TY - JOUR
AU - Wang,, You-Shao
AB - Abstract The present study aimed to explore the possible functions of radial oxygen loss (ROL) on mangrove nutrition. A field survey was conducted to explore the relations among ROL, root anatomy and leaf N in different mangrove species along a continuous tidal gradient. Three mangroves with different ROL (Avicennia marina [A. marina], Kandelia obovata and Rhizophora stylosa) were then selected to further explore the dynamics of N at the root-soil interface. The results showed that seaward pioneer mangrove species such as A. marina appeared to exhibit higher leaf N despite growing under poorer nutrient conditions. Greater leaf N in pioneer mangroves coincided with their special root structure (e.g., high porosity together with a thin lignified/suberized exodermis) and powerful ROL. An interesting positive relation was observed between ROL and leaf N in mangroves. Moreover, rhizo-box data further showed that soil nitrification was also strongly correlated with ROL. A. marina, which had the highest ROL among the three mangrove species studied, consistently possessed the highest levels of NO3−, nitrification and ammonia-oxidizing bacteria and archaea gene copies in the rhizosphere. Besides, both NO3− and NH4+ influxes were found to be higher in the roots of A. marina when compared to those of K. obovata and R. stylosa. In summary, greater N acquisition by pioneer mangroves such as A. marina was strongly correlated with ROL which would regulate N transformation and translocation at the root-soil interface. The implications of this study may be significant in mangrove nutrition and the mechanisms involved in mangrove zonation. Introduction Mangroves are one of the most productive and bio-diverse ecosystems along tropical and subtropical coastlines (Alongi 2002, Stephen et al. 2017). Net primary productivity of mangroves ranges from to 2 to 50 Mg C ha−1 year−1, rivaling tropical rainforests (Clark et al. 2001, Lovelock et al. 2015). Despite the high productivity, nitrogen (N) limitations were widely observed in mangroves (Feller et al. 2003a, 2003b, Lin et al. 2010). It would be of great interest to explore why mangroves can sustain high productivity in spite of N limitation (Krauss et al. 2008, Reef et al. 2010). Nitrogen availability in the sediments is influenced by many biotic and abiotic factors, including soil properties (e.g., particle size, redox status and moisture content), litter production and microbial activities (Nielsen et al. 2003, Reis et al. 2017). In contrast to terrestrial forests, mangrove sediments are frequently flooded by tides. Nitrification and the microbial formation of NO3− in mangrove sediments are greatly restrained due to frequent tidal waterlogging and O2 shortage (Reef et al. 2010). High salinity and pollutants accumulated in mangrove sediments may further reduce the activities of ammonia-oxidizing bacteria and archaea (AOB and AOA) (Chen et al. 2016, Wang and Gu 2013). Consequently, concentrations of NO3− in mangrove sediments are extremely low, and most inorganic N exists as NH4+ (Inoue et al. 2011, Xiao et al. 2018). However, the sole NH4+ source may be not advantageous for N acquisition and assimilation. The productivity and biomass yield of the plants (such as rice) were found to be higher when NH4+ and NO3− were supplied simultaneously in an appropriate ratio (Raman et al. 1995; Kronzucker 2000). Soil inundation can result in a shortage of O2 (Ponnamperuma 1984, Peters et al. 1997). The success of mangroves is partly ascribed to their special anatomical structure (e.g., developed aerial roots and aerenchyma) that facilitates O2 diffusion to the submerged roots (Youssef and Saenger 1996). The presence of air space in the roots of mangroves provides an efficient pathway for O2 transportation with low resistance (Abiko et al. 2012, Cheng et al. 2015, Pi et al. 2009). During O2 diffusion within the roots, radial oxygen loss (ROL) often occurs simultaneously (Armstrong and Beckett 1987, Xu et al. 2013). ROL can directly result in an aerobic microenvironment surrounding the roots, which may be significant in NO3− formation in the rhizosphere by facilitating the growth of some aerobic microorganisms (e.g., AOB and AOA) (Armstrong et al. 1992, Begg et al. 1994, Li et al. 2008, Phukan et al. 2016). ROL and O2 diffusion within the roots are strongly associated with root anatomy (e.g., aerenchyma formation and lignin/suberin deposition within the exodermis) (Kotula et al. 2017, Sundgren et al. 2018, Visser et al. 2000, Yamauchi et al. 2018). Some wetland plants are even plastic and respond to waterlogging by increasing root porosity (Colmer 2003a, 2003b, Evans 2003, Gibberd et al. 1999) and/or by forming a thicker suberized exodermis to enhance O2 diffusion efficiency toward root tips (Armstrong 1971, McDonald et al. 2002, Colmer and Pedersen 2008). As for N, the alterations in root aeration (e.g., decreased suberization and increased root porosity) induced by N deficiency were also observed by Schreiber et al. (2005) and in our previous study (Cheng et al. 2012b). Unfortunately, the possible functions of root anatomy and ROL on N nutrition in mangroves are still poorly understood. Therefore, the present study aims to: (i) investigate the correlations among ROL, root anatomy and leaf N in mangroves along a continuous tidal gradient; (ii) explore N transformation and nitrification in the rhizosphere of mangroves with different ROL; (iii) compare the fluxes of NO3− and NH4+ near the root surface among different mangrove species. The purpose of this study is mainly to evaluate the hypothesis that N acquisition by mangroves is strongly related to ROL which would regulate N transformation and translocation at the root-soil interface. The present study is not only significant in providing a better understanding of mangrove nutrition, but it also highlights the possible functions of root aeration and ROL on mangrove distribution in the intertidal regions. Materials and methods The variations in soil properties, species zonation, root anatomy, ROL and leaf N in mangroves along a continuous tidal gradient A field survey was conducted in Gaoqiao mangrove natural reserve, Zhanjiang, Guangdong province, China. There were five sampling sites along a tidal gradient (Figure S1 available as Supplementary Data at Tree Physiology Online), which represented the distribution of the following species Avicennia marina (A. marina), Aegiceras corniculatum (A. corniculatum), Kandelia obovata (K. obovata), Bruguiera gymnorrhiza (B. gymnorrhiza) and Rhizophora stylosa (R. stylosa). Here is an interesting sequential zonation in Gaoqiao; A. marina is found in the most seaward front of mangrove forests, followed by A. corniculatum, whereas B. gymnorrhiza and R. stylosa are often found in landward areas with higher altitude. The distribution of K. obovata was scattered and overlapped, mostly in transitional or landward regions. At each sampling site, the leaves from 12 adult trees were collected (the second pair of leaves near the top of the branches, and six leaves from three branches per adult tree ) and combined as one biological replicate, and from 12 young seedlings the second pair of leaves near the top of stem were collected per seedling and combined as a biological replicate. The leaves were dried at 60 °C for 1 week, then ground to powder, and about 0.1 g powder was used for leaf N analysis by a C/N elemental analyzer (Carlo Erba NA 2100, Milan, Italy). Simultaneously, six sediment samples (surface sediments) were also collected from each sampling site. Salinity and pH were determined immediately by a salinity auto-analyzer (PNT3000, STEPS, Nuremberg, Germany) and an IQ160 pH meter, respectively. The sediments were dried naturally and then ground into a fine powder. About 0.1 g sediment powder was incubated in 1 ml 2 M HCl for 20 min to remove carbonates. Total organic carbon and total nitrogen in the