+, (C) jlo-2, (D) 2x35S::TIR1-FLAG, (E) 2x35S::AFB1-FLAG, (F) 2x35S::TIR1-FLAG; jlo-2, and (G) 2x35S::AFB1-FLAG; jlo-2. (H) Root length in millimetres of the indicated seedling genotypes. (I–L) Scanning electron micrographs of (I) wild-type, (J) jlo-2, (K) 2x35S::TIR1-FLAG; jlo-2, and (L) 2x35S::AFB1-FLAG; jlo-2 shoots. All seedlings were 5 days old. Asterisks mark a significant difference from jlo-2 mutant (*P≤0.01, analysed by Student’s t-test). Scale bars: 1 mm in (A–G) and 50 μm in (I–L). Error bars indicate standard error. Interestingly, transgenic expression of TIR1 and AFB1 also supported extended shoot development of jlo-2. The jlo-2 homozygous mutants show a severe retardation in shoot growth, and mutant meristems initiate primordia at arbitrary positions (Fig. 7J; Rast and Simon, 2012) that either fail to grow out or develop into radialized organs (Fig. 7J). By 25 DAG, the jlo-2 shoot meristems had stopped further growth. Constitutive expression of TIR1 or AFB1 in jlo-2 mutants caused the formation of several small leaves carrying trichomes by 5 DAG (Fig. 7K, L) before leaf development and meristem activity eventually arrested within 25 DAG. We conclude that JLO is required for TIR1 and AFB1 expression during root and shoot development, and that the lack of auxin receptors is causal for at least some of the developmental defects observed in jlo mutants. To assess whether JLO directly regulates the expression of TIR1 and AFB1, we tested whether JLO binds the TIR1 and AFB1 promoters using chromatin immunoprecipitation (ChIP)–quantitative PCR (qPCR) assays with seedling tissue. However, no significant enrichment for the TIR1 or AFB1 promoter, or for other intronic or exonic regions of these genes was detected. This indicates that the interaction of JLO to its target sequences is only very transient, or that JLO regulates TIR1 and AFB1 expression in an indirect manner (see Supplementary Fig. S6). Discussion Auxin is a central regulator of plant growth and development, and the main function of auxin, the control of auxin responsive gene expression, relies on the TIR1/AFB (TRANSPORT INHIBITOR RESPONSE1/AUXIN SIGNALING F-BOX) clade of auxin receptors, which facilitate the degradation of the AUX/IAA transcriptional repressors in response to auxin (reviewed in Mockaitis and Estelle, 2008). Whilst the regulation of auxin synthesis, transport, and AUX/IAA degradation has been well studied, much less is known about the control of TIR1/AFB levels and activities, which can significantly contribute to overall auxin signaling (Dreher et al. 2006). In seedlings, TIR1 is an intrinsically unstable protein, and changes in TIR1 availability can influence auxin signaling. Furthermore, environmental factors such as ambient temperature strongly impact plant growth, which is partially mediated by auxin. Increased temperature was found to control the expression of auxin biosynthetic genes via PHYTOCHROME INTERACTING FACTOR4, but also to promote rapid accumulation of the TIR1 auxin co-receptor, an effect that is dependent on the molecular chaperone HEAT SHOCK PROTEIN 90 (Yu et al., 2015; Wang et al., 2016). Besides protein stability, auxin receptors can also be regulated post-transcriptionally through miR393 in response to pathogen attacks (Navarro et al., 2006; Parry et al., 2009). Our study of JLO function and its mutant phenotypes now uncovers the importance of transcriptional regulation of TIR1 and AFB1. JLO was first identified as an important developmental regulator in a large mutagenesis screen using transposable elements as activation tags. In that study, altered expression of JLO was shown to drastically affect organ initiation, leaf, and root development, and shoot and root meristem maintenance (Borghi et al., 2007, Rast and Simon, 2012). Some of these effects could be assigned to the misexpression of KNOX genes in organ primordia and later during leaf development, since failure to maintain KNOX silencing affects acquisition of proper organ cell fate, and consequently also organ architecture and shape (Tsiantis et al., 1999, Byrne et al., 2000, Hay et al., 2006). This indicates that JLO can regulate meristematic gene functions. KNOX down-regulation at the sites of lateral organ initiation coincides spatially and temporally with the establishment of a concentration maximum for auxin at the peripheral zone of the SAM, which depends on the auxin efflux carrier PIN1 (Benková et al., 2003; Reinhardt et al., 2003). Compromising PIN1 activity or auxin signaling results in ectopic expression of the KNOX gene KNAT1 in Arabidopsis leaves (Hay et al., 2006). Mutants in KNAT1 can at least partially rescue the loss of lateral organs in pin1 mutants, suggesting that a failure to repress KNAT1 expression in the periphery of the SAM in pin1 mutants could antagonize lateral organ formation (Hay et al., 2006). These observations indicate antagonistic interactions between auxin signaling and KNOX gene expression or function, and JLO appears to play a role in regulating both of these processes. Importantly, early jlo mutant defects such as developmental arrest during embryonic or the first seedling stages could not be explained by misregulation of KNOX genes, but phenotypically resembled those found in mutants for key auxin signaling components (e.g. BDL/MP) (Bureau and Simon, 2008; Bureau et al., 2010). In previous studies (Borghi et al., 2007; Bureau et al., 2010), JLO was shown to act by promoting expression of several auxin responsive genes, for instance the auxin efflux facilitators PIN. However, the molecular mechanisms underlying PIN regulation was not known. We now show that JLO positively regulates the expression of auxin co-receptors AFB1 and TIR1, and that the developmental defects observed in jlo mutants can be partially suppressed by constitutive transgenic, and therefore JLO-independent, expression of AFB1 or TIR1. However, we were unable to detect direct binding of JLO to the promoter regions of TIR1 or AFB1, suggesting that JLO controls AFB1 and TIR1 expression in an indirect manner. Furthermore, the expression domains of JLO and TIR1 or AFB1 overlap only partially in the RAM, indicating that JLO may act very early in development to establish TIR1 and AFB1 expression, which could be maintained at later stages independently of JLO. Importantly, JLO-dependent repression of the KNOX gene KNAT1 in organ primordia had been previously shown to involve the MYB-class transcription factor AS1 and the LBD protein AS2 (Phelps-Durr et al., 2005; Hay et al., 2006; Guo et al., 2008; Rast and Simon, 2012). AS1 and AS2 interact directly to repress KNAT1 expression and bind the promoters of KNAT1 and KNAT2, possibly as a repressive chromatin complex through recruitment of the histone chaperone histone regulatory protein A (HIRA) or members of the POLYCOMB REPRESSIVE COMPLEX 2 (PRC2) (Phelps-Durr et al., 2005; Guo et al., 2008; Lodha et al., 2013). Thus, LBD family transcription factors could act transiently to direct chromatin modifiers to their targets. JLO was shown to physically interact with the AS2–AS1 heteromer via direct contacts with AS2 (Rast and Simon, 2012), and the strong mutant phenotype of jlo loss of function alleles could indicate that JLO acts transiently as a hub that assembles diverse repressive (and activating) chromatin