TY - JOUR
AU - Ahmad,, Parvaiz
AB - Abstract Environmental stress imposes negative impacts on the growth and development of the crop plants. The present study was designed to assess the effect of plant growth-promoting rhizobacteria (PGPR) (Pseudomonas aeruginosa and Burkholderia gladioli) on plant pigments and phenolic compounds in 10-day-old root-knot nematode (RKN)-infected Lycopersicon esculentum seedlings. The levels of different osmoprotectants and organic acids were also evaluated in nematode-infected L. esculentum seedlings. Our results revealed that nematode-infected seedlings had reduced levels of plant pigments (chlorophyll (70.5 %), carotenoids (64.8 %) and xanthophylls (34.3 %)) and enhanced levels of phenolic compounds (total phenols (40.3 %), flavonoids (80.9 %), anthocyanins (28.9 %) and polyphenols (366.1 %)), osmoprotectants (total osmolytes (15.3 %), total carbohydrates (54.9 %), reducing sugars (45.3 %), trehalose (94.5 %), glycine betaine (59.01 %) and proline (69.6 %)) and (citric acid (28.4 %), fumaric acid (18.16 %), succinic acid (179.9 %) and malic acid (21.7 %)). The levels of these metabolites increased after inoculation with P. aeruginosa and B. gladioli. The expression of genes encoding different enzymes pertaining to phenols and organic acid metabolism was also studied. The expression of genes was elevated in nematode-infected plants, i.e. CHS (chalcone synthase) by 1.32-folds, PAL (phenylalanine ammonia lyase) by 1.16-folds, CS (citrate synthase) by 1.6-folds, SUCLG1 (succinyl-CoA ligase) by 1.19-folds, SDH (succinate dehydrogenase) by 1.92-folds, FH (fumarate hydratase) by 2.4-folds and malate synthase (MS) by 1.26-folds and further upregulated after PGPR inoculation. This study demonstrates the importance of PGPR in managing nematode infection in plants through alteration in the synthesis of different secondary metabolites in plants. Lycopersicon seedlings, photosynthetic pigments, plant growth-promoting rhizobacteria, root-knot nematodes, RT–qPCR, secondary metabolites Background Environmental adversities are the limiting factors for global agricultural production. The multiple stresses come together to affect the plants in field conditions, thereby modulating the physiological processes of the plants. The phytobiome represents the associations of plants with multiple organisms in an agro-ecosystem or biome. Within the phytobiome, organisms interact to support different activities, such as the production of phytohormones, defensive metabolites, growth factors and nutrient uptake (Sánchez-Cañizares et al. 2017). This zone also includes pathogens or parasites that can attack plants through roots. The pathogenicity of root-knot nematodes (RKNs), which are known for causing serious damage to agricultural crops globally and for placing additional economic burdens on farmers (Khanna et al. 2019). Meloidogyne incognita is a species of RKN that is endoparasitic and are well known for causing damage to a broad range of economically important crops (Sharma and Sharma 2017). However, M. incognita has been reported to cause a 27 % loss in the yield and productivity of Lycopersicon esculentum plants, and 50 % damage overall to vegetable crops worldwide (Kaur et al. 2011; Perry and Moens 2013). Meloidogyne incognita are microscopic organisms that reside in soils and migrate to host plants for infection and the development of feeding mechanisms using stylets (Goellner 2001). They usually feed upon plant root cells by withdrawing nutrients from the roots, which leads to damage to the entire plant due to losses in its productivity (Nyaku et al. 2017). Moreover, M. incognita invasion occurs during their infectious stage, when second-stage juveniles move through the root tip region and subsequently block the plant vascular system. After successfully inhabiting the vascular tissue, the nematodes lose their mobility and complete their entire life cycle within roots (Elhady et al. 2018). The most commonly observed symptoms in plants after nematode infection are wilting, a reduction in plant height and biomass, swollen roots, damage to the plasma membrane, formation of root galls, chlorosis, necrosis and an impact on overall yield (Bais et al. 2006; Jang et al. 2014). Moreover, it has been reported that disturbances that affect different physiological and metabolic processes occur during nematode attack. These include changes in water balance, mineral and solute transport, cytoplasmic leakage and photosynthetic efficiencies (Hallmann et al. 2001; Hirsch et al. 2013; Seid et al. 2015). They also generate oxidative stress within plants, and as a result, a series of defence actions are upregulated to overcome the stress conditions generated within the plant (Saed-Moucheshi et al. 2014). Lycopersicon esculentum is one of the most commonly and abundantly cultivated crops globally. It is a dietary source of various antioxidants and nutrients with a number of health benefits (Giovannucci 1999; Dorais et al. 2008; Slimestad and Verheul 2009). Lycopersicon esculentum is regarded as a good source of lycopene, vitamin C, vitamin K, folate, potassium, fibres, β-carotene, naringenin and chlorogenic acid, which reduce the risks of diseases such as heart-associated problems, cancers, skin diseases and respiratory diseases (Atkinson et al. 2011; Kotíková et al. 2011; Seid et al. 2015). It has been identified as a host plant for M. incognita that disturbs the cell architecture and overall growth and development of the plants. Nematode infection adversely affects the growth and productivity of the plant (Williamson and Hussey 1996; Williamson and Gleason 2003); hence, there is an immediate need to manage the incidence of RKN infection in plants. Nematicides have been used to control the proliferation of nematodes, but these were banned a long time ago because they are an environmental hazard. Resistant crop varieties and immune plants are not yet available on the market (Williamson and Roberts 2009; Radwan et al. 2012; Elhady et al. 2018). Therefore, there is a need to determine novel strategies that are environmentally friendly and economically feasible for the control of nematode infections within plants. Interestingly, it has been reported that plant growth-promoting rhizobacteria (PGPR) can prevent the proliferation of nematodes in soil (Sharma and Sharma 2016). This is well known as a sustainable method for the prevention of RKNs (Saxena et al. 2005; Sharma and Sharma 2015; Nyaku et al. 2017). Plant growth-promoting rhizobacteria often reside in the rhizospheric region of the soil and prevent the growth of pathogenic organisms by their feeding mechanisms, the release of toxins, the secretion of antibiotics and enzymes that interfere with the recognition patterns of plant nematode interactions (Kerry 2000). Furthermore, they promote the phenomenon of induced systemic resistance in plants that protects against nematode attack (Siddiqui and Mahmood 1999). Many PGPR, such as Agrobacterium, Bacillus, Pseudomonas, Rhizobium and Burkholderia, have been shown to induce suppressive activities against M. incognita by reducing gall formation, controlling nematode reproduction, and hatching and killing juveniles through the release of toxins (Chen et al. 2000; Davies et al. 2001; Ali et al. 2002; Khanna et al. 2019). Moreover, PGPR have been shown to elicit stress-induced responses against nematodes in plants through the production of indole-3-acetic acid, 1-aminocyclopropane-1-carboxylate deaminase, ethylene, gibberellins and bioactive compounds that improve the ability of the roots to stimulate mineral uptake within the plant, which is essential for proper functioning and metabolism (Egamberdieva and Kucharova 2009). The release of bioactive (secondary metabolite) agents by microbes against nematode infection has been reported by Liu et al. (2009). Another study has also shown the role of different metabolites synthesized by Pseudomonas sp. in nematode-infected plants. This study isolated different metabolites, such as alkaline metalloproteinase, cyclo (L-Pro-L-Ile) and many other volatile organic compounds (VOCs) that shown nematicidal activities (Gao et al. 2016). Similar to this study, Gao et al. (2016) also reported the production of sphingosine as a defence mechanism in response to RKN infection. Pseudomonas sp. produced protease enzymes in response to M. incognita in tomato plants that induced defences against second-stage juveniles (Sharma and Sharma 2017). In addition, Meyer et al. (2004) demonstrated that numerous microorganisms released proteins associated with the cuticle that suppressed nematode populations within the soil. Plant growth-promoting rhizobacteria effectively colonize the rhizosphere and inhibit pathogens within the phytobiome, thereby improving every aspect of plant growth. The present study was undertaken to determine the potential of PGPR (P. aeruginosa and B. gladioli) for the control of M. incognita infections in 10-day-old L. esculentum seedlings. The potential for PGPR to act as biocontrol agents for RKNs was assessed by studying the effect of microbes on secondary metabolites such as phenolic compounds (flavonoids, anthocyanins, total phenols and polyphenols), osmolytes (carbohydrates, reducing sugars, trehalose, glycine betaine, free amino acid, total osmolytes and proline) and organic acids (citric acid, fumaric acid, succinic acid and malic acid). Molecular studies were performed using RT–qPCR to study the expression of genes that encode for phenol and organic acid metabolism. Materials and Methods Inoculation of bacterial strains The PGPR strains P. aeruginosa MTCC7195 and B. gladioli MTCC10242 were chosen for use in the study, and were purchased from IMTECH (Mohali, Punjab, India). These were cultured under sterile conditions in 50 mL of nutrient broth medium at a 13 g L−1 concentration in a Bio-Oxygen Demand incubator (Caltan (Deluxe Automatic), New Delhi, India). The PGPR were incubated at 28 °C for 24–48 h. The strains were then subcultured for use in other tests. The microbial strain inoculations were completed by growing PGPR strains in 50 mL nutrient broth medium in a Bio-Oxygen Demand incubator at 28 °C for 24–48 h. After incubation, they were centrifuged at 10 000 rpm and 4 °C for 15–20 min. The supernatant was removed, and the pellet that had