TY - JOUR
AU - Bhatia, Mickie
AB - Abstract Induced pluripotent stem cell reprogramming has provided critical insights into disease processes by modeling the genetics and related clinical pathophysiology. Human cancer represents highly diverse genetics, as well as inter- and intra-patient heterogeneity, where cellular model systems capable of capturing this disease complexity would be invaluable. Acute myeloid leukemia (AML) represents one of most heterogeneous cancers and has been divided into genetic subtypes correlated with unique risk stratification over the decades. Here, we report our efforts to induce pluripotency from the heterogeneous population of human patients that represents this disease in the clinic. Using robust optimized reprogramming methods, we demonstrate that reprogramming of AML cells harboring leukemic genomic aberrations is a rare event with the exception of those with de novo mixed-lineage leukemia (MLL) mutations that can be reprogrammed and model drug responses in vitro. Our findings indicate that unlike hematopoietic cells devoid of genomic aberrations, AML cells harboring driver mutations are refractory to reprogramming. Expression of MLL fusion proteins in AML cells did not contribute to induced reprogramming success, which continued to select for patient derived cells devoid of AML patient-specific aberrations. Our study reveals that unanticipated blockades to achieving pluripotency reside within the majority of transformed AML patient cells. Induced pluripotent stem cells, Acute myeloid leukemia, Mixed-lineage leukemia, Reprogramming Significance Statement Our study reveals that unanticipated blockades to achieving pluripotency reside within the majority of transformed acute myeloid leukemia (AML) patient cells. This is critical in establishing the foundation for further studies toward overcoming this obstacle, and creating novel models for human AML disease. Introduction Generation of induced pluripotent stem cells (iPSCs) has provided critical models to better understand the molecular and cellular basis of human disease [1, 2]. In successful cases of iPSC disease modeling, specific gene mutations have been targeted that were strongly associated with cellular defects manifesting pathophysiology in patients. iPSC disease models were further used for the discovery of modulating drugs [3] and/or gene correction [4]. In the case of human cancer, the sequence of genetic mutation acquisition and causal effects [5, 6] represents a major challenge to developing surrogate models of transformation for preclinical translation [7]. This heterogeneity of human cancer genetics is further compounded by inter- and intra-patient variability and is well illustrated in adult acute myeloid leukemia (AML) [8, 9]. Genetic stratification of AML patients has allowed correlations to overall survival and drug responses in the clinic [10] and has been used for targeted drug development against driver mutations [11, 12]. More recently, whole genome sequencing has allowed further genetic resolution of AML patients into four risk categories; favorable, intermediate classes (1 and 2), and adverse [9]. Accordingly, application of iPSC technology to reprogram individual AML patient cells holds the potential to capture the molecular diversity of this disease, leading to detailed understanding of patient specific treatment and management [13]. Here, we report our efforts to induce pluripotent reprogramming of AML patient samples. AML patients were carefully selected to reflect disease heterogeneity observed in the clinic [9]. Other than a single sample harboring mixed-lineage leukemia (MLL) rearrangement, which reprogrammed and modeled AML drug response, we report that pluripotent reprogramming of AML patient cells is a rare event and may be limited to samples harboring MLL mutations due to the selection of non-mutated hematopoietic progenitors. Introduction of the MLL-AF9 fusion protein is insufficient for overcoming the reprogramming blockade, which instead selects for healthy hematopoietic cells. Materials and Methods Patient Samples Primary bone marrow (BM) and peripheral blood (PB) samples were obtained from human AML patients, and mobilized PB (MPB) and cord blood (CB) from healthy donors, in accordance with Research Ethics Board-approved protocols at McMaster University. Mononuclear cells were isolated using density gradient centrifugation [Ficoll-Paque Premium; (GE Healthcare, Piscataway, NJ)] followed by ammonium chloride lysis (StemCell Technologies). Cells were cryopreserved in fetal bovine serum with 10% dimethyl sulfoxide until use. Cell Culture Upon thawing, CD34+ enrichment was performed using human CD34 MicroBead Kit (Miltenyi Biotec, Bergisch Gladbach, Germany) and then AML samples were cultured in hematopoietic medium: Iscove’s Modified, Dulbecco’s Media (IMDM) with 15% v/v BSA (Bovine Serum Albumin), Insulin, and Transferrin (BIT) (StemCell Technologies Vancouver, Canada), 1% v/v Non-Essential Amino Acids (NEAA), and 1% v/v Na-pyruvate (Gibco, Grand Island, NY), 100 ng/ml Flt-3 ligand, 20 ng/ml interleukin-3, and 100 ng/ml thrombopoietin (all (R&D Systems, Minneapolis, MN)) and 100 ng/ml stem cell factor (Amgen Inc., Thousand Oaks, CA) for 24 to 48 hours before transduction. During reprogramming, AML samples were cultured