modifying complexes. An initial survey of further protein–protein interactions within the LBD family via in planta FRET analysis showed that JLO and many other LBD proteins can form a range of different complexes (Berckmans et al., 2011). Which types of complexes are formed in a given cell will then mainly depend on the specific subset of LBD proteins that are being expressed, and on their relative amount. The overall developmental context may then also determine the ultimate function of JLO, acting either as a transcriptional activator (of auxin receptors) or repressor (of KNOX genes). Together, our data show that already from early embryogenesis onwards, JLO is required for expression of the auxin receptors TIR1 and AFB1, and thereby plays a central role in patterning processes throughout plant development. Thus, JLO can regulate auxin perception and consequently auxin transport and auxin-responsive gene expression. Differential regulation of specific auxin receptors may also provide an effective mechanism for adaptation of plants in response to changing environmental factors. We now need to uncover how JLO itself is controlled at the transcriptional level or via interaction with cofactors in order to gain fresh insights on the regulation of development in plants. Supplementary data Supplementary data are available at JXB online. Fig. S1. ChIP–qPCR shows no evidence for a direct interaction of JLO protein with the TIR1 or AFB1 loci. Fig. S2. Phenotypic analysis of jlo mutants. Fig. S3. Genetic interaction between JLO and the PLT genes. Fig. S4. AUX1 expression is reduced in jlo-2. Fig. S5. TIR1 and AFB1 expression is down-regulated in jlo mutants. Fig. S6. TIR1 and AFB1 expression changes after inducing JLO-FLAG expression. Table S1. Oligonucleotides used for qRT-PCR analyses. Table S2. Oligonucleotides used for ChIP-qPCR analyses. Table S3. Genetic interactions between JLO and PLT-family genes. Table S4. Genetic interactions between JLO and TIR1. Accession numbers Sequence data from this article can be found in the Arabidopsis Genome Initiative or GenBank/EMBL databases under the following accession numbers: AT4g00220 (JLO), AT1g04550 (BDL), AT1g19850 (MP), AT3G62980 (TIR1) and AT4G03190 (AFB1). Author contributions The authors have made the following declaration about their contributions. Conceived and designed the experiments: MRS, PZ, and RS. Performed the experiments: MRS, PZ, and SS. Analysed the data: MRS, PZ, and RS. Shared material and discussed the results: SK and MK. Wrote the paper: MRS, PZ, and RS. Acknowledgements We are grateful to Cornelia Gieseler, Silke Winters and Carin Theres for technical support and members of the Simon laboratory, Noséky N. Soi and Melinka Butenko for critical comments. We thank Jiří Friml and Teva Vernoux for generously supplying plant materials. This work was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG, Si 947/4-1) to RS and by the Alexander-von-Humboldt Foundation to PZ. References Aida M Beis D Heidstra R Willemsen V Blilou I Galinha C Nussaume L Noh YS Amasino R Scheres B. 2004 . The PLETHORA genes mediate patterning of the Arabidopsis root stem cell niche . Cell 119 , 109 – 120 . Google Scholar Crossref Search ADS PubMed WorldCat Albertazzi L Arosio D Marchetti L Ricci F Beltram F. 2009 . Quantitative FRET analysis with the EGFP-mCherry fluorescent protein pair . Photochemistry and Photobiology 85 , 287 – 297 . Google Scholar Crossref Search ADS PubMed WorldCat Bainbridge K Guyomarc’h S Bayer E Swarup R Bennett M Mandel T Kuhlemeier C. 2008 . Auxin influx carriers stabilize phyllotactic patterning . Genes & Development 22 , 810 – 823 . Google Scholar Crossref Search ADS PubMed WorldCat Benková E Michniewicz M Sauer M Teichmann T Seifertová D Jürgens G Friml J. 2003 . Local, efflux-dependent auxin gradients as a common module for plant organ formation . Cell 115 , 591 – 602 . Google Scholar Crossref Search ADS PubMed WorldCat Berckmans B Vassileva V Schmid SPet al. . 