formed was washed twice, then dissolved in double distilled water to obtain the population, expressed as 109 cells per mL. Culturing of nematodes The nematode cultures were maintained in a greenhouse by collecting infected samples from different sites. Meloidogyne incognita was isolated, identified and maintained for the study. The egg masses were detached from roots and placed in distilled water. They were then incubated at 27 °C to stimulate hatching, followed by the collection of second-stage juvenile nematodes in double distilled water. These were counted using a light microscope, and used for experimental work. Plant material and treatments Certified L. esculentum ‘Pusa Ruby’ (wild tomato) seeds were purchased and sterilized using 0.01 % mercuric chloride (HgCl2) solution. The seeds were dipped in the mercuric chloride solution and were then washed with distilled water. The seeds were grown in autoclaved petri dishes lined with Whatmann filter paper grade 1. Each petri dish contained 30 seeds with or without microbial treatment at a cell density of 109 cells per mL. The seedlings were inoculated with nematodes at a rate of five juveniles per seedling (5 J/S) after the germination of the seeds. The petri dishes were kept in a seed germinator under sterile conditions for 10 days. The standard maintenance conditions for seed germination were a 16-h photoperiod, a white light intensity of 175 μmol m−2 s−1, a relative humidity of 90 % and a temperature of 25–27 °C. Plant pigments The following plant pigments were determined in the present work. Determination of chlorophyll and carotenoid contents. The chlorophyll and carotenoid levels were measured using the protocol proposed by Arnon (1949) and Maclachlan and Zalik (1963). First, 1 g of fresh seedlings was crushed in 4 mL of 80 % acetone. The solution was centrifuged at 10 000 rpm for 20 min at 4 °C. The supernatant was removed, and the chlorophyll and carotenoid contents were determined. The absorbance was read at 645 and 663 nm for chlorophyll and at 480 and 510 nm for carotenoids using a UV-Vis spectrophotometer (Genesys 10 UV, Thermo Fisher Scientific, Waltham, MA, USA). Determination of xanthophyll content. The xanthophyll content was determined using the methods of Lawrence (1990). First, 50 mg of dried plant sample was placed in a 100-mL flask. Then, 30 mL of extract was prepared by mixing 10 mL hexane, 7 mL acetone, 6 mL absolute alcohol and 7 mL toluene and mixing this solution with the sample in the flask for 15–20 min. Then, 2 mL of 40 % methanolic potassium hydroxide was added to the flask. It was incubated at 58 °C in a water bath for 15–20 min and then kept in dark conditions for 1 h. Then, 30 mL of hexane with 10 % sodium sulfate was added to the flask, producing a final volume of 100 mL. The mixture was shaken continuously for 1 min and placed in dark conditions. The upper layer was separated and poured into a 50-mL flask, and the volume was adjusted with hexane. The absorbance was read at 474 nm. Estimation of phenolic compounds Total phenols. The total phenolic content was determined using the method of Singleton and Rossi (1965). First, 500 mg of dried plant sample was crushed in 40 mL of 60 % ethanol and heated at 65 °C for 15 min. The mixture was filtered and re-extracted from the remaining residue, and a volume of 100 mL was maintained by adding 60 % ethanol. Then, 2 mL of the mixture was mixed with 10 mL of Folin–Ciocalteu reagent. To this mixture, 8 mL of sodium carbonate was added, and the resultant solution was stored for 2 h. Absorbance was recorded at 765 nm, and gallic acid was used as the standard to determine total phenols. Flavonoid content. The flavonoid content was determined using the method adopted by Zhishen et al. (1999). First,100 mg of dried plant sample was taken and homogenized in 3 mL of absolute alcohol. Then, 1 mL of prepared extract was mixed with 4 mL of double distilled water, 3 mL of 5 % sodium nitrite and 3 mL of 10 % aluminium chloride. The solution was then incubated for 10 min, and then 2 mL of sodium hydroxide and 2.4 mL of distilled water were added. The absorbance was read at 510 nm, and rutin was used as the standard to determine flavonoid levels. Anthocyanin content. The anthocyanin levels were determined using the Mancinelli (1984) method. First, 1 g of seedling sample was homogenized in 4 mL of acidified methanol that had been prepared by mixing methanol, distilled water and hydrochloric acid at a ratio of 79:20:1. The extract was kept overnight at 4 °C and was then centrifuged at 10 000 g for 15–20 min at 4 °C. The absorbance was read at 530 and 657 nm. Polyphenol contents. The polyphenol content was determined using ultra-high-performance liquid chromatography (UHPLC) (Shimadzu Nexera UHPLC System, Shimadzu, Kyoto, Japan). The samples were prepared by crushing 500 mg of plant sample in 4 mL of 80 % HPLC-grade methanol. The sample was then centrifuged at 10 000 g and 4 °C for 15–20 min. The supernatant was extracted and filtered through micropore filters (0.22 μm pore size). Different standards for 11 polyphenols were run in parallel with the plant samples, and compounds present in the samples were detected and identified (Shimadzu-Lab solutions). The instrument consisted of a photodiode array detector that was connected to a UHPLC machine. The UHPLC machine has the following specifications: column (Shim-pack VP-C8) with a column size of 150 × 4.6 mm, column pore size of 5 μm, flow rate of 1 mL min−1, wavelength of 280 nm and temperature of 25 °C. Estimation of osmoprotectants Total osmolytes. Total osmolytes were measured using a vapour pressure osmometer (Vapro 5600, Wescor, Logan, UT, USA). Total carbohydrates. The total carbohydrate content was determined using the methods of Hodge and Hofreiter (1962). First, 0.1 g of seedling sample was boiled in 5 mL of 2.5 M hydrochloric acid for 4 h. The mixture was cooled to room temperature (37 °C), and sodium carbonate was added to neutralize the reaction mixture. The volume was adjusted to 25 mL with double distilled water. Then, 0.5 mL of this was extracted, 2 mL of Anthrone reagent was added to it and the mixture was heated for 10 min. The absorbance was read at 630 nm after the solution was allowed to cool, and D-glucose was used as the standard to determine total carbohydrates (mg g−1 DW). Reducing sugars Reducing sugars were determined using the protocol adopted by Miller (1959). First, 0.1 g of dried seedling sample was extracted in 80 % ethanol. Then, 3 mL of 3,5-dinitrosalicylic acid (DNSA) was mixed with 3 mL of extractant. The DNSA was prepared by adding 0.2 g phenol crystals to 0.05 g sodium sulfite. This mixture was added to 100 mL of 1 % sodium hydroxide and stored at 4 °C. Finally, 40 % potassium sodium tartrate was added to the extractant, and the absorbance was read at 510 nm. Trehalose content The trehalose content was determined using the method proposed by Trevelyan and Harrison (1956). First, 0.5 g of dried plant sample was macerated in 80 % ethanol. It was then centrifuged at 6000 rpm and 4 °C for 15–20 min. Then, 100 μL of this mixture was dissolved in 4 mL of Anthrone reagent and 2.0 mL of TCA (trichloroacetic acid). The absorbance was read at 620 nm, and glucose was used as the standard to determine the trehalose content. Glycine betaine contents The glycine betaine levels were quantified using the protocol adopted by Grieve and Grattan (1983). First, 500 mg of dried plant sample was macerated in an extractant prepared by mixing 5 mL of distilled water and toluene (0.05 %), which was kept for 24 h prior to use, and filtered through micropore filters with a 0.2 µm pore size. Then, 1 mL of hydrochloric acid (2 N) and 0.1 mL of potassium triiodide were added to 0.5 mL of extract, and the solution was mixed by shaking. The solution was incubated under ice-cold conditions for 2 h, then 2 mL of ice-cold water and 10 mL of 1,2-dichloroethane were added. After that, two distinct layers were formed; the topmost layer was removed, and the absorbance of the lower pink-coloured layer was read at 365 nm. Betaine hydrochloride was used as the standard to determine the glycine betaine content. Proline content The proline content was determined using the method of Bates et al. (1973). First, 0.5 mg of plant tissue was crushed in 10 mL 3 % sulfosalicylic acid. The prepared mixture was centrifuged at 10 000 rpm for 15–20 min. Then, 2.0 mL of the supernatant was removed and mixed with 2.0 mL of ninhydrin and 2.0 mL of glacial acetic acid and then boiled at 100 °C. The samples were moved to ice-cold conditions to halt the reaction, and then 4 mL of toluene was added to the reactants, and the solution was vigorously shaken for a minute. The aqueous layer was removed, and the optical density of the red toluene layer was read at 520 nm. L-Proline was used as the standard to determine the proline content. Free amino acid contents The free amino acid levels were determined using the method of Lee and Takahashi (1966). First, 0.1 g dried seedlings was ground in 80 % alcohol and then heated for 10 min in a water bath. The extract was centrifuged for 15–20 min at 2000 rpm. Then, 3.8 mL of ninhydrin reagent was added to 0.2 mL of reaction mixture and boiled in a water bath. The reaction was cooled until the formation of a purplish blue colour was observed, and the absorbance was read at 570 nm. Organic acid contents The organic acid levels were determined using the method of Chen et al. (2001), with some modifications. First, 0.05 g of oven-dried plant sample was powdered and macerated in 0.5 mL of HPLC-grade absolute methanol and 0.5 mL of hydrochloric acid. The samples were shaken for 4 h and then centrifuged at 13 000 rpm for 15–20 min at 4 °C. The supernatant was then extracted, and 300 µL of HPLC-grade methanol and 100 µL of 50 % sulfuric acid were added. The reactants were incubated overnight in a water bath at a temperature of 65 °C. The reactants were then cooled at 25 °C, and 800 µL of chloroform and 400 µL of double distilled water were added. The reaction mixture was vortexed, and two layers were subsequently formed. The upper layer was discarded, and the lower chloroform layer was carefully removed for organic acid estimation by gas chromatography–mass spectrometry (GC-MS). A sample volume of 2 µL was injected