on irradiated mouse embryonic fibroblasts (iMEFs) in reprogramming media supplemented either with 10 ng/ml human fibroblast growth factor (FGF) 2 (R&D systems), or 20 ng/ml human leukemia inhibitory factor (LIF, ThermoFisher), PD0325901 (1 μM), and CHIR99021 (3 μM, (Selleckchem, Houston, TX)), herein termed FGF 2 [14] and LIF-2i media [15], respectively. iPSCs were differentiated into hematopoietic progenitor cells (HPCs) as described previously [16]. Cellular Reprogramming pSIN4-EF2-O2S and pSIN4-CMV-K2M plasmids were provided by James Thomson (Addgene plasmids #21162 and #21164, respectively) [17], and pLBC2GM-MLL-AF9 was kindly provided by Dr. John E. Dick. Cells were transduced in hematopoietic media in the presence of 8 µg/ml polybrene (Sigma-Aldrich, Oakville, Canada) via spinfection, twice over 48 hours. On day 5, cells were seeded onto iMEFs and maintained in FGF2 or LIF-2i media. iPSC colonies emerged ∼20 days post-transduction and were individually isolated and expanded on iMEFs in FGF2 media. Bromodomain and Extra Terminal Protein Inhibitor Assay Cells were plated in 96-well format and treated after 24 hours (bromodomain and extra-terminal protein inhibitor [IBET]-151 and pyrvinium, (Tocris, Minneapolis, MN)) for additional 24 hours. On days 3 or 5 depending on the experiment, cell survival was assessed using LIVE/DEAD Fixable Far Red Dead Cell Stain Kit (ThermoFisher, Waltham, MA) and Hoechst 33342 staining (BD, Becton-Dickinson, Franklin Lakes, NJ). Flow Cytometry HPCs were analyzed with CD34-PE and CD45-APC antibodies, transduction efficiency with OCT4-AF647 and SOX2-AF647, iPSCs with OCT4-AF488, SOX2-AF647, NANOG-PE, SSEA3-PE, and TRA-1-60-AF647 (all BD). Intracellular staining was performed using the Cytofix/Cytoperm kit (BD). Flow cytometry was performed on LSRII and FACSAria (BD) and analyzed by FlowJo software (Tree Star, Ashland, OR). Fluorescence In Situ Hybridization Fluorescence in situ hybridization was performed on AML, iPSC, and colony-forming unit (CFU) samples, as described previously [14]. Number of nuclei scored is indicated in figure legends. Teratoma Assay AML iPSCs were collected and injected as clumps into NOD/SCID mice testes. At 8 weeks, teratomas were harvested, fixed with 4% paraformaldehyde, embedded in paraffin, and processed for H&E staining. Clonogenic CFU Assay HPCs were plated in Methocult H4434 (StemCell Technologies) to quantify CFU capacity. Individual colonies were spun onto slides using Shandon Cytospin 3 (Block Scientific, Bellport, NY) and stained with Giemsa-Wright (Shandon Kwik-Diff Stain Kit, Thermo Fisher). Reverse-Transcriptase Polymerase Chain Reaction Reverse-transcriptase polymerase chain reaction was performed on AML, iPSCs, and CFU to assess MLL-AF9 fusion transcript. Primer sequences used were MLL-exon7-F: GGAAGTCAAGCAAGCAGGTC and AF9-exon7-R: TCGGCTGCCTCC TCTATTTA, and GAPDH-F: CCACATCGCTCAGACACCAT and GAPDH-R: GCGCCCAATACGACCAAAT. Exogenous (exo) OCT4 silencing was determined using the following primer sets: exo-OCT4-F: CCCATGCATTCAAACTGAGGTG and exo-OCT4-R: AGGGAGAGGGGCGGAATTG; total-OCT4-F: CAGTGCCCGAAACCCACAC, and total-OCT4-R: GGAGACCCAGCAGCCTCAAA, and GAPDH primers described above. Imaging and Immunocytochemistry Phase contrast and fluorescent images were acquired on an Olympus microscope with a CoolSNAP HQ2 camera (Photometric Scientific, Tucson, AZ) or the Operetta High Content Imaging System (PerkinElmer, Waltham, MA). Hoechst + LDFR– cell counts for the IBET assay were quantified using Acapella and FCS express software. Teratomas and cytospins were imaged using ScanScope slide scanner with ImageScope software (Aperio, Leica Biosystems, Wetzlar, Germany). iPSCs were stained with TRA-1–60-DyLight488 (Thermo Fisher). Statistical Analyses Data are presented as mean ± SEM or SD. Statistical analyses were performed using Prism software (GraphPad, La Jolla, CA). Results Thirteen genetic subtypes of human AML were used in pluripotent reprogramming studies deliberately spanning the favorable, intermediate 1, intermediate 2, and adverse AML risk groups (Fig. 1A, 1B; Supporting Information Table S1) that cover the molecular and therapeutic heterogeneity of adult AML disease [8–10]. Given leukemic disease cell dissemination experienced by AML patients, samples from both the BM as well as PB compartment were obtained. Cultured CD34+ cells were transduced and assessed morphologically for human iPSCs expressing TRA-1-60 [18], which were enumerated per patient (Fig. 1A; Supporting Information Fig. S1A, S1B). Although seven patient samples gave rise to iPSC colonies, nine patient samples failed to reprogram entirely (Fig. 1C). As AML samples were selected based on genetic diversity and specific aberrations, molecular probes were used to interrogate individual iPSC colonies from the seven patients. Detection of genomic aberrations specific to each AML patient revealed that only one AML patient of 16 was able to give rise to pluripotent cells originating from transformed AML cells (Fig. 1C, 1D; Supporting Information Fig. S1C) and detailed in Supporting Information Table S1. Although Sendai-based Oct-4, Sox2, Klf4, and c-myc (OSKM) delivery increased iPSC formation (Supporting Information Fig. S1D), this enhancement was incapable of recruiting AML cells to the pluripotent state (Fig. 