TY - JOUR
AU - Pelayo, Jacinta S.
AB - Abstract Proteus mirabilis is an important cause of urinary tract infection (UTI) in patients with complicated urinary tracts. Thirty-five strains of P. mirabilis isolated from UTI were examined for the adherence capacity to epithelial cells. All isolates displayed the aggregative adherence (AA) to HEp-2 cells, a phenotype similarly presented in LLC-MK2 cells. Biofilm formation on polystyrene was also observed in all strains. The mannose-resistant Proteus-like fimbriae (MR/P), Type I fimbriae and AAF/I, II and III fimbriae of enteroaggregative Escherichia coli were searched by the presence of their respective adhesin-encoding genes. Only the MR/P fimbrial subunits encoding genes mrpA and mrpH were detected in all isolates, as well as MR/P expression. A mutation in mrpA demonstrated that MR/P is involved in aggregative adherence to HEp-2 cells, as well as in biofilm formation. However, these phenotypes are multifactorial, because the mrpA mutation reduced but did not abolish both phenotypes. The present results reinforce the importance of MR/P as a virulence factor in P. mirabilis due to its association with AA and biofilm formation, which is an important step for the establishment of UTI in catheterized patients. Proteus mirabilis, cystitis, aggregative adherence, HEp-2 cells, MR/P fimbriae Introduction Proteus mirabilis is a common cause of urinary tract infection (UTI) in patients with short- and long-term indwelling urinary catheters, and in individuals with structural or functional abnormalities of the urinary tract. These infections may cause cystitis and serious complications such as pyelonephritis, bacteraemia and stone formation, which can cause severe damage in kidney tissue and may block catheters (Rózalski et al., 1997; Coker et al., 2000). Proteus mirabilis expresses several putative virulence factors, such as urease, flagella (associated with the swarming phenomenon), resistance to normal serum, IgG and IgA proteases, outer-membrane proteins and fimbriae (Rózalski et al., 1997). A variety of fimbriae and haemagglutinins have been detected in P. mirabilis, such as mannose-resistant Proteus-like fimbriae (MR/P), mannose-resistant Klebsiella-like haemagglutinin, nonagglutinating fimbriae, P. mirabilis fimbriae, ambient-temperature fimbriae, P. mirabilis P-like fimbriae and mannose-sensitive fimbriae. Among them, MR/P is the best understood, and its presence has been associated with the development of pyelonephritis (Old & Adegbola, 1982; Bahrani & Mobley, 1994; Rózalski et al., 1997). This fimbria is encoded by the mrp gene cluster that contains two divergent transcripts: mrpABCDEFGHJ (mrp operon) and mrpI. mrpA encodes the major structural fimbrial subunit, mrpBEFG encodes the smaller subunits, mrpD encodes the chaperone, mrpC encodes the usher, mrpH encodes the pilin of fimbriae, and mrpJ encodes a protein that represses transcription of the flagellar regulon (Bahrani & Mobley, 1994; Li et al., 1999, 2001). mrpI encodes a recombinase that switches the invertible element from ON to OFF (transcription of the mrp operon) or from OFF to ON, which prevents the transcription of the mrp operon (Zhao et al., 1997). Colonization of the epithelium is the first step in P. mirabilis uropathogenesis and such an ability can be demonstrated in vitro using distinct cell lines (Rózalski et al., 1997). However, the mechanisms by which P. mirabilis adhere to epithelial cells in vivo are not completely understood (Bahrani & Mobley, 1994; Rózalski et al., 1997). For some pathogens, such as the diarrhoeagenic Escherichia coli pathotypes, adherence ability to HeLa or HEp-2 cells is expressed in specific patterns known as localized adherence, where the bacteria adhere to the cell surface as tight clusters; aggregative adherence (AA), where the bacteria adhere in a stacked-brick pattern, forming aggregates of bacteria on the cell surface and on the cover slip; and diffuse adherence, where the bacteria adhere diffusely to the cell surface (Scaletsky et al., 1984; Nataro et al., 1987). The AA pattern is the characteristic that defines enteroaggregative E. coli (EAEC), one of the diarrhoeagenic E. coli pathotypes (Nataro et al., 1987). Studies demonstrating fimbriae-mediated adhesion of P. mirabilis to tissue culture cells in vitro have been reported by some authors, but none of them described a characteristic pattern of adherence (Sareneva et al., 1990; Cook et al., 1995). In this study, the in vitro adherence pattern of P. mirabilis strains isolated from patients with UTI, and the establishment of the AA pattern displayed by these isolates were investigated. Materials and methods Bacterial strains and vectors Thirty-five P. mirabilis strains isolated from urine of patients (1–71 years old; median age, 25) with community-acquired UTI were examined in this study. The population analysed (21 men and 14 women) was selected from patients attending the emergency room of public hospitals and a clinical laboratory in the city of