TY - JOUR
AU - Tikkanen,, Ilkka
AB - Abstract We have shown earlier that cardiomyocyte apoptosis continues at a high level late after myocardial infarction and contributes to adverse cardiac remodeling. Here we studied whether this process can be inhibited by the vasopeptidase inhibitor omapatrilat, a drug which causes simultaneous inhibition of both angiotensin converting enzyme and neutral endopeptidase. Our hypothesis was that omapatrilat-treated rats would have less cardiomyocyte apoptosis, and less adverse cardiac remodeling compared to rats treated with selective inhibitors of angiotensin converting enzyme, neutral endopeptidase or placebo. Myocardial infarction was produced by ligation of the left anterior descending coronary artery. Rats were randomized to receive omapatrilat, captopril, neutral endopeptidase inhibitor SQ-28603 or vehicle. Rats treated with omapatrilat and captopril had reduced cardiac BNP mRNA levels and less myocardial fibrosis by comparison with the vehicle-treated rats. However, omapatrilat was more effective than captopril in attenuating hypertrophy as measured by relative cardiac weight (3.0±0.2 vs. 3.8±0.2 mg/g, P<0.01) or by echocardiographically determined left ventricular mass (0.61±0.05 vs. 0.83±0.06 g, P<0.01). Myocardial apoptosis was elevated both in the infarction border zone (0.129±0.017%) and in the remote area (0.035±0.005%) still 4 weeks after myocardial infarction. Angiotensin converting enzyme inhibition proved to be important in the prevention of apoptosis since both omapatrilat and captopril reduced the number of apoptotic myocytes whereas selective neutral endopeptidase inhibitor SQ-28603 had no effect. In conclusion, myocardial apoptosis, remaining increased 4 weeks after myocardial infarction, was reduced by angiotensin converting enzyme inhibition. Vasopeptidase inhibition was more effective than selective angiotensin converting enzyme inhibition in preventing adverse cardiac remodeling after myocardial infarction. ACE inhibitors, Apoptosis, Fibrosis, Hypertrophy, Infarction, Remodeling Time for primary review 18 days. 1 Introduction The neurohormonal activation after myocardial infarction (MI) plays an important role in the development and progression of adverse cardiac remodeling. The modulation of this neurohormonal response is an important target in preventing development of heart failure [1–3]. Treatment with angiotensin converting enzyme (ACE) inhibitors and angiotensin II (AT II) type 1 receptor (AT1) blockers has been shown to inhibit cardiac hypertrophy, preserve cardiac function, and attenuate changes in myocardial gene expression in experimental MI models [4]. The beneficial effect of renin–angiotensin system blockade on survival after MI has also been demonstrated in multiple clinical trials [5,6]. Myocardial remodeling after MI includes compensatory hypertrophy of the cardiac myocytes [7–9], but also an increase in interstitial collagen deposition [10]. Transition from compensatory hypertrophy to progressive dilatation and heart failure is mediated at least partly by the continuous loss of myocytes due to apoptosis [11–14]. In experimental MI models myocardial apoptosis has been shown to continue at a high level not only in the areas adjacent to the infarction zone, but also in the more remote areas of the left ventricle (LV) [15–17]. This can be due to pressure overload [18] and neurohormonal factors, both of which have been demonstrated to induce apoptosis in the heart. AT II is a direct trigger of apoptosis of ventricular myocytes in vitro [19]. However, it is unclear whether post-MI apoptosis can be prevented by ACE-inhibitors or even more effectively by inhibiting neutral endopeptidase (NEP). The objective of this study was to investigate the effects of combined ACE and NEP inhibition on adverse myocardial remodeling and apoptosis after MI. We used omapatrilat, a single molecule that simultaneously inhibits both NEP and ACE [20]. NEP inhibition protects atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP) and related peptides from enzymatic inactivation [21] and thus preserves the vasodilatory, natriuretic, diuretic [20], and antihypertrophic effects of these peptides [22]. Concurrent ACE inhibition blocks AT II formation and increases bradykinin levels [23–25]. The co-inhibition of NEP and ACE has been shown to produce greater haemodynamic and renal effects than inhibition of either NEP or ACE alone in several models of heart failure and hypertension [26,27]. Our hypothesis was that omapatrilat would have greater anti-apoptotic and anti-remodeling effects compared with the selective inhibitors of ACE or NEP in the rat MI model. 2 Methods 2.1 Animals Male Wistar rats were obtained from the Viikki Biocenter, Helsinki, Finland. Animals were housed at 23–25 °C in a 12-h light/dark cycle with access to standard powdered rat chow and normal water. The Helsinki University Central Hospital Animals Ethics Committee and the Provincial State Office of Southern Finland approved the experimental procedures. 2.2 Drugs Omapatrilat, a dual NEP and ACE inhibitor, SQ-28603, a selective NEP inhibitor and captopril, a selective ACE inhibitor, were provided by Bristol-Myers Squibb Pharmaceuticals (Princeton, NY, USA). The drugs under study were mixed to powdered rat chow. The doses were selected according to our earlier dose–response work [28] and targeted at omapatrilat 40 mg/kg per day, SQ-28603 100 mg/kg per day, and captopril 100 mg/kg per day. The actual consumed doses were omapatrilat 39 mg/kg per day, SQ-28603 88 mg/kg per day and captopril 109 mg/kg per day. 2.3 Study outline The animals were acclimated to powdered rat chow without medication for 5 days. Daily food and water consumption were determined throughout the study. The body weights were recorded before starting medication, before operation and 1 and 4 weeks after MI operation. The animals were randomised to the treatment groups 24 h before the MI operation to cover also the acute and subacute phases of infarction. The medication had no effect on the size of the infarction, since there was no difference in the infarcted area between the groups as measured by planimetry at 1 or 4 weeks after the operation. MI was produced by ligation of the left anterior descending coronary artery as described earlier [15,29]. The control rats underwent the same procedure, except for the ligation of the coronary artery (sham operation). Systolic blood pressure (SBP) was measured before starting the medication, 1 and 4 weeks after operation by tail cuff plethysmography in conscious lightly restrained animals. Echocardiography was carried out in all animals 4 weeks after operation. The animals were sacrificed 1 or 4 weeks after operation. Hearts that showed no histological signs of infarction were not included in the study. There were seven rats in each omapatrilat and captopril group, 6–8 rats in SQ-28603 groups and 10 rats in vehicle control groups. 