TY - JOUR
AU - Krivoruchko, Anastasia
AB - Abstract Beta-elemene, a sesquiterpene and the major component of the medicinal herb Curcuma wenyujin, has antitumor activity against various types of cancer and could potentially serve as a potent antineoplastic drug. However, its current mode of production through extraction from plants has been inefficient and suffers from limited natural resources. Here, we engineered a yeast cell factory for the sustainable production of germacrene A, which can be transformed to beta-elemene by a one-step chemical reaction in vitro. Two heterologous germacrene A synthases (GASs) converting farnesyl pyrophosphate (FPP) to germacrene A were evaluated in yeast for their ability to produce germacrene A. Thereafter, several metabolic engineering strategies were used to improve the production level. Overexpression of truncated 3-hydroxyl-3-methylglutaryl-CoA reductase and fusion of FPP synthase with GAS, led to a sixfold increase in germacrene A production in shake-flask culture. Finally, 190.7 mg/l of germacrene A was achieved. The results reported in this study represent the highest titer of germacrene A reported to date. These results provide a basis for creating an efficient route for further industrial application re-placing the traditional extraction of beta-elemene from plant sources. Electronic supplementary material The online version of this article (doi:10.1007/s10295-017-1934-z) contains supplementary material, which is available to authorized users. Introduction Terpenoids comprise the largest class of natural products with more than 40,000 known structures, many of which are essential for plant growth, development and general metabolism. Beta-elemene, a sesquiterpene and the major component in Chinese medicinal herb, Curcuma wenyujin Y. H. Chen et C. Ling, displays antitumor activity against a variety of tumor types, including leukemia, brain, breast, prostate, ovarian, cervical, colon, laryngeal, and lung carcinoma cells [17]. Beta-elemene is not the direct product of a sesquiterpene synthase, but it is transformed from the precursor germacrene A by a one-step molecular rearrangement under heating and/or acidic conditions. Even at room temperature in vitro, the conversion yield can reach 98% or more (Fig. 1) [13, 27]. The current production of beta-elemene is via extraction from plant sources. However, these plant sources are limited and the yield obtained is extremely low [17, 24]. Due to easy genetic manipulation, scalability and high capability, microbial cells have attracted great attention as a promising host for the production of a wide array of compounds, from traditional food products to biofuels, pharmaceuticals and chemicals. Several terpenoids have been successfully produced through metabolic engineering of microbes, including artemisinin [18], taxadiene [2] and miltiradiene [28]. Saccharomyces cerevisiae is considered as a versatile host for the production of isoprenoids [25, 28], due to its great advantages including easy genetic manipulation, inherent safety, good tolerance to low pH and fermentation inhibitors [5], decreased susceptibility to phage contaminations, minimization of the interference or competition of any natural pathway with the engineered pathways when exhibiting limited native secondary metabolism [22], and ability to functionally express eukaryotic cytochrome P450 enzymes [14]. Fig. 1 Open in new tabDownload slide Production of germacrene A and beta-elemene. Germacrene A is produced through the intracellular MVA pathway of yeast, and then transformed to beta-elemene through Cope rearrangement under heat condition in vitro In Saccharomyces cerevisiae, the precursor germacrene A could be synthesized from farnesyl pyrophosphate (FPP), an intermediate of the mevalonate pathway, in a reaction catalyzed by germacerene A synthase (GAS). While several germacrene A synthases from different species have been introduced into yeast and Escherichia coli for germacrene A production [1, 15, 19], the titer obtained was very low (<10 mg/l) due to lack of optimization of the biosynthetic pathway [9]. In the present study, we sought to produce germacrene A at high yields in S. cerevisiae by selecting a heterologous, high-active germacrene A synthase, overexpressing key enzymes in the mevalonate pathway as well as constructing protein fusions (Fig. 1). Our final strain displayed a significant improvement over previously reported microbes engineered for the production of this compound. Methods Plasmid