into a GC-MS system (Shimadzu GC-MS-Q2010Plus, Kyoto, Japan) for organic acid determination. The standard conditions for GC were as follows: the carrier was helium gas, the gas flow into the column was set at a rate of 1.7 mL min−1; an analytical column with specifications of ID 0.025 mm, DB-5ms and length 30 m was used; the temperature range of the column was 50 °C for 1 min during the initial stages, followed by an increase of 25 °C min−1 to 125 °C, and a maximum of 300 °C was held for 15 min. The standard conditions for MS were an ion source, temperature conditions of 200 °C, an interface temperature of 280 °C, a solvent cut time of 3 min and relative detection mode. A comparison of the mass spectra obtained with data from the National Institute of Standard and Technology and Wiley 7 Library was undertaken to enable the determination of organic acids. Gene expression analysis RNA was isolated from10-day-old L. esculentum seedlings using the TRIzol method (Invitrogen, Life Technologies, USA). The quantitative analysis was performed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and qualitative analysis with agarose gel electrophoresis (2 %). RNA was treated with DNase (DNA-free kit; Ambion TURBO DNA-free, Thermo Fisher Scientific, Waltham, MA, USA) to remove any DNA contamination and to maintain the purity of the RNA. cDNA synthesis was then completed using the Im-Prom-II™ Reverse Transcription System (Promega, Madison, WI, USA). For this purpose, 1 μg of DNase-exposed RNA was used as a template, and oligoT12 primers (First Choice RLM-RACE Kit, Ambion, Thermo Fisher Scientific, Waltham, MA, USA) were used for the synthesis (Awasthi et al. 2016). The primers designed for the present work are listed in Table 1. Table 1. Nucleotide sequences used in experiment. Primers Primer code Primer sequences Tm (°C) Ubiquitin (Ubq) Forward primer 5′ GAGGAATGCAGATCTTCGTG 3′ Reverse primer 5′ TCCTTGTCCTGGATCTTAGC 3′ Succinate dehydrogenase (SDH) NM_001.3F14 NM_001.3R14 Forward primer 5′ TAAGGATCTGGTGGTGGATATGA3′ Reverse primer 5′ GCAAGCACATAGAATACATTCG3′ 59.8 60.4 Succinyl-CoA ligase alpha 1 (SUCL1) NM_001.2F17 NM_001.2R17 Forward primer 5′ ATCAAGAACTCGGCTGATT3′ Reverse primer 5′ AAGGCCAACAGCAGTAG3′ 60.4 60.5 Citrate synthase, mitochondrial (CS) XM_004.3F18 XM_004.3R18 Forward primer 5′ GGTGGTAATGTCAGTGCTC3′ Reverse primer 5′ CCCACATTCTTCTACAACAGAT3′ 60.3 60.3 Fumarate hydratase 1, mitochondrial (FH) XM_004.2F19 XM_004.2R19 Forward primer 5′ TATCAAGATTGGGCGAACC3′ Reverse primer 5′ CCCTTTCTTTGTATTCAATCCTG3′ 59.5 59.5 Malate synthase, glyoxysomal (MS) XM_004.3F20 XM_004.3R20 Forward primer 5′ TTTCAGATGAATGAAATCTTGTATGAAC3′ Reverse primer 5′ AAGTCGGAGTAACTCCTCATAAA3′ 60.0 60.0 Phenylalanine ammonia lyase (PAL5) gene M9.1F43 M9.1R43 Forward primer 5′ TTTGGATGGAAGCTCTTATGTC3′ Reverse primer 5′ ATCTCTCTCTCAATCATCTTTGT3′ 60.0 59.8 Chalconesynthase (CHS2) HQ.1F44 HQ.1R44 Forward primer 5′ TCGAGTTCTTGTTGTTTGCT3′ Reverse primer 5′ GGCCTTTCAACTTCTGGTAA3′ 60.0 60.2 Primers Primer code Primer sequences Tm (°C) Ubiquitin (Ubq) Forward primer 5′ GAGGAATGCAGATCTTCGTG 3′ Reverse primer 5′ TCCTTGTCCTGGATCTTAGC 3′ Succinate dehydrogenase (SDH) NM_001.3F14 NM_001.3R14 Forward primer 5′ TAAGGATCTGGTGGTGGATATGA3′ Reverse primer 5′ GCAAGCACATAGAATACATTCG3′ 59.8 60.4 Succinyl-CoA ligase alpha 1 (SUCL1) NM_001.2F17 NM_001.2R17 Forward primer 5′ ATCAAGAACTCGGCTGATT3′ Reverse primer 5′ AAGGCCAACAGCAGTAG3′ 60.4 60.5 Citrate synthase, mitochondrial (CS) XM_004.3F18 XM_004.3R18 Forward primer 5′ GGTGGTAATGTCAGTGCTC3′ Reverse primer 5′ CCCACATTCTTCTACAACAGAT3′ 60.3 60.3 Fumarate hydratase 1, mitochondrial (FH) XM_004.2F19 XM_004.2R19 Forward primer 5′ TATCAAGATTGGGCGAACC3′ Reverse primer 5′ CCCTTTCTTTGTATTCAATCCTG3′ 59.5 59.5 Malate synthase, glyoxysomal (MS) XM_004.3F20 XM_004.3R20 Forward primer 5′ TTTCAGATGAATGAAATCTTGTATGAAC3′ Reverse primer 5′ AAGTCGGAGTAACTCCTCATAAA3′ 60.0 60.0 Phenylalanine ammonia lyase (PAL5) gene M9.1F43 M9.1R43 Forward primer 5′ TTTGGATGGAAGCTCTTATGTC3′ Reverse primer 5′ ATCTCTCTCTCAATCATCTTTGT3′ 60.0 59.8 Chalconesynthase (CHS2) HQ.1F44 HQ.1R44 Forward primer 5′ TCGAGTTCTTGTTGTTTGCT3′ Reverse primer 5′ GGCCTTTCAACTTCTGGTAA3′ 60.0 60.2 Open in new tab Table 1. Nucleotide sequences used in experiment. Primers Primer code Primer sequences Tm (°C) Ubiquitin (Ubq) Forward primer 5′ GAGGAATGCAGATCTTCGTG 3′ Reverse primer 5′ TCCTTGTCCTGGATCTTAGC 3′ Succinate dehydrogenase (SDH) NM_001.3F14 NM_001.3R14 Forward primer 5′ TAAGGATCTGGTGGTGGATATGA3′ Reverse primer 5′ GCAAGCACATAGAATACATTCG3′ 59.8 60.4 Succinyl-CoA ligase alpha 1 (SUCL1) NM_001.2F17 NM_001.2R17 Forward primer 5′ ATCAAGAACTCGGCTGATT3′ Reverse primer 5′ AAGGCCAACAGCAGTAG3′ 60.4 60.5 Citrate synthase, mitochondrial (CS) XM_004.3F18 XM_004.3R18 Forward primer 5′ GGTGGTAATGTCAGTGCTC3′ Reverse primer 5′ CCCACATTCTTCTACAACAGAT3′ 60.3 60.3 Fumarate hydratase 1, mitochondrial (FH) XM_004.2F19 XM_004.2R19 Forward primer 5′ TATCAAGATTGGGCGAACC3′ Reverse primer 5′ CCCTTTCTTTGTATTCAATCCTG3′ 59.5 59.5 Malate synthase, glyoxysomal (MS) XM_004.3F20 XM_004.3R20 Forward primer 5′ TTTCAGATGAATGAAATCTTGTATGAAC3′ Reverse primer 5′ AAGTCGGAGTAACTCCTCATAAA3′ 60.0 60.0 Phenylalanine ammonia lyase (PAL5) gene M9.1F43 M9.1R43 Forward primer 5′ TTTGGATGGAAGCTCTTATGTC3′ Reverse primer 5′ ATCTCTCTCTCAATCATCTTTGT3′ 60.0 59.8 Chalconesynthase (CHS2) HQ.1F44 HQ.1R44 Forward primer 5′ TCGAGTTCTTGTTGTTTGCT3′ Reverse primer 5′ GGCCTTTCAACTTCTGGTAA3′ 60.0 60.2 Primers Primer code Primer sequences Tm (°C) Ubiquitin (Ubq) Forward primer 5′ GAGGAATGCAGATCTTCGTG 3′ Reverse primer 5′ TCCTTGTCCTGGATCTTAGC 3′ Succinate dehydrogenase (SDH) NM_001.3F14 NM_001.3R14 Forward primer 5′ TAAGGATCTGGTGGTGGATATGA3′ Reverse primer 5′ GCAAGCACATAGAATACATTCG3′ 59.8 60.4 Succinyl-CoA ligase alpha 1 (SUCL1) NM_001.2F17 NM_001.2R17 Forward primer 5′ ATCAAGAACTCGGCTGATT3′ Reverse primer 5′ AAGGCCAACAGCAGTAG3′ 60.4 60.5 Citrate synthase, mitochondrial (CS) XM_004.3F18 XM_004.3R18 Forward primer 5′ GGTGGTAATGTCAGTGCTC3′ Reverse primer 5′ CCCACATTCTTCTACAACAGAT3′ 60.3 60.3 Fumarate hydratase 1, mitochondrial (FH) XM_004.2F19 XM_004.2R19 Forward primer 5′ TATCAAGATTGGGCGAACC3′ Reverse primer 5′ CCCTTTCTTTGTATTCAATCCTG3′ 59.5 59.5 Malate synthase, glyoxysomal (MS) XM_004.3F20 XM_004.3R20 Forward primer 5′ TTTCAGATGAATGAAATCTTGTATGAAC3′ Reverse primer 5′ AAGTCGGAGTAACTCCTCATAAA3′ 60.0 60.0 Phenylalanine ammonia lyase (PAL5) gene M9.1F43 M9.1R43 Forward primer 5′ TTTGGATGGAAGCTCTTATGTC3′ Reverse primer 5′ ATCTCTCTCTCAATCATCTTTGT3′ 60.0 59.8 Chalconesynthase (CHS2) HQ.1F44 HQ.1R44 Forward primer 5′ TCGAGTTCTTGTTGTTTGCT3′ Reverse primer 5′ GGCCTTTCAACTTCTGGTAA3′ 60.0 60.2 Open in new tab Gene expression studies using qRT–PCR The gene expression of 10-day-old L. esculentum seedlings exposed to nematode infection and PGPR inoculation was investigated using the primers listed in Table 1 using qRT–PCR (Rather et al. 2015). Synthesis of cDNA was completed using the IM-Prom-II™ Reverse Transcription System (Promega, Madison, WI, USA), and primers were designed using Primer3 software (Untergasser et al. 2012). The expression levels were estimated using a Light Cycler 96 Real-Time PCR System, which was operated according to the manufacturer’s instructions (F. Hoffmann-La Roche, Basel, Switzerland). The reaction mixture (20 μL) comprised cDNA (diluted form), 1× Light Cycler 480 SYBR Green I Master (F. Hoffmann-La Roche, Basel, Switzerland) and 1 μM primers (Integrated DNA Technologies, Skokie, IL, USA; primer sequences are listed in Table 1). The qRT–PCR (thermal cycler) protocol had an incubation period of 10–15 min at 95 °C and then 45 cycles with three-step amplification (95 °C for 10 s, 60 °C for 15 s and 72 °C for 25 s). The data interpretation was completed using a dissociation curve formed after heating at 95 °C for 10 s under normal conditions and cooling to 65 °C for 60 s. A temperature of 97 °C for 1 s was attained with a ramping rate of 0.2 °C s−1. A non-template or negative control reaction was also included in the reaction mixtures. The experiment was conducted in triplicate. The Ubq (Ubiquitin) gene was used as a housekeeping (control) gene for the normalization of reactions. The data were investigated using the threshold cycle (Ct) of the amplification curve. The relative gene expression level was measured using the 2Ct method (Livak and Schmittgen 2001; Awasthi et al. 2015), where Ct = (Ct, target − Ct, Ubiquitin)time x − (Ct, target − Ct, Ubiquitin)time 0. Statistical analysis The results were statistically assessed using a two-way analysis of variance (ANOVA) and Tukey’s multiple comparison test to find the HSD (honestly significant difference). The data are presented as the means ± standard deviation (SD). The significant differences were determined at P ≤ 0.05 and 0.01. The data were evaluated using the built-in functions of Microsoft Excel (Microsoft Corporation, Redmond, WA, USA). Results The effect of PGPR on photosynthetic pigments in nematode-infected L. esculentum seedlings Photosynthetic pigments such as total chlorophyll, carotenoids and xanthophylls were assessed. The total chlorophyll content decreased by 70.54 % in the nematode-infected plants compared with the control plants (Fig. 1A–C). The treatment of the nematode-infected plants with P. aeruginosa (M1) resulted in an increase in total chlorophyll levels by 292.9 %. Moreover, the treatment of the infected seedlings with B. gladioli (M2) also increased the level of total chlorophyll in the seedlings by 451.3 %. We also determined that the carotenoid content decreased by 64.85 % in the nematode-infected seedlings compared with the control seedlings. The application of P. aeruginosa (M1) enhanced the carotenoid content by 339.5 % in the nematode-infected seedlings and by 587.3 % with B. gladioli (M2) treatment. The xanthophyll content declined in the nematode-infected plants by 34.32 % in comparison with the control plants. An increase of 137.63 and 235.1 % was observed in the levels of xanthophylls after treatment of the infected seedlings with P. aeruginosa (M1) and B. gladioli (M2), respectively. Figure 1. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on plant pigments: (A) total chlorophyll content, (B) total carotenoid content, (C) total xanthophyll content in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01. Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Figure 1. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on plant pigments: (A) total chlorophyll content, (B) total carotenoid content, (C) total xanthophyll content in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01. Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Phenolic compounds The effect of PGPR on total phenols, flavonoids and anthocyanins in nematode-infected L. esculentum seedlings. The levels of total phenols, flavonoids and anthocyanins increased in the nematode-infected seedlings by 40.39, 80.98 and 28.97 %, respectively (Fig. 2A–C). Furthermore, treatment with P. aeruginosa (M1) led to further increases in the total phenol content (48.30 %), flavonoid content (22.99 %) and anthocyanin content (95.07 %). The treatment of the infected seedlings with B. gladioli (M2) also increased the levels of total phenols, flavonoids and anthocyanin by 94.46, 38.13 and 109.7 %, respectively. Figure 2. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on phenolic compounds: (A) total phenols, (B) total flavonoids, (C) total anthocyanins in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01. Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Figure 2. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on phenolic compounds: (A) total phenols, (B) total flavonoids, (C) total anthocyanins in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01. Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). The effect of PGPR on the total polyphenol content in nematode-infected L. esculentum seedlings. The influence of P. aeruginosa, B. gladioli and nematode infection on the polyphenol content of L. esculentum plants are shown in Table 2. The results of the present study show the production of different polyphenols, such as caffeic acid, gallic acid, chlorogenic acid, quercetin, kaempferol, gallic acid, epicatechin, umbelliferone, ellagic acid, rutin and catechin, in the seedlings treated with nematodes and with P. aeruginosa or B. gladioli. The levels of total polyphenols showed a significant increase of 366.1 % in the nematode-infected seedlings compared with the control seedlings. Total polyphenols were also increased by 113.8 and 58.42 % with P. aeruginosa and B. gladioli treatments, respectively, in the infected seedlings. Table 2. Effect of M1 (109 cells per mL) and M2 (109 cells per mL) inoculation on different polyphenols in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, ** indicates significance at P ≤ 0.01. Different letters on the table indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Treatments Catechin (mean ± SD) Chlorogenic acid (mean ± SD) Caffeic acid (mean ± SD) Umbelliferone (mean ± SD) Rutin (mean ± SD) Ellagic acid (mean ± SD) Quercetin (mean ± SD) Gallic acid (mean ± SD) Epicatechin (mean ± SD) Kaemferol (mean ± SD) Coumeric acid (mean ± SD) Total polyphenol content (mean ± SD) CN 2.653 ± 0.7305 1.54 ± 0.22 2.43 ± 0.1205 1.746 ± 0.2589 6.27 ± 0.9417 1.66 ± 0.5040 0.326 ± 0.19505 1.406 ± 0.1563 0.2503 ± 0.0892 9.23 ± 1.127 0.062 ± 0.0282 27.588 ± 1.00118e N 43.81 ± 5.089 29.41 ± 4.0551 17.74 ± 6.085 4.92 ± 0.3502 8.866 ± 0.3407 6.33 ± 0.5732 - 3.273 ± 0.5641 - 14.18 ± 3.2777 - 128.56 ± 8.8653c M1 16.44 ± 4.6818 20.04 ± 3.9917 7.74 ± 4.0841 2.423 ± 0.4605 5.526 ± 0.4037 3.24 ± 0.2956 0.3473 ± 0.0991 2.66 ± 0.4954 0.732 ± 0.1718 - 0.791 ± 0.1986 59.957 ± 12.1163d M1 + N 128.7 ± 2.575 65.73 ± 1.2595 22.48 ± 1.0453 7.306 ± 0.8021 16.44 ± 1.0006 7.6 ± 0.7808 - 4.07 ± 0.8261 - 22.066 ± 2.614 0.5226 ± 0.0692 274.93 ± 9.0268a M2 30.74 ± 4.872 - 9.32 ± 1.3134 3.906 ± 0.3251 3.75 ± 0.4693 2.18 ± 0.3815 - 3.06 ± 1.3771 1.959 ± 0.0769 14.50 ± 3.060 - 69.709 ± 9.7335d M2 + N 136.8 ± 12.5905 - 2.48 ± 0.8213 13.38 ± 0.7626 15.65 ± 0.43501 9.68 ± 0.9932 - 3.76 ± 1.2150 3.038 ± 0.0646 18.14 ± 1.529 0.7046 ± 0.03458 203.67 ± 13.9362b F-ratio(df 1, 12)T: 1017.436**F-ratio(df 2, 12)D: 124.345**F-ratio(df 2, 12)T × D: 51.898**HSD: 27.352 Treatments Catechin (mean ± SD) Chlorogenic acid (mean ± SD) Caffeic acid (mean ± SD) Umbelliferone (mean ± SD) Rutin (mean ± SD) Ellagic acid (mean ± SD) Quercetin (mean ± SD) Gallic acid (mean ± SD) Epicatechin (mean ± SD) Kaemferol (mean ± SD) Coumeric acid (mean ± SD) Total polyphenol content (mean ± SD) CN 2.653 ± 0.7305 1.54 ± 0.22 2.43 ± 0.1205 1.746 ± 0.2589 6.27 ± 0.9417 1.66 ± 0.5040 0.326 ± 0.19505 1.406 ± 0.1563 0.2503 ± 0.0892 9.23 ± 1.127 0.062 ± 0.0282 27.588 ± 1.00118e N 43.81 ± 5.089 29.41 ± 4.0551 17.74 ± 6.085 4.92 ± 0.3502 8.866 ± 0.3407 6.33 ± 0.5732 - 3.273 ± 0.5641 - 14.18 ± 3.2777 - 128.56 ± 8.8653c M1 16.44 ± 4.6818 20.04 ± 3.9917 7.74 ± 4.0841 2.423 ± 0.4605 5.526 ± 0.4037 3.24 ± 0.2956 0.3473 ± 0.0991 2.66 ± 0.4954 0.732 ± 0.1718 - 0.791 ± 0.1986 59.957 ± 12.1163d M1 + N 128.7 ± 2.575 65.73 ± 1.2595 22.48 ± 1.0453 7.306 ± 0.8021 16.44 ± 1.0006 7.6 ± 0.7808 - 4.07 ± 0.8261 - 22.066 ± 2.614 0.5226 ± 0.0692 274.93 ± 9.0268a M2 30.74 ± 4.872 - 9.32 ± 1.3134 3.906 ± 0.3251 3.75 ± 0.4693 2.18 ± 0.3815 - 3.06 ± 1.3771 1.959 ± 0.0769 14.50 ± 3.060 - 69.709 ± 9.7335d M2 + N 136.8 ± 12.5905 - 2.48 ± 0.8213 13.38 ± 0.7626 15.65 ± 0.43501 9.68 ± 0.9932 - 3.76 ± 1.2150 3.038 ± 0.0646 18.14 ± 1.529 0.7046 ± 0.03458 203.67 ± 13.9362b F-ratio(df 1, 12)T: 1017.436**F-ratio(df 2, 12)D: 124.345**F-ratio(df 2, 12)T × D: 51.898**HSD: 27.352 Open in new tab Table 2. Effect of M1 (109 cells per mL) and M2 (109 cells per mL) inoculation on different polyphenols in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, ** indicates significance at P ≤ 0.01. Different letters on the table indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Treatments Catechin (mean ± SD) Chlorogenic acid (mean ± SD) Caffeic acid (mean ± SD) Umbelliferone (mean ± SD) Rutin (mean ± SD) Ellagic acid (mean ± SD) Quercetin (mean ± SD) Gallic acid (mean ± SD) Epicatechin (mean ± SD) Kaemferol (mean ± SD) Coumeric acid (mean ± SD) Total polyphenol content (mean ± SD) CN 2.653 ± 0.7305 1.54 ± 0.22 2.43 ± 0.1205 1.746 ± 0.2589 6.27 ± 0.9417 1.66 ± 0.5040 0.326 ± 0.19505 1.406 ± 0.1563 0.2503 ± 0.0892 9.23 ± 1.127 0.062 ± 0.0282 27.588 ± 1.00118e N 43.81 ± 5.089 29.41 ± 4.0551 17.74 ± 6.085 4.92 ± 0.3502 8.866 ± 0.3407 6.33 ± 0.5732 - 3.273 ± 0.5641 - 14.18 ± 3.2777 - 128.56 ± 8.8653c M1 16.44 ± 4.6818 20.04 ± 3.9917 7.74 ± 4.0841 2.423 ± 0.4605 5.526 ± 0.4037 3.24 ± 0.2956 0.3473 ± 0.0991 2.66 ± 0.4954 0.732 ± 0.1718 - 0.791 ± 0.1986 59.957 ± 12.1163d M1 + N 128.7 ± 2.575 65.73 ± 1.2595 22.48 ± 1.0453 7.306 ± 0.8021 16.44 ± 1.0006 7.6 ± 0.7808 - 4.07 ± 0.8261 - 22.066 ± 2.614 0.5226 ± 0.0692 274.93 ± 9.0268a M2 30.74 ± 4.872 - 9.32 ± 1.3134 3.906 ± 0.3251 3.75 ± 0.4693 2.18 ± 0.3815 - 3.06 ± 1.3771 1.959 ± 0.0769 14.50 ± 3.060 - 69.709 ± 9.7335d M2 + N 136.8 ± 12.5905 - 2.48 ± 0.8213 13.38 ± 0.7626 15.65 ± 0.43501 9.68 ± 0.9932 - 3.76 ± 1.2150 3.038 ± 0.0646 18.14 ± 1.529 0.7046 ± 0.03458 203.67 ± 13.9362b F-ratio(df 1, 12)T: 1017.436**F-ratio(df 2, 12)D: 124.345**F-ratio(df 2, 12)T × D: 51.898**HSD: 27.352 Treatments Catechin (mean ± SD) Chlorogenic acid (mean ± SD) Caffeic acid (mean ± SD) Umbelliferone (mean ± SD) Rutin (mean ± SD) Ellagic acid (mean ± SD) Quercetin (mean ± SD) Gallic acid (mean ± SD) Epicatechin (mean ± SD) Kaemferol (mean ± SD) Coumeric acid (mean ± SD) Total polyphenol content (mean ± SD) CN 2.653 ± 0.7305 1.54 ± 0.22 2.43 ± 0.1205 1.746 ± 0.2589 6.27 ± 0.9417 1.66 ± 0.5040 0.326 ± 0.19505 1.406 ± 0.1563 0.2503 ± 0.0892 9.23 ± 1.127 0.062 ± 0.0282 27.588 ± 1.00118e N 43.81 ± 5.089 29.41 ± 4.0551 17.74 ± 6.085 4.92 ± 0.3502 8.866 ± 0.3407 6.33 ± 0.5732 - 3.273 ± 0.5641 - 14.18 ± 3.2777 - 128.56 ± 8.8653c M1 16.44 ± 4.6818 20.04 ± 3.9917 7.74 ± 4.0841 2.423 ± 0.4605 5.526 ± 0.4037 3.24 ± 0.2956 0.3473 ± 0.0991 2.66 ± 0.4954 0.732 ± 0.1718 - 0.791 ± 0.1986 59.957 ± 12.1163d M1 + N 128.7 ± 2.575 65.73 ± 1.2595 22.48 ± 1.0453 7.306 ± 0.8021 16.44 ± 1.0006 7.6 ± 0.7808 - 4.07 ± 0.8261 - 22.066 ± 2.614 0.5226 ± 0.0692 274.93 ± 9.0268a M2 30.74 ± 4.872 - 9.32 ± 1.3134 3.906 ± 0.3251 3.75 ± 0.4693 2.18 ± 0.3815 - 3.06 ± 1.3771 1.959 ± 0.0769 14.50 ± 3.060 - 69.709 ± 9.7335d M2 + N 136.8 ± 12.5905 - 2.48 ± 0.8213 13.38 ± 0.7626 15.65 ± 0.43501 9.68 ± 0.9932 - 3.76 ± 1.2150 3.038 ± 0.0646 18.14 ± 1.529 0.7046 ± 0.03458 203.67 ± 13.9362b F-ratio(df 1, 12)T: 1017.436**F-ratio(df 2, 12)D: 124.345**F-ratio(df 2, 12)T × D: 51.898**HSD: 27.352 Open in new tab Osmoprotectants The effect of PGPR on total osmolytes, carbohydrates and reducing sugars in nematode-infected L. esculentum seedlings. Nematode infection led to an increase in the levels of total osmolytes, carbohydrates and reducing sugars by 15.38, 54.91 and 45.37 %, respectively, compared with the control plants (Fig. 3A–C). The total osmolyte content in the infected seedlings increased by 28.8 and 39.5 % after inoculation with P. aeruginosa (M1) and B. gladioli (M2), respectively. Moreover, the total carbohydrate content increased by 41.58 and 63.89 % after treatment with P. aeruginosa (M1) and B. gladioli (M2), respectively. Reducing sugars also increased by 167.9 % when supplemented with P. aeruginosa (M1) and by 127.08 % when supplemented with B. gladioli (M2). Figure 3. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on different osmoprotectants: (A) total osmolytes, (B) total carbohydrates, (C) total reducing sugars, (D) trehalose content, (E) glycine betaine content, (F) proline content, (G) free amino acid content in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01. Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Figure 3. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on different osmoprotectants: (A) total osmolytes, (B) total carbohydrates, (C) total reducing sugars, (D) trehalose content, (E) glycine betaine content, (F) proline content, (G) free amino acid content in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01. Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). The effect of PGPR on trehalose, glycine betaine, proline and free amino acid contents. Nematode infection in L. esculentum seedlings increased the levels of trehalose, glycine betaine and proline by 94.5, 59.01 and 69.6 %, respectively, compared with the control seedlings (Fig. 3D–G). We also observed that free amino acid levels decreased by 58.01 % in the nematode-infected seedlings compared with the control seedlings. The present study also found that levels of trehalose, glycine betaine and proline increased after treatment with P. aeruginosa (M1) by 96.09, 24.75 and 91.4 %, respectively. Moreover, the levels of trehalose, glycine betaine and proline also increased after inoculation with B. gladioli (M2) by 127.9, 32.25 and 121.5 %, respectively. The free amino acid levels increased by 174.4 and 198.5 % in the infected seedlings after treatment with P. aeruginosa (M1) and B. gladioli (M2), respectively. The effect of PGPR on organic acids in L. esculentum seedlings through GC-MS analysis. The levels of fumaric acid, succinic acid, malic acid and citric acid increased in the seedlings exposed to nematode infection by 28.4, 18.16, 179.9 and 21.7 %, respectively, compared with the control seedlings (Table 3). Furthermore, the levels of fumaric acid, succinic acid, malic acid and citric acid increased by 51.07, 67.56, 181.3 and 76.55 % when the nematode-infected seedlings were inoculated with P. aeruginosa (M1). A similar trend was observed with the organic acid levels after the nematode-infected seedlings were treated with B. gladioli (M2). The fumaric acid content increased by 22.96 %, succinic acid by 44.06 %, malic acid by 114.26 % and citric acid by 62.66 % when the nematode-infected seedlings were inoculated with B. gladioli (M2). Table 3. Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on organic acid contents (fumaric acid, citric acid, succinic acid, malic acid) in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, ** indicates significance at P ≤ 0.01). Different letters on the table indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Treatments Fumaric acid (mean ± SD) (mg g−1 FW) Succinic acid (mean ± SD) (mg g−1 FW) Citric acid (mean ± SD) (mg g−1 FW) Malic acid (mean ± SD) (mg g−1 FW) CN 0.359 ± 0.0061e 0.741 ± 0.0283e 2.72 ± 0.2510d 1.60 ± 0.2777f N 0.461 ± 0.0235d 0.876 ± 0.0203cd 3.31 ± 0.1338c 4.48 ± 0.2730e M1 0.538 ± 0.0144bc 0.785 ± 0.0180de 4.58 ± 0.3051b 8.62 ± 0.3452c M1 + N 0.696 ± 0.0078a 1.469 ± 0.0882a 5.86 ± 0.0669a 12.61 ± 0.2331a M2 0.514 ± 0.011c 0.9314 ± 0.0255c 4.23 ± 0.2397b 7.56 ± 0.315d M2 + N 0.567 ± 0.014b 1.26 ± 0.0256b 5.39 ± 0.1607a 9.61 ± 0.251b F-ratio(df 1, 12)T 131.27** 372.4** 105.09** 489.8** F-ratio(df 2, 12)D 177.3** 104.27** 188.44** 1133.23** F-ratio(df 2, 12)T × D 11.19** 65.28** 4.6009** 17.61** HSD 0.0527 0.1153 0.5728 0.7823 Treatments Fumaric acid (mean ± SD) (mg g−1 FW) Succinic acid (mean ± SD) (mg g−1 FW) Citric acid (mean ± SD) (mg g−1 FW) Malic acid (mean ± SD) (mg g−1 FW) CN 0.359 ± 0.0061e 0.741 ± 0.0283e 2.72 ± 0.2510d 1.60 ± 0.2777f N 0.461 ± 0.0235d 0.876 ± 0.0203cd 3.31 ± 0.1338c 4.48 ± 0.2730e M1 0.538 ± 0.0144bc 0.785 ± 0.0180de 4.58 ± 0.3051b 8.62 ± 0.3452c M1 + N 0.696 ± 0.0078a 1.469 ± 0.0882a 5.86 ± 0.0669a 12.61 ± 0.2331a M2 0.514 ± 0.011c 0.9314 ± 0.0255c 4.23 ± 0.2397b 7.56 ± 0.315d M2 + N 0.567 ± 0.014b 1.26 ± 0.0256b 5.39 ± 0.1607a 9.61 ± 0.251b F-ratio(df 1, 12)T 131.27** 372.4** 105.09** 489.8** F-ratio(df 2, 12)D 177.3** 104.27** 188.44** 1133.23** F-ratio(df 2, 12)T × D 11.19** 65.28** 4.6009** 17.61** HSD 0.0527 0.1153 0.5728 0.7823 Open in new tab Table 3. Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on organic acid contents (fumaric acid, citric acid, succinic acid, malic acid) in 10-day-old L. esculentum seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, ** indicates significance at P ≤ 0.01). Different letters on the table indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Treatments Fumaric acid (mean ± SD) (mg g−1 FW) Succinic acid (mean ± SD) (mg g−1 FW) Citric acid (mean ± SD) (mg g−1 FW) Malic acid (mean ± SD) (mg g−1 FW) CN 0.359 ± 0.0061e 0.741 ± 0.0283e 2.72 ± 0.2510d 1.60 ± 0.2777f N 0.461 ± 0.0235d 0.876 ± 0.0203cd 3.31 ± 0.1338c 4.48 ± 0.2730e M1 0.538 ± 0.0144bc 0.785 ± 0.0180de 4.58 ± 0.3051b 8.62 ± 0.3452c M1 + N 0.696 ± 0.0078a 1.469 ± 0.0882a 5.86 ± 0.0669a 12.61 ± 0.2331a M2 0.514 ± 0.011c 0.9314 ± 0.0255c 4.23 ± 0.2397b 7.56 ± 0.315d M2 + N 0.567 ± 0.014b 1.26 ± 0.0256b 5.39 ± 0.1607a 9.61 ± 0.251b F-ratio(df 1, 12)T 131.27** 372.4** 105.09** 489.8** F-ratio(df 2, 12)D 177.3** 104.27** 188.44** 1133.23** F-ratio(df 2, 12)T × D 11.19** 65.28** 4.6009** 17.61** HSD 0.0527 0.1153 0.5728 0.7823 Treatments Fumaric acid (mean ± SD) (mg g−1 FW) Succinic acid (mean ± SD) (mg g−1 FW) Citric acid (mean ± SD) (mg g−1 FW) Malic acid (mean ± SD) (mg g−1 FW) CN 0.359 ± 0.0061e 0.741 ± 0.0283e 2.72 ± 0.2510d 1.60 ± 0.2777f N 0.461 ± 0.0235d 0.876 ± 0.0203cd 3.31 ± 0.1338c 4.48 ± 0.2730e M1 0.538 ± 0.0144bc 0.785 ± 0.0180de 4.58 ± 0.3051b 8.62 ± 0.3452c M1 + N 0.696 ± 0.0078a 1.469 ± 0.0882a 5.86 ± 0.0669a 12.61 ± 0.2331a M2 0.514 ± 0.011c 0.9314 ± 0.0255c 4.23 ± 0.2397b 7.56 ± 0.315d M2 + N 0.567 ± 0.014b 1.26 ± 0.0256b 5.39 ± 0.1607a 9.61 ± 0.251b F-ratio(df 1, 12)T 131.27** 372.4** 105.09** 489.8** F-ratio(df 2, 12)D 177.3** 104.27** 188.44** 1133.23** F-ratio(df 2, 12)T × D 11.19** 65.28** 4.6009** 17.61** HSD 0.0527 0.1153 0.5728 0.7823 Open in new tab Molecular analysis Molecular analysis was undertaken by studying the expression of genes that encode important enzymes involved in the metabolism of phenols and organic acids to evaluate the effect of treatment with P. aeruginosa (M1) and B. gladioli (M2) during nematode infection on L. esculentum seedlings (Fig. 4A–G). We determined that the expression of the PAL (phenylalanine ammonia lyase) and CHS (chalcone synthase) genes was upregulated by 1.16-folds (12.70 %) and 1.32-folds (27.17 %), respectively, in the nematode-infected seedlings compared with the control seedlings. Treatment with P. aeruginosa (M1) further enhanced the expression of the PAL and CHS genes by 2.41-folds (107.1 %) and 2.47-folds (86.6 %), respectively, in the nematode-infected seedlings compared with the control seedlings. Burkholderia gladioli (M2) treatment also led to the upregulation of the expression of the PAL and CHS genes by 2.27-folds (94.86 %) and 2.41-folds (81.96 %), respectively, in the nematode-infected L. esculentum seedlings compared with the control seedlings. We also observed that the expression of the CS (encoding citrate synthase) and FH (encoding fumarate hydratase) genes was elevated by 1.6-folds (52.27 %) and 2.4-folds (139.3 %), respectively, in the nematode-infected seedlings compared with the control seedlings. Additionally, the expression of the SUCLG1 (encoding succinyl-CoA ligase), SDH (encoding succinate dehydrogenase) and MS (encoding malate synthase) genes was increased by 1.19-folds (16.28 %), 1.92-folds (82.05 %) and 1.26-folds (25.97 %), respectively, in the seedlings infected with nematodes compared with the control seedlings. Treatment with P. aeruginosa (M1) further increased the expression levels of the CS, SUCLG1, FH, SDH and MS genes by 4.12-folds (156.4 %), 2.3-folds (96.73 %), 9.07-folds (277.3 %), 2.8-folds (45.79 %) and 2.14-folds (67.26 %), respectively. Additionally, treatment with B. gladioli (M2) resulted in the increased expression of the CS, SUCLG1, FH, SDH and MS genes by 1.96-folds (22.30 %), 6.6-folds (458.3 %), 8.4-folds (252.7 %), 2.85-folds (48.1 %) and 2.19-folds (73.39 %), respectively, in the nematode-infected seedlings compared with the control seedlings. We observed a significant difference in the expression studies of genes encoding organic acids and phenols that assist in overcoming nematode stress. Figure 4. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on gene expression of several genes: (A) FH gene, (B) SDH gene, (C) SUCLG1 gene, (D) CS gene, (E) MS gene, (F) PAL gene, (G) CHS gene in 10-day-old tomato seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Figure 4. Open in new tabDownload slide Effect of M1 (109 cells per mL) and M2 (109 cells per mL) and their combinations on gene expression of several genes: (A) FH gene, (B) SDH gene, (C) SUCLG1 gene, (D) CS gene, (E) MS gene, (F) PAL gene, (G) CHS gene in 10-day-old tomato seedlings under nematode infection. Data are presented as means of three replicates ± SD and HSD values. F-ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at P < 0.5 according to Tukey’s multiple comparison test (CN, control; N, nematode; M1, Pseudomonas aeruginosa; M2, Burkholderia gladioli). Discussion The present study found that nematode infection in L. esculentum plants impaired the activity of photosynthetic pigments, as assessed in terms of the total chlorophyll, carotenoid and xanthophyll contents. The results of our study are supported by an earlier study conducted by Vasil’Eva et al. (2003), who found that RKNs led to a reduction in the levels of chlorophyll b, carotenoids and β-carotene in tomato plants. This study suggested that impairment of the photosynthetic pigments mainly occurred due to the inhibition of enzymatic activities involved in the violaxanthin cycle that disrupted the stabilization of the photosynthetic apparatus (Vasil’Eva et al. 2003). A study using Machilus thunbergii determined that the inhibition of plant pigments (chlorophyll, chlorophyllide, Mg-protoporphyrin IX, pheophytin and protoporphyrin) was due to the development of galls in the plant roots. This study also demonstrated that the water balance of the entire plant was disturbed due to gall formation in the roots, which disturbed the chlorophyll a/b ratio (Yang et al. 2003). A reduction in the total chlorophyll content was also observed in Abelmoschus esculentus subjected to nematode infection (Abbasi et al. 2008). The results of the present study also demonstrated that P. aeruginosa and B. gladioli can increase the levels of plant pigments in the presence of M. incognita infection. We determined that Trichosanthes kirilowii plants subjected to nematode stress had elevated levels of plant pigments when treated with plant growth-promoting microbial strains (Jiang et al. 2018). Moreover, other studies reported that treatment with B. licheniformis in nematode-infected plants led an increase in the levels of different plant pigments (Thakur et al. 2018). According to these studies, B. licheniformis releases gold nanoparticles into the soil that inhibit the survival of nematodes associated with plant roots. Furthermore, a study determined that Bacillus subtilis, B. pumilus and P. fluorescens reduced the M. incognita proliferation in the roots of cow pea and enhanced the