2.4 Samples The rats were sacrificed by phenobarbital 55 mg/kg (Mebunat®, Orion Pharma, Espoo, Finland) intraperitoneally and blood samples were collected into pre-chilled lithium heparin tubes and into tubes containing Na2EDTA and aprotinin (500 kallikrein inhibitor units per ml). Heart and kidney weights were determined. Heart and kidneys were snap-frozen in isopentane at −40 °C and stored at −80 °C for subsequent in vitro autoradiography analysis. Before freezing the heart was excised into 2-mm transverse slices distal to the level of coronary ligature. One of the myocardial slices was fixed in 4% neutral buffered formalin for 24 h, embedded in paraffin, and cut into 4-μm-thick sections for histology, planimetry, and assessment of apoptosis. Plasma renin activity (PRA), N-terminal ANP and BNP were measured by radioimmunoassay [28,30]. 2.5 Autoradiographs Quantitative in vitro autoradiography was carried out on renal sections (20 μm) with the radioligand [125I]RB104 for NEP and [125I]MK351A for ACE as described earlier [31,32]. The optical densities were quantified by an AIDA computer image analyzing system (AIDA 2D densitometry) coupled to the FUJIFILM BAS-5000 phosphoimager (Tamro, Finland). Specific binding was calculated as total binding minus non-specific binding. 2.6 Histology and planimetry of infarct size The presence of signs of either acute MI or collagen scars was analyzed under microscope by examination of Van Gieson-stained transverse LV sections. Infarct size was determined planimetrically as the ratio of infarcted tissue or scar to the length of the entire LV endocardial circumference. Infarcts were classified as small (10–30%), moderate (31–49%) or large (>50%). There were no statistically significant differences in infarct sizes between the groups. 2.7 BNP mRNA BNP mRNA expression was determined both from the border zone of MI and from the remote area of the LV. Total RNA was prepared with the QuickPrep® system (Amersham–Pharmacia Biotech, Uppsala, Sweden) and the cDNA first strand was synthesized using M-MuLV reverse transcriptase. The quantitative PCR reactions were carried out with an ABI 7700 Sequence Detection System using TaqMan® chemistry. The forward and reverse primers for rat BNP mRNA detection were TGGGCAGAAGATAGACCGGA and ACAACCTCAGCCCGTCACAG, corresponding to nucleotides 300–319 and 361–342 of rat BNP cDNA coding sequence, respectively. The 62 bp amplicon was detected using the bifunctional fluorogenic probe 5′-Fam™-CCAAGCGACTGACTGCGCCG-Tamra™-3′. The results were normalized to 18S RNA quantified from the same samples as described previously [33]. 2.8 Myocardial fibrosis The interstitial collagen volume fraction (CVF) was determined from three different slices of picrosirius red (Fluka)-stained LV sections under polarized light. Areas of connective tissue network and myocytes were quantified by a semiautomated computer-based analysis system as described by Brooks et al. [34]. 2.9 Apoptosis Apoptotic cardiomyocytes were detected with the terminal deoxynucleotide transferase-mediated ddUTP nick end labeling (TUNEL) assay. Analysis of apoptosis was carried out in one LV slice obtained from the sample showing maximal infarct size. The number of apoptotic cardiomyocytes was counted in the whole LV under a light microscope with an ocular grid. The apoptotic myocytes were identified by the presence of myofilaments surrounding the nucleus. The amounts of apoptotic cardiomyocytes were expressed as the proportion of TUNEL-positive cardiomyocyte nuclei from the total number of cardiomyocyte nuclei, obtained by multiplying the density of cardiomyocyte nuclei in a serial Dnase I-treated control section times the area of the section [11,15,35]. 2.10 Echocardiography Prior to echocardiography, the animals were sedated by medetomidine 0.25 mg/kg (Domitor®, Orion Pharma, Espoo, Finland) given subcutaneously and placed on a thermal plate. Two-dimensional echocardiographic measurements were carried out using a 7–10 MHz phased array sector probe (Toshiba Power Vision 8000, Toshiba Medical Systems, Nasu, Japan) from the right parasternal projection. An average of three measurements was used to assess LV end diastolic diameter (LVEDD), LV anterior wall thickness, and posterior wall thickness (PW). LV end diastolic volume (LVEDV) was measured by Simpson's formula. LV mass was calculated from a standard cube formula and relative PW thickness (2*PW/LVEDD) as described [36]. The coefficient of variation was 3.3% for LVEDD, 8.7% for PW, and 7.9% for LVEDV, respectively. 2.11 Statistical methods Results are presented as mean±S.E.M. unless otherwise stated. Data were analyzed using analysis of variance (ANOVA) including infarction size (MI%) as a covariate where appropriate. If statistical significance was obtained between groups, Fisher's protected least significance test was used to determine where significant differences existed. Blood pressure measurements were analyzed using repeated measures ANOVA. A difference at P<0.05 was considered statistically significant. 3 Results 3.1 Body weight, systolic blood pressure, and hormonal parameters 3.1.1 Body weight There was no statistical difference in the body weight between the groups either before the operation or after the 4-week treatment period (Table 1). Table 1 Body weight, hormonal parameters, and tissue enzyme inhibition in rats 4 weeks after MI . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . Weight (g) 366±18 365±10 369±21 370±13 399±15 Hormonal parameters PRA (ng/ml) 6.9±1.6 8.1±2.2 19.2±3.0 56.5±9.2*** 11.5±2.1 NT-ANP (pmol/l) 729±78 926±121 1526±62 1383±501 803±88 BNP (pmol/l) 6.3±0.7 8.1±0.8 9.8±3.7 12.2±2.7 8.3±0.5 Tissue enzymes Renal NEP% of vehicle 100±9 36±6*** 98±7 36±3*** Renal ACE% of vehicle 100±10 30±5*** 71±4** 94±4 . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . Weight (g) 366±18 365±10 369±21 370±13 399±15 Hormonal parameters PRA (ng/ml) 6.9±1.6 8.1±2.2 19.2±3.0 56.5±9.2*** 11.5±2.1 NT-ANP (pmol/l) 729±78 926±121 1526±62 1383±501 803±88 BNP (pmol/l) 6.3±0.7 8.1±0.8 9.8±3.7 12.2±2.7 8.3±0.5 Tissue enzymes Renal NEP% of vehicle 100±9 36±6*** 98±7 36±3*** Renal ACE% of vehicle 100±10 30±5*** 71±4** 94±4 Values are given as mean±S.E.M. PRA, plasma renin activity; NT-ANP, N-terminal natriuretic peptide; BNP, B-type natriuretic peptide. *Vehicle+MI versus Treatment+MI. **P<0.01, ***P<0.001. Open in new tab Table 1 Body weight, hormonal parameters, and tissue enzyme inhibition in rats 4 weeks after MI . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . Weight (g) 366±18 365±10 369±21 370±13 399±15 Hormonal parameters PRA (ng/ml) 6.9±1.6 8.1±2.2 19.2±3.0 56.5±9.2*** 11.5±2.1 NT-ANP (pmol/l) 729±78 926±121 1526±62 1383±501 803±88 BNP (pmol/l) 6.3±0.7 8.1±0.8 9.8±3.7 12.2±2.7 8.3±0.5 Tissue enzymes Renal NEP% of vehicle 100±9 36±6*** 98±7 36±3*** Renal ACE% of vehicle 100±10 30±5*** 71±4** 94±4 . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . Weight (g) 366±18 365±10 369±21 370±13 399±15 Hormonal parameters PRA (ng/ml) 6.9±1.6 8.1±2.2 19.2±3.0 56.5±9.2*** 11.5±2.1 NT-ANP (pmol/l) 729±78 926±121 1526±62 1383±501 803±88 BNP (pmol/l) 6.3±0.7 8.1±0.8 9.8±3.7 12.2±2.7 8.3±0.5 Tissue enzymes Renal NEP% of vehicle 100±9 36±6*** 98±7 36±3*** Renal ACE% of vehicle 100±10 30±5*** 71±4** 94±4 Values are given as mean±S.E.M. PRA, plasma renin activity; NT-ANP, N-terminal natriuretic peptide; BNP, B-type natriuretic peptide. *Vehicle+MI versus Treatment+MI. **P<0.01, ***P<0.001. Open in new tab 3.1.2 Blood pressure Mean SBP before starting the medication was 129 mmHg. One week after MI, SBP was lower in the omapatrilat (91±7 mmHg, P<0.01) and captopril (97±5 mmHg, P<0.05) treated groups compared to the selective NEP inhibitor (113±5 mmHg), but there was no significant difference by comparison with the vehicle MI group. Four weeks after the operation SBP was lowest in the omapatrilat group, but there was no significant difference compared to the captopril or vehicle-treated rats (Fig. 1). Fig. 1 Open in new tabDownload slide Mean systolic blood pressures before operation, 1 and 4 weeks after MI in different treatment groups. There were no significant differences in SBPs between omapatrilat, captopril and vehicle-MI rats, though SBP was lowest in the omapatrilat-treated rats. Fig. 1 Open in new tabDownload slide Mean systolic blood pressures before operation, 1 and 4 weeks after MI in different treatment groups. There were no significant differences in SBPs between omapatrilat, captopril and vehicle-MI rats, though SBP was lowest in the omapatrilat-treated rats. 3.1.3 Hormonal effects Treatment with captopril but not with omapatrilat increased significantly PRA (Table 1). PRA level in captopril-treated rats was sevenfold compared to control MI rats (P<0.001) and over 2.5-fold compared to omapatrilat-treated rats (P<0.001). SQ-28603 had no effect on PRA. There were no significant differences in plasma N-terminal ANP or BNP levels between any of the treatment groups. 3.1.4 ACE and NEP autoradiography ACE and NEP inhibitions from kidney samples were analyzed by quantitative autoradiography [26,32] to control the effectiveness of drug administration. The renal ACE autoradiography signal was 22% higher after 4 weeks in vehicle MI rats compared with sham-operated rats, but the difference was not statistically significant. There was no change in NEP autoradiography signal levels after MI in vehicle-treated rats. Omapatrilat showed inhibition of both ACE and NEP (remaining activities 30±5%, P<0.001 and 36±6%, P<0.001, respectively, Table 1). SQ-28602 inhibited NEP (36±3%, P<0.001), but had no effect on ACE (94±4%). Captopril had no inhibitory effect on renal NEP (98±7%), but inhibited renal ACE (71±4%, P<0.01). 3.2 Hypertrophy, BNP gene expression and fibrosis 3.2.1 Heart weight A compensatory increase in the relative heart weight was detected 4 weeks after MI in non-treated rats (P<0.01, Fig. 2A). At 1 week there were no differences in relative cardiac weights between the groups. However, 4 weeks after operation relative cardiac weights were significantly smaller in the omapatrilat (3.0±0.2 mg/g, P<0.01) and SQ-28603 (3.3±0.2 mg/g, P<0,05) treated groups compared to control MI rats (3.9±0.3 mg/g) (Fig. 2B). Also as measured by echocardiography, LV mass was significantly lower in the omapatrilat-treated group compared to captopril and control MI groups (Table 2). Fig. 2 Open in new tabDownload slide Relative cardiac weight 1 and 4 weeks after MI, and effect of different treatments on cardiac weight 4 weeks after MI. (A) Cardiac weight increased gradually after MI and after 4 weeks the difference was statistically significant. The increase in cardiac weight is expressed as relative to 1 week sham operated rats. (B) Omapatrilat and SQ-28603-treated rats had lower relative cardiac weights compared to vehicle MI rats after 4 weeks of treatment. There was a statistically significant difference between omapatrilat and captopril-treated animals. Results are expressed as mean±S.E.M. **P<0.01. SQ-28603 stands for the selective NEP inhibitor. Fig. 2 Open in new tabDownload slide Relative cardiac weight 1 and 4 weeks after MI, and effect of different treatments on cardiac weight 4 weeks after MI. (A) Cardiac weight increased gradually after MI and after 4 weeks the difference was statistically significant. The increase in cardiac weight is expressed as relative to 1 week sham operated rats. (B) Omapatrilat and SQ-28603-treated rats had lower relative cardiac weights compared to vehicle MI rats after 4 weeks of treatment. There was a statistically significant difference between omapatrilat and captopril-treated animals. Results are expressed as mean±S.E.M. **P<0.01. SQ-28603 stands for the selective NEP inhibitor. Table 2 Echocardiographic parameters in MI operated rats 4 weeks after operation . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . LV mass (g) 0.76±0.05 0.86±0.04 0.61±0.03** 0.83±0.06 0.73±0.05 PW thickening 0.32±0.02 0.27±0.01* 0.30±0.01 0.28±0.01* ratio LVEDD (mm) 7.9±0.2 9.1±0.4# 8.6±0.4 9.1±0.2 9.6±0.3 LVEDV (μl) 566±34 692±48# 604±72 690±48 752±76 . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . LV mass (g) 0.76±0.05 0.86±0.04 0.61±0.03** 0.83±0.06 0.73±0.05 PW thickening 0.32±0.02 0.27±0.01* 0.30±0.01 0.28±0.01* ratio LVEDD (mm) 7.9±0.2 9.1±0.4# 8.6±0.4 9.1±0.2 9.6±0.3 LVEDV (μl) 566±34 692±48# 604±72 690±48 752±76 Values are given as mean±S.E.M. #P<0.05 Sham versus Vehicle+MI. *P<0.05 versus Vehicle+MI, **P<0.01 versus Vehicle+MI. Open in new tab Table 2 Echocardiographic parameters in MI operated rats 4 weeks after operation . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . LV mass (g) 0.76±0.05 0.86±0.04 0.61±0.03** 0.83±0.06 0.73±0.05 PW thickening 0.32±0.02 0.27±0.01* 0.30±0.01 0.28±0.01* ratio LVEDD (mm) 7.9±0.2 9.1±0.4# 8.6±0.4 9.1±0.2 9.6±0.3 LVEDV (μl) 566±34 692±48# 604±72 690±48 752±76 . Sham . Vehicle+ . Omapatrilat+ . Captopril+ . SQ-28603+ . . . MI . MI . MI . MI . LV mass (g) 0.76±0.05 0.86±0.04 0.61±0.03** 0.83±0.06 0.73±0.05 PW thickening 0.32±0.02 0.27±0.01* 0.30±0.01 0.28±0.01* ratio LVEDD (mm) 7.9±0.2 9.1±0.4# 8.6±0.4 9.1±0.2 9.6±0.3 LVEDV (μl) 566±34 692±48# 604±72 690±48 752±76 Values are given as mean±S.E.M. #P<0.05 Sham versus Vehicle+MI. *P<0.05 versus Vehicle+MI, **P<0.01 versus Vehicle+MI. Open in new tab 3.2.2 BNPmRNA LV hypertrophy after MI involves the hypertrophic growth of cardiomyocytes and the accumulation of fibrillar collagen in the interstitium. As a marker of hypertrophic gene expression we used BNP mRNA levels. After MI, the expression of BNP mRNA increased both in the border zone of infarction and in the remote area compared to the sham group (Fig. 3A). In the vehicle MI group BNP mRNA expression was 3.7-fold higher in the border zone and 1.5-fold higher in the remote zone 4 weeks after operation compared to the sham group. There were no significant differences in the expression of BNP mRNA between the medicated groups 1 week after MI, but after 4 weeks the expression was lower in the omapatrilat and captopril-treated rats. The reduced BNP mRNA expression was detected both in border zone and remote areas (Fig. 3B). Instead, in the SQ-28603-treated group there were no statistical differences in BNP mRNA levels compared to the vehicle-treated MI group in either area. Fig. 3 Open in new tabDownload slide Effect of different treatments on relative BNP mRNA expression. (A) BNP mRNA expression increased after MI. The difference was significant already after 1 week in the border zone of the infarction, and also after 4 weeks in the remote area. (B) Omapatrilat and to a lesser extent captopril decreased BNP mRNA expression 4 weeks after MI. Results are shown as relative to 1 (A) or 4 weeks (B) sham operated animals. *P<0.05, **P<0.01, ***P<0.001. Fig. 3 Open in new tabDownload slide Effect of different treatments on relative BNP mRNA expression. (A) BNP mRNA expression increased after MI. The difference was significant already after 1 week in the border zone of the infarction, and also after 4 weeks in the remote area. (B) Omapatrilat and to a lesser extent captopril decreased BNP mRNA expression 4 weeks after MI. Results are shown as relative to 1 (A) or 4 weeks (B) sham operated animals. *P<0.05, **P<0.01, ***P<0.001. 3.2.3 Myocardial fibrosis To estimate the interstitial component of the hypertrophy, we measured the levels of fibrosis from the LV tissue sections 4 weeks after the operation. CVF was determined from the non-infarcted area by quantitative morphometry. Myocardial fibrosis increased after MI. In the sham operated animals, CVF in the LV was 1.9±0.4%, whereas in the vehicle MI group, CVF was 4.8±0.9% (P<0.001) (Fig. 4). Both omapatrilat and captopril treatments decreased CVF compared to the vehicle-treated group (2.8±0.2%, P<0.01 and 2.8±0.7%, P<0.01, respectively). Selective NEP inhibition by SQ-28603 did not have any effect on fibrosis. Fig. 4 Open in new tabDownload slide Effect of different treatments on myocardial fibrosis after MI. (A) Slices from the remote area of the LV showing fibrosis after vehicle treatment (a) and omapatrilat (b) treatment. (B) Omapatrilat and captopril reduced fibrosis as measured 4 weeks after MI. Results are expressed as mean±S.E.M. CVF=collagen volume fraction (%). Fig. 4 Open in new tabDownload slide Effect of different treatments on myocardial fibrosis after MI. (A) Slices from the remote area of the LV showing fibrosis after vehicle treatment (a) and omapatrilat (b) treatment. (B) Omapatrilat and captopril reduced fibrosis as measured 4 weeks after MI. Results are expressed as mean±S.E.M. CVF=collagen volume fraction (%). 