and strain construction All plasmids and strains used in this study are listed in Table 1. The yeast host strain in this study is SCIGS22a, which is derived from a previous study [16]. pBS01 is a “minimal plasmid” derivative of pSP-GM1 [6] with most of the backbone regions removed. The genes HaGAS2 opt from Helianthus annuus L. and LTC2 opt from Lactuca sativa, coding for germarcene A synthase, were codon optimized for expression in S. cerevisiae (Synthesized by Sangon Biotech, China) (Table S1), cut with SacI/SpeI and ligated into SacI/SpeI restricted vector pBS01 separately, yielding pBYH05 and pBYH06, respectively. These two plasmids were transformed into SCIGS22a, resulting in strains SCIYH11 and SCIYH12, respectively. All endogenous S. cerevisiae genes used in this study were PCR amplified using genomic DNA of CEN. PK113-5D (MATa SUC2 MAL2-8c ura3-52) as template. The primers used for amplification are listed Table 2. We used Gibson assembly [10] in the construction of some of the plasmids. This was done using the Gibson Assembly® Master Mix (New England Biolabs). The catalytic domain of HMG1 (tHMG1) was amplified using primer pair 1 and 2. pBYH06 was divided into two fragments, one was amplified using primers 3 and 4, the other one was amplified using primers 5 and 6. Two fragments with tHMG1 were reassembled into a circle, yielding pBYH09. Similarly, ERG20 was amplified from S. cerevisiae using primers 7 and 8, and then assembled with two fragments from pBYH06 mentioned above resulting in plasmid pBYH10. All sequences coding for four fusion proteins of ERG20 and LTC2 were under the control of TEF1 promoter. LTC2 opt was amplified from pBYH05 using two primer pairs 9 and 10, 11 and 10, then fused these two fragments with ERG20 fragment which was amplified by another pair of primers 12 and 13 separately. Subsequently, two 2.7-kb fragments containing ERG20 and LTC2 opt and two different linkers (GSG and GGGGS) were cleaved with SpeI/SacI and inserted into the corresponding sites of pBS01, yielding pBYH13 and pBYH14. We used same method to construct pBYH11 and pBYH12, since they are very similar to pBYH13 and pBYH14 except the order of ERG20 and LTC2 opt. ERG20 was amplified from CEN. PK113-5D using two primer pairs 14 and 15, 16 and 15. The resulting fragments were then fused with LTC2 opt which was amplified by another pair of primers 17 and 18, respectively. Then two fragments, LTC2 opt-GSG-ERG20 and LTC2 opt-GGGGS-ERG20, were cleaved with SpeI/SacI and inserted into the corresponding sites of pBS01, yielding pBYH11 and pBYH12. pBYH15 was constructed by Gibson cloning as well. A 4.8-kb fragment including fusion enzymes, PGK1 promoter, TEF1 promoter and ADH1 terminator was amplified from pBYH14 using primers 19 and 20. Then the product was reassembled with a fragment containing tHMG1 amplified using primers 21 and 22 and a fragment amplified using primers 23 and 24 from pBYH06, and circularized, resulting in plasmid pBYH15. List of plasmids and strains Strain . Plasmid . Description . References . SCIGS22a – MATa MAL2-8c SUC2 ura3-52 lpp1Δ::loxP dpp1Δ::loxP P ERG9 Δ::loxP-P HXT1 gdh1Δ::loxP P TEF1-ERG20 P PGK1-GDH2 P TEF1-tHMG1 [16] SCIYH11 pBYH05 SCIGS22a P TEF1-HaGAS2 opt This study SCIYH12 pBYH06 SCIGS22a P TEF1-LTC2 opt This study SCIYH18 pBYH09 SCIGS22a P PGK1-tHMG1 P TEF1-LTC2 opt This study SCIYH19 pBYH10 SCIGS22a P PGK1-ERG20 P TEF1-LTC2 opt This study SCIYH20 pBYH11 SCIGS22a P TEF1-LTC2 opt-GSG-ERG20 This study SCIYH21 pBYH12 SCIGS22a P TEF1-LTC2 opt-GGGGS-ERG20 This study SCIYH22 pBYH13 SCIGS22a P TEF1-ERG20-GSG-LTC2 opt This study SCIYH23 pBYH14 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt This study SCIYH24 pBYH15 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt aaaaaaaaaaP PGK1-tHMG1 This study Strain . Plasmid . Description . References . SCIGS22a – MATa MAL2-8c SUC2 ura3-52 lpp1Δ::loxP dpp1Δ::loxP P ERG9 Δ::loxP-P HXT1 gdh1Δ::loxP P TEF1-ERG20 P PGK1-GDH2 P TEF1-tHMG1 [16] SCIYH11 pBYH05 SCIGS22a P TEF1-HaGAS2 opt This study SCIYH12 pBYH06 SCIGS22a P TEF1-LTC2 opt This study SCIYH18 pBYH09 SCIGS22a P PGK1-tHMG1 P TEF1-LTC2 opt This study SCIYH19 pBYH10 SCIGS22a P PGK1-ERG20 P TEF1-LTC2 opt This study SCIYH20 pBYH11 SCIGS22a P TEF1-LTC2 opt-GSG-ERG20 This study SCIYH21 pBYH12 SCIGS22a P TEF1-LTC2 opt-GGGGS-ERG20 This study SCIYH22 pBYH13 SCIGS22a P TEF1-ERG20-GSG-LTC2 opt This study SCIYH23 pBYH14 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt This study SCIYH24 pBYH15 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt aaaaaaaaaaP PGK1-tHMG1 This study Open in new tab List of plasmids and strains Strain . Plasmid . Description . References . SCIGS22a – MATa MAL2-8c SUC2 ura3-52 lpp1Δ::loxP dpp1Δ::loxP P ERG9 Δ::loxP-P HXT1 gdh1Δ::loxP P TEF1-ERG20 P PGK1-GDH2 P TEF1-tHMG1 [16] SCIYH11 pBYH05 SCIGS22a P TEF1-HaGAS2 opt This study SCIYH12 pBYH06 SCIGS22a P TEF1-LTC2 opt This study SCIYH18 pBYH09 SCIGS22a P PGK1-tHMG1 P TEF1-LTC2 opt This study SCIYH19 pBYH10 SCIGS22a P PGK1-ERG20 P TEF1-LTC2 opt This study SCIYH20 pBYH11 SCIGS22a P TEF1-LTC2 opt-GSG-ERG20 This study SCIYH21 pBYH12 SCIGS22a P TEF1-LTC2 opt-GGGGS-ERG20 This study SCIYH22 pBYH13 SCIGS22a P TEF1-ERG20-GSG-LTC2 opt This study SCIYH23 pBYH14 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt This study SCIYH24 pBYH15 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt aaaaaaaaaaP PGK1-tHMG1 This study Strain . Plasmid . Description . References . SCIGS22a – MATa MAL2-8c SUC2 ura3-52 lpp1Δ::loxP dpp1Δ::loxP P ERG9 Δ::loxP-P HXT1 gdh1Δ::loxP P TEF1-ERG20 P PGK1-GDH2 P TEF1-tHMG1 [16] SCIYH11 pBYH05 SCIGS22a P TEF1-HaGAS2 opt This study SCIYH12 pBYH06 SCIGS22a P TEF1-LTC2 opt This study SCIYH18 pBYH09 SCIGS22a P PGK1-tHMG1 P TEF1-LTC2 opt This study SCIYH19 pBYH10 SCIGS22a P PGK1-ERG20 P TEF1-LTC2 opt This study SCIYH20 pBYH11 SCIGS22a P TEF1-LTC2 opt-GSG-ERG20 This study SCIYH21 pBYH12 SCIGS22a P TEF1-LTC2 opt-GGGGS-ERG20 This study SCIYH22 pBYH13 SCIGS22a P TEF1-ERG20-GSG-LTC2 opt This study SCIYH23 pBYH14 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt This study SCIYH24 pBYH15 SCIGS22a P TEF1-ERG20-GGGGS-LTC2 opt aaaaaaaaaaP PGK1-tHMG1 This study Open in new tab List of primers Primer no. . Sequence (5′–3′) . 1 GGAAGTAATAATCTACTTTTTACAACAATATAAAACAGGATCCAAAACAATGGCTGCAGACCAATTGGTG 2 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGAC 3 CTTGGCAGCAACAGGAVTAG 4 GCTAGCGTTGTTGGTACCGTT 5 GGAACGTGCTGCTACTCATC 6 GGATCCTGTTTTATATTTGTTGT 7 GGAAGTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCAAAACAATGGCTTCAGAAAAAGAAATTAGG 8 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACG CTAGCTTATTTACTTCTCTTGTAAACC 9 GAACAAGGTTTACAAGAGAAGTAAAGGGTCCGGAATGGCTGCCGTGGATACAAACGC 10 CGAGCTCTTACATTGACACAGAGCCCACG 11 GAACAAGGTTTACAAGAGAAGTAAAGGAGGCGGTGGGTCCATGGCTGCCGTGGATACAAACGC 12 GGACTAGTAAACAATGGCTTCAGAAAAAGAAATTAGGAG 13 TTTACTTCTCTTGTAAACCTTGTTCAAAAAC 14 CTATTATTCGTGGGCTCTGTGTCAATGGGGTCCGGAATGGCTTCAGAAAAAGAAATTAGGAG 15 CGAGCTCTTATTTACTTCTCTTGTAAACCTTGTTCAAAAAC 16 CTATTATTCGTGGGCTCTGTGTCAATGGGAGGCGGTGGGTCCATGGCTTCAGAAAAAGAAATTAGGAG 17 GGACTAGTAAACAATGGCTGCCGTGGATACAAACGC 18 CATTGACACAGAGCCCACGAATAATAG 19 GGATCCTGTTTTATATTTGTTGTAAAAAGTAG 20 GGAACGTGCTGCTACTCATC 21 GTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCATGGCTGCAGACCAATTGGTGAAAACTG 22 GGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGACGGACC 23 GCTAGCGTTGTTGGTACCGTTGTTCAATTGACAG 24 CTTGGCAGCAACAGGACTA Primer no. . Sequence (5′–3′) . 1 GGAAGTAATAATCTACTTTTTACAACAATATAAAACAGGATCCAAAACAATGGCTGCAGACCAATTGGTG 2 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGAC 3 CTTGGCAGCAACAGGAVTAG 4 GCTAGCGTTGTTGGTACCGTT 5 GGAACGTGCTGCTACTCATC 6 GGATCCTGTTTTATATTTGTTGT 7 GGAAGTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCAAAACAATGGCTTCAGAAAAAGAAATTAGG 8 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACG CTAGCTTATTTACTTCTCTTGTAAACC 9 GAACAAGGTTTACAAGAGAAGTAAAGGGTCCGGAATGGCTGCCGTGGATACAAACGC 10 CGAGCTCTTACATTGACACAGAGCCCACG 11 GAACAAGGTTTACAAGAGAAGTAAAGGAGGCGGTGGGTCCATGGCTGCCGTGGATACAAACGC 12 GGACTAGTAAACAATGGCTTCAGAAAAAGAAATTAGGAG 13 TTTACTTCTCTTGTAAACCTTGTTCAAAAAC 14 CTATTATTCGTGGGCTCTGTGTCAATGGGGTCCGGAATGGCTTCAGAAAAAGAAATTAGGAG 15 CGAGCTCTTATTTACTTCTCTTGTAAACCTTGTTCAAAAAC 16 CTATTATTCGTGGGCTCTGTGTCAATGGGAGGCGGTGGGTCCATGGCTTCAGAAAAAGAAATTAGGAG 17 GGACTAGTAAACAATGGCTGCCGTGGATACAAACGC 18 CATTGACACAGAGCCCACGAATAATAG 19 GGATCCTGTTTTATATTTGTTGTAAAAAGTAG 20 GGAACGTGCTGCTACTCATC 21 GTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCATGGCTGCAGACCAATTGGTGAAAACTG 22 GGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGACGGACC 23 GCTAGCGTTGTTGGTACCGTTGTTCAATTGACAG 24 CTTGGCAGCAACAGGACTA Open in new tab List of primers Primer no. . Sequence (5′–3′) . 