1A). The single AML sample reprogrammed to iPSC did so only under LIF-2i conditions (Fig. 1A) [15] and possessed the MLL-AF9 rearrangement in all analyzed clones (Fig. 1D; Supporting Information Fig. S1C). The remaining iPSCs generated did not contain AML mutations (Fig. 1E, 1F). Importantly, generation of iPSCs from AML patients harboring MLL rearrangement is not necessarily sufficient alone, as additional patient samples (AML #9, #10, and #11) failed to reprogram (Fig. 1E). Figure 1 Open in new tabDownload slide Reprogramming frequency of peripheral blood and bone marrow cells obtained from acute myeloid leukemia (AML) patients representing heterogeneity of disease in the human population. (A): A summary of AML samples from 16 individual patients used for pluripotent reprogramming induction and induced pluripotent stem cell (iPSC) outcome. Further details concerning the patients and samples are included in Supporting Information Table 1. Leukemic aberrations were detected with reverse-transcriptase polymerase chain reaction (RT-PCR) and/or fluorescence in situ hybridization (FISH) on individual iPSC colonies, with the exception of AML#9 where TRA-1–60+ iPSC colonies were pooled before testing by RT-PCR. “∅” denotes AML samples where iPSC generation was attempted but no TRA-1-60+ colonies per each subtype (AML or normal) were generated. (B): Summary of AML patient molecular heterogeneity analyzed in this study. (C): Summary of AML iPSC reprogramming success, as determined by retention of leukemic aberration following iPSC colony identification. (D): FISH performed in AML#12 and leukemia inhibitory factor-2i-derived AML iPSC, mixed-lineage leukemia (MLL)-rearrangement indicated with arrowheads. More than fifty nuclei scored per iPSC line (number of AML iPSC clones out of total iPSC clones examined, is shown as ratio in top right corner) and per de novo AML. (E): FISH performed in AML#10 and AML#11 and representative normal iPSCs (number of AML iPSC clones out of total iPSC clones examined is shown as ratio in top right corner). MLL-rearrangement indicated with arrowheads in de novo AML. More than fifty nuclei scored per iPSC line, and per de novo AML. (F): FISH performed in representative iPSCs from AML#1 (co-localization of the Pro-Myelocytic Leukemia (PML) and Retinoic Acid Receptor Alpha (RARα), red and green, respectively), AML#2, and AML#7 shows the absence of the leukemic aberration (normal iPSC), which is identified with arrowheads in the de novo AML patient sample (frequency within CD34+ cells indicated in top row). Number of AML iPSC clones out of total iPSC clones examined is shown as ratio in top right corner per representative iPSC nuclei image per AML sample. Fifty nuclei scored per clone. Abbreviations: AML, acute myeloid leukemia; FGF, fibroblast growth factor; iPSC, induced pluripotent stem cell; LIF, leukemia inhibitory factor; NA, data not available. Figure 1 Open in new tabDownload slide Reprogramming frequency of peripheral blood and bone marrow cells obtained from acute myeloid leukemia (AML) patients representing heterogeneity of disease in the human population. (A): A summary of AML samples from 16 individual patients used for pluripotent reprogramming induction and induced pluripotent stem cell (iPSC) outcome. Further details concerning the patients and samples are included in Supporting Information Table 1. Leukemic aberrations were detected with reverse-transcriptase polymerase chain reaction (RT-PCR) and/or fluorescence in situ hybridization (FISH) on individual iPSC colonies, with the exception of AML#9 where TRA-1–60+ iPSC colonies were pooled before testing by RT-PCR. “∅” denotes AML samples where iPSC generation was attempted but no TRA-1-60+ colonies per each subtype (AML or normal) were generated. (B): Summary of AML patient molecular heterogeneity analyzed in this study. (C): Summary of AML iPSC reprogramming success, as determined by retention of leukemic aberration following iPSC colony identification. (D): FISH performed in AML#12 and leukemia inhibitory factor-2i-derived AML iPSC, mixed-lineage leukemia (MLL)-rearrangement indicated with arrowheads. More than fifty nuclei scored per iPSC line (number of AML iPSC clones out of total iPSC clones examined, is shown as ratio in top right corner) and per de novo AML. (E): FISH performed in AML#10 and AML#11 and representative normal iPSCs (number of AML iPSC clones out of total iPSC clones examined is shown as ratio in top right corner). MLL-rearrangement indicated with arrowheads in de novo AML. More than fifty nuclei scored per iPSC line, and per de novo AML. (F): FISH performed in representative iPSCs from AML#1 (co-localization of the Pro-Myelocytic Leukemia (PML) and Retinoic Acid Receptor Alpha (RARα), red and green, respectively), AML#2, and AML#7 shows the absence of the leukemic aberration (normal iPSC), which is identified with arrowheads in the de novo AML patient sample (frequency within CD34+ cells indicated in top row). Number of AML iPSC clones out of total iPSC clones examined is shown as ratio in top right corner per representative iPSC nuclei image per AML sample. Fifty nuclei scored per clone. Abbreviations: AML, acute myeloid leukemia; FGF, fibroblast growth factor; iPSC, induced pluripotent stem cell; LIF, leukemia inhibitory factor; NA, data