sediments were then detected by a C/N elemental analyzer. Table 1 Sediment parameters, species zonation and leaf N along a continuous tidal gradient in Gaoqiao, Zhanjiang, Guangdong province, China. Different letters in the same column indicated significant differences at P < 0.05. species . Leaf N (g kg−1) . Sediment parameters . . Adult tree . Young tree . pH . Salinity (g L−1) . Total organic Carbon (%) . Total nitrogen (g kg−1) . A. marina 20.02 ± 1.72 a 22.50 ± 1.56 a 4.93 ± 0.16 c 1.96 ± 0.07 a 0.72 ± 0.10 d 0.85 ± 0.10 c A. corniculatum 17.50 ± 1.25 b 17.51 ± 0.98 b 5.23 ± 0.08 b 1.74 ± 0.09 b 1.06 ± 0.06 c 0.97 ± 0.12 c K. obovata 16.20 ± 1.34 b 15.26 ± 1.84 c 4.76 ± 0.12 c 1.52 ± 0.09 c 1.31 ± 0.08 b 1.23 ± 0.06 b B. gymnorrhiza 13.66 ± 0.47 c 12.87 ± 1.78 c 5.45 ± 0.21 a 1.27 ± 0.03 d 1.86 ± 0.10 a 1.43 ± 0.05 a R. stylosa 10.83 ± 0.33 d 11.00 ± 0.92 d 5.50 ± 0.12 a 1.17 ± 0.03 d 1.85 ± 0.12 a 1.45 ± 0.13 a species . Leaf N (g kg−1) . Sediment parameters . . Adult tree . Young tree . pH . Salinity (g L−1) . Total organic Carbon (%) . Total nitrogen (g kg−1) . A. marina 20.02 ± 1.72 a 22.50 ± 1.56 a 4.93 ± 0.16 c 1.96 ± 0.07 a 0.72 ± 0.10 d 0.85 ± 0.10 c A. corniculatum 17.50 ± 1.25 b 17.51 ± 0.98 b 5.23 ± 0.08 b 1.74 ± 0.09 b 1.06 ± 0.06 c 0.97 ± 0.12 c K. obovata 16.20 ± 1.34 b 15.26 ± 1.84 c 4.76 ± 0.12 c 1.52 ± 0.09 c 1.31 ± 0.08 b 1.23 ± 0.06 b B. gymnorrhiza 13.66 ± 0.47 c 12.87 ± 1.78 c 5.45 ± 0.21 a 1.27 ± 0.03 d 1.86 ± 0.10 a 1.43 ± 0.05 a R. stylosa 10.83 ± 0.33 d 11.00 ± 0.92 d 5.50 ± 0.12 a 1.17 ± 0.03 d 1.85 ± 0.12 a 1.45 ± 0.13 a Open in new tab Table 1 Sediment parameters, species zonation and leaf N along a continuous tidal gradient in Gaoqiao, Zhanjiang, Guangdong province, China. Different letters in the same column indicated significant differences at P < 0.05. species . Leaf N (g kg−1) . Sediment parameters . . Adult tree . Young tree . pH . Salinity (g L−1) . Total organic Carbon (%) . Total nitrogen (g kg−1) . A. marina 20.02 ± 1.72 a 22.50 ± 1.56 a 4.93 ± 0.16 c 1.96 ± 0.07 a 0.72 ± 0.10 d 0.85 ± 0.10 c A. corniculatum 17.50 ± 1.25 b 17.51 ± 0.98 b 5.23 ± 0.08 b 1.74 ± 0.09 b 1.06 ± 0.06 c 0.97 ± 0.12 c K. obovata 16.20 ± 1.34 b 15.26 ± 1.84 c 4.76 ± 0.12 c 1.52 ± 0.09 c 1.31 ± 0.08 b 1.23 ± 0.06 b B. gymnorrhiza 13.66 ± 0.47 c 12.87 ± 1.78 c 5.45 ± 0.21 a 1.27 ± 0.03 d 1.86 ± 0.10 a 1.43 ± 0.05 a R. stylosa 10.83 ± 0.33 d 11.00 ± 0.92 d 5.50 ± 0.12 a 1.17 ± 0.03 d 1.85 ± 0.12 a 1.45 ± 0.13 a species . Leaf N (g kg−1) . Sediment parameters . . Adult tree . Young tree . pH . Salinity (g L−1) . Total organic Carbon (%) . Total nitrogen (g kg−1) . A. marina 20.02 ± 1.72 a 22.50 ± 1.56 a 4.93 ± 0.16 c 1.96 ± 0.07 a 0.72 ± 0.10 d 0.85 ± 0.10 c A. corniculatum 17.50 ± 1.25 b 17.51 ± 0.98 b 5.23 ± 0.08 b 1.74 ± 0.09 b 1.06 ± 0.06 c 0.97 ± 0.12 c K. obovata 16.20 ± 1.34 b 15.26 ± 1.84 c 4.76 ± 0.12 c 1.52 ± 0.09 c 1.31 ± 0.08 b 1.23 ± 0.06 b B. gymnorrhiza 13.66 ± 0.47 c 12.87 ± 1.78 c 5.45 ± 0.21 a 1.27 ± 0.03 d 1.86 ± 0.10 a 1.43 ± 0.05 a R. stylosa 10.83 ± 0.33 d 11.00 ± 0.92 d 5.50 ± 0.12 a 1.17 ± 0.03 d 1.85 ± 0.12 a 1.45 ± 0.13 a Open in new tab Young seedlings of the above five mangrove species were transported to the laboratory for the measurement of root anatomy and ROL. The seedlings used for root anatomy and ROL measurement were about 7–12 cm (stem height, without the height of propagules) and with four to six fully expanded leaves. For each species, eight seedlings were used for the measurements of ROL and root porosity. Rates of ROL from the entire root were measured by a titanium citrate colorimetric method as reported by Kludze et al. (1993) and Cheng et al. (2010 and 2012b). At first, the seedlings were transferred to a plastic box filled with N2. The roots were incubated in a predeoxygenated 0.2 strength Hoagland solution, and a layer of paraffin oil was added in order to avoid air oxidation. Then 5 ml titanium (III) citrate (prepared by 60 ml 1.16 M TiCl3 mixed with 70 ml saturated Na2CO3 