levels of photosynthetic pigments (Abd-el-Khair et al. 2019). Another study conducted by da Silva et al. (2019) depicted that Pinus pinaster infested with nematode infection when amended with diazotropic bacteria prevented the degradation of plant pigments and enhanced their synthesis that in turn upregulated the different metabolic activities of the plants. The enhanced photosynthetic activities observed in the present study might be a result of PGPR upregulating the enzymes associated with photosynthetic pigments in plants during nematode attack. Other potential reasons include the fact that microbes increase the organic matter and useful nutrients within the soil, such as nitrogen, potassium, phosphorous and magnesium, that stimulate the production of photosynthetic pigments. In the present study, it was determined that nematode-infected plants showed elevated levels of phenolic compounds such as total phenols, flavonoids, anthocyanins and polyphenols. A number of phenolic compounds, such as monohydroxy and dihydroxy compounds, quinones and cinnamic acid, have been reported to possess nematicidal activities (Mahajan et al. 1992). These are known to control gall formation, egg hatching and the proliferation of second-stage RKNs (Malik et al. 1989). Increases in the levels of chlorogenic acid in tomato subjected to nematode infection were reported by Malik et al. (1989) and Hung and Rohde (1973). These studies suggested that this compound accumulates and strengthens the epidermis against nematode attack. Furthermore, studies on Vigna radiata plants reported that the total phenol content increased during nematode infection (Ahmed et al. 2009). According to these studies, the increase in the level of phenols is mainly due to enhanced expression of the phenylalanine ammonia lyase (PAL) enzyme. Moreover, the increase in the total phenolic content of nematode-infected brinjal plants was attributed to the stimulation of polyphenol oxidase activity (Nayak 2015). Many phenolic compounds, such as sinapic acid, gallic acid, vanillic acid, salicylic acid, protocatechuic acid, ferulic acid and chlorogenic acid, increased in Solanum lycopersicum under nematode stress (Patel et al. 2017). Moreover, flavonoids have been shown to impart resistance to RKNs. These are involved in reducing the mobility of nematodes, reversing nematode activity, hindering the migratory activities of nematodes and ultimately killing the nematodes (Chin et al. 2018). A study found that M. incognita-infected tomato plants had elevated quercetin and luteolin levels at infection sites (Kirwa et al. 2018). The stimulation of anthocyanin activity under biotic stress conditions has also been determined to be due to the upregulation of chalcone synthase activity that is involved in pathogenesis (Winkel-Shirley 2001). The results of the present study also show an increase in the levels of phenolic compounds in nematode-infected plants individually and upon treatment with microbes. Earlier studies reported the role of microbes in determining the levels of phenolic compounds in soybean plants during nematode infection (Kang et al. 2018). These studies suggested that PGPR stimulated the production of nematicidal metabolites, such as 4-vinylphenol and palmitic acid, as determined using transcriptomic and metabolomic analyses. These studies also determined that the synthesis of phytoalexins and phenolic compounds induced systemic resistance during nematode infection (Viswanathan et al. 2003). The stimulation in the levels of phenolic acids was also noticed in cow pea under the influence of M. incognita in the presence of B. subtilis, B. pumilus and P. fluorescens, respectively (Abd-el-Khair et al. 2019). In addition, da Silva et al. (2019) demonstrated that nematode-infected P. pinaster showed higher and improved biosynthesis of phenolics in the presence of diazotropic bacteria as a mechanism of defence against infection to mediate the normal functioning of the plant. In the present study, the control of phenolic compound activity by microorganisms mainly occurred due to the induction of the polyphenol oxidase enzyme and chalcone synthase enzyme activities that mediated the accumulation of phenolic compounds at infection sites to reinforce the cell wall from nematode attack. The present study also determined that levels of osmoprotectants such as sugar, trehalose, reducing sugars, total osmolytes, proline and glycine betaine were stimulated in plants under the influence of PGPR and nematodes. Our results were in agreement with the findings of Haase et al. (2007), who found that levels of amino acids, sugars and carboxylates in Hordeum vulgare increased in the presence of rhizobacterial strains. This study suggested that microbes adhere to the roots and then synthesize sugars and other metabolites that protect the plants from nematode attack (Haase et al. 2007). Metagenomic studies also found that PGPR control the expression levels of genes that encode polysaccharides, amino acids, carbohydrates and protein metabolism (Tian et al. 2015). Jiang et al. (2018) determined that PGPR increased the synthesis of polysaccharides and trichosanthins in T. kirilowii infected with nematodes as a defence action. A similar study on Arabidopsis plants subjected to nematode infections reported that the levels of amino acids and other phosphorylated metabolites increased (Marella et al. 2013). Moreover, this study also reported that the accumulation of different sugars, such as 1-kestose, raffinose and α,α-trehalose, was elevated during nematode attack as an activating response of the plant defence system mediated by microbes (Hofmann et al. 2010). Another paper studied the effects of treatment with Trichoderma harzianum and Serratia marcescens on nematode-infected tomato plants and found that these strains induced systemic resistance in the plants and induced polyphenol oxidase and β-1,3-glucanase activity that triggered the synthesis of osmoprotectants, such as sugars and amines, to elevate the defence expression within the plants (Abd-Elgawad and Kabeil 2012). The elevation in transcript levels of different secondary metabolites has also been determined in the present study, which can be directly attributed to enhanced protein synthesis of enzymes involved in secondary metabolism. The present study also revealed that the levels of all organic acids that were measured (citric, malic, succinic and fumaric acids) were elevated in plants exposed to nematode infection. Our studies find support from a previous study conducted by Seo and Kim (2014), who observed enhanced levels of organic acid formation in Capsicum annum plants exposed to M. incognita infection. Moreover, another study found that nematode-infected rye plants showed increased levels of organic acids that contributed to nematicidal activity in plants (McBride et al. 2000). They found that the accumulation of organic acids at the infection site provided resistance against the pathogens. The levels of oxalic acid, citric acid, acetic acid, formic acid, butyric acid, propionic acid, valeric acid, salicylic acid and ascorbic acid production increased in M. incognita-infected tomato plants that were able to suppress the proliferation of nematodes (Radwan 2017). Volatile organic compounds are known to be involved in the suppression of nematode infection in Coffea arabica plants (Silva et al. 2013). Volatile organic compounds such as (Z)-hex-3-en-1-ol, linalyl acetate, butane-1,4-diol, (E)-hex-3-en-1-ol, (E)-hex-2-enal, hexyl acetate, meso-butane-2,3-diol, butane-1,3-diol,3-hydroxybutan-2-one, 4-hydroxybutan-2-one, nerolidol, (E)-hex-3-en-1-ol, (E)-hex-2-enyl acetate and butane-1,2-diolcan reduce gall formation in infected plants (Silva et al. 2013). A simulation of organic acid synthesis, which primarily examined oxalic acid synthesis, found that Aspergillus niger controlled the incidence of M. incognita infection (Jang et al. 2016). In addition, A. candidus has also been reported to produce citric acid derivatives, such as 2-hydroxypropane-1,2,3-tricarboxylic acid, and 3-hydroxy-5-methoxy-3-(methoxycarbonyl)-5-oxopentanoic acid, which showed an antagonistic relationship with plant parasitic nematodes (Shemshura et al. 2016). Molecular analysis revealed that the increased levels of genes encoding secondary metabolites (phenols and organic acids) in infected plants were further enhanced in the presence of PGPR. Gao et al. (2018) found that expression levels of the PAL and polyphenol oxidase enzymes in soybean plants were stimulated in response to nematode attack. The increase in the expression of genes pertaining to secondary metabolites is mainly attributed to microbe-mediated stimulation of shikimate pathway that triggers the synthesis of many phenolic compounds and other metabolites in plants as defence response. However, in the present study, it is suggested that the induction of the expression levels of genes encoding antioxidants and secondary metabolites is likely due to increased protein levels and enzyme synthesis of polyphenol oxidases, chalcone synthases and phenylalanine lyase as a result of microbial activities. Conclusion In the present study, nematode infection altered the physiological and metabolic characteristics of L. esculentum seedlings. However, inoculation with PGPR resulted in the activation of defence responses in nematode-infected seedlings by increasing the levels of plant photosynthetic pigments, phenolic compounds, osmoprotectants and organic acids. The accumulation of metabolites in plants subjected to nematode infection and inoculated with PGPR shows that this is an effective strategy to overcome nematode stress. The present study therefore suggests that PGPR play a valuable role in stress alleviation for nematode-stressed L. esculentum seedlings. Plant growth-promoting rhizobacteria are an effective, an economical and a promising approach for improving the growth and productivity of plants under nematode infection. However, further research is needed to elucidate the mechanisms underlying the nematicidal activities of PGPR. Acknowledgements The authors are grateful to the Deanship of Scientific Research, King Saud University for supporting this work through Research Group No. RGP-231. Contributions by the Authors K.K., R.B., S.G.G. and P.A. designed the experimental work. K.K., V.L.J. and A.S. performed the work. A.A.A., M.H.S. and N.M. analysed the data and helped in discussion part of the manuscript. K.K., V.L.J., A.S. and P.O. wrote the draft of the manuscript. P.A., P.O. and R.B. revised the manuscript to the present form. Conflict of Interest None declared. Literature Cited Abbasi MW , Ahmed N , Zaki MJ , Shaukat SS . 