not available. AML#12-iPSCs were further interrogated for a fully reprogrammed state using multiple criteria, including: endogenous OCT4 activation concurrent with transgene silencing, morphology and expression of pluripotent markers, retained TRA-1-60 expression upon serial passaging, teratomas comprised of all three germ layer derivatives (Fig. 2A–2D; Supporting Information Fig. S2A). The ability to generate this rare iPSC line from AML patients is consistent with recent reports revealing the ability to generate human AML iPSCs where deeper analyses indicated these events were limited to samples involving MLL mutations (two patients [19] and one patient [20]), but similar to our findings, no other AML iPSCs representing other disease subtypes were reported. AML#12-iPSC clones were differentiated to the hematopoietic lineage, but were refractory to blood specification in comparison with counterpart iPSCs devoid of MLL rearrangement (Fig. 2E). Nevertheless, these AML-iPSCs recapitulated a block in terminal differentiation, similar to de novo AML#12 HPCs (Fig. 2F, 2G). This maturation defect was in direct contrast to normal iPSCs derived from the same AML patient that were capable of terminal differentiation and complete granulocytic and monocytic lineage maturation, including erythrocytic progenitors (Fig 2F, 2G; Supporting Information Fig. S2B–S2D). Analysis for MLL-AF9 expression shows the fusion transcript persisted in differentiated progenitors derived from AML iPSCs (Fig. 2H). These results are consistent with a recent report showing a block in terminal differentiation (mature CD45+ cells) from iPSCs derived from a transformed MDS/AML patient [20] and two primary AML patients [19], while their normal iPSC counterparts produced mature CD45+ cells. Figure 2 Open in new tabDownload slide Derivation of acute myeloid leukemia (AML)-induced pluripotent stem cells (iPSCs) from a primary AML sample harboring mixed-lineage leukemia (MLL)-AF9, which recapitulates features of primary disease. (A): AML#12 cells were transduced with POU5F1/OCT4, SOX2, KLF4, and c-MYC (OSKM) factors via lentiviral transduction. Resulting colonies were enumerated by light microscopy. Scale bar = 100 μm. (B): Flow cytometric plots showing AML iPSC cells express pluripotent markers OCT4, SOX2, NANOG, TRA-1–60, and SSEA3 representing three individually isolated iPSC lines from AML#12. Mean ± SD, N = 3. (C): Immunocytochemistry depicting TRA-1–60+ AML iPSC colony derived from AML#12. Scale bar = 100 μm. (D): H&E staining of teratoma sections shows tissues from all three germ layers: ectoderm (neural epithelium), endoderm (intestinal goblet cells), and mesoderm (adipocytes), indicated by arrowheads. N = 3 mice injected. Scale bar = 200 μm. (E): Frequency of CD34 + CD45+ cell generation from AML#12 iPSCs. N = 6 normal iPSC clones from AML#12 patient; n = 1 biological replicate each; N = 8 different AML iPSC clones, n = 2 biological replicates each. Unpaired t test; ****, p < .0001. (F): Representative colony-forming unit (CFU) and single cell morphologies derived from de novo AML#12, AML iPSC, and normal iPSC hematopoietic derivatives. Stage of maturation based on morphological assessment is indicated. CFU-E were not detected from de novo AML or AML iPSC. White scale bars = 500 μm; black scale bars = 10 μm. (G): Distribution of hematopoietic colony lineage from normal and AML iPSC hematopoietic derivatives, N = 6 and N = 1, respectively. (H) Reverse-transcriptase polymerase chain reaction of MLL-AF9 mRNA shows expression persists in AML iPSC hematopoietic derivatives following CFU assay. Abbreviations: AML, acute myeloid leukemia; CFU, colony-forming unit; DAPI, 4′,6-diamidino-2-phenylindole; E, erythrocytic; G, granulocytic; GM, granulocyte–macrophage; iPSC, induced pluripotent stem cell; M, macrophage. Figure 2 Open in new tabDownload slide Derivation of acute myeloid leukemia (AML)-induced pluripotent stem cells (iPSCs) from a primary AML sample harboring mixed-lineage leukemia (MLL)-AF9, which recapitulates features of primary disease. (A): AML#12 cells were transduced with POU5F1/OCT4, SOX2, KLF4, and c-MYC (OSKM) factors via lentiviral transduction. Resulting colonies were enumerated by light microscopy. Scale bar = 100 μm. (B): Flow cytometric plots showing AML iPSC cells express pluripotent markers OCT4, SOX2, NANOG, TRA-1–60, and SSEA3 representing three individually isolated iPSC lines from AML#12. Mean ± SD, N = 3. (C): Immunocytochemistry depicting TRA-1–60+ AML iPSC colony derived from AML#12. Scale bar = 100 μm. (D): H&E staining of teratoma sections shows tissues from all three germ layers: ectoderm (neural epithelium), endoderm (intestinal goblet cells), and mesoderm (adipocytes), indicated by arrowheads. N = 3 mice injected. Scale bar = 200 μm. (E): Frequency of CD34 + CD45+ cell generation from AML#12 iPSCs. N = 6 normal iPSC clones from AML#12 patient; n = 1 biological replicate each; N = 8 different AML iPSC clones, n = 2 biological replicates each. Unpaired t test; ****, p < .0001. (F): Representative colony-forming unit (CFU) and single cell morphologies derived from de novo AML#12, AML iPSC, and normal iPSC hematopoietic derivatives. Stage of maturation based on morphological assessment is indicated. CFU-E were not detected from de novo AML or