1 GGAAGTAATAATCTACTTTTTACAACAATATAAAACAGGATCCAAAACAATGGCTGCAGACCAATTGGTG 2 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGAC 3 CTTGGCAGCAACAGGAVTAG 4 GCTAGCGTTGTTGGTACCGTT 5 GGAACGTGCTGCTACTCATC 6 GGATCCTGTTTTATATTTGTTGT 7 GGAAGTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCAAAACAATGGCTTCAGAAAAAGAAATTAGG 8 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACG CTAGCTTATTTACTTCTCTTGTAAACC 9 GAACAAGGTTTACAAGAGAAGTAAAGGGTCCGGAATGGCTGCCGTGGATACAAACGC 10 CGAGCTCTTACATTGACACAGAGCCCACG 11 GAACAAGGTTTACAAGAGAAGTAAAGGAGGCGGTGGGTCCATGGCTGCCGTGGATACAAACGC 12 GGACTAGTAAACAATGGCTTCAGAAAAAGAAATTAGGAG 13 TTTACTTCTCTTGTAAACCTTGTTCAAAAAC 14 CTATTATTCGTGGGCTCTGTGTCAATGGGGTCCGGAATGGCTTCAGAAAAAGAAATTAGGAG 15 CGAGCTCTTATTTACTTCTCTTGTAAACCTTGTTCAAAAAC 16 CTATTATTCGTGGGCTCTGTGTCAATGGGAGGCGGTGGGTCCATGGCTTCAGAAAAAGAAATTAGGAG 17 GGACTAGTAAACAATGGCTGCCGTGGATACAAACGC 18 CATTGACACAGAGCCCACGAATAATAG 19 GGATCCTGTTTTATATTTGTTGTAAAAAGTAG 20 GGAACGTGCTGCTACTCATC 21 GTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCATGGCTGCAGACCAATTGGTGAAAACTG 22 GGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGACGGACC 23 GCTAGCGTTGTTGGTACCGTTGTTCAATTGACAG 24 CTTGGCAGCAACAGGACTA Primer no. . Sequence (5′–3′) . 1 GGAAGTAATAATCTACTTTTTACAACAATATAAAACAGGATCCAAAACAATGGCTGCAGACCAATTGGTG 2 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGAC 3 CTTGGCAGCAACAGGAVTAG 4 GCTAGCGTTGTTGGTACCGTT 5 GGAACGTGCTGCTACTCATC 6 GGATCCTGTTTTATATTTGTTGT 7 GGAAGTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCAAAACAATGGCTTCAGAAAAAGAAATTAGG 8 GAAAAGGGGCCTGTCAATTGAACAACGGTACCAACAACG CTAGCTTATTTACTTCTCTTGTAAACC 9 GAACAAGGTTTACAAGAGAAGTAAAGGGTCCGGAATGGCTGCCGTGGATACAAACGC 10 CGAGCTCTTACATTGACACAGAGCCCACG 11 GAACAAGGTTTACAAGAGAAGTAAAGGAGGCGGTGGGTCCATGGCTGCCGTGGATACAAACGC 12 GGACTAGTAAACAATGGCTTCAGAAAAAGAAATTAGGAG 13 TTTACTTCTCTTGTAAACCTTGTTCAAAAAC 14 CTATTATTCGTGGGCTCTGTGTCAATGGGGTCCGGAATGGCTTCAGAAAAAGAAATTAGGAG 15 CGAGCTCTTATTTACTTCTCTTGTAAACCTTGTTCAAAAAC 16 CTATTATTCGTGGGCTCTGTGTCAATGGGAGGCGGTGGGTCCATGGCTTCAGAAAAAGAAATTAGGAG 17 GGACTAGTAAACAATGGCTGCCGTGGATACAAACGC 18 CATTGACACAGAGCCCACGAATAATAG 19 GGATCCTGTTTTATATTTGTTGTAAAAAGTAG 20 GGAACGTGCTGCTACTCATC 21 GTAATTATCTACTTTTTACAACAAATATAAAACAGGATCCATGGCTGCAGACCAATTGGTGAAAACTG 22 GGGGCCTGTCAATTGAACAACGGTACCAACAACGCTAGCTTAGGATTTAATGCAGGTGACGGACC 23 GCTAGCGTTGTTGGTACCGTTGTTCAATTGACAG 24 CTTGGCAGCAACAGGACTA Open in new tab Strain SCIYH11 and SCIYH12 were constructed by transforming plasmids pBYH05 and pBYH06 into SCIGS22a, respectively. Similarly, plasmids pBYH09, pBYH10, pBYH11, pBYH12, pBYH13, pBYH14, pBYH15 were transformed into SCIGS22a resulting in strains SCIYH18, SCIYH19, SCIYH20, SCIYH21, SCIYH22, SCIYH23, SCIYH24, respectively. Media and growth conditions The yeast strains were selected on synthetic defined (SD) medium with 20 g l−1 glucose as carbon source without uracil at 30 °C. Select single colonies of strains were then used for pre-culture in test tubes with a 5-ml minimal medium which had following composition: 7.5 g l−1 (NH4)2SO4; 14.4 g l−1 KH2PO4; 0.5 g l−1 MgSO4·7H2O; 20 g l−1 glucose; 2 ml l−1 trace metal solution; 1 ml l−1 vitamin solution. The pH of the medium was adjusted to 6.5 by controlled addition of 2 M KOH. These were cultivated at 30 °C with 200 rpm. After pre-culture, cells were inoculated into 20 ml of fresh defined medium described above in a 100-ml Erlenmeyer flask with an initial OD600 of 0.05. For analysis, 10% (v/v) dodecane was also added into the culture to capture the germacrene A produced in the organic layer. The main cultures with dodecane were cultivated at 30 °C with 200 rpm for 72 h. Analytical methods Sesquiterpene production was captured by dodecane during shake flasks cultivation as described above. We took the samples from the aqueous layer to measure the OD600 after 72 h. The product-containing dodecane layer was sampled and analyzed by GC–MS (Focus GC, ThermoFisher Scientific) equipped with a Zebron ZB-50 column and an ISQ mass spectrometer (ThermoFisher Scientific). The GC program was as follows: initial temperature of 40 °C, hold for 1 min; ramp to 180 °C at a rate of 25 °C per minute and hold for 5 min; then raise to 300 °C at a rate of 15 °C per min and hold for 3 min. The temperature of inlet, mass transfer line and ion source were kept at 250, 250, 200 °C, respectively. The inject volume was 1 µl. The flow rate of the carrier gas (helium) was set to 1.0 ml per minute, and data were acquired at full scan mode (50–650 m/z). Results Selection of germacrene A synthase For selecting an efficient germacrene A synthase (GAS), we compared two germacrene A synthase encoding genes HaGAS2 [GenBank: DQ016668] from Helianthus annuus L. [11] and LTC2 [GenBank: AF489965] from Lactuca sativa [4] in yeast. Both of the GASs contain highly conserved DDxxD and RxR motifs, responsible for the divalent metal ion-substrate binding [11]. We introduced these two codon optimized