2008 . Effect of Barleria acanthoides Vahl. on root-knot nematode infection and growth of infected okra and brinjal plants . Pakistan Journal of Botany 40 : 2193 – 2198 . WorldCat Abd-Elgawad MM , Kabeil SS . 2012 . Biological control of Meloidogyne incognita by Trichoderma harzianum and Serratia marcescens and their related enzymatic changes in tomato roots . African Journal of Biotechnology 11 : 16247 – 16252 . Google Scholar Crossref Search ADS WorldCat Abd-El-Khair H , El-Nagdi WM , Youssef MM , Abd-Elgawad MM , Dawood MG . 2019 . Protective effect of Bacillus subtilis, B. pumilus, and Pseudomonas fluorescens isolates against root knot nematode Meloidogyne incognita on cowpea . Bulletin of the National Research Centre 43 : 64 . Google Scholar Crossref Search ADS WorldCat Ahmed N , Abbasi MW , Shaukat SS , Zaki MJ . 2009 . Physiological changes in leaves of mungbean plants infected with Meloidogyne javanica . Phytopathologia Mediterranea 48 : 262 – 268 . WorldCat Ali NI , Siddiqui IA , Shahid Shaukat S , Zaki MJ . 2002 . Nematicidal activity of some strains of Pseudomonas spp . Soil Biology and Biochemistry 34 : 1051 – 1058 . Google Scholar Crossref Search ADS WorldCat Arnon DI . 1949 . Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris . Plant Physiology 24 : 1 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat Atkinson NJ , Dew TP , Orfila C , Urwin PE . 2011 . Influence of combined biotic and abiotic stress on nutritional quality parameters in tomato (Solanum lycopersicum) . Journal of Agricultural and Food Chemistry 59 : 9673 – 9682 . Google Scholar Crossref Search ADS PubMed WorldCat Awasthi P , Mahajan V , Jamwal VL , Kapoor N , Rasool S , Bedi YS , Gandhi SG . 2016 . Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii . Journal of Genetics 95 : 647 – 657 . Google Scholar Crossref Search ADS PubMed WorldCat Awasthi P , Mahajan V , Rather IA , Gupta AP , Rasool S , Bedi YS , Vishwakarma RA , Gandhi SG . 2015 . Plant omics: isolation, identification, and expression analysis of cytochrome P450 gene sequences from Coleus forskohlii . Omics 19 : 782 – 792 . Google Scholar Crossref Search ADS PubMed WorldCat Bais HP , Weir TL , Perry LG , Gilroy S , Vivanco JM . 2006 . The role of root exudates in rhizosphere interactions with plants and other organisms . Annual Review of Plant Biology 57 : 233 – 266 . Google Scholar Crossref Search ADS PubMed WorldCat Bates LS , Waldren RP , Teare ID . 1973 . Rapid determination of free proline for water-stress studies . Plant and Soil 39 : 205 – 207 . Google Scholar Crossref Search ADS WorldCat Chen J , Abawi GS , Zuckerman BM . 2000 . Efficacy of Bacillus thuringiensis, Paecilomyces marquandii, and Streptomyces costaricanus with and without organic amendments against Meloidogyne hapla infecting lettuce . Journal of Nematology 32 : 70 – 77 . Google Scholar PubMed WorldCat Chen M-C , Wang M-K , Chiu C-Y , Huang P-M , King H-B . 2001 . Determination of low molecular weight dicarboxylic acids and organic functional groups in rhizosphere and bulk soils of Tsuga and Yushania in a temperate rain forest . Plant and Soil 231 : 37 – 44 . Google Scholar Crossref Search ADS WorldCat Chin S , Behm C , Mathesius U . 2018 . Functions of flavonoids in plant–nematode interactions . Plants 7 : 85 . Google Scholar Crossref Search ADS WorldCat Davies KG , Fargette M , Balla G , Daud AI , Duponnois R , Gowen SR , Mateille T , Phillips MS , Sawadogo A , Trivino C , Vouyoukalou E , Trudgill DL . 2001 . Cuticle heterogeneity as exhibited by Pasteuria spore attachment is not linked to the phylogeny of parthenogenetic root-knot nematodes (Meloidogyne spp.) . Parasitology 122 : 111 – 120 . Google Scholar Crossref Search ADS PubMed WorldCat Dorais M , Ehret DL , Papadopoulos AP . 2008 . Tomato (Solanum lycopersicum) health components: from the seed to the consumer . Phytochemistry Reviews 7 : 231 – 250 . Google Scholar Crossref Search ADS WorldCat Egamberdieva D , Kucharova Z . 2009 . Selection for root colonising bacteria stimulating wheat growth in saline soils . Biology and Fertility of Soils 45 : 563 – 571 . Google Scholar Crossref Search ADS WorldCat Elhady A , Adss S , Hallmann J , Heuer H . 2018 . Rhizosphere microbiomes modulated by pre-crops assisted plants in defense against plant-parasitic nematodes . Frontiers in Microbiology 9 : 1133 . Google Scholar Crossref Search ADS PubMed WorldCat Gao H , Qi G , Yin R , Zhang H , Li C , Zhao X . 2016 . Bacillus cereus strain S2 shows high nematicidal activity against Meloidogyne incognita by producing sphingosine . Scientific Reports 6 : 7 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat Gao X , Zhang S , Zhao X , Wu Q . 2018 . Potassium-induced plant resistance against soybean cyst nematode via root exudation of phenolic acids and plant pathogen-related genes . PLoS One 13 : e0200903 . Google Scholar Crossref Search ADS PubMed WorldCat Giovannucci E . 1999 . Tomatoes, tomato-based products, lycopene, and cancer: review of the epidemiologic literature . Journal of the National Cancer Institute 91 : 317 – 331 . Google Scholar Crossref Search ADS PubMed WorldCat Goellner M , Wang X , Davis EL . 2001 . Endo-beta-1,4-glucanase expression in compatible plant-nematode interactions . The Plant Cell 13 : 2241 – 2255 . Google Scholar PubMed WorldCat Grieve CM , Grattan SR . 1983 . Rapid assay for determination of water soluble quaternary ammonium compounds . Plant and Soil 70 : 303 – 307 . Google Scholar Crossref Search ADS WorldCat Haase S , Ruess L , Neumann G , Marhan S , Kandeler E . 2007 . Low-level herbivory by root-knot nematodes (Meloidogyne incognita) modifies root hair morphology and rhizodeposition in host plants (Hordeum vulgare) . Plant and Soil 301 : 151 – 164 . Google Scholar Crossref Search ADS WorldCat Hallmann J , Quadt-Hallmann A , Miller WG , Sikora RA , Lindow SE . 2001 . Endophytic colonization of plants by the biocontrol agent Rhizobium etli G12 in relation to Meloidogyne incognita infection . Phytopathology 91 : 415 – 422 . Google Scholar Crossref Search ADS PubMed WorldCat Hirsch PR , Miller AJ , Dennis PG . 2013 . Do root exudates exert more influence on rhizosphere bacterial community structure than other rhizodeposits? In: de Bruijn FJ , ed. Molecular microbial ecology of the rhizosphere . Hoboken, NJ: John Wiley & Sons, Inc. , 229 – 242 . Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Hodge J , Hofreiter B . 1962 . Methods in carbohydrate chemistry . New York : Academic Press . Google Preview WorldCat COPAC Hofmann J , El Ashry Ael N , Anwar S , Erban A , Kopka J , Grundler F . 2010 . Metabolic profiling reveals local and systemic responses of host plants to nematode parasitism . The Plant Journal 62 : 1058 – 1071 . Google Scholar PubMed WorldCat Hung C , Rohde RA . 1973 . Phenol accumulation related to resistance in tomato to infection by root-knot and lesion nematodes Journal of Nematology 5 : 253 – 258 . Google Scholar PubMed WorldCat Jang JY , Choi YH , Shin TS , Kim TH , Shin KS , Park HW , Kim YH , Kim H , Choi GJ , Jang KS , Cha B , Kim IS , Myung EJ , Kim JC . 2016 . Biological control of Meloidogyne incognita by Aspergillus niger F22 producing oxalic acid . PLoS One 11 : e0156230 . Google Scholar Crossref Search ADS PubMed WorldCat Jang JY , Dang QL , Choi YH , Choi GJ , Jang KS , Cha B , Luu NH , Kim JC . 2014 . Nematicidal activities of 4-quinolone alkaloids isolated from the aerial part of Triumfetta grandidens against Meloidogyne incognita . Journal of Agricultural and Food Chemistry 63 : 68 – 74 . Google Scholar Crossref Search ADS WorldCat Jiang CH , Xie P , Li K , Xie YS , Chen LJ , Wang JS , Xu Q , Guo JH . 2018 . Evaluation of root-knot nematode disease control and plant growth promotion potential of biofertilizer Ning shield on Trichosanthes kirilowii in the field . Brazilian Journal of Microbiology 49 : 232 – 239 . Google Scholar Crossref Search ADS PubMed WorldCat Kang W , Zhu X , Wang Y , Chen L , Duan Y . 2018 . Transcriptomic and metabolomic analyses reveal that bacteria promote plant defense during infection of soybean cyst nematode in soybean . BMC Plant Biology 18 : 86 . Google Scholar Crossref Search ADS PubMed WorldCat Kaur DN , Sharma S , Sultan M . 2011 . Effect of different chemicals on root knot nematode in seed beds of tomato . Plant Disease Research 26 : 170 – 178 . WorldCat Kerry BR . 2000 . Rhizosphere interactions and the exploitation of microbial agents for the biological control of plant-parasitic nematodes . Annual Review of Phytopathology 38 : 423 – 441 . Google Scholar Crossref Search ADS PubMed WorldCat Khanna K , Jamwal VL , Kohli SK , Gandhi SG , Ohri P , Bhardwaj R , Wijaya L , Alyemeni MN , Ahmad P . 2019 . Role of plant growth promoting bacteria (PGPR) as biocontrol agents of Meloidogyne incognita through improved plant defense of Lycopersicon esculentum . Plant and Soil 436 : 325 – 345 . Google Scholar Crossref Search ADS WorldCat Kirwa HK , Murungi LK , Beck JJ , Torto B . 2018 . Elicitation of differential responses in the root-knot nematode Meloidogyne incognita to tomato root exudate cytokinin, flavonoids, and alkaloids . Journal of Agricultural and Food Chemistry 66 : 11291 – 11300 . Google Scholar Crossref Search ADS PubMed WorldCat Kotíková Z , Lachman J , Hejtmánková A , Hejtmánková K . 2011 . Determination of antioxidant activity and antioxidant content in tomato varieties and evaluation of mutual interactions between antioxidants . LWT - Food Science and Technology 44 : 1703 – 1710 . Google Scholar Crossref Search ADS WorldCat Lawrence J . 1990 . Determination of total xanthophyll and marigold oleoresin . Journal of Association of Official Analytical Chemists 2 : 970 – 975 . WorldCat Lee YP , Takahashi T . 1966 . An improved colorimetric determination of amino acids with the use of ninhydrin . Analytical Biochemistry 14 : 71 – 77 . Google Scholar Crossref Search ADS WorldCat Liu YJ , Zhai CY , Liu Y , Zhang KQ . 