AML iPSC. White scale bars = 500 μm; black scale bars = 10 μm. (G): Distribution of hematopoietic colony lineage from normal and AML iPSC hematopoietic derivatives, N = 6 and N = 1, respectively. (H) Reverse-transcriptase polymerase chain reaction of MLL-AF9 mRNA shows expression persists in AML iPSC hematopoietic derivatives following CFU assay. Abbreviations: AML, acute myeloid leukemia; CFU, colony-forming unit; DAPI, 4′,6-diamidino-2-phenylindole; E, erythrocytic; G, granulocytic; GM, granulocyte–macrophage; iPSC, induced pluripotent stem cell; M, macrophage. Given the observed similarities between the AML#12-iPSC-derivatives and primary AML#12 sample, we used the AML-iPSCs to predict drug response for possible use as a 4 day screening platform as a simplified approach to what has been tested recently by others [19, 20]. As IBETs have emerged as promising epigenetic/anti-cancer therapies [21], we tested normal and AML iPSC response given the epigenetic involvement of pluripotent reprogramming. AML iPSCs showed a significant and selective resistance toward IBET-151 [22] compared with normal iPSCs with only 5 days of drug treatment (Fig. 3A). These results using AML iPSCs are similar to Fong et al. [23], which exposed MLL-AF9-transformed mouse HSPCs to IBET selective pressure over 8–16 weeks. Strikingly, a synergic effect between WNT-β-catenin inhibition and IBET could also been observed only with AML iPSCs (Fig. 3B), with very similar doses as previously showed using primary samples [23], but was apparent as early as 3 days post treatment. These results provide proof of principle to suggest that AML iPSCs can enable unique platforms for high throughput screens for novel chemical compounds toward restoration of normal hematopoietic differentiation features of AML that have been used previously for differentiation-inducing therapies [24, 25]. Figure 3 Open in new tabDownload slide Acute myeloid leukemia (AML)-induced pluripotent stem cell (iPSC) recapitulate bromodomain and extra-terminal protein inhibitor resistance and drug synergism observed in primary leukemic samples. (A): Cell survival curve shown 5 days after treatment, as a percentage of input cell number. N = 3 independent experiments, n = 3 biological replicates per experiment. One-way analysis of variance (ANOVA); **, p < .01. Normal and AML iPSC experiments were conducted in parallel in the same growth and differentiation conditions. (B): Cell survival shown 3 days after treatment, as a percentage of input cell number. N = 3 independent experiments, n = 3 biological replicates per experiment. Two-way ANOVA; *, p < .05; **, p < .01. Normal and AML iPSC experiments were conducted in parallel in the same growth and differentiation conditions. Abbreviations: DMSO, dimethyl sulfoxide; IBET, bromodomain and extra-terminal protein inhibitor; iPSC, induced pluripotent stem cell. Figure 3 Open in new tabDownload slide Acute myeloid leukemia (AML)-induced pluripotent stem cell (iPSC) recapitulate bromodomain and extra-terminal protein inhibitor resistance and drug synergism observed in primary leukemic samples. (A): Cell survival curve shown 5 days after treatment, as a percentage of input cell number. N = 3 independent experiments, n = 3 biological replicates per experiment. One-way analysis of variance (ANOVA); **, p < .01. Normal and AML iPSC experiments were conducted in parallel in the same growth and differentiation conditions. (B): Cell survival shown 3 days after treatment, as a percentage of input cell number. N = 3 independent experiments, n = 3 biological replicates per experiment. Two-way ANOVA; *, p < .05; **, p < .01. Normal and AML iPSC experiments were conducted in parallel in the same growth and differentiation conditions. Abbreviations: DMSO, dimethyl sulfoxide; IBET, bromodomain and extra-terminal protein inhibitor; iPSC, induced pluripotent stem cell. Given AML iPSC generation is a rare event limited to AML samples with MLL mutations, we sought to better understand the relationship between leukemic MLL fusion products [26] and pluripotent reprogramming. Therefore, we overexpressed the MLL-AF9 fusion protein [27] together with OSMK in AML patient samples with and without endogenous MLL-AF9 as well as a human AML cell line (Fig. 4A). Using green fluorescent protein (GFP) as a reporter for MLL-AF9 transduction, AML samples could be efficiently transduced (Fig. 4B) to express the MLL fusion. Despite MLL-AF9 overexpression, AML samples were incapable of pluripotent reprogramming, and only normal iPSCs could be generated (Fig. 4C). These results suggest that pluripotent reprogramming selects for cells devoid of genomic aberrations. To more directly evaluate this observation, we cocultured healthy MPB HPCs and a human AML cell line (OCI-AML3 constitutively expressing GFP to identify cell of origin), and subjected cocultures to reprogramming conditions (Fig. 4D, 4E). TRA-1–60+ iPSCs were enumerated and analyzed for GFP coexpression (Fig. 4F). Generation of iPSC colonies were only formed from the GFP-MPB HPCs at all mixture ratios, and no GFP+ AML iPSC were detected (Fig. 4G). To examine whether AML cells were refractory to transduction of reprogramming factor expression, we compared expression of exogenous OCT4 and SOX2. Expression levels in patient AML and an AML cell line