Londrina, Brazil. Strains were isolated between April 2001 and May 2002. The bacterial isolates were identified by MicroScan (Dade Behring, CA) using the Neg Combo 20 plates. The identification was confirmed by biochemical tests in the authors' laboratory (Farmer, 1999) and isolates were stored at −70°C in tryptic soy broth (TSB) (Biobras, Brazil), with 20% glycerol. For MR/P optimal expression, P. mirabilis strains were grown statically in Luria–Bertani (LB) broth at 37°C for 48 h. The recombinant MrpA-expressing strain was a gift from Dr Pablo Zunino (Instituto de Investigaciones Biológicas Clemente Estable, Uruguay) and has been described previously (Zunino et al., 2001). The suicide vector pJP5603 and E. coli S17-1(λpir) (Penfold & Pemberton, 1992) were used in the mutagenesis experiments. The following strains were used as a positive control for PCR studies: P. mirabilis HI4320 (Mobley & Warren, 1987), E. coli V-27 (Johnson & Stell, 2000), E. coli 042 (Czeczulin et al., 1997) and E. coli 17-2 (Nataro et al., 1992). Escherichia coli K12 HB101 (Sambrook et al., 1989) was used as a negative control in PCR reactions. The antibiotics kanamycin (50 µg mL−1), polymyxin B (50 µg mL−1) and ampicillin (100 µg mL−1) were used as indicated. Adherence assays to HEp-2 and LLC-MK2 cells Proteus mirabilis isolates were tested for adherence to HEp-2 (human laryngeal carcinoma) and LLC-MK2 (kidney of rhesus monkey) cells as described by Cravioto et al., (1979). Briefly, semi-confluent HEp-2 or LLC-MK2 cell monolayers in 24-well tissue culture plates containing a coverslip were incubated with 40 µL of bacterial cultures in LB and 960 µL of Dulbecco's modified Eagle's medium (Cultilab, Brazil). After 3 or 6 h of bacteria-epithelial cells' incubation at 37°C, the wells were washed with phosphate-buffered saline (PBS) six times, fixed with methanol and stained for 5 min with May–Grünwald stain diluted 1 : 2 with Sørensen buffer M/30 (pH 7.3), and Giemsa stain diluted 1 : 3 with the same buffer (20 min). The cover slips were washed in water, air-dried, mounted on glass slides and examined in a light microscope with a × 100 oil immersion lens. To quantify the number of adherent bacteria to the epithelial cells and to the coverslips, the following protocol was used. After the bacteria-HEp-2 cells' incubation period, nonadherent bacteria were removed from the monolayers by washing with PBS. The epithelial cells were lysed with 400 µL of 1% (v/v) Triton X-100 solution (Sigma Aldrich) in each well of the tissue culture plate. After 10 min of incubation at room temperature, 1.6 mL of PBS was added to the wells and homogenized by pipetting several times. Serial dilutions (1 : 10) in PBS were plated on MacConkey agar, incubated overnight and the colonies were counted to calculate the CFU mL−1. All assays were performed in triplicate. Biofilm formation Adhesion to the inert surface was assayed using the methodology described by Jansen et al., (2004) with modifications. Bacteria isolates were cultivated overnight at 37°C in LB broth. The cultures were diluted 1 : 10 in 200 µL of fresh, filter-sterilized pooled human urine in sterile 96-well polystyrene plates (NUNC, Naperville, IL) and incubated for 24 h at 37°C. Negative control wells contained urine only. After incubation, the content of each well was aspirated and washed three times with 200 µL of sterile distilled water. The microplates were air dried, and adherent bacteria were stained for 15 min with 200 µL of 0.1% aqueous crystal violet per well. After three rinses with sterile distilled water, bacterium-bound dye was released by the addition of 200 µL of dimethyl sulphoxide (Sigma Aldrich). One hundred microlitres of dimethyl sulphoxide–crystal violet solution was transferred to new sterile 96-well polystyrene plates, and the OD of each well was measured at 595 nm on a Micro-ELISA Autoreader (MultiScan EX, Labsystem, Uniscience). All assays were performed in triplicate. Haemagglutination assay Type one fimbriae expression was assayed by the mannose-sensitive (MS) haemagglutination of guinea-pig erythrocytes in the absence but not in the presence of 50 mM mannose (Mobley & Chippendale, 1990). MR/P haemagglutination was investigated by microplate agglutination of tannic acid-treated and nontreated chicken erythrocytes, as described previously by Bahrani et al., (1994). Detection of virulence markers by PCR The P. mirabilis isolates were screened for the presence of the following genetic sequences: mrpA (major subunit of MR/P fimbriae) and mrpH (pilin of MR/P fimbriae) (GenBank accession number Z32686), fimH (adhesin subunit of type I fimbriae) (Johnson & Stell, 2000), EAEC probe (fragment of the EAEC high-molecular weight virulence plasmid) (Schmidt et al., 1995), aggA (pilin of AAF/I EAEC fimbriae) (Nataro et al., 1992), aafA (pilin of AAF/II EAEC fimbriae) (Czeczulin et al., 1997) and agg3C (usher of AAF/III EAEC fimbriae) (Bernier et al., 2002). Table 1 shows the primers sequences, sizes of amplified DNA fragment, and annealing