2009 . Nematicidal activity of Paecilomyces spp. and isolation of a novel active compound . Journal of Microbiology 47 : 248 – 252 . Google Scholar Crossref Search ADS WorldCat Livak KJ , Schmittgen TD . 2001 . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method . Methods 25 : 402 – 408 . Google Scholar Crossref Search ADS PubMed WorldCat Maclachlan S , Zalik S . 1963 . Plastid structure, chlorophyll concentration and free amino acid composition of a chlorophyll mutant of barley . Canadian Journal of Botany 41 : 1053 – 1062 . Google Scholar Crossref Search ADS WorldCat Mahajan R , Kaur D , Bajaj KL . 1992 . Nematicidal activity of phenolic compounds against Meloidogyne incognita . Nematologia Mediterranea 20 : 217 – 219 . WorldCat Malik MS , Singh Dhindsa K , Pal V , Verma KK , Sangwan NK , Bhatti DS . 1989 . Nematicidal efficacy of substituted phenols, phenoxyacetic acid esters and hydrazides: a structure-activity relationship study . Nematologica 35 : 366 – 370 . Google Scholar Crossref Search ADS WorldCat Mancinelli AL . 1984 . Photoregulation of anthocyanin synthesis: VIII. Effect of light pretreatments . Plant Physiology 75 : 447 – 453 . Google Scholar Crossref Search ADS PubMed WorldCat Marella HH , Nielsen E , Schachtman DP , Taylor CG . 2013 . The amino acid permeases AAP3 and AAP6 are involved in root-knot nematode parasitism of Arabidopsis . Molecular Plant-Microbe Interactions 26 : 44 – 54 . Google Scholar Crossref Search ADS PubMed WorldCat McBride RG , Mikkelsen RL , Barker KR . 2000 . The role of low molecular weight organic acids from decomposing rye in inhibiting root-knot nematode populations in soil . Applied Soil Ecology 15 : 243 – 251 . Google Scholar Crossref Search ADS WorldCat Meyer SL , Huettel RN , Liu XZ , Humber RA , Juba J , Nitao JK . 2004 . Activity of fungal culture filtrates against soybean cyst nematode and root-knot nematode egg hatch and juvenile motility . Nematology 6 : 23 – 32 . Google Scholar Crossref Search ADS WorldCat Miller GL . 1959 . Use of dinitrosalicylic acid reagent for determination of reducing sugar . Analytical Chemistry 31 : 426 – 428 . Google Scholar Crossref Search ADS WorldCat Nayak DK . 2015 . Effects of nematode infection on contents of phenolic substances as influenced by root-knot nematode, Meloidogyne incognita in susceptible and resistant brinjal cultivars . Agricultural Science Digest - A Research Journal 35 : 163 . Google Scholar Crossref Search ADS WorldCat Nyaku ST , Affokpon A , Danquah A , Brentu FC . 2017 . Harnessing useful rhizosphere microorganisms for nematode control . In: Shah MM and Mahamood M, eds. Nematology-concepts, diagnosis and control . InTech . Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Patel VS , Shukla YM , Dhruve JJ . 2017 . Influence of root knot nematode (Meloidogyne spp.) on phenolic acid profile in root of tomato (Solanum lycopersicum L.) . International Journal of Current Microbiology and Applied Sciences 6 : 840 – 848 . Google Scholar Crossref Search ADS WorldCat Perry RN , Moens M . 2013 . Plant nematology . Boston, MA: CABI. Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Radwan MA . 2017 . Comparative suppressive effect of some organic acids against Meloidogyne incognita infecting tomato . Pakistan Journal of Nematology 35 : 197 – 208 . Google Scholar Crossref Search ADS WorldCat Radwan MA , Farrag SAA , Abu-Elamayem MM , Ahmed NS . 2012 . Biological control of the root-knot nematode, Meloidogyne incognita on tomato using bioproducts of microbial origin . Applied Soil Ecology 56 : 58 – 62 . Google Scholar Crossref Search ADS WorldCat Rather IA , Awasthi P , Mahajan V , Bedi YS , Vishwakarma RA , Gandhi SG . 2015 . Molecular cloning and functional characterization of an antifungal PR-5 protein from Ocimum basilicum . Gene 558 : 143 – 151 . Google Scholar Crossref Search ADS PubMed WorldCat Saed-Moucheshi A , Pakniyat H , Pirasteh-Anosheh H , Azooz MM (eds). 2014 . Role of ROS as signaling molecules in plants . In: Oxidative damage to plants . Oxford : Elsevier , 585 – 620 . Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Sánchez-Cañizares C , Jorrín B , Poole PS , Tkacz A . 2017 . Understanding the holobiont: the interdependence of plants and their microbiome . Current Opinion in Microbiology 38 : 188 – 196 . Google Scholar Crossref Search ADS PubMed WorldCat Saxena A , Lata Shende R , Pandey A . 2005 . Culturing of plant growth promoting rhizobacteria . In: Gopi KP , Varma A , eds. Basic research applications of mycorrhizae . New Delhi, India : IK International Pvt Ltd , 453 – 474 . Google Preview WorldCat COPAC Seid A , Fininsa C , Mekete T , Decraemer W , Wesemael WML . 2015 . Tomato (Solanum lycopersicum) and root-knot nematodes (Meloidogyne spp.) – a century-old battle . Nematology 17 : 995 – 1009 . Google Scholar Crossref Search ADS WorldCat Seo Y , Kim YH . 2014 . Control of Meloidogyne incognita using mixtures of organic acids . The Plant Pathology Journal 30 : 450 – 455 . Google Scholar Crossref Search ADS PubMed WorldCat Sharma IP , Sharma A . 2015 . Application of arbuscular mycorrhiza for managing root-knot disease in tomato (Lycopersicon esculentum) under glass-house conditions in Pantnagar, India . African Journal of Microbiology Research 9 : 463 – 468 . Google Scholar Crossref Search ADS WorldCat Sharma IP , Sharma AK . 2016 . Physiological and biochemical changes in tomato cultivar PT-3 with dual inoculation of mycorrhiza and PGPR against root-knot nematode . Symbiosis 71 : 175 – 183 . Google Scholar Crossref Search ADS WorldCat Sharma IP , Sharma AK . 2017 . Effective control of root-knot nematode disease with Pseudomonad rhizobacteria filtrate . Rhizosphere 3 : 123 – 125 . Google Scholar Crossref Search ADS WorldCat Shemshura ON , Bekmakhanova NE , Mazunina MN , Meyer SL , Rice CP , Masler EP . 2016 . Isolation and identification of nematode-antagonistic compounds from the fungus Aspergillus candidus . FEMS Microbiology Letters 363 : fnw026 . Google Scholar Crossref Search ADS PubMed WorldCat Siddiqui ZA , Mahmood I . 1999 . Role of bacteria in the management of plant parasitic nematodes: a review . Bioresource Technology 69 : 167 – 179 . Google Scholar Crossref Search ADS WorldCat Silva WRJ , Machado ART , Campos VAC , Zeri ACM , Campos VP , Oliveira DF . 2013 . Volatile organic compounds for the control of Meloidogyne exigua in Coffea arabica . Tropical Plant Pathology 38 : 375 – 386 . Google Scholar Crossref Search ADS WorldCat da Silva MN , Pintado ME , Sarmento B , Stamford NP , Vasconcelos MW . 2019 . A biofertilizer with diazotrophic bacteria and a filamentous fungus increases Pinus pinaster tolerance to the pinewood nematode (Bursaphelenchus xylophilus) . Biological Control 132 : 72 – 80 . Google Scholar Crossref Search ADS WorldCat Singleton VL , Rossi JA . 1965 . Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents . American journal of Enology and Viticulture 16 : 144 – 158 . WorldCat Slimestad R , Verheul M . 2009 . Review of flavonoids and other phenolics from fruits of different tomato (Lycopersicon esculentum Mill.) cultivars . Journal of the Science of Food and Agriculture 89 : 1255 – 1270 . Google Scholar Crossref Search ADS WorldCat Thakur RK , Shirkot P , Dhirta B . 2018 . Studies on effect of gold nanoparticles on Meloidogyne incognita and tomato plants growth and development . Cold Spring Harbor Laboratory. BioRxiv. doi: Tian BY , Cao Y , Zhang KQ . 2015 . Metagenomic insights into communities, functions of endophytes, and their associates with infection by root-knot nematode, Meloidogyne incognita, in tomato roots . Scientific Reports 5 : 17087 . Google Scholar Crossref Search ADS PubMed WorldCat Trevelyan WE , Harrison JS . 1956 . Studies on yeast metabolism. 5. The trehalose content of baker’s yeast during anaerobic fermentation . The Biochemical Journal 62 : 177 – 183 . Google Scholar PubMed WorldCat Untergasser A , Cutcutache I , Koressaar T , Ye J , Faircloth BC , Remm M , Rozen SG . 2012 . Primer3–new capabilities and interfaces . Nucleic Acids Research 40 : e115 . Google Scholar Crossref Search ADS PubMed WorldCat Vasil’Eva I , Vanyushkin S , Zinov’Eva S , Udalova ZV , Bolychevtseva YV , Paseshnichenko V . 2003 . Photosynthetic pigments of tomato plants under conditions of biotic stress and effects of furostanol glycosides . Applied Biochemistry and Microbiology 39 : 606 – 612 . Google Scholar Crossref Search ADS WorldCat Viswanathan R , Nandakumar R , Samiyappan R . 2003 . Role of pathogenesis-related proteins in rhizobacteria-mediated induced systemic resistance against Colletotrichum falcatum in sugarcane . Journal of Plant Diseases and Protection 110 : 524 – 534 . WorldCat Williamson VM , Gleason CA . 2003 . Plant-nematode interactions . Current Opinion in Plant Biology 6 : 327 – 333 . Google Scholar Crossref Search ADS PubMed WorldCat Williamson VM , Hussey RS . 1996 . Nematode pathogenesis and resistance in plants . The Plant Cell 8 : 1735 – 1745 . Google Scholar PubMed WorldCat Williamson VM , Roberts PA . 2009 . Mechanisms and genetics of resistance . In: Perry RN , Moens M , Starr JL , eds. Root-knot nematodes . Wallingford, UK : CABI , 301 – 325 . Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Winkel-Shirley B . 2001 . Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology . Plant Physiology 126 : 485 – 493 . Google Scholar Crossref Search ADS PubMed WorldCat Yang C-M , Yang M-M , Hsu J-M , Jane W-N . 2003 . Herbivorous insect causes deficiency of pigment-protein complexes in an oval-pointed cecidomyiid gall of Machilus thunbergii leaf . Botanical Bulletin of Academia Sinica 44 : 315 – 321 . WorldCat Zhishen J , Mengcheng T , Jianming W . 1999 . The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals . Food Chemistry 64 : 555 – 559 . Google Scholar Crossref Search ADS WorldCat © The Author(s) 2019. Published by Oxford University Press on behalf of the Annals of Botany Company. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.
TI - Evaluation of the role of rhizobacteria in controlling root-knot nematode infection in Lycopersicon esculentum plants by modulation in the secondary metabolite profiles
JF - AoB Plants
DO - 10.1093/aobpla/plz069
DA - 2019-11-01
UR - https://www.deepdyve.com/lp/oxford-university-press/evaluation-of-the-role-of-rhizobacteria-in-controlling-root-knot-hXLyErDCnw
VL - 11
IS - 6
DP - DeepDyve
ER -