2011 . Auxin-dependent cell cycle reactivation through transcriptional regulation of Arabidopsis E2Fa by lateral organ boundary proteins . The Plant Cell 23 , 3671 – 3683 . Google Scholar Crossref Search ADS PubMed WorldCat Bleckmann A Weidtkamp-Peters S Seidel CA Simon R. 2010 . Stem cell signaling in Arabidopsis requires CRN to localize CLV2 to the plasma membrane . Plant Physiology 152 , 166 – 176 . Google Scholar Crossref Search ADS PubMed WorldCat Blilou I Xu J Wildwater M Willemsen V Paponov I Friml J Heidstra R Aida M Palme K Scheres B. 2005 . The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots . Nature 433 , 39 – 44 . Google Scholar Crossref Search ADS PubMed WorldCat Borghi L Bureau M Simon R. 2007 . Arabidopsis JAGGED LATERAL ORGANS is expressed in boundaries and coordinates KNOX and PIN activity . The Plant Cell 19 , 1795 – 1808 . Google Scholar Crossref Search ADS PubMed WorldCat Brunoud G Wells DM Oliva Met al. . 2012 . A novel sensor to map auxin response and distribution at high spatio-temporal resolution . Nature 482 , 103 – 106 . Google Scholar Crossref Search ADS PubMed WorldCat Bureau M Rast MI Illmer J Simon R. 2010 . JAGGED LATERAL ORGAN (JLO) controls auxin dependent patterning during development of the Arabidopsis embryo and root . Plant Molecular Biology 74 , 479 – 491 . Google Scholar Crossref Search ADS PubMed WorldCat Bureau M Simon R. 2008 . JLO regulates embryo patterning and organ initiation by controlling auxin transport . Plant Signaling & Behavior 3 , 145 – 147 . Google Scholar Crossref Search ADS PubMed WorldCat Byrne ME Barley R Curtis M Arroyo JM Dunham M Hudson A Martienssen RA. 2000 . Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis . Nature 408 , 967 – 971 . Google Scholar Crossref Search ADS PubMed WorldCat Clough SJ Bent AF. 1998 . Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . The Plant Journal 16 , 735 – 743 . Google Scholar Crossref Search ADS PubMed WorldCat Cole M Chandler J Weijers D Jacobs B Comelli P Werr W. 2009 . DORNROSCHEN is a direct target of the auxin response factor MONOPTEROS in the Arabidopsis embryo . Development 136 , 1643 – 1651 . Google Scholar Crossref Search ADS PubMed WorldCat Curtis MD Grossniklaus U. 2003 . A gateway cloning vector set for high-throughput functional analysis of genes in planta . Plant Physiology 133 , 462 – 469 . Google Scholar Crossref Search ADS PubMed WorldCat Czechowski T Stitt M Altmann T Udvardi MK Scheible WR. 2005 . Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis . Plant Physiology 139 , 5 – 17 . Google Scholar Crossref Search ADS PubMed WorldCat Dharmasiri N Dharmasiri S Weijers D Lechner E Yamada M Hobbie L Ehrismann JS Jürgens G Estelle M. 2005 . Plant development is regulated by a family of auxin receptor F box proteins . Developmental Cell 9 , 109 – 119 . Google Scholar Crossref Search ADS PubMed WorldCat Ding Z Friml J. 2010 . Auxin regulates distal stem cell differentiation in Arabidopsis roots . Proceedings of the National Academy of Sciences, USA 107 , 12046 – 12051 . Google Scholar Crossref Search ADS WorldCat Dreher KA Brown J Saw RE Callis J. 2006 . The Arabidopsis Aux/IAA protein family has diversified in degradation and auxin responsiveness . The Plant Cell 18 , 699 – 714 . Google Scholar Crossref Search ADS PubMed WorldCat Friml J Vieten A Sauer M Weijers