temperature for the searched sequences. The mrpA and mrpH primers were designed to amplify a 648-bp and a 444-bp DNA fragments, respectively. These fragments correspond to the 5′- region from nucleotide 1778 to 2426, and from nucleotide 8301 to 8745, of the published sequence of mrpA and mrpH, respectively (GenBank accession number Z32686). Proteus mirabilis HI4320 was used as a positive control for mrpA and mrpH, E. coli V-27 for fimH, E. coli 042 for EAEC probe, aafA and agg3C and E. coli 17-2 for aggA. Table 1 Primers, sizes of amplified fragments and annealing temperatures employed in the PCR reactions Sequence  Primer sequence (5′–3′)  Amplified fragment (bp)  Annealing temperature (°C)  Reference  mrpA (major subunit of MR/P fimbriae)  (F) GAGCCATTCAATTAGGAATAATCCA (R) AGCTCTGTACTTCCTTGTACAGA  648  58  This study  mrpA-inner (major subunit of MR/P fimbriae)  (F) ATGAGCTCTGCGGGTTCTGCTTT (R) ATGGTACCTCAGATGCAGAACCT  419  67  This study  mrpH (pilin of MR/P fimbriae)  (F) CCTTGTTATGGTTGGCCTGT (R) AGCCAGATGCGATAACCAAC  444  58  This study  fimH (adhesin subunit of type I fimbriae)  (F) TGCAGAACGGATAAGCCG GG (R) GCAGTCACCTGCCCTCCGTGA  508  63  Johnson & Stell (2000)  EAEC probe (fragment of the EAEC high-molecular weight virulence plasmid)  (F) CTGGCGAAAGACTGTATCAT (R) CAATGTATAGAAATCCGCTGTT  630  53  Schmidt et al. (1995)  aggA (pilin of AAF/I EAEC fimbriae)  (F) GCGTTAGAAAGACCTCCAATA (R) GCCGGATCCTTAAAAATTAATTCCGGC  432  55  Gioppo et al. (2000)  aafA (pilin of AAF/II EAEC fimbriae)  (F) ACATGCATGCAAAAAATCAGAATGTTTGTT (R) CGGGATCCATTTGTCACAAGCTCAGC  550  59  Gioppo et al. (2000)  agg3C (usher subunit of AAF/III EAEC fimbriae)  (F) GTTTGGAACCGGGAATTAACATTG (R) ATACTTTAGATACCCCTCACGCAG  485  59  Bernier et al. (2002)  Sequence  Primer sequence (5′–3′)  Amplified fragment (bp)  Annealing temperature (°C)  Reference  mrpA (major subunit of MR/P fimbriae)  (F) GAGCCATTCAATTAGGAATAATCCA (R) AGCTCTGTACTTCCTTGTACAGA  648  58  This study  mrpA-inner (major subunit of MR/P fimbriae)  (F) ATGAGCTCTGCGGGTTCTGCTTT (R) ATGGTACCTCAGATGCAGAACCT  419  67  This study  mrpH (pilin of MR/P fimbriae)  (F) CCTTGTTATGGTTGGCCTGT (R) AGCCAGATGCGATAACCAAC  444  58  This study  fimH (adhesin subunit of type I fimbriae)  (F) TGCAGAACGGATAAGCCG GG (R) GCAGTCACCTGCCCTCCGTGA  508  63  Johnson & Stell (2000)  EAEC probe (fragment of the EAEC high-molecular weight virulence plasmid)  (F) CTGGCGAAAGACTGTATCAT (R) CAATGTATAGAAATCCGCTGTT  630  53  Schmidt et al. (1995)  aggA (pilin of AAF/I EAEC fimbriae)  (F) GCGTTAGAAAGACCTCCAATA (R) GCCGGATCCTTAAAAATTAATTCCGGC  432  55  Gioppo et al. (2000)  aafA (pilin of AAF/II EAEC fimbriae)  (F) ACATGCATGCAAAAAATCAGAATGTTTGTT (R) CGGGATCCATTTGTCACAAGCTCAGC  550  59  Gioppo et al. (2000)  agg3C (usher subunit of AAF/III EAEC fimbriae)  (F) GTTTGGAACCGGGAATTAACATTG (R) ATACTTTAGATACCCCTCACGCAG  485  59  Bernier et al. (2002)  F, forward primer; R, reverse primer. View Large Table 1 Primers, sizes of amplified fragments and annealing temperatures employed in the PCR reactions Sequence  Primer sequence (5′–3′)  Amplified fragment (bp)  Annealing temperature (°C)  Reference  mrpA (major subunit of MR/P fimbriae)  (F) GAGCCATTCAATTAGGAATAATCCA (R) AGCTCTGTACTTCCTTGTACAGA  648  58  This study  mrpA-inner (major subunit of MR/P fimbriae)  (F) ATGAGCTCTGCGGGTTCTGCTTT (R) ATGGTACCTCAGATGCAGAACCT  419  67  This study  mrpH (pilin of MR/P fimbriae)  (F) CCTTGTTATGGTTGGCCTGT (R) AGCCAGATGCGATAACCAAC  444  58  This study  fimH (adhesin subunit of type I fimbriae)  (F) TGCAGAACGGATAAGCCG GG (R) GCAGTCACCTGCCCTCCGTGA  508  63  Johnson & Stell (2000)  EAEC probe (fragment of the EAEC high-molecular weight virulence plasmid)  (F) CTGGCGAAAGACTGTATCAT (R) CAATGTATAGAAATCCGCTGTT  630  53  Schmidt et al. (1995)  aggA (pilin of AAF/I EAEC fimbriae)  (F) GCGTTAGAAAGACCTCCAATA (R) GCCGGATCCTTAAAAATTAATTCCGGC  432  55  Gioppo et al. (2000)  aafA (pilin of AAF/II EAEC fimbriae)  (F) ACATGCATGCAAAAAATCAGAATGTTTGTT (R) CGGGATCCATTTGTCACAAGCTCAGC  550  59  Gioppo et al. (2000)  agg3C (usher subunit of AAF/III EAEC fimbriae)  (F) GTTTGGAACCGGGAATTAACATTG (R) ATACTTTAGATACCCCTCACGCAG  485  59  Bernier et al. (2002)  Sequence  Primer sequence (5′–3′)  Amplified fragment (bp)  Annealing temperature (°C)  Reference  mrpA (major subunit of MR/P fimbriae)  (F) GAGCCATTCAATTAGGAATAATCCA (R) AGCTCTGTACTTCCTTGTACAGA  648  58  This study  mrpA-inner (major subunit of MR/P fimbriae)  (F) ATGAGCTCTGCGGGTTCTGCTTT (R) ATGGTACCTCAGATGCAGAACCT  419  67  This study  mrpH (pilin of MR/P fimbriae)  (F) CCTTGTTATGGTTGGCCTGT (R) AGCCAGATGCGATAACCAAC  444  58  This study  fimH (adhesin subunit of type I fimbriae)  (F) TGCAGAACGGATAAGCCG GG (R) GCAGTCACCTGCCCTCCGTGA  508  63  Johnson & Stell (2000)  EAEC probe (fragment of the EAEC high-molecular weight virulence plasmid)  (F) CTGGCGAAAGACTGTATCAT (R) CAATGTATAGAAATCCGCTGTT  630  53  Schmidt et al. (1995)  aggA (pilin of AAF/I EAEC fimbriae)  (F) GCGTTAGAAAGACCTCCAATA (R) GCCGGATCCTTAAAAATTAATTCCGGC  432  55  Gioppo et al. (2000)  aafA (pilin of AAF/II