were similar to healthy MPB (Fig. 4H, 4I), suggesting comparable transduction efficiency. Therefore, the inability to express reprogramming factors in AML cells does not explain why normal HPCs are targeted for reprogramming. Figure 4 Open in new tabDownload slide Ectopic mixed-lineage leukemia (MLL)-AF9 expression is insufficient for pluripotent reprogramming of acute myeloid leukemia (AML), which selects normal cellular genomes devoid of driver leukemic aberrations. (A): Summary of AML patient samples, as shown in Figure 1A, which to not produce AML-induced pluripotent stem cell (iPSC), used for MLL-AF9 (green fluorescent protein [GFP]) over-expression concurrently with reprogramming. AML#9 and AML#10 samples had pre-existing MLL-rearrangement, N = 2 independent reprogramming experiments each. AML#2 and OCI-AML3, N = 1 each. AML#12 MLL-AF9 expression included for reference. “∅” denotes AML samples, where iPSC generation was attempted but no TRA-1–60+ colonies (AML or normal) were generated. (B): AML#9 cells were transduced with MLL-AF9 (GFP) and POU5F1/OCT4, SOX2, KLF4, and c-MYC (OSKM) factors via lentivirus. Resulting cells were assessed by light microscopy for GFP expression. Scale bar = 50 μm. (C): Reverse-transcriptase polymerase chain reaction of MLL-AF9 mRNA shows lack of expression in normal iPSC in contrast to original de novo AML#9. (D): OCI-AML3 cell GFP expression (black gates), and subsequent fluorescence-activated cell sorting purification of highly GFP-expressing OCI-AML3 cells (green gate) used for reprogramming experiments. (E): Schematic depicting the mixture of healthy mobilized peripheral blood (MPB) with an AML cell line at known ratios before fibroblast growth factor reprogramming conditions. GFP expression was used to distinguish OCI-AML3 cells from normal MPB cells. (F): Representative wells of MPB and OCI-AML3 depicting GFP and TRA-1–60 expression, 20 days post-transduction. GFP + TRA-1–60+ colonies were not observed in any well format. Image with cyan border is 10× magnification of indicated region in 50:50 well. (G): Total number of TRA-1-60+ colonies detected per indicated well. Mean ± SD, n = 2 technical replicates per mixture. (H): Flow cytometric plots indicating OCT4 + SOX2+ co-expression 5 days post-transduction. (I): Frequency of OCT4 + SOX2+ 5 days post-transduction in indicated samples. Mean ± SD, n = 3 technical replicates per sample. Abbreviations: AML, acute myeloid leukemia; GFP, green fluorescent protein; iPSC, induced pluripotent stem cell; MLL, mixed-lineage leukemia; MPB, mobilized peripheral blood. Figure 4 Open in new tabDownload slide Ectopic mixed-lineage leukemia (MLL)-AF9 expression is insufficient for pluripotent reprogramming of acute myeloid leukemia (AML), which selects normal cellular genomes devoid of driver leukemic aberrations. (A): Summary of AML patient samples, as shown in Figure 1A, which to not produce AML-induced pluripotent stem cell (iPSC), used for MLL-AF9 (green fluorescent protein [GFP]) over-expression concurrently with reprogramming. AML#9 and AML#10 samples had pre-existing MLL-rearrangement, N = 2 independent reprogramming experiments each. AML#2 and OCI-AML3, N = 1 each. AML#12 MLL-AF9 expression included for reference. “∅” denotes AML samples, where iPSC generation was attempted but no TRA-1–60+ colonies (AML or normal) were generated. (B): AML#9 cells were transduced with MLL-AF9 (GFP) and POU5F1/OCT4, SOX2, KLF4, and c-MYC (OSKM) factors via lentivirus. Resulting cells were assessed by light microscopy for GFP expression. Scale bar = 50 μm. (C): Reverse-transcriptase polymerase chain reaction of MLL-AF9 mRNA shows lack of expression in normal iPSC in contrast to original de novo AML#9. (D): OCI-AML3 cell GFP expression (black gates), and subsequent fluorescence-activated cell sorting purification of highly GFP-expressing OCI-AML3 cells (green gate) used for reprogramming experiments. (E): Schematic depicting the mixture of healthy mobilized peripheral blood (MPB) with an AML cell line at known ratios before fibroblast growth factor reprogramming conditions. GFP expression was used to distinguish OCI-AML3 cells from normal MPB cells. (F): Representative wells of MPB and OCI-AML3 depicting GFP and TRA-1–60 expression, 20 days post-transduction. GFP + TRA-1–60+ colonies were not observed in any well format. Image with cyan border is 10× magnification of indicated region in 50:50 well. (G): Total number of TRA-1-60+ colonies detected per indicated well. Mean ± SD, n = 2 technical replicates per mixture. (H): Flow cytometric plots indicating OCT4 + SOX2+ co-expression 5 days post-transduction. (I): Frequency of OCT4 + SOX2+ 5 days post-transduction in indicated samples. Mean ± SD, n = 3 technical replicates per sample. Abbreviations: AML, acute myeloid leukemia; GFP, green fluorescent protein; iPSC, induced pluripotent stem cell; MLL, mixed-lineage leukemia; MPB, mobilized peripheral blood. Conclusion Here, we show the derivation of AML iPSC from a primary human AML patient harboring MLL-AF9, which represents a rare event in reprogramming AML patient samples that contain patient-specific leukemic aberrations. Instead, we demonstrate the current optimized methods for pluripotent reprogramming select for healthy hematopoietic cells devoid of leukemic mutations. In this