D Schwarz H Hamann T Offringa R Jürgens G. 2003 . Efflux-dependent auxin gradients establish the apical-basal axis of Arabidopsis . Nature 426 , 147 – 153 . Google Scholar Crossref Search ADS PubMed WorldCat Galinha C Hofhuis H Luijten M Willemsen V Blilou I Heidstra R Scheres B. 2007 . PLETHORA proteins as dose-dependent master regulators of Arabidopsis root development . Nature 449 , 1053 – 1057 . Google Scholar Crossref Search ADS PubMed WorldCat Gray WM Kepinski S Rouse D Leyser O Estelle M. 2001 . Auxin regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins . Nature 414 , 271 – 276 . Google Scholar Crossref Search ADS PubMed WorldCat Guo M Thomas J Collins G Timmermans MC. 2008 . Direct repression of KNOX loci by the ASYMMETRIC LEAVES1 complex of Arabidopsis . The Plant Cell 20 , 48 – 58 . Google Scholar Crossref Search ADS PubMed WorldCat Hamann T Benkova E Bäurle I Kientz M Jürgens G. 2002 . The Arabidopsis BODENLOS gene encodes an auxin response protein inhibiting MONOPTEROS-mediated embryo patterning . Genes & Development 16 , 1610 – 1615 . Google Scholar Crossref Search ADS PubMed WorldCat Hardtke CS Berleth T. 1998 . The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development . The EMBO Journal 17 , 1405 – 1411 . Google Scholar Crossref Search ADS PubMed WorldCat Hay A Barkoulas M Tsiantis M. 2006 . ASYMMETRIC LEAVES1 and auxin activities converge to repress BREVIPEDICELLUS expression and promote leaf development in Arabidopsis . Development 133 , 3955 – 3961 . Google Scholar Crossref Search ADS PubMed WorldCat Heidstra R Welch D Scheres B. 2004 . Mosaic analyses using marked activation and deletion clones dissect Arabidopsis SCARECROW action in asymmetric cell division . Genes & Development 18 , 1964 – 1969 . Google Scholar Crossref Search ADS PubMed WorldCat Heisler MG Ohno C Das P Sieber P Reddy GV Long JA Meyerowitz EM. 2005 . Patterns of auxin transport and gene expression during primordium development revealed by live imaging of the Arabidopsis inflorescence meristem . Current Biology 15 , 1899 – 1911 . Google Scholar Crossref Search ADS PubMed WorldCat Kepinski S Leyser O. 2005 . The Arabidopsis F-box protein TIR1 is an auxin receptor . Nature 435 , 446 – 451 . Google Scholar Crossref Search ADS PubMed WorldCat Koncz C Kreuzaler F Kalman Z Schell J. 1984 . A simple method to transfer, integrate and study expression of foreign genes, such as chicken ovalbumin and alpha-actin in plant tumors . The EMBO Journal 3 , 1029 – 1037 . Google Scholar PubMed OpenURL Placeholder Text WorldCat Kwiatkowska D . 2004 . Surface growth at the reproductive shoot apex of Arabidopsis thaliana pin-formed 1 and wild type . Journal of Experimental Botany 55 , 1021 – 1032 . Google Scholar Crossref Search ADS PubMed WorldCat Lodha M Marco CF Timmermans MC. 2013 . The ASYMMETRIC LEAVES complex maintains repression of KNOX homeobox genes via direct recruitment of Polycomb-repressive complex2 . Genes & Development 27 , 596 – 601 . Google Scholar Crossref Search ADS PubMed WorldCat Liscum E Reed JW. 2002 . Genetics of Aux/IAA and ARF action in plant growth and development . Plant Molecular Biology 49 , 387 – 400 . Google Scholar Crossref Search ADS PubMed WorldCat Marchant A Bhalerao R Casimiro I Eklöf J Casero PJ Bennett M Sandberg G. 2002 . AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling . The Plant Cell 14 , 589 – 597 . Google Scholar Crossref Search ADS PubMed WorldCat Mockaitis K Estelle M. 2008 . Auxin receptors and plant development: a new signaling paradigm . Annual Review of Cell and Developmental Biology 24 , 55 – 80 . Google Scholar Crossref Search ADS PubMed WorldCat Morrison SJ Spradling AC. 2008 . Stem cells and niches: mechanisms that promote stem cell maintenance throughout life . Cell 132 , 598 – 611 . Google Scholar Crossref Search ADS PubMed WorldCat Navarro L Dunoyer P Jay F Arnold B Dharmasiri N Estelle M Voinnet O Jones JDG. 2006 . A plant miRNA contributes to antibacterial resistance by repressing auxin signaling . Science 312 , 436 – 439 . Google Scholar Crossref Search ADS PubMed WorldCat Nodine MD Yadegari R Tax FE. 2007 . RPK1 and TOAD2 are two receptor-like kinases redundantly required for Arabidopsis embryonic pattern formation . Developmental Cell 12 , 943 – 956 . Google Scholar Crossref Search ADS PubMed WorldCat Parry G Calderon-Villalobos LI Prigge M Peret B Dharmasiri S Itoh H Lechner E Gray WM Bennett M Estelle M. 2009 . Complex regulation of the TIR1/AFB family of auxin receptors . Proceedings of the National Academy of Sciences, USA 106 , 22540 – 22545 . Google Scholar Crossref Search ADS WorldCat Petrášek J Friml J. 2009 . Auxin transport routes in plant development . Development 136 , 2675 – 2688 . Google Scholar Crossref Search ADS PubMed WorldCat Phelps-Durr TL Thomas J Vahab P Timmermans MC. 2005 . Maize rough sheath2 and its Arabidopsis orthologue ASYMMETRIC LEAVES1 interact with HIRA, a predicted histone chaperone, to maintain knox gene silencing and determinacy during organogenesis . The Plant Cell 17 , 2886 – 2898 . Google Scholar Crossref Search ADS PubMed WorldCat Pi L Aichinger E van der Graaff E Llavata-Peris CI Weijers D Hennig L Groot E Laux T. 2015 . Organizer-derived WOX5 signal maintains root columella stem cells through chromatin-mediated repression of CDF4 Expression . Developmental Cell 33 , 576 – 588 . Google Scholar Crossref Search ADS PubMed WorldCat Rast MI Simon R. 2012 . Arabidopsis JAGGED LATERAL ORGANS acts with ASYMMETRIC LEAVES2 to coordinate KNOX and PIN expression in shoot and root meristems . The Plant Cell 24 , 2917 – 2933 . Google Scholar Crossref Search ADS PubMed WorldCat Reinhardt D Pesce ER Stieger P Mandel T Baltensperger K Bennett M Traas J Friml J Kuhlemeier C. 2003 . Regulation of phyllotaxis by polar auxin transport . Nature 426 , 255 – 260 . Google Scholar Crossref Search ADS PubMed WorldCat Ruegger M Dewey E Gray WM Hobbie L Turner J Estelle M. 1998 . The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast grr1p . Genes & Development 12 , 198 – 207 . Google Scholar Crossref Search ADS PubMed WorldCat Sabatini S Beis D Wolkenfelt Het al. . 1999 . An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root . Cell 99 , 463 – 472 . Google Scholar Crossref Search ADS PubMed WorldCat Sabatini S Heidstra R Wildwater M Scheres B. 2003 . SCARECROW is involved in positioning the stem cell niche in the Arabidopsis root meristem . Genes & Development 17 , 354 – 358 . Google Scholar Crossref Search ADS PubMed WorldCat Sarkar AK Luijten M Miyashima S Lenhard M Hashimoto T Nakajima K Scheres B Heidstra R Laux T. 2007 . Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers . Nature 446 , 811 – 814 . Google Scholar Crossref Search ADS PubMed WorldCat Scheres B Wolkenfelt H Willemsen V Terlouw M Lawson E Dean C Weisbeek P. 1994 . Embryonic origin of the Arabidopsis primary root and root meristem initials . Development 120 , 2475 – 2487 . Google Scholar OpenURL Placeholder Text WorldCat Schubert D Primavesi L Bishopp A Roberts G Doonan J Jenuwein T Goodrich J. 2006 . Silencing by plant Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine 27 . The EMBO Journal 25 , 4638 – 4649 . Google Scholar Crossref Search ADS PubMed WorldCat Soyano T Thitamadee S Machida Y Chua NH. 2008 . Asymmetric LEAVES2-LIKE19/LATERAL ORGAN BOUNDARIES DOMAIN30 and ASL20/LBD18 regulate tracheary element differentiation in Arabidopsis . The Plant Cell 20 , 3359 – 3373 . Google Scholar Crossref Search ADS PubMed WorldCat Sozzani R Iyer-Pascuzzi A. 2014 . Postembryonic control of root meristem growth and development . Current Opinion in Plant Biology 17 , 7 – 12 . Google Scholar Crossref Search ADS PubMed WorldCat Swarup R Kargul J Marchant Aet al. . 