3.3 Apoptosis and left ventricular dilatation 3.3.1 Cardiomyocyte apoptosis Apoptosis increased after MI both in the border zone and in the remote area. The apoptosis was 3.6-fold higher in the border zone compared with the remote area 4 weeks after MI. The percentage of apoptotic cardiomyocytes in the myocardium of sham operated rats was 0.01±0.002% (Fig. 5) and remained stable from 1 to 4 weeks. In the border zone areas of vehicle-treated infarctions, the percentage of apoptotic cells decreased from 0.18 to 0.13% (P=0.34) from 1 to 4 weeks. In the remote noninfarcted myocardium, apoptosis increased from 0.014% at 1 week to 0.035% at 4 weeks (P<0.05). Fig. 5 Open in new tabDownload slide The amount of cardiomyocyte apoptosis in the border and remote zones of the LV 4 weeks after operation. On top, an example of apoptotic cardiomyocyte stained by TUNEL method. Results are expressed as mean±S.E.M. *P<0.05, **P<0.01. Fig. 5 Open in new tabDownload slide The amount of cardiomyocyte apoptosis in the border and remote zones of the LV 4 weeks after operation. On top, an example of apoptotic cardiomyocyte stained by TUNEL method. Results are expressed as mean±S.E.M. *P<0.05, **P<0.01. Both omapatrilat and captopril treatments decreased the number of apoptotic myocytes in LV tissue sections. After 1 week the level of apoptosis in the border zone area of MI was 0.14% with captopril-treated rats and 0.13% with omapatrilat-treated rats compared to 0.18% in vehicle-treated MI rats, but the difference was not statistically significant. After 4 weeks of treatment there was a significant decrease in apoptosis in the border zone of infarction in the omapatrilat-treated group compared to the vehicle group (0.06% and 0.13%, respectively, P<0.01, Fig. 5). A significant decrease in apoptosis was also detected in the captopril-treated animals both in the border and also in the remote zone (0.08%, P<0.05, and 0.019%, P<0.05, respectively). In contrast, the amount of apoptosis in the SQ-28603-treated animals did not differ from the control MI group 4 weeks after the operation. LV dilatation after MI was evaluated by transthoracic echocardiography. The echocardiographically measured LV dimensions are summarized in Table 2. LV dilatation was observed 4 weeks after operation as the LVEDDs and LVEDVs were significantly larger in the vehicle MI group when compared to sham operated rats, but there were no significant differences between the different MI treatment groups. However relative wall thickness decreased significantly both in omapatrilat and SQ-28603-treated rats compared with the vehicle MI rats (Table 2). 4 Discussion Our results indicate that omapatrilat was more effective than captopril in preventing cardiac hypertrophy after experimental MI in rats. Omapatrilat as well as captopril reduced hypertrophic gene expression and had an antifibrotic effect, whereas SQ-28603 had no effect. Both omapatrilat and captopril treatments inhibited cardiomyocyte apoptosis. 4.1 Hemodynamic and hormonal effects of ACE/NEP inhibition The objective of this study was to compare dual ACE/NEP inhibitor omapatrilat to selective ACE and NEP inhibitors, captopril and SQ-28603, respectively, in a rat MI model. Omapatrilat is the most clinically developed vasopeptidase inhibitor [37]. It produces a balanced inhibition of NEP and ACE in vivo [28], but has no effect on other related enzymes [38]. Both preclinical studies as well as clinical trials have shown that omapatrilat is effective in treating heart failure and it is suggested to have greater impact on morbidity and mortality than selective ACE inhibitors alone [39–42]. One of the adverse effects of the selective ACE inhibition is the compensatory increase in PRA. This increase may partially damp the beneficial hemodynamic and antihypertrophic effects of ACE inhibitors. In our study, captopril treatment induced an increase in PRA similar to what has been reported earlier [43]. However, despite the ACE inhibitory component of omapatrilat, PRA was not significantly increased in omapatrilat-treated animals compared with the animals treated with vehicle. The lack of the compensatory activation of the renin–angiotensin system may be explained by NEP inhibition, because enhanced action of natriuretic peptides has been reported to inhibit renin synthesis [44]. 4.2 Effect of ACE/NEP inhibition on cardiac hypertrophy and BNP gene expression BNP mRNA expression is a sensitive marker of LV hypertrophy [45,46,4]. In our study, BNP mRNA in the border zone of infarction was already clearly increased 1 week after the MI operation in vehicle-treated rats. After 4 weeks, an increase in BNP mRNA was also detected in the remote noninfarcted area. Omapatrilat and also to a lesser extent captopril significantly decreased BNP mRNA expression both in the border zone and in the remote area of myocardium 4 weeks after MI. Selective NEP inhibition did not affect the BNP mRNA expression. In accordance with the decreased BNP expression, omapatrilat treatment reduced relative cardiac weights as well as echocardiographically measured LV mass compared to vehicle-treated rats. It has been previously demonstrated that another vasopeptidase inhibitor S21402 reduced the mass of both ventricles of the heart after MI [43]. In that study captopril regressed LV mass, selective NEP inhibitor SCH42495 regressed right ventricular mass and the combined effect of these drugs was equal to the cardiac mass reduction caused by the vasopeptidase inhibitor S21402. In another study, candesartan and cilazapril both significantly prevented the increase in heart weight at 4 weeks after MI operation [47]. In our experimental setting, ACE inhibition alone did not cause significant changes in cardiac weight, which may depend on the relatively short follow-up time. Slightly lower SBP levels with omapatrilat may contribute to the better antihypertrophic effect. Omapatrilat is an effective inhibitor of cardiac ACE as demonstrated by our earlier in vitro autoradiography findings [28] and this may also explain the more effective reduction in heart mass by omapatrilat compared to captopril treatment. Inhibition of NEP may also reduce hypertrophy by increasing autocrine and paracrine actions of natriuretic peptides, as a selective NEP inhibitor, SCH42495, reduced LV hypertrophy with minimal effects on blood pressure [48]. 