EAEC fimbriae)  (F) ACATGCATGCAAAAAATCAGAATGTTTGTT (R) CGGGATCCATTTGTCACAAGCTCAGC  550  59  Gioppo et al. (2000)  agg3C (usher subunit of AAF/III EAEC fimbriae)  (F) GTTTGGAACCGGGAATTAACATTG (R) ATACTTTAGATACCCCTCACGCAG  485  59  Bernier et al. (2002)  F, forward primer; R, reverse primer. View Large MR/P mutagenesis MR/P mutagenesis was achieved by constructing a knockout of the mrpA gene, which encodes the major subunit of MR/P fimbriae, using the suicide vector pJP5603 (Penfold & Pemberton, 1992). This strategy was used to investigate the role of MR/P fimbriae in the accentuated AA pattern of strain P. mirabilis UEL-13. An mrpA inner primer (Table 1) was designed to amplify a 419-bp fragment, corresponding to the 5′-region from nucleotide 1913 to 2332 of the published sequence of mrpA (Gen Bank accession number Z32686). The PCR product was ligated with the vector pGEM-T Easy (Promega), following the manufacturer's instructions. After ligation and transformation into E. coli host JM109, the transformants were selected on LB agar plates containing ampicillin. Transformants were analysed for correct insert cloning and the selected construct (pSR1), carrying an internal mrpA nucleotide sequence, was digested with EcoRI. The internal mrpA fragment with sites of EcoRI was cloned into the corresponding site of the suicide vector pJP5603. After ligation and transformation by electroporation into host S17-1(λpir), the transformants were selected on LB agar plates containing kanamycin. The resulting transformants were analysed for correct cloning, and the pSR2 plasmid was selected. The S17-1(λpir) containing pSR2 was then conjugated with wild-type strain P. mirabilis UEL-13 by filter mating on cellulose nitrate membranes. Transconjugants were selected in LB agar plates containing kanamycin and polymyxin and their identity was confirmed by biochemical tests (Farmer, 1999). The mrpA mutant selected was designed P. mirabilis UEL-13∷mrpA. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting detection of MrpA Overnight bacterial growth of P. mirabilis UEL-13 and UEL-13∷mrpA in 3 mL of LB broth were pelleted for 15 min at 1100 g. Whole pellets were recovered and prepared by boiling in SDS-PAGE buffer and subjected to 15% SDS-PAGE (Laemmli, 1970). The gels were either Coomassie stained or transferred onto a nitro-cellulose membrane for immunoblotting. The anti-MrpA polyclonal antiserum was raised in Balb/c mice against the MrpA protein, which was purified following the protocol described by Zunino et al., (2001). Four- to 6-week-old female Balb/c mice were immunized intraperitoneally with 30 µg of MrpA in complete Marcol–Montanide adjuvant. The immunization protocol consisted of one booster injection of the same amount of protein at a 4-week interval. The Western blot and the immunodetection were performed as described by Towbin et al., (1979) and Anderton & Thorpe (1980), respectively. The immunoblot was developed using the anti-MrpA (1 : 100), followed by incubation with horseradish peroxidase-conjugated goat anti-mouse serum (Zymed), diluted 1 : 2000. The membrane was developed with hydrogen peroxide and 3,3′-diaminobenzidine (Sigma Aldrich). Transmission electron microscopy (TEM) The expression of MR/P was examined by an immunogold assay (Nara et al., 2005), using anti-MrpA and IgG protein-gold of 10 nm. Grids were examined with a ZEISS EM 109 TEM (ZEISS, Germany), operated at 80 kV. Statistical analysis Analysis of the correlation between data was performed using Student's two-tailed t-test with Welch's correction. ELISA OD data were analysed by mean and SE using GraphPad Prism 3.00®. Differences between ODs of wild-type and mutant P. mirabilis UEL-13 strains were considered to be significant when the probability of equality was <0.05 (P<0.05). Results The ability of uropathogenic P. mirabilis to adhere to epithelial cells in vitro was initially evaluated in HEp-2 cells. All 35 strains presented few bacteria, forming aggregates on both coverslip and HEp-2 cells surfaces after 3 h of incubation (Fig. 1a). Interestingly, after 6 h of incubation all strains showed the characteristic AA pattern, with predominance of bacteria adherence to the coverslip (Fig. 1b). In addition, the adherence ability of 16 isolates of this study (including isolate UEL-13) was also evaluated using the LLC-MK2 cell line, demonstrating the same AA pattern as observed in HEp-2 cells. The capacity to form biofilm on polystyrene was also investigated, due to its association with the expression of AA pattern in EAEC. All 35 isolates were able to adhere to the inert substratum after incubation in sterile urine, displaying OD595 nm ranging from 0.035 to 0.175. Figure 1 View largeDownload slide HEp-2 adherence assays with (a) Proteus mirabilis UEL-13, 3 h assay (b) P. mirabilis UEL-13, 6 h assay, (c) P. mirabilis UEL-13∷mrpA, 3 h assay, and (d) P. mirabilis UEL-13∷mrpA, 6 h assay. Magnification: × 1000. Figure 1 View largeDownload slide HEp-2 adherence assays with (a) Proteus mirabilis UEL-13, 