genes into expression plasmid pBS01 separately, and then transformed them into S. cerevisiae SCIGS22a, which was optimized for isoprenoid production in previous study [21]. Expression of LTC2 opt enabled a production of germacrene A of 30 mg/l (strain SCIYH12, Fig. 2), and HaGAS2 opt expression resulted in 20 mg/l germacrene A (strain SCIYH11, Fig. 2), which indicated that LTC2 opt was more efficient than HaGAS2 opt for germacrene A production. Thus, LTC2 opt was chosen for further work. Because of high temperature during analysis, germacrene A transformed into beta-elemene completely. Subsequent GC/MS analysis demonstrates that beta-elemene was produced by recombinant strain SCYH12 (Fig. 3a), and for which the mass spectra matched the beta-elemene structure (Fig. 3b). Fig. 2 Open in new tabDownload slide Titers of germacrene A produced by strains containing HaGAS2 opt and LTC2 opt. The strains were cultivated for 72 h in minimal media, and germacrene A was captured by dodecane during shaking flasks. The data represent average ± standard deviations of at least three independent clones Fig. 3 Open in new tabDownload slide Beta-elemene was detected by GC/MS. a GC/MS chromatograms of beta-elemene isolated from SCIYH12, negative control and standard. b Mass spectra of beta-elemene from selected peak of SCIYH12. The strains were cultivated for 72 h in minimal media, and germacrene A was captured by dodecane during shaking flasks. The data represent average ± standard deviations of at least three independent clones Increasing germacrene A production by overexpression of tHMG1 To improve production of germacrene A we performed further engineering of the mevalonate pathway. Hydroxy-3-methylglutaryl coenzyme A reductase (HMGR), encoded by the gene HMG1, is a key flux-controlling step in the mevalonate pathway [7]. Several studies revealed that overexpression of tHMG1 (3-terminal 1575 bp part of HMG1), encoding the catalytic domain of HMG-CoA reductase could lead to an improved production of isoprenoids in S. cerevisiae [7, 26, 28]. We, therefore, overexpressed tHMG1 under a strong promoter PGK1 in a high copy number vector. The resulting strain SCIYH18 produced 47.7 mg/l germacrene A, which corresponds with a 1.5-fold improvement compared to the control strain SCIYH12 (Fig. 4). Fig. 4 Open in new tabDownload slide Titers of germacrene A produced by SCIYH12 and SCIYH18. The strains were cultivated for 72 h in minimal media, and germacrene A was captured by dodecane during shaking flasks. The data represent average ± standard deviations of at least three independent clones Enzyme fusion of FPPS and GAS increased germacrene A production Farnesyl diphosphate (FPP) is the precursor of various yeast essential metabolites, such as squalene, isoprenoids, steroid, heme A and ergosterol [12, 23]. In yeast, both geranyl diphosphate (GPP) and farnesyl diphosphate synthase activities are shared by one enzyme called farnesyl diphosphate synthase (FPPS), which is encoded by the gene ERG20 [8]. Since FPP is involved in the synthesis of many different metabolites, we fused FPPS with GAS to redirect flux towards germacrene A production. A functional fusion protein strategy in metabolic process requires the soluble expression of the chimeric enzyme [3]. Previous studies indicated that linker length and the order of proteins contribute not only to the expression efficiency, but also to correct folding of the two fusion proteins. Thus, in the present study we examined both the effect of linker length and order. Two flexible linkers, GSG and GGGGS, which have different lengths were used in this study. We, therefore, constructed four possible fusion configurations (FPPS-GSG-GAS, FPPS-GGGGS-GAS, GAS-GSG-FPPS and GAS-GGGGS-FPPS) and expressed these under the control of the strong promoter TEF1. The four fusion configurations had higher germacrene A titer than the control strain SCIYH19 expressing free FPPS and GAS (Fig. 5), which indicated that fusion FPPS with GAS has successfully enhanced carbon channeling toward germacrene A production. Among these fusions, FPPS-GGGGS-GAS (strain SCIYH23) enabled highest production of germacrene A (97.7 mg/l), twofold higher compared to the control strain SCIYH19 containing free FPPS and GAS in a separate form. Interestingly, the FPPS-GSG-GAS expressing strain had a similar germacrene A titer of 97.2 mg/l, while the strain carrying the fusion GAS-GSG-FPPS (strain SCIYH20) and GAS-GGGGS-FPPS (strain SCIYH21) displayed lower germacrene A production (Fig. 5). Fig. 5 Open in new tabDownload slide Germacrene A productions by yeast strains overexpressing various enzymes. All strains were cultivated using two layer fermentation method in shake-flask culture for 72 h. Minimal media was used during cultivation. The data represent average ± standard deviations of at least three independent clones We next combined expression of tHMG1 and the enzyme fusion to further increase the germacrene A production. The resulting strain SCIYH24, carrying a tHMG1 and FPPS-GGGGS-GAS overexpressing plasmid, produced 190 mg/l germacrene A in shake-flask culture, which is approximately twofold higher compared to strain SCIYH23 containing the fusion configuration FPPS-GGGGS-GAS and fourfold higher than that obtained by strain SCIYH18 only expressing tHMG1. Discussion and conclusion Though Curcuma wenyujin is a native producer of beta-elemene, we failed to identify an efficient GAS in this plant (data not shown). Alternatively, we selected two GASs from sunflower and lettuce, which have previously been shown as efficient GASs. Consistently, expression of these two GASs enabled relatively high level production of germacrene A in yeast. In metabolic engineering, identification and optimization of flux-controlling steps is essential for high level production of target molecules such as isoprenoids as reported previously [2, 20, 28]. Here, even though our background strain contains an additional, highly expressed copy of tHMG1, our results have shown that further overexpression of this gene results in a 1.5-fold increase in Germacrene A production, suggesting this step is still exerting some flux-control. Another strategy used in this study to enhance the precursor was to redirect the pathway flux towards germacrene A formation. Since FPP is a precursor for several metabolites, overexpression of FPPS alone might not be so beneficial for improving the production of target molecules, but may increase the accumulation of by-products such as farnesol, the hydrolysis product of FPP [28]. Enzyme fusion is, however, a feasible strategy to improve the flux towards FPP and further to a sesquiterpene by enabling substrate channeling [3]. We, therefore, constructed different enzyme fusions of FPPS and GAS by optimizing the linkers and fusion orders (FPPS-GSG-GAS, FPPS-GGGGS-GAS, GAS-GSG-FPPS and GAS-GGGGS-FPPS). Among these fusion configurations, FPPS-GGGGS-GAS (strain SCIYH23) produced the highest titer of germacrene A, which indicated that it was the most beneficial for protein folding and biological activity of these enzymes. Interesting, the fusion order is very important for efficient production of germacrene A, while the linker had little effect on germacrene A production (Fig. 5). These results indicated that proper fusion order is essential for enzyme activities, allowing two active sites to be brought into a closer proximity which reduces loss of intermediates compared with other competing pathways [28]. Finally, combined overexpression of tHMG1 and FPPS-GGGGS-GAS in same strain resulted in an additional improvement of germacrene A to 190.7 mg/L, sixfold higher compared to the control strain SCIYH12, which was already engineered for high-level production of sesquiterpenes. This titer is much higher than reported previously for engineered yeast strains(150 µg/l) [15] and E. coli (<10 mg/l) [9] carrying germacrene A synthase, but without enhancing upstream isoprenoid pathways, which suggests that enhancing the pools of precursors is beneficial for overproducing germacrene A. Furthermore, construction and optimization of a fusion protein for enhanced substrate channeling would be a feasible approach for the production of other isoprenoids and chemicals especially for pathways involving unstable or toxic intermediates. Traditional extraction methods to obtain beta-elemene could be time consuming and limited by the growth situation of plant. Here, we have demonstrated that metabolic engineering of yeast could be a potential replacement for current production routes. While further improvement is necessary before commercial production via microbes is achieved, this study could form a basis for further manipulation that would allow replacement of traditional extraction of beta-elemene from plant resources. Acknowledgements This work was supported by the National Science Fund for Distinguished Young Scholars (81325023). Part of this work was funded by the Knut and Alice Wallenberg foundation and the Novo Nordisk Foundation. We thank Yun