and 600 ml 0.2 M sodium citrate, pH = 5.6) was added into the solution by a syringe. The seedlings together with the tubes were then allowed to contact with air (about 30 °C and 300 μmol m−2 s−1 in light intensity). After incubation for 24 h, color changes in the solutions were observed at 527 nm. As for the measurement of root porosity (POR), lateral roots (the section 0–6 cm from root tip) were divided with a razor blade and cut into segments (about 1 cm in length). Porosities for the lateral roots were detected by a pycnometer method as described by Kludze et al. (1993) and Mei et al. (2014). Porosity (% volume of air space) = 100 × (Wpvr–Wpr)/ [(Wp + r) – Wpr]. All units of weight are represented in g, where r is the weight of the fresh roots; Wp is the mass of the pycnometer filled with water; Wpr and Wpvr are the weights of the pycnometer filled with water and roots before and after vacuuming, respectively. In terms of the measurements of root anatomy, lateral roots with a similar size (~0.8–1.2 mm in diameter) were selected, and free-hand cross sections at apical (0.5 cm) and subapical root regions (about 2 cm from the root tip) were made. For each species, 12 lateral roots were selected. Root anatomical features such as lignification and suberization were observed by a fluorescence microscope (Olympus BX53, Tokyo, Japan) (Thomas et al. 2007, Zeier et al. 1999). As for root lignification, the sections were stained with concentrated hydrochloric acid and phloroglucinol (5 g phloroglucinol dissolved in 100 ml 95% ethyl alcohol) and then observed immediately under bright field to show lignification. In terms of suberization, the sections were stained with Fluorol yellow 088 (0.01% w/v, FY088-polyethylene glycol 400-glycerol dye solution) for 1 h, and then viewed with UV light as described by Thomas et al. (2007). Lab seedling cultivation and plant martial preparation One year before this study, propagules of the three selected mangroves (A. marina, K. obovata and R. stylosa) were collected from Gaoqiao mangrove natural reserve mentioned above. The seedlings were cultivated in a glass house (natural temperature approximately 10–25 °C) to the next January. During plant material preparation, the seedlings were mainly irrigated with tap water. Previous studies have reported that mangrove can grow in a wide range of salinity; the salt in the sediments is sufficient for initial growth (Pi et al. 2010, Ye et al. 2005, Ye and Tam 2002). The overwintered seedlings with similar size were selected as plant materials for all the following laboratory-based experiments. The original size of seedlings was about 10 ± 2 cm in height (stem height, without propagule) and with four to six fully expanded leaves. The average dry biomass (the sum of leaf, stem and roots, but without propagule) of A. marina, K. obovata and R. stylosa were 1.05, 1.63 and 1.67 g, respectively. Microenvironment and N dynamics in the rhizosphere of the three selected mangroves with different ROL A rhizo-box experiment was employed to evaluate N dynamics in the rhizosphere. The soil used in this experiment was also collected from R. stylosa-dominant mangroves in Gaoqiao, since the nutrient conditions seemed to be better in R. stylosa-dominant mangroves (Table 1). The design of the rhizo-box followed Lu et al. (2007) with minor modification (Figure S2 available as Supplementary Data at Tree Physiology Online). The size of the rhizo-box was 16 × 18 × 18 cm. Rhizo-boxes were designed to divide the soils into different compartments: planted (middle 2 cm) zone, rhizosphere (0–1 cm away from planted zone), near-rhizosphere (1–3 cm away from planted zone) and nonrhizosphere (3–7 cm away from planted zone). The different compartments were separated by nylon nets (30 μm mesh), which could limit root growth but not influence water and nutrient fluxes. The seedlings of the three mangroves were kept in light growth incubators (GDZ-400D, 28 ± 5 °C, 300 μmol m−2 s−1 in light intensity, 16/8 h day/night and high/low tide cycle with a salinity of 5‰). There were three rhizo-boxes for each species, and three seedlings were planted in each rhizo-box. After 100 days, growth parameters, tissue N, ROL and root anatomy were detected as described above (three replicates for each analysis, the seedlings in the same rhizo-box were considered as a biological replicate). Soil samples were also collected for the measurements of inorganic N, nitrification activity and AOB and AOA gene copies. For each soil region, there were three replicate (two samples from the same soil region were combined as a biological replicate). Table 2 Characteristics of root anatomy and ROL in the five mangroves along a continuous tidal gradient. Numbers of outer cell layers were counted based on 12 seedlings for each species. Different letters in the same column indicated significant differences among mangroves species at P < 0.05. +, thin; ++, medium; +++, thick. Species . Status of outer cell layers (exodermis/hypodermis, without epidermis) . Root porosity (%) . ROL (μmol O2 d−1 g−1 dry weight root) . Presence of lignified/suberized walls . No. of outer cell layers . A. marina + 1.75 ± 0.45 c 29.53 ± 1.28 a 36.68 ± 1.28 a A. corniculatum + 2.08 ± 0.67 c 27.75 ± 1.44ab 31.83 ± 2.76 b K. obovata ++ 2.83 ± 0.40 b 25.60 ± 1.27 b 24.07 ± 2.09 c B. gymnorrhiza +++ 3.75 ± 0.62 a 24.11 ± 2.12 b 13.67 ± 1.18 d R. stylosa +++ 4.41 ± 0.52 a 11.09 ± 0.93 c 7.87 ± 0.90 e Species . Status of outer cell layers (exodermis/hypodermis, without epidermis) . Root porosity (%) . ROL (μmol O2 d−1 g−1 dry weight root) . Presence of lignified/suberized walls . No. of outer cell layers . A. marina + 1.75 ± 0.45 c 29.53 ± 1.28 a 36.68 ± 1.28 a A. corniculatum + 2.08 ± 0.67 c 27.75 ± 1.44ab 31.83 ± 2.76 b K. obovata ++ 2.83 ± 0.40 b 25.60 ± 1.27 b 24.07 ± 2.09 c B. gymnorrhiza +++ 3.75 ± 0.62 a 24.11 ± 2.12 b 13.67 ± 1.18 d R. stylosa +++ 4.41 ± 0.52 a 11.09 ± 0.93 c 7.87 ± 0.90 e Open in new tab Table 2 Characteristics of root anatomy and ROL in the five mangroves along a continuous tidal gradient. Numbers of outer cell layers were counted based on 12 seedlings for each species. Different letters in the same column indicated significant differences among mangroves species at P < 0.05. +, thin; ++, medium; +++, thick. Species . Status of outer cell layers (exodermis/hypodermis, without epidermis) . Root porosity (%) . ROL (μmol O2 d−1 g−1 dry weight root) . Presence of lignified/suberized walls . No. of outer cell layers . A. marina + 1.75 ± 0.45 c 29.53 ± 1.28 a 36.68 ± 1.28 a A. corniculatum + 2.08 ± 0.67 c 27.75 ± 1.44ab 31.83 ± 2.76 b K. obovata ++ 2.83 ± 0.40 b 25.60 ± 1.27 b 24.07 ± 2.09 c B. gymnorrhiza +++ 3.75 ± 0.62 a 24.11 ± 2.12 b 13.67 ± 1.18 d R. stylosa +++ 4.41 ± 0.52 a 11.09 ± 0.93 c 7.87 ± 0.90 e Species . Status of outer cell layers (exodermis/hypodermis, without epidermis) . Root porosity (%) . ROL (μmol O2 d−1 g−1 dry weight root) . Presence of lignified/suberized walls . No. of outer cell layers . A. marina + 1.75 ± 0.45 c 29.53 ± 1.28 a 36.68 ± 1.28 a A. corniculatum + 2.08 ± 0.67 c 27.75 ± 1.44ab 31.83 ± 2.76 b K. obovata ++ 2.83 ± 0.40 b 25.60 ± 1.27 b 24.07 ± 2.09 c B. gymnorrhiza +++ 3.75 ± 0.62 a 24.11 ± 2.12 b 13.67 ± 1.18 d R. stylosa +++ 4.41 ± 0.52 a 11.09 ± 0.93 c 7.87 ± 0.90 e Open in new tab Values of redox potentials (Eh) and pH were detected immediately after harvest. Inorganic N was extracted with 2 M KCl and then measured by a flow analyzer (QuAAtro39, Seal, Berlin, Germany). A chlorate inhibition method was employed for nitrification potential activity measurement (Chen et al. 2016). In brief, fresh soil was added into 50 ml tubes and then mixed with 20 ml reaction liquid containing 15 μM Na3PO4, 200 μM NH4 and 10 mM KClO3. After incubating at 25 °C for 48 h in the dark, NO3− was extracted and determined by a flow analyzer (QuAAtro39, Seal, Berlin, Germany). The abundances of AOB and AOA were also determined. At