2004 . Structure-function analysis of the presumptive Arabidopsis auxin permease AUX1 . Plant Cell 16 , 3069 – 3083 . Google Scholar Crossref Search ADS PubMed WorldCat Tan X Calderon-Villalobos LI Sharon M Zheng C Robinson CV Estelle M Zheng N. 2007 . Mechanism of auxin perception by the TIR1 ubiquitin ligase . Nature 446 , 640 – 645 . Google Scholar Crossref Search ADS PubMed WorldCat Tian H Wabnik K Niu Tet al. . 2014 . WOX5-IAA17 feedback circuit-mediated cellular auxin response is crucial for the patterning of root stem cell niches in Arabidopsis . Molecular Plant 7 , 277 – 289 . Google Scholar Crossref Search ADS PubMed WorldCat Tiwari SB Hagen G Guilfoyle TJ. 2004 . Aux/IAA proteins contain a potent transcriptional repression domain . The Plant Cell 16 , 533 – 543 . Google Scholar Crossref Search ADS PubMed WorldCat Truernit E Bauby H Dubreucq B Grandjean O Runions J Barthélémy J Palauqui JC. 2008 . High-resolution whole-mount imaging of three-dimensional tissue organization and gene expression enables the study of phloem development and structure in Arabidopsis . The Plant Cell 20 , 1494 – 1503 . Google Scholar Crossref Search ADS PubMed WorldCat Tsiantis M Schneeberger R Golz JF Freeling M Langdale JA. 1999 . The maize rough sheath2 gene and leaf development programs in monocot and dicot plants . Science 284 , 154 – 156 . Google Scholar Crossref Search ADS PubMed WorldCat Ulmasov T Hagen G Guilfoyle TJ. 1997 . ARF1, a transcription factor that binds to auxin response elements . Science 276 , 1865 – 1868 . Google Scholar Crossref Search ADS PubMed WorldCat Ulmasov T Hagen G Guilfoyle TJ. 1999 . Activation and repression of transcription by auxin-response factors . Proceedings of the National Academy of Sciences, USA 96 , 5844 – 5849 . Google Scholar Crossref Search ADS WorldCat Vieten A Sauer M Brewer PB Friml J. 2007 . Molecular and cellular aspects of auxin-transport-mediated development . Trends in Plant Science 12 , 160 – 168 . Google Scholar Crossref Search ADS PubMed WorldCat Wang R Zhang Y Kieffer M Yu H Kepinski S Estelle M. 2016 . HSP90 regulates temperature-dependent seedling growth in Arabidopsis by stabilizing the auxin co-receptor F-box protein TIR1 . Nature Communications 7 , 10269 . Google Scholar Crossref Search ADS PubMed WorldCat Weijers D Schlereth A Ehrismann JS Schwank G Kientz M Jürgens G. 2006 . Auxin triggers transient local signaling for cell specification in Arabidopsis embryogenesis . Developmental Cell 10 , 265 – 270 . Google Scholar Crossref Search ADS PubMed WorldCat Yu H Zhang Y Moss BL Bargmann BOR Wang R Prigge M Nemhauser JL Estelle M. 2015 . Untethering the TIR1 auxin receptor from the SCF complex increases its stability and inhibits auxin response . Nature Plants 1 , 14030 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes These authors contributed equally to this work. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
TI - The Arabidopsis JAGGED LATERAL ORGANS (JLO) gene sensitizes plants to auxin
JF - Journal of Experimental Botany
DO - 10.1093/jxb/erx131
DA - 2017-05-17
UR - https://www.deepdyve.com/lp/oxford-university-press/the-arabidopsis-jagged-lateral-organs-jlo-gene-sensitizes-plants-to-iDctcluLyD
SP - 2741
EP - 2755
VL - 68
IS - 11
DP - DeepDyve
ER -