4.3 Effect of ACE/NEP inhibition on myocardial fibrosis Both omapatrilat and captopril reduced myocardial fibrosis after MI. Collagen deposition during healing of the MI is central for preserving the strength of the infarcted area [49,50]. However, the accumulation of interstitial fibrosis to the noninfarcted area is associated with the development of hypertrophy and may have a negative effect on the diastolic function of the heart [51]. The renin–angiotensin system is an important regulator not only of cardiomyocyte hypertrophy but also of interstitial matrix. AT II stimulates cardiac fibroblast collagen synthesis via the AT1 receptor in vitro [52], and both ACE inhibition and AT1 blockade have been shown to inhibit the interstitial accumulation of collagen after MI and in hypertensive heart disease [51,53]. NEP inhibition reduces degradation of natriuretic peptides, which are known to have an antifibrotic effect by the stimulation of their A- and B-type receptors [54]. ACE and NEP also act as potent kinin-degrading enzymes in plasma and tissues [55,56] and accordingly, plasma and tissue bradykinin levels are increased during ACE/NEP inhibition [57]. Kinins have been shown to contribute to the reduction of myocardial collagen accumulation by ACE inhibition after MI [58]. Farina et al. [59] have shown that dual NEP/ACE inhibitor S21402 inhibited cardiac fibrosis in spontaneously hypertensive rats. Both captopril and selective NEP inhibitor treatments had antifibrotic effects. In the present work, the antifibrotic effect was similar with both omapatrilat and captopril. However, we found no inhibition of the fibrosis with the selective NEP inhibitor SQ-28603 alone. 4.4 Effect of ACE/NEP inhibition on myocardial apoptosis Experimental studies have shown that apoptosis is induced during hypoxia [60] and ischemia–reperfusion in myocardium [61]. Apoptosis is also activated in human acute MI [62]. We and others have earlier shown that cardiomyocyte apoptosis occurs continuously over an extended period of time both in the border zone of MI and in the remote, noninfarcted area [15,17]. Progressive deterioration of LV function and development of heart failure after MI is mediated in part by loss of cardiac myocytes due to apoptosis [14,15]. ACE inhibitor enalapril has been shown to decrease apoptosis in the border zones of infarct scars in a dog model of ischemic heart failure [63]. In our study, both omapatrilat and captopril decreased apoptosis in the border zone of the infarct but also to a lesser extent in the remote non-infarcted area. In contrast, selective NEP inhibition did not affect the number of apoptotic cells. AT II has been earlier reported to directly induce apoptosis in isolated cardiac myocytes [19], but the precise mechanism is unknown. Another possible explanation for the decreased apoptosis by ACE-inhibitors is the reduced pressure load. This is supported by the findings of Teiger et al. [18] who demonstrated that pressure overload induces myocardial apoptosis in experimental rat aortic stenosis. In conclusion, combined NEP/ACE inhibition with the vasopeptidase inhibitor omapatrilat, had several favorable effects in the post-MI model in the rat. Development of cardiac hypertrophy and myocardial interstitial fibrosis as well as acceleration of apoptotic cardiomyocyte loss after MI were effectively reduced in rats treated with omapatrilat. Combined NEP/ACE inhibition was more effective than selective ACE inhibition in reducing total cardiac mass in this model. NEP inhibition alone reduced cardiac hypertrophy only slightly. The introduction of vasopeptidase inhibitors provides a new therapeutic strategy that may confer improved cardiac protection compared to ACE inhibition in cardiac diseases. Acknowledgements We wish to acknowledge Terhi Suvanto and Tuula Riihimäki for excellent technical assistance. This study was supported by the Research Grants of Helsinki University Central Hospital, the Sigrid Juselius Foundation, and Bristol-Myers Squibb Pharmaceutical Research Institute. M.L. and E.P. were supported by personal grants from Paavo Nurmi Foundation and T.B. from von Frenckell's Foundation. References [1] Swedberg K. Eneroth P. Kjekshus J. Wilhemmsen L. for the CONSENSUS Trial Study Group Hormones regulating cardiovascular function in patients with severe congestive heart failure and their relation to mortality Circulation 1990 82 1730 1736 Google Scholar Crossref Search ADS PubMed WorldCat [2] Francis G.S. McDonald K.M. Cohn J.N. Neurohormonal activation in preclinical heart failure: remodeling and the potential for intervention Circulation 1993 87 Suppl IV 90 96 OpenURL Placeholder Text WorldCat [3] Pool P.E. Neurohormonal activation in the treatment of congestive heart failure: basis for new treatments? Cardiology 1998 90 1 7 Google Scholar Crossref Search ADS PubMed WorldCat [4] Jin H. Yang R. Awad T.A. et al. Effects of early angiotensin-converting enzyme inhibition on cardiac gene expression after acute myocardial infarction Circulation 2001 103 736 742 Google Scholar Crossref Search ADS PubMed WorldCat [5] CONSENSUS Trial Study Group Effects of enalapril on mortality in severe congestive heart failure N Engl J Med 1987 316 1429 1435 Crossref Search ADS PubMed WorldCat [6] SOLVD Investigators Effect of enalapril on survival in patients with reduced left ventricular ejection fractions and congestive heart failure N Engl J Med 1991 325 293 302 Crossref Search ADS PubMed WorldCat [7] Weisman H.F. Bush D.E. Mannisi J.A. Weisfeldt M.L. Healy B. Cellular mechanisms of myocardial infarct expansion Circulation 1988 78 186 201 Google Scholar Crossref Search ADS PubMed WorldCat [8] Pfeffer J.M. Progressive ventricular dilation in experimental myocardial infarction and its attenuation by angiotensin-converting enzyme inhibition Am J Cardiol 1991 68 17D 25D Google Scholar Crossref Search ADS PubMed WorldCat [9] Olivetti G. Capasso J.M. Meggs L.G. Sonnenblick E.H. Anversa P. Cellular basis of chronic ventricular remodeling after myocardial infarction in rats Circ Res 1991 68 856 869 Google Scholar Crossref Search ADS PubMed WorldCat [10] Michel J.B. Lattion A.L. Salzmann J.L. et al. Hormonal and cardiac effects of converting enzyme inhibition in rat myocardial infarction Circ Res 1988 62 641 650 Google Scholar Crossref Search ADS PubMed WorldCat [11] Saraste A. Morphologic criteria and detection of apoptosis Herz 1999 24 189 195 Google Scholar Crossref Search ADS PubMed WorldCat [12] Narula J. Haider N. Virmani R. et al. Apoptosis in myocytes in end-stage heart failure N Engl J Med 1996 335 1182 1189 Google Scholar Crossref Search ADS PubMed WorldCat [13] Olivetti G. Abbi R. Quaini F. et al. Apoptosis in the failing human heart N Engl J Med 1997 336 1131 1141 Google Scholar