Chen, Min Chen and Ping Su for providing good comments and help. We also thank Guodong Liu for reading the manuscript and providing valuable suggestions. Authors’ contribution JN and LQH conceived and supervised the study. YTH designed and performed the experiments as well as drafting the manuscript. AK assisted with the construction of plasmid pBS01 and participated in experiment design. YJZ participated in the design and provided many valuable suggestions during the study. JCB contributed to Gibson cloning and fermentation experiment. All authors read and approved the final manuscript. Compliance with ethical standards Conflict of interest The authors declare that they have no competing interests. References 1. Agger SA , Lopez-Gallego F, Hoye TR, Schmidt-Dannert C Identification of sesquiterpene synthases from Nostoc punctiforme PCC 73102 and Nostoc sp. strain PCC 7120 J Bacteriol 2008 190 6084 6096 10.1128/JB.00759-08 2546793 Google Scholar Crossref Search ADS PubMed WorldCat 2. Ajikumar PK , Xiao WH, Tyo KE, Wang Y, Simeon F, Leonard E, Mucha O, Phon TH, Pfeifer B, Stephanopoulos G Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli Science 2010 330 70 74 10.1126/science.1191652 3034138 Google Scholar Crossref Search ADS PubMed WorldCat 3. Albertsen L , Chen Y, Bach LS, Rattleff S, Maury J, Brix S, Nielsen J, Mortensen UH Diversion of Flux toward sesquiterpene production in Saccharomyces cerevisiae by fusion of host and heterologous enzymes Appl Environ Microb 2011 77 1033 1040 10.1128/AEM.01361-10 Google Scholar Crossref Search ADS WorldCat 4. Bennetta MH , Mansfield JW, Lewis MJ, Beale MH Cloning and expression of sesquiterpene synthase genes from lettuce (Lactuca sativa L.) Phytochemistry 2002 60 255 261 10.1016/S0031-9422(02)00103-6 Google Scholar Crossref Search ADS PubMed WorldCat 5. Borodina I , Nielsen J Advances in metabolic engineering of yeast Saccharomyces cerevisiae for production of chemicals Biotechnol J 2014 9 609 620 10.1002/biot.201300445 Google Scholar Crossref Search ADS PubMed WorldCat 6. Chen Y , Partow S, Scalcinati G, Siewers V, Nielsen J Enhancing the copy number of episomal plasmids in Saccharomyces cerevisiae for improved protein production FEMS Yeast Res 2012 12 598 607 10.1111/j.1567-1364.2012.00809.x Google Scholar Crossref Search ADS PubMed WorldCat 7. Donald KAG , Hampton RY, Fritz IB Effects of overproduction of the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase on squalene synthesis in Saccharomyces cerevisiae Appl Environ Microb 1997 63 3341 3344 Google Scholar Crossref Search ADS WorldCat 8. Fischer MJC , Meyer S, Claudel P, Bergdoll M, Karst F Metabolic engineering of monoterpene synthesis in yeast Biotechnol Bioeng 2011 108 1883 1892 10.1002/bit.23129 Google Scholar Crossref Search ADS PubMed WorldCat 9. Gao Y (2012) The study of microbial synthesis of germacrene A the precursor of beta-elemene. Master dissertation. Hangzhou Normal University 10. Gibson DG , Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO Enzymatic assembly of DNA molecules up to several hundred kilobases Nat Methods 2009 6 343 345 10.1038/nmeth.1318 Google Scholar Crossref Search ADS PubMed WorldCat 11. Gopfert JC , Macnevin G, Ro DK, Spring O Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes BMC Plant Biol 2009 9 86 10.1186/1471-2229-9-86 2715020 Google Scholar Crossref Search ADS PubMed WorldCat 12. Karst F , Plochocka D, Meyer S, Szkopinska A Farnesyl diphosphate synthase activity affects ergosterol level and proliferation of yeast Saccharomyces cerevisae Cell Biol Int 2004 28 193 197 10.1016/j.cellbi.2003.12.001 Google Scholar Crossref Search ADS PubMed WorldCat 13. Kraker JD , Franssen MCR, Groot AD, König WA, Bouwmeester HJ (+)-Germacrene A biosynthesis Plant Physiol 1998 117 1381 1392 10.1104/pp.117.4.1381 34902 Google Scholar Crossref Search ADS PubMed WorldCat 14. Krivoruchko A , Nielsen J Production of natural products through metabolic engineering of Saccharomyces cerevisiae Curr Opin Biotechnol 2014 35C 7 15 Google Scholar OpenURL Placeholder Text WorldCat 15. Liu Q , Majdi M, Cankar K, Goedbloed M, Charnikhova T, Verstappen FW, de Vos RC, Beekwilder J, van der Krol S, Bouwmeester HJ Reconstitution of the costunolide biosynthetic pathway in yeast and Nicotiana benthamiana PLoS One 2011 6 e23255 10.1371/journal.pone.0023255 3156125 Google Scholar Crossref Search ADS PubMed WorldCat 16. Lopez J , Essus K, Kim IK, Pereira R, Herzog J, Siewers V, Nielsen J, Agosin E Production of beta-ionone by combined expression