single case, AML iPSC recapitulated the primary disease and showed a differentiation blockade in vitro, not observed in normal iPSC derived from the same patient. The functional contribution of MLL-AF9 fusion protein during hematopoietic differentiation remains an ongoing interest of our group. Additional mutations may be involved, which should be evaluated using whole genome sequencing and CRISPER/Cas9 knockout studies. The low efficiency of cancer cell reprogramming to pluripotency has yet to be fully acknowledged, for it to be experimentally addressed. Similar to previous cancer cell reprogramming studies reported [7, 28–30], we suggest that the reprogramming blockade occurs downstream of transduction, and we hypothesize that this is attributed to epigenetic and genetic aberrancies inherent to de novo human AML [10]. Our results are similar to two reports, which elude that normal genomes are selected during the reprogramming process and are negatively selected over serial passaging of human iPSCs [31, 32]. Although in vitro systems that functionally model human AML heterogeneity would be invaluable, our results indicate that pluripotent reprogramming is not able capture AML disease. Our report is consistent with reports in other human leukemias such as CML [28] and B-cell leukemia [7]. Furthermore, and similar to recent findings [19, 20], rare AML reprogramming was restricted to MLL mutations. However, this aberration was not sufficient, even upon ectopic expression, to induce pluripotent reprogramming of AML. Unfortunately, MLL rearrangements represent only 2% of adult AML patients [10], and modeling MLL mutations in AML has been established in mouse in vivo systems [33] as well as human CB leukemic transformation [27], and novel therapies which target MLL fusion products have been developed [12]. As others have shown specific molecular blocks of pluripotent reprogramming [34, 35], the inability of AML cells to reprogram offers a unique system to uncover unique inhibitors of pluripotent reprogramming that have yet to be identified and would allow revisiting the capture of AML molecular and patient heterogeneity with iPSC approaches in the future. Acknowledgments The authors thank Drs. Ronan Foley, Brian Leber, Anargyros Xenocostas, and Mark Minden for providing acute myeloid leukemia samples, Pamela O’Hoski for de-identified sample information, and Sarah Laronde for technical support. Author Contributions J.-H.L. and K.R.S.: conception and design, collection and assembly of data, data analysis and interpretation; J.C.R., L.O., and B.T.: collection and assembly of data, data analysis and interpretation; Z.S.: collection and assembly of data; M.B.: conception and design, manuscript writing, financial support, final approval of manuscript. Disclosure of Potential Conflicts of Interest The authors indicated no potential conflicts of interest. References 1 McNulty M , Crispino JD. iPSCs offer a new look at GATA1-trisomy 21 cooperation . Cell Stem Cell 2016 ; 18 : 563 – 564 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Banno K , Omori S, Hirata K et al. Systematic cellular disease models reveal synergistic interaction of trisomy 21 and GATA1 mutations in hematopoietic abnormalities . Cell Rep 2016 ; Google Scholar OpenURL Placeholder Text WorldCat 3 Yamashita A , Morioka M, Kishi H et al. Statin treatment rescues FGFR3 skeletal dysplasia phenotypes . Nature 2014 ; 513 : 507 – 511 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Young CS , Hicks MR, Ermolova NV et al. A single CRISPR-Cas9 deletion strategy that targets the majority of DMD patients restores dystrophin function in hiPSC-derived muscle cells . Cell Stem Cell 2016 ; 18 : 533 – 540 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Stratton MR , Campbell PJ, Futreal PA. The cancer genome . Nature 2009 ; 458 : 719 – 724 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Alexandrov LB , Nik-Zainal S, Wedge DC et al. Signatures of mutational processes in human cancer . Nature 2013 ; 500 : 415 – 421 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Munoz-Lopez A , Romero-Moya D, Prieto C et al. Development refractoriness of MLL-rearranged human B cell acute leukemias to reprogramming into pluripotency . Stem Cell Rep 2016 ; 7 : 602 – 618 . Google Scholar Crossref Search ADS WorldCat 8 Dohner H , Weisdorf DJ, Bloomfield CD. Acute myeloid leukemia . N Engl J Med 2015 ; 373 : 1136 – 1152 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Papaemmanuil E , Gerstung M, Bullinger L et al. Genomic classification and prognosis in acute myeloid leukemia . N Engl J Med 2016 ; 374 : 2209 – 2221 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Dohner K Dohner H. Molecular characterization of acute myeloid leukemia . Haematologica 2008 ; 93 : 976 – 982 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Huang Yy ME , Chen SR, Chai JR et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia . Blood 1988 ; 72 : 567 – 572 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Getlik M , Smil D, Zepeda-Velazquez C et al. Structure-based optimization of a small molecule antagonist of the interaction between WD repeat-containing protein 5 (WDR5) and mixed-lineage leukemia 1 (MLL1) . J Med Chem 2016 ; 59 : 2478 – 2496 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Collins FS , Varmus H. A new initiative on precision medicine . N Engl J Med 2015 ; 372 : 793 – 795 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Salci KR , Lee JH, Laronde S et al. Cellular reprogramming allows generation of autologous hematopoietic progenitors from AML patients that are devoid of patient-specific genomic aberrations . Stem Cells (Dayton, Ohio) 2015 ; 33 : 1839 – 1849 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Jong-Hee Lee SL , Collins TJ, Shapovalova Z et al. Lineage-specific differentiation is influenced by state of human pluripotency . Cell Rep 2017 ; 19 : 20 – 35 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Chadwick K , Wang L, Li L et al. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells . Blood 2003 ; 102 : 906 – 915 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Yu J , Hu K, Smuga-Otto K et al. Human induced pluripotent stem cells free of vector and transgene sequences . Science (New York, NY) 2009 ; 324 : 797 – 801 . Google Scholar Crossref Search ADS WorldCat 18 Chan EM , Ratanasirintrawoot S, Park IH et al. Live cell imaging distinguishes bona fide human iPS cells from partially reprogrammed cells . Nat Biotechnol 2009 ; 27 : 1033 – 1037 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Chao MP , Gentles AJ, Chatterjee S et al. Human AML-iPSCs reacquire leukemic properties after differentiation and model clonal variation of disease . Cell Stem Cell 2017 (in press). Google Scholar OpenURL Placeholder Text WorldCat 20 Kotini AG , Chang C-J, Chow A et al. Stage-specific human induced pluripotent stem cells map the progression of myeloid transformation to transplantable leukemia . Cell Stem Cell 2017 ; 20 : 1 – 14 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Shi J , Vakoc CR. The mechanisms behind the therapeutic activity of BET bromodomain inhibition . Mol Cell 2014 ; 54 : 728 – 736 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Dawson MA , Prinjha RK, Dittmann A et al. Inhibition of BET recruitment to chromatin as an effective treatment for MLL-fusion leukaemia . Nature 2011 ; 478 : 529 – 533 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Fong CY , Gilan O, Lam EY et al. BET inhibitor resistance emerges from leukaemia stem cells . Nature 2015 ; 525 : 538 – 542 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Nowak D , Stewart D, Koeffler HP. Differentiation therapy of leukemia: 3 decades of development . Blood 2009 ; 113 : 3655 – 3665 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Sachlos E , Risueno RM, Laronde S et al. Identification of drugs including a dopamine receptor antagonist that selectively target cancer stem cells . Cell Stem Cell 2012 ; 149 : 1284 – 1297 . Google Scholar OpenURL Placeholder Text WorldCat 26 Slany RK. The molecular biology of mixed lineage leukemia . Haematologica 2009 ; 94 : 984 – 993 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Barabé F , Kennedy J, Hope K et al. Modeling the initiation and progression of human acute leukemia in mice . Science (New York, NY) 2007 ; 316 : 600 – 604 . Google Scholar Crossref Search ADS WorldCat 28 Kumano K , Arai S, Hosoi M et al. Generation of induced pluripotent stem cells from primary chronic myelogenous leukemia patient samples . Blood 2012 ; 119 : 6234 – 6242 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Carette JE , Pruszak J, Varadarajan M et al. Generation of iPSCs from cultured human malignant cells . Blood 2010 ; 115 : 4039 – 4042 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Kim J , Hoffman JP, Alpaugh RK et al. An iPSC line from human pancreatic ductal adenocarcinoma undergoes early to invasive stages of pancreatic cancer progression . Cell Rep 2013 ; 3 : 2088 – 2099 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Hussein SM , Batada NN, Vuoristo S et al. Copy number variation and selection during reprogramming to pluripotency . Nature 2011 ; 471 : 58 – 62 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Bershteyn M , Hayashi Y, Desachy G et al. Cell-autonomous correction of ring chromosomes in human induced pluripotent stem cells . Nature 2014 ; 507 : 99 – 103 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Krivtsov AV , Twomey D, Feng Z et al. Transformation from committed progenitor to leukaemia stem cell initiated by MLL-AF9 . Nature 2006 ; 442 : 818 – 822 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Cheloufi S , Elling U, Hopfgartner B et al. The histone chaperone CAF-1 safeguards somatic cell identity . Nature 2015 ; 528 : 218 – 224 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Borkent M , Bennett BD, Lackford B et al. A Serial shRNA Screen for Roadblocks to Reprogramming Identifies the Protein Modifier SUMO2 . Stem Cell Rep 2016 ; 6 : 704 – 716 . Google Scholar Crossref Search ADS WorldCat Author notes J.-H.L. and K.R.S. contributed equally to this article. © 2017 AlphaMed Press This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Brief Report: Human Acute Myeloid Leukemia Reprogramming to Pluripotency Is a Rare Event and Selects for Patient Hematopoietic Cells Devoid of Leukemic Mutations
JO - Stem Cells
DO - 10.1002/stem.2655
DA - 2017-09-01
UR - https://www.deepdyve.com/lp/oxford-university-press/brief-report-human-acute-myeloid-leukemia-reprogramming-to-fK5R965kFO
SP - 2095
EP - 2102
VL - 35
IS - 9
DP - DeepDyve
ER -