3 h assay (b) P. mirabilis UEL-13, 6 h assay, (c) P. mirabilis UEL-13∷mrpA, 3 h assay, and (d) P. mirabilis UEL-13∷mrpA, 6 h assay. Magnification: × 1000. Because the AA pattern to HEp-2 cells was observed among these strains, the EAEC adherence-related fimbrial (AAF/I, II and III) genes were searched for, as well as the EAEC probe fragment. None of these EAEC-associated genetic sequences was detected among all P. mirabilis strains. The adhesin subunit of type I fimbriae was also searched in all isolates and the results correlated with the haemagglutination of guinea-pig erythrocytes. The fimH gene and expression of mannose-sensitive haemagglutination of guinea-pig erythrocytes were not detected in any of the 35 isolates, indicating the lack of type I fimbriae among these isolates. On the other hand, the presence of the MR/P-related genes mrpA and mrpH was detected by PCR in all isolates of this study. These results were correlated with the expression of MR/P, also detected in all isolates by haemagglutination of chicken erythrocytes in the presence and absence of tannic acid. Owing to the fact that all strains of this study presented the AA pattern to HEp-2 cells and the MR/P-associated genes, it was decided to investigate further the role of MR/P in the establishment of that adherence pattern. For these experiments, the P. mirabilis UEL-13 was chosen as the prototype strain because it displayed the more accentuated AA pattern of our collection and harboured the genetic markers shared by the other P. mirabilis strains. This prototype strain was able to agglutinate tannic acid-treated and nontreated chicken erythrocytes, to form a biofilm and displayed an intense AA pattern after 6 h of incubation with HEp-2 cells, as shown in Fig. 1b. An mrpA mutation in the prototype strain, which was designated P. mirabilis UEL-13∷mrpA, was obtained using a construction in a suicide vector (pRS2). In order to determine whether there were differences other than expression of MR/P fimbriae, the mutant strain was compared with the wild-type parental strain for a number of biochemical characteristics (Farmer, 1999), as well as the in vitro growth characteristics. No differences were found for any of the biochemical markers and the growth curves were similar. The pRS2 insertion in strain UEL-13 was verified by the acquired kanamycin resistance and the correct localization of insertion was checked by Southern blot analysis of AvaI UEL-13∷mrpA genomic DNA digestion (data not shown). The lack of expression of MR/P fimbriae in the mutant was examined by haemagglutination of chicken erythrocytes, immunoblotting and immunogold assays. As shown in Fig. 2, the antisera against MrpA recognized a polypeptide of c. 17 kDa only in the wild-type strain, indicating the absence of MR/P in the mutant strain. The P. mirabilis UEL-13∷mrpA strain was also incapable of agglutinating chicken erythrocytes (in the presence and absence of tannic acid), confirming the lack of MR/P expression. The lack of expression of MR/P fimbriae was also verified by immunogold assays. As presented in Fig. 3a, the antisera against MrpA recognized fimbrial structures in the wild-type strain UEL-13, while in the mutant UEL-13∷mrpA there was no labelling (Fig. 3b). Figure 2 View largeDownload slide Reactivity of the polyclonal antiserum against the MrpA subunit with the proteins of bacterial extracts detected by SDS-PAGE (15%). Lane 1: Wild-type strain Proteus mirabilis UEL-13. Lane 2: The MR/P fimbrial mutant P. mirabilis UEL-13∷mrpA. Figure 2 View largeDownload slide Reactivity of the polyclonal antiserum against the MrpA subunit with the proteins of bacterial extracts detected by SDS-PAGE (15%). Lane 1: Wild-type strain Proteus mirabilis UEL-13. Lane 2: The MR/P fimbrial mutant P. mirabilis UEL-13∷mrpA. Figure 3 View largeDownload slide TEM of immunogold staining for MR/P fimbriae. (a) Strain Proteus mirabilis UEL-13 (magnification: × 80 000, scale bar: 250 nm). (b) Strain P. mirabilis UEL-13∷mrpA (magnification: × 70 000, scale bar: 250 nm). Figure 3 View largeDownload slide TEM of immunogold staining for MR/P fimbriae. (a) Strain Proteus mirabilis UEL-13 (magnification: × 80 000, scale bar: 250 nm). (b) Strain P. mirabilis UEL-13∷mrpA (magnification: × 70 000, scale bar: 250 nm). The adherence pattern of UEL-13∷mrpA was investigated using HEp-2 cells. Very few adherent bacteria were observed in the 3-h assay (Fig. 1c). In the 6 h assay, a noncharacteristic pattern of adhesion was detected (Fig. 1d), showing an intense reduction of the AA pattern in comparison with strain UEL-13 (Fig. 1b). The reduction of the aggregative adherent bacteria displayed by the mrpA mutant was quantified by CFU counts of HEp-2 cell-adherent bacteria. As shown in Fig. 4, the wild-type P. mirabilis strain formed a significantly more accentuated adhesion than the mutant strain (P=0.0030). Biofilm formation was also reduced in the mrpA mutant (Fig. 5). The wild-type strain formed significantly more biofilm than the mutant strain (P=0.0341). Figure 4 View largeDownload slide HEp-2 cell-adherent bacterial counts (CFU mL−1). Bars represent the 95% confidence interval of means and SE of triplicates. P=0.0030 Proteus mirabilis UEL-13∷mrpA strain compared with the wild-type UEL-13. Figure 4 View largeDownload slide HEp-2 cell-adherent bacterial counts (CFU mL−1). Bars represent the 95% confidence interval of means and SE of triplicates. P=0.0030 Proteus mirabilis UEL-13∷mrpA strain compared with the wild-type UEL-13. Figure 5 View largeDownload slide Biofilm formation. The reaction was detected with 0.1% of aqueous crystal violet recorded OD595 nm on a Multiskan EX ELISA reader. Bars represent the 95% confidence interval of means and SD of quadruplicates. P=0.0341 Proteus mirabilis UEL-13∷mrpA strain compared with the wild-type UEL-13. Figure 5 View largeDownload slide Biofilm formation. The reaction was detected with 0.1% of aqueous crystal violet recorded OD595 nm on a Multiskan EX ELISA reader. Bars represent the 95% confidence interval of means and SD of quadruplicates. P=0.0341 Proteus mirabilis UEL-13∷mrpA strain compared with the wild-type UEL-13. Discussion Several potential virulence factors have been described in uropathogenic P. mirabilis, including secreted proteins and adhesins (Rózalski et al., 1997). In this work, the adherence properties of P. mirabilis isolates from community-acquired UTI have been analyzed. All isolates showed the characteristic AA pattern to HEp-2 cells, which has been originally described as the main characteristic of EAEC (Nataro et al., 1987). This phenotype was also shown by 16 of these isolates, including isolate UEL-13, when in contact with LLC-MK2 cells. Because this is a kidney-derived cell line, such an observation suggests the in vivo expression of this phenotype. Studies suggesting fimbriae-mediated P. mirabilis adhesion to tissue culture cells in vitro were reported by some authors (Sareneva et al., 1990; Cook et al., 1995; Jansen et al., 2004), but none of them described a characteristic pattern of adherence. In addition to EAEC, the AA pattern has been recognized in Klebsiella pneumoniae strains associated with nosocomial infections, and in atypical enteropathogenic and Shiga toxin-producing E. coli isolated from diarrhoea (Favre-Bonte et al., 1995; Morabito et al., 1998; Gomes et al., 2004). All P. mirabilis isolates demonstrated the capacity to form a biofilm on polystyrene after incubation in urine, as demonstrated previously by other authors (Jansen et al., 2004). Such a capacity was also detected using LB broth as the incubation medium (data not shown). The ability of these strains to adhere to plastic may be important for the establishment of UTI in catheterized patients. In fact, a high percentage of UTI is caused by this organism in patients with chronic instrumentation, such as catheterization (Mobley & Belas, 1995). As described for EAEC (Sheikh et al., 2001), biofilm formation is associated with the AA pattern shown by these isolates. Interestingly, none of the P. mirabilis of this study showed the EAEC fimbriae-associated genes, indicating the presence of a non-EAEC-related adhesin among them. Recently, a role of type one fimbriae in the aggregative adherence of EAEC has been described (Moreira et al., 2003), which led to investigation of its presence among the isolates of this study, although the fimH gene and expression of mannose-sensitive haemagglutination of guinea-pig erythrocytes were not detected in any of the 35 isolates. Adegbola et al., (1983) also observed that the mannose-binding type 1 fimbriae are rarely expressed by uropathogenic strains of P. mirabilis. Because all isolates presented MR/P fimbriae-related genes, the involvement of this fimbriae in the establishment of the characteristic AA pattern presented by the uropathogenic P. mirabilis was investigated. A knockout of mrpA generated an MR/P nonexpressing mutant and its phenotypical analysis confirmed its involvement in the AA pattern of P. mirabilis, because AA was notably reduced in comparison with their respective wild-type strain, but not abolished. In fact, MR/P seems to act as a cofactor in the establishment of the AA pattern, because the lack of MR/P expression partially reduced that phenotype. It may be possible that any of the other adhesins already described in P. mirabilis (Massad & Mobley, 1994; Cook et al., 1995; Zunino et al., 2000) participates in this multifactorial phenotype in P. mirabilis. The AA pattern in EAEC is also a multifactorial phenotype (Moreira et al., 2003). These data suggest that colonization is multifactorial and that a number of fimbriae may work efficiently all together to colonize the bladder and kidneys. Further studies evaluating the role of these other adhesins are necessary to understand the AA pattern shown by P. mirabilis. The role of MR/P in the capacity to form biofilm on polystyrene was also evaluated in the MR/P mutant. Biofilm formation was significantly reduced but not abolished, similar to the observation in the