Crossref Search ADS PubMed WorldCat [14] Sharov V.G. Sabbah H.N. Shimoyama H. et al. Evidence of cardiocyte apoptosis in myocardium of dogs with chronic heart failure Am J Pathol 1996 148 141 149 Google Scholar PubMed OpenURL Placeholder Text WorldCat [15] Palojoki E. Saraste A. Eriksson A. et al. Cardiomyocyte apoptosis and ventricular remodeling after myocardial infarction in rats Am J Physiol 2001 280 H2726 H2731 OpenURL Placeholder Text WorldCat [16] Cheng W. Kajstura J. Nitahara J.A. et al. Programmed myocyte cell death affects the viable myocardium after infarction in rats Exp Cell Res 1996 226 316 327 Google Scholar Crossref Search ADS PubMed WorldCat [17] Sam F. Sawyer D.B. Xie Z. et al. Mice lacking inducible nitric oxide synthase have improved left ventricular contractile function and reduced apoptotic cell death late after myocardial infarction Circ Res 2001 89 351 356 Google Scholar Crossref Search ADS PubMed WorldCat [18] Teiger E. Dam T.- V Richard L. et al. Apoptosis in pressure overload-induced heart hypertrophy in the rat J Clin Invest 1996 97 2891 2897 Google Scholar Crossref Search ADS PubMed WorldCat [19] Kajstura J. Cigola E. Malhotra A. et al. Angiotensin II induces apoptosis of adult ventricular myocytes in vitro J Mol Cell Cardiol 1997 29 859 870 Google Scholar Crossref Search ADS PubMed WorldCat [20] Burnett J.C. Jr. Vasopeptidase inhibition: a new concept in blood pressure management J Hypertens 1999 17 Suppl 1 S37 43 OpenURL Placeholder Text WorldCat [21] Roques B.P. Nob Noble F. Dauge V. Fournie-Zaluski M.C. Beamont A. NEP 24.11: Structure, inhibition and experimental and clinical pharmacology Pharmacol Rev 1993 45 87 146 Google Scholar PubMed OpenURL Placeholder Text WorldCat [22] Levin E.R. Gardner D.G. Samson W.K. Natriuretic peptides N Engl J Med 1998 339 321 328 Google Scholar Crossref Search ADS PubMed WorldCat [23] Johnston C.I. Tissue angiotensin converting enzyme in cardiac and vascular hypertrophy, repair and remodeling (clinical conference) Hypertension 1994 23 258 268 Google Scholar Crossref Search ADS PubMed WorldCat [24] Gainer J.V. Morrow J.D. Loveland A. King D.J. Brown N.J. Effect of bradykinin-receptor blockade on the response to angiotensin-converting-enzyme inhibitor in normotensive and hypertensive subjects (see comments) N Engl J Med 1998 339 1285 1292 Google Scholar Crossref Search ADS PubMed WorldCat [25] Hornig B. Kohler C. Drexler H. Role of bradykinin in mediating vascular effects of angiotensin-converting enzyme inhibitors in humans Circulation 1997 95 1115 1118 Google Scholar Crossref Search ADS PubMed WorldCat [26] Tikkanen T. Tikkanen I. Rockell M.D. et al. Dual inhibition of NEP and angiotensin-converting enzyme in rats with hypertension and diabetes mellitus Hypertension 1998 32 778 785 Google Scholar Crossref Search ADS PubMed WorldCat [27] French J.F. Anderson B.A. Dows T.R. Dage R.C. Dual inhibition of angiotensin-converting enzyme and NEP in rats with hypertension J Cardiovasc Pharmacol 1995 26 107 113 Google Scholar Crossref Search ADS PubMed WorldCat [28] Bäcklund T. Palojoki E. Grönholm T. et al. Dual inhibition of angiotensin converting enzyme and neutral endopeptidase by omapatrilat in rat in vivo Pharmacol Res 2001 44 411 418 Google Scholar Crossref Search ADS PubMed WorldCat [29] Fishbein M.C. MacLean D. Maroko P.R. Experimental myocardial infarction in the rat: qualitative and quantitative changes during pathologic evolution Am J Pathol 1978 90 57 70 Google Scholar PubMed OpenURL Placeholder Text WorldCat [30] Vuolteenaho O. Koistinen P. Martikkala V. Takala T. Leppäluoto J. Effect of physical exercise in hypobaric conditions on atrial natriuretic peptide secretion Am J Physiol 1992 263 R647 R652 Google Scholar PubMed OpenURL Placeholder Text WorldCat [31] Burrell L.M. Farina N. Risvanis J. et al. Inhibition of NEP, the degradative enzyme for natriuretic peptides, in rat kidney after oral SCH 42495 Clin Sci 1997 93 43 50 Google Scholar Crossref Search ADS PubMed WorldCat [32] Kohzuki M. Johnston C.I. Chai S.Y. et al. Measurement of angiotensin converting enzyme induction and inhibition using quantitative in vitro autoradiography: tissue selective induction after chronic lisinopril treatment J Hypertens 1991 9 579 587 Google Scholar Crossref Search ADS PubMed WorldCat [33] Majalahti-Palviainen T. Hirvinen M. Tervonen V. et al. Gene structure of a new cardiac hormone: a model for heart-specific gene expression Endocrinology 2000 141 731 740 Google Scholar PubMed OpenURL Placeholder Text WorldCat [34] Brooks W.W. Bing O.H.L. Robinson K.G. et al. Effect of angiotensin-converting enzyme inhibition on myocardial fibrosis and function in hypertrophied and failing myocardium from the spontaneously hypertensive rat Circulation 1997 96 4002 4010 Google Scholar Crossref Search ADS PubMed WorldCat [35] Gavrieli Y. Sherman Y. Ben-Sasson S.A. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation J Cell Biol 1992 119 493 501 Google Scholar Crossref Search ADS PubMed WorldCat [36] Litwin S.E. Katz S.E. Morgan J.P. Douglas P.S. Thrombosis/Thrombolysis/Vasodilator Responses: Serial echocardiographic assessment of left ventricular geometry and function after large myocardial infarction in the rat Circulation 1994 89 345 354 Google Scholar Crossref Search ADS PubMed WorldCat [37] Trippodo N.C. Robl J.A. Asaad M.M. et al. Effects of omapatrilat in low, normal, and high renin experimental hypertension Am J Hypertens 1998 11 363 372 Google Scholar Crossref Search ADS PubMed WorldCat [38] Weber M. Vasopeptidase inhibitors Lancet 2001 358 1525 1532 Google Scholar Crossref Search ADS PubMed WorldCat [39] Trippodo N.C. Robl J.A. Asaad M.M. et al. Cardiovascular effects of the novel dual inhibitor of neutral endopeptidase and angiotensin-converting enzyme BMS-182657 in experimental hypertension and heart failure J Pharmacol Exp Ther 1995 275 745 752 Google Scholar PubMed OpenURL Placeholder Text WorldCat [40] Trippodo N.C. Fox M. Monticello T.M. Panchal B.C. Asaad M.M. Vasopeptidase inhibition with omapatrilat improves cardiac geometry and survival in cardiomyopathic hamsters more than