of carotenogenic and plant CCD1 genes in Saccharomyces cerevisiae Microb Cell Fact 2015 14 84 10.1186/s12934-015-0273-x 4464609 Google Scholar Crossref Search ADS PubMed WorldCat 17. Lu JJ , Dang YY, Huang M, Xu WS, Chen XP, Wang YT Anti-cancer properties of terpenoids isolated from Rhizoma Curcumae–a review J Ethnopharmacol 2012 143 406 411 10.1016/j.jep.2012.07.009 Google Scholar Crossref Search ADS PubMed WorldCat 18. Paddon CJ , Westfall PJ, Pitera DJ, Benjamin K, Fisher K, McPhee D, Leavell MD, Tai A, Main A, Eng D, Polichuk DR, Teoh KH, Reed DW, Treynor T, Lenihan J, Fleck M, Bajad S, Dang G, Dengrove D, Diola D, Dorin G, Ellens KW, Fickes S, Galazzo J, Gaucher SP, Geistlinger T, Henry R, Hepp M, Horning T, Iqbal T, Jiang H, Kizer L, Lieu B, Melis D, Moss N, Regentin R, Secrest S, Tsuruta H, Vazquez R, Westblade LF, Xu L, Yu M, Zhang Y, Zhao L, Lievense J, Covello PS, Keasling JD, Reiling KK, Renninger NS, Newman JD High-level semi-synthetic production of the potent antimalarial artemisinin Nature 2013 496 528 532 10.1038/nature12051 Google Scholar Crossref Search ADS PubMed WorldCat 19. Ramirez AM , Saillard N, Yang T, Franssen MC, Bouwmeester HJ, Jongsma MA Biosynthesis of sesquiterpene lactones in pyrethrum (Tanacetum cinerariifolium) PLoS One 2013 8 e65030 10.1371/journal.pone.0065030 3669400 Google Scholar Crossref Search ADS PubMed WorldCat 20. Ro DK , Paradise EM, Ouellet M, Fisher KJ, Newman KL, Ndungu JM, Ho KA, Eachus RA, Ham TS, Kirby J, Chang MCY, Withers ST, Shiba Y, Sarpong R, Keasling JD Production of the antimalarial drug precursor artemisinic acid in engineered yeast Nature 2006 440 940 943 10.1038/nature04640 Google Scholar Crossref Search ADS PubMed WorldCat 21. Scalcinati G , Partow S, Siewers V, Schalk M, Daviet L, Nielsen J Combined metabolic engineering of precursor and co-factor supply to increase alpha-santalene production by Saccharomyces cerevisiae Microb Cell Fact 2012 11 117 10.1186/1475-2859-11-117 3527295 Google Scholar Crossref Search ADS PubMed WorldCat 22. Siddiqui MS , Thodey K, Trenchard I, Smolke CD Advancing secondary metabolite biosynthesis in yeast with synthetic biology tools FEMS Yeast Res 2012 12 144 170 10.1111/j.1567-1364.2011.00774.x Google Scholar Crossref Search ADS PubMed WorldCat 23. Siddiqui MS , Thodey K, Trenchard I, Smolke CD Advancing secondary metabolite biosynthesis in yeast with synthetic biology tools FEMS Yeast Res 2012 12 144 170 10.1111/j.1567-1364.2011.00774.x Google Scholar Crossref Search ADS PubMed WorldCat 24. Sousa EMBD , Martínez J, Chiavone-Filho O, Rosa PTV, Domingos T, Meireles MAA Extraction of volatile oil from Croton zehntneri Pax et Hoff with pressurized CO2: solubility, composition and kinetics J Food Eng 2005 69 325 333 10.1016/j.jfoodeng.2004.08.023 Google Scholar Crossref Search ADS WorldCat 25. Tippmann S , Scalcinati G, Siewers V, Nielsen J Production of farnesene and santalene by Saccharomyces cerevisiae using fed-batch cultivations with RQ-controlled feed Biotechnol Bioeng 2016 113 72 81 10.1002/bit.25683 Google Scholar Crossref Search ADS PubMed WorldCat 26. Verwaal R , Wang J, Meijnen JP, Visser H, Sandmann G, van den Berg JA, van Ooyen AJJ High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous Appl Environ Microb 2007 73 4342 4350 10.1128/AEM.02759-06 Google Scholar Crossref Search ADS WorldCat 27. Weinheimer AJ , Youngblood WW, Washecheck PH, Karns TKB, Ciereszko LS Isolation of the elusive (-)-germacrene-A from the gorgonian, Eunicea mammosa: chemistry of coelenterates XVIII Tetrahedron Lett 1970 7 497 500 10.1016/0040-4039(70)89009-8 Google Scholar OpenURL Placeholder Text WorldCat Crossref 28. Zhou YJJ , Gao W, Rong QX, Jin GJ, Chu HY, Liu WJ, Yang W, Zhu ZW, Li GH, Zhu GF, Huang LQ, Zhao ZBK Modular pathway engineering of diterpenoid synthases and the mevalonic acid pathway for miltiradiene production J Am Chem Soc 2012 134 3234 3241 10.1021/ja2114486 Google Scholar Crossref Search ADS PubMed WorldCat © Society for Industrial Microbiology 2017 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model) © Society for Industrial Microbiology 2017
TI - Metabolic engineering of Saccharomyces cerevisiae for production of germacrene A, a precursor of beta-elemene
JO - Journal of Industrial Microbiology and Biotechnology
DO - 10.1007/s10295-017-1934-z
DA - 2017-07-01
UR - https://www.deepdyve.com/lp/oxford-university-press/metabolic-engineering-of-saccharomyces-cerevisiae-for-production-of-fOYAt0dm5u
SP - 1065
EP - 1072
VL - 44
IS - 7
DP - DeepDyve
ER -