adherence assay to epithelial cells. Jansen et al., (2004) investigated the role of MR/P fimbriae in the colonization of the urinary tract, using a transurethrally infected mice model, and in biofilm production. This fimbria dictated the localization of bacteria in the bladder and contributed to biofilm formation (Jansen et al., 2004). The present data confirm the observations of Jansen et al., (2004) in the role of MR/P on biofilm formation, and describe for the first time the expression of the AA pattern to cultured epithelial cells among uropathogenic P. mirabilis. Fimbriae-mediated adherence to uroepithelial cells and kidney epithelium is essential for virulence of P. mirabilis and plays an important role in the pathogenesis of UTI (Rózalski et al., 1997). The P. mirabilis studied here presented several potential virulence factors, which contribute to the pathogenesis of UTI, especially the AA pattern to epithelial cells and the adherence capacity to inert surfaces. Acknowledgements The authors wish to thank Dr Pablo Zunino for the gift of the MrpA-expressing strain and helpful suggestions. The authors are also indebted to Dr Harry Mobley for the gift of P. mirabilis strain HI4320. References Adegbola R.A. Old D.C. Senior B.W. ( 1983) The adhesins and fimbriae of Proteusmirabilis strains associated with high and low affinity for the urinary tract. J Med Microbiol  16: 427– 431. Google Scholar CrossRef Search ADS PubMed  Anderton B.H. Thorpe R.C. ( 1980) New methods of analysing for antigens and glycoproteins in complex mixtures. Immunol Today  1: 122– 127. Google Scholar CrossRef Search ADS PubMed  Bahrani F.K. Mobley HLT ( 1994) Proteus mirabilis MR/P fimbrial operon: genetic organization, nucleotide sequence, and conditions for expression. J Bacteriol  176: 3412– 3419. Google Scholar CrossRef Search ADS PubMed  Bahrani F.K. Massad G. Lockatell C.V. Johnson D.E. Russell R.G. Warren J.W. Mobley HLT ( 1994) Construction of an MR/P fimbrial mutant of Proteusmirabilis: role in virulence in a mouse model of ascending urinary tract infection. Infect Immun  176: 3412– 3419. Bernier C. Gounon P. Le Bouguénec C. ( 2002) Identification of an aggregative adhesion fimbriae (AAF) type III-encoding operon in enteroaggregative Escherichiacoli as a sensitive probe for detecting the AAF-encoding operon family. Infect Immun  70: 4302– 4311. Google Scholar CrossRef Search ADS PubMed  Coker C. Poore C.A. Li X. Mobley HLT ( 2000) Pathogenesis of Proteusmirabilis urinary tract infection. Microb Infect  2: 1497– 1505. Google Scholar CrossRef Search ADS   Cook S.W. Mody N. Valle J. Hull R. ( 1995) Molecular cloning of Proteusmirabilis uroepithelial cell adherence (uca) genes. Infect Immun  63: 2082– 2086. Google Scholar PubMed  Cravioto A. Gross R.J. Scotland S.M. Rowe B. ( 1979) An adhesive factor found in strains of Escherichiacoli belonging to the traditional infantile enteropathogenic serotypes. Curr Microbiol  3: 95– 99. Google Scholar CrossRef Search ADS   Czeczulin J.R. Balepur S. Hicks S. Phillips A. Hall R. Kothary M.H. Navarro-Garcia F. Nataro J.P. ( 1997) Aggregative adherence fimbria II, a second fimbrial antigen mediating aggregative adherence in enteroaggregative Escherichiacoli. Infect Immun  65: 4135– 4145. Google Scholar PubMed  Farmer J.J. ( 1999) Enterobacteriaceae: Introduction and Identification. Manual of Clinical Microbiology , 7th edn ( Murray P.R. Baron E.J. Pfauer M.A. Tenorer F.C. Yolken R.H., eds), pp. 442– 458. ASM Press, Washington, DC. Favre-Bonte S. Darfeuille-Michaud A. Forestier C. ( 1995) Aggregative adherence of Klebsiella pneumoniae to human intestine-407 cells. Infect Immun  63: 1318– 1328. Google Scholar PubMed  Gioppo NMR Elias W.P. Jr Vidotto M.C. Linhares R.E. Saridakis H.O. Gomes TAT Trabulsi L.R. Pelayo J.S. ( 2000) Prevalence of HEp-2 cell-adherent Escherichia coli and characterization of enteroaggregative E. coli and chain-like adherent E. coli isolated from children with and without diarrhoea, in Londrina, Brazil. FEMS Microbiol Lett  190: 293– 298. Google Scholar CrossRef Search ADS PubMed  Gomes TAT Irino K. Girão D.M. Girão VBC Guth BEC Vaz TMI Moreira F.C. Chinarelli S.H. Vieira MAM ( 2004) Emerging enteropathogenic Escherichiacoli strains? Emerg Infect Dis  10: 1851– 1855. Google Scholar CrossRef Search ADS PubMed  Jansen A.M. Lockatell V. Johson D.E. Mobley HLT ( 2004) Mannose-resistant Proteus-Like fimbriae are produced by most Proteus mirabilis strains infecting the urinary tract, dictate the in vivo localization of bacteria, and contribute to biofilm formation. Infect Immun  72: 7294– 7305. Google Scholar CrossRef Search ADS PubMed  Johnson J.R. Stell A.L. ( 2000) Extended virulence genotypes of Escherichiacoli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis  181: 261– 272. Google Scholar CrossRef Search ADS PubMed  Laemmli M.K. ( 1970) Cleavage of structural proteins during the assembly of the head of bacteriophage. Nature  227: 680– 685. Google Scholar CrossRef Search ADS PubMed  Li X. Johnson D.E. Mobley HLT ( 1999) Requirement of MrpH for manose-resistant Proteus-like fimbriae-mediated hemaglutination by Proteus mirabilis. Infect Immun  67: 2822– 2833. Google Scholar PubMed  Li X. Rasko D.A. Lockatell C.V. Johnson D.E. Mobley HLT ( 2001) Repression of bacterial motility by a novel fimbrial gene product. EMBO J  20: 4854– 4862. Google Scholar CrossRef Search ADS PubMed  Massad G. Mobley HLT ( 1994) Genetic organization and complete sequence of the Proteus mirabilispmf fimbrial operon. Gene  150: 101– 104. Google Scholar CrossRef Search ADS PubMed  Mobley HLT Belas R. ( 1995) Swarming and pathogenicity of Proteusmirabilis in the urinary tract. Trends Microbiol  3: 280– 284. Google Scholar CrossRef Search ADS PubMed  Mobley HLT Chippendale G.R. ( 1990) Hemagglutinin, urease, and hemolysin production by Proteusmirabilis from clinical sources. J Infect Dis  161: 525– 530. Google Scholar CrossRef Search ADS PubMed  Mobley HLT Warren J.W. ( 1987) Urease-positive bacteriuria and obstruction of long-term urinary catheters. J Clin Microbiol  25: 2216– 2217. Google Scholar PubMed  Morabito S. Karch H. Mariani-Kurkdjian P. Schmidt H. Minelli F. Bingen E. Caprioli A. ( 1998) Enteroaggregative, Shiga toxin-producing Escherichiacoli O111: H2 associated with an outbreak of haemolytic-uremic syndrome. J Clin Microbiol  36: 840– 842. Google Scholar PubMed  Moreira C.G. Carneiro S.M. Nataro J.P. Trabulsi L.R. Elias W.P. ( 2003) Role of type I fimbriae in the aggregative adhesion pattern of enteroaggregative Escherichia coli. FEMS Microbiol Lett  226: 79– 85. Google Scholar CrossRef Search ADS PubMed  Nara J.M. Rocha L.B. Szulczewski V. Troiano PER Trabulsi L.R. Piazza RMF Cianciarullo A.M. ( 2005) Bundle-forming pilus and intimin of enteropathogenic Escherichiacoli as diagnosis markers. Braz J Morphol Sci  ( Suppl.) 207– 208. Nataro J.P. Kaper J.B. Robins-Browne R. Prado V. Vial P. Levine M.M. ( 1987) Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells. Pediatr Infect Dis J  6: 829– 831. Google Scholar CrossRef Search ADS PubMed  Nataro J.P. Deng Y. Maneval D.R. German A.L. Martin W.C. Levine M.M. ( 1992) Aggregative adherence fimbriae I of enteroaggregative Escherichiacoli mediate adherence to HEp-2 cells and hemagglutination of human erythrocytes. Infect Immun  60: 2297– 2304. Google Scholar PubMed  Old D. Adegbola R. ( 1982) Hemagglutinins and fimbriae of Morganella, Proteus and Providencia. J Med Microbiol  15: 551– 564. Google Scholar CrossRef Search ADS PubMed  Penfold R.J. Pemberton J.M. ( 1992) An improved suicide vector for construction of chromosomal insertion mutations in bacteria. Gene  11: 145– 146. Google Scholar CrossRef Search ADS   Rózalski A. Sidorczyk Z. Kotelko K. ( 1997) Potential virulence factors of Proteusbacilli. Microbiol Mol Biol Rev  61: 65– 89. Google Scholar PubMed  Sambrook J. Fritsch E.F. Maniatis T. ( 1989) Molecular Cloning: A Laboratory Manual , 2nd edn. Cold Spring Harbor, New York. Sareneva T. Holthöfer H. Korhonen T.K. ( 1990) Tissue-binding affinity of Proteusmirabilis fimbriae in the human urinary tract. Infect Immun  58: 3330– 3336. Google Scholar PubMed  Scaletsky ICA Silva MLM Trabulsi L.R. ( 1984) Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells. Infect Immun  45: 534– 536. Google Scholar PubMed  Schmidt H. Knop C. Franke S. Aleksic S. Heesemann J. Karch H. ( 1995) Development of PCR for screening of enteroaggregative Escherichiacoli. J Clin Microbiol  33: 701– 705. Google Scholar PubMed  Sheikh J. Hicks S. Dall'Agnol M. Phillips A.D. Nataro J.P. ( 2001) Roles for Fis and YafK in biofilm formation by enteroaggregative Escherichia coli. Mol Microbiol  41: 983– 997. Google Scholar CrossRef Search ADS PubMed  Towbin H. Staehelin T. Gordon J. ( 1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA  76: 4350– 4354. Google Scholar CrossRef Search ADS PubMed  Zhao H. Li X. Johnson D.E. Bolnfield I. Mobley HLT ( 1997) In vivo phase variation of MR/P fimbrial gene expression in Proteus mirabilis infecting the urinary tract. Mol Microbiol  48: 1009– 1019. Google Scholar CrossRef Search ADS   Zunino P. Geymonat L. Allen A.G. Legnani-Fajardo C. Maskell D.J. ( 2000) Virulence of a Proteus mirabilis ATF isogenic mutant is not impaired in a mouse model of ascending urinary tract infection. FEMS Immunol Med Microbiol  29: 137– 144. Google Scholar CrossRef Search ADS PubMed  Zunino P. Geymonat L. Allen A.G. Preston A. Sosa V. Maskell D.J. ( 2001) New aspects of the role of MR/P fimbriae in Proteusmirabilis urinary tract infection. FEMS Immunol Med Microbiol  31: 113– 120. Google Scholar CrossRef Search ADS PubMed  © 2007 Federation of European Microbiological Societies
TI - Aggregative adherence of uropathogenic Proteus mirabilis to cultured epithelial cells
JF - Journal of the Endocrine Society
DO - 10.1111/j.1574-695X.2007.00308.x
DA - 2007-11-01
UR - https://www.deepdyve.com/lp/oxford-university-press/aggregative-adherence-of-uropathogenic-proteus-mirabilis-to-cultured-gk2GPV3Ddk
SP - 319
EP - 326
VL - 51
IS - 2
DP - DeepDyve
ER -