does ACE inhibition with captopril J Cardiovasc Pharmacol 1999 34 782 790 Google Scholar Crossref Search ADS PubMed WorldCat [41] Thomas C.V. McDaniel G.M. Holzgrefe H.H. et al. Chronic dual inhibition of angiotensin-converting enzyme and neutral endopeptidase during the development of left ventricular dysfunction in dogs J Cardiovasc Pharmacol 1998 32 902 912 Google Scholar Crossref Search ADS PubMed WorldCat [42] Rouleau J.L. Pfeffer M.A. Stewart D.J. et al. for the IMPRESS investigators Comparison of vasopeptidase inhibitor omapatrilat, and lisinopril on exercise tolerance and morbidity in patients with heart failure: IMPRESS randomised trial Lancet 2000 356 615 620 Google Scholar Crossref Search ADS PubMed WorldCat [43] Burrell L.M. Farina N.K. Balding L.C. Johnston C.I. Beneficial renal and cardiac effects of vasopeptidase inhibition with S21402 in heart failure Hypertension 2000 36 1105 1111 Google Scholar Crossref Search ADS PubMed WorldCat [44] Cuneo R.C. Espiner E.A. Nicholls M.G. Yandle T.G. Livesey J.H. Effect of physiological levels of atrial natriuretic peptide on hormone secretion: inhibition of angiotensin-induced aldosterone secretion and renin release in normal man J Clin Endocrinol Metab 1987 65 765 772 Google Scholar Crossref Search ADS PubMed WorldCat [45] Iso T. Arai M. Wada A. et al. Humoral factor(s) produced by pressure overload enhance cardiac hypertrophy and natriuretic peptide expression Am J Physiol 1997 273 H113 H118 Google Scholar PubMed OpenURL Placeholder Text WorldCat [46] Shimoike H. Iwai N. Kinoshita M. Differential regulation of natriuretic peptide genes in infarcted rat hearts Clin Exp Pharmacol Physiol 1997 24 23 30 Google Scholar Crossref Search ADS PubMed WorldCat [47] Yoshiyama M. Takeuchi K. Omura T. et al. Effects of candesartan and cilazapril on rats with myocardial infarction assessed by echocardiography Hypertension 1999 33 961 968 Google Scholar Crossref Search ADS PubMed WorldCat [48] Monopoli A. Forlani A. Ongini E. Chronic inhibition of NEP reduces left ventricular hypertrophy without changing blood pressure in spontaneously hypertensive rats J Hypertens 1991 9 Suppl S246 247 OpenURL Placeholder Text WorldCat [49] Lerman R.H. Apstein C.S. Kagan M.H. et al. Myocardial healing and repair after experimental infarction in the rabbit Circ Res 1983 53 378 388 Google Scholar Crossref Search ADS PubMed WorldCat [50] Judgutt B.I. Left ventricular rupture threshold during the healing phase after myocardial infarction in the dog Can J Physiol Pharmacol 1987 65 307 316 Google Scholar Crossref Search ADS PubMed WorldCat [51] Schieffer B. Wirger A. Meybrunn M. et al. Coronary heart disease/myocardial infarction/myocardial stunning: comparative effects of chronic angiotensin-converting enzyme inhibition and angiotensin II type 1 receptor blockade on cardiac remodeling after myocardial infarction in the rat Circulation 1994 89 2273 2282 Google Scholar Crossref Search ADS PubMed WorldCat [52] Brilla C.G. Zhou G. Matsubara L. Weber K.T. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone J Mol Cell Cardiol 1994 26 809 820 Google Scholar Crossref Search ADS PubMed WorldCat [53] Brilla C.G. Funck R.C. Rupp H. Lisinopril-mediated regression of myocardial fibrosis in patients with hypertensive heart disease Circulation 2000 102 1388 Google Scholar Crossref Search ADS PubMed WorldCat [54] Redondo J. Bishop J.E. Wilkins M.R. Effect of atrial natriuretic peptide and cyclic GMP phosphodiesterase inhibition on collagen synthesis by adult cardiac fibroblasts Br J Pharmacol 1998 124 1455 1462 Google Scholar Crossref Search ADS PubMed WorldCat [55] Ishida H. Scicli A.G. Carretero O.A. Contributions of various rat plasma peptidases to kinin hydrolysis J Pharmacol Exp Ther 1989 251 817 820 Google Scholar PubMed OpenURL Placeholder Text WorldCat [56] Baumgarten C.R. Linz W. Kunkel G. Scholkens B.A. Wiemer G. Ramiprilat increases bradykinin outflow from isolated hearts of rats Br J Pharmacol 1993 108 293 295 Google Scholar Crossref Search ADS PubMed WorldCat [57] Campbell D.J. Kladis A. Duncan A.M. Effects of converting enzyme inhibitors on angiotensin and bradykinin peptides Hypertension 1994 23 439 449 Google Scholar Crossref Search ADS PubMed WorldCat [58] Wollert K.C. Studer R. Doerfer K. et al. Differential effects of kinins on cardiomyocyte hypertrophy and interstitial collagen matrix in the surviving myocardium after myocardial infarction in the rat Circulation 1997 95 1910 1917 Google Scholar Crossref Search ADS PubMed WorldCat [59] Farina N.K. Johnston C.I. Burrell L.M. Reversal of cardiac hypertrophy and fibrosis by S21402, a dual inhibitor of neutral endopeptidase and angiotensin converting enzyme in SHRs J Hypertens 2000 18 749 755 Google Scholar Crossref Search ADS PubMed WorldCat [60] Tanaka M. Ito H. Adachi S. et al. Hypoxia induces apoptosis with enhanced expression of Fas antigen messenger RNA in cultured neonatal rat cardiomyocytes Circ Res 1994 75 426 433 Google Scholar Crossref Search ADS PubMed WorldCat [61] Gottlieb R. Burleson K.O. Kloner R.A. Babior B.M. Engler R.L. Reperfusion injury induces apoptosis in rabbit cardiomyocytes J Clin Invest 1994 94 1621 1628 Google Scholar Crossref Search ADS PubMed WorldCat [62] Saraste A. Pulkki K. Kallajoki M. et al. Apoptosis in human acute myocardial infarction Circulation 1997 95 320 323 Google Scholar Crossref Search ADS PubMed WorldCat [63] Goussev A. Sharov V.G. Shimoyama H. et al. Effects of ACE inhibition on cardiomyocyte apoptosis in dogs with heart failure Am J Physiol 1998 275 H626 H631 Google Scholar PubMed OpenURL Placeholder Text WorldCat Author notes 1 These authors contributed equally to this article. Copyright © 2003, European Society of Cardiology
TI - Effect of vasopeptidase inhibitor omapatrilat on cardiomyocyte apoptosis and ventricular remodeling in rat myocardial infarction
JO - Cardiovascular Research
DO - 10.1016/S0008-6363(02)00721-6
DA - 2003-03-01
UR - https://www.deepdyve.com/lp/oxford-university-press/effect-of-vasopeptidase-inhibitor-omapatrilat-on-cardiomyocyte-fGHNEd7xZE
SP - 727
EP - 737
VL - 57
IS - 3
DP - DeepDyve
ER -