first, soil DNA (about 1.0 g fresh sediment) was extracted (E.Z.N.A. Soil DNA Kit, Omega). AOB was amplified by amoA-1f (5′GGGGTTTCTACTGGTGGT3′) and amoA-2r (5′CCCCTCKGSAAAGCCTTCTTC3′), whereas the primers of Arch-amoAF (5′STAATGGTCTGGCTTAGACG3′) and Arch-amoAR (5′GCGGCCATCCATCTGTATGT3′) were employed for AOA amplification (Wang and Gu, 2013). The polymerase chain reaction (PCR) products of the targeted genes were purified (EZNA Gel Extraction Kit, Omega), inserted to a pMD 18-T vector (Takara) and subsequently transformed into Escherichia coli DH5α competent cell (Takara). Quantitative PCR (qPCR) was employed to evaluate the abundances of AOB and AOA in the soil samples. All samples were measured in triplicate for qPCR analysis. The following reagents were used for qPCR reaction: 9 μl ddH2O, 12.5 μl SYBR® Premix Ex Taq ™ II, 0.5 μl bovine serum albumin (10 mg ml−1), 1 μl DNA (30–50 ng μl−1) and 1 μl forward and reverse primers (10 μM). The conditions were as follows: denaturing 40 thermal cycles at 95 °C for 45 s, annealing at 58 °C for 30 s for AOB or annealing at 56°C for 30 s for AOA and finally extending at 72 °C for 1 min. Plasmids containing the targeted PCR amplicons were extracted (plasmid extraction Kit, Omega) for the preparation of standard curves. The concentrations of plasmid DNA were determined using a NanoDrop2000 analyzer (Thermo), and the copies of the target genes were calculated by the ratio of molecular weight between plasmid DNA and insert amplicons [gene copies = (6.02 × 1023 × plasmid DNA content × 10−9)/(the length of the targeted AOA or AOB sequences × 660), where the unit of gene copies was copies per μl, plasmid DNA content was represented in ng per μl]. Serial 10-fold dilutions of standard plasmids with known targeted gene copies were made using the same qPCR program for the calculation of standard curves. PCR efficiencies were 88–96% for AOB and 91–96% for AOA, and the correlation coefficients (R2) were <0.98 for both the two targeted genes. Influxes of NO3− and NH4+ the near root surface of the three selected mangrove species Non-invasive Micro-test Technology (Amherst, MA, USA) was employed to evaluate the influxes of NO3− and NH4+ at the root surface (Hawkins et al. 2014, Luo et al. 2013). The overwintered seedlings of the three mangroves were transferred to the growth incubators (growth conditions were described above) for short-term growth until new leaves and obvious root elongation were observed. The lateral roots with similar size (about 0.8–1.2 mm in diameter) were then selected and excised for the measurements of NO3− and NH4+ influxes. Previous studies have showed that the influxes of ions remained stable for several hours after root separation (Hawkins et al. 2014). The excised roots were then equilibrated in measuring solutions (NH4+ measuring solution: 0.1 mM CaCl2, 0.1 mM NH4Cl, 0.3 mM MES buffer, pH 5.5; NO3− measuring solution: 0.1 mM KCl, 0.1 mM CaCl2, 0.1 mM KNO3, 0.3 mM MES buffer, pH 5.5). The compositions of the measuring solutions followed manufacturer’s instructions and previous studies (Luo et al. 2013, Zheng et al. 2013). Chloride was employed in the measuring solutions to simulate a natural anionic environment. The selectivity of the NO3− microelectrode for Cl− is ~2.73% (using 100 mM Cl− as ion release source, according to the manufacturer’s instructions), the interferences of Cl− are of little concern in the present working concentration range (Henriksen et al. 1990). Table 3 Growth, ROL and concentrations of N in tissues of the three mangroves growing in rhizo-boxes. There were three relations for each analysis. Different letters in the same column indicated significant differences among mangroves species at P < 0.05. Species . Stem height (cm) . Biomass (g) . ROL (μmol O2 d−1 g−1 DW root) . Concentrations of N in plant tissues (mg g−1) . Root . Stem . Leaf . A. marina 31.95 ± 1.65 a 2.94 ± 0.35 b 32.47 ± 2.39 a 15.70 ± 1.66 a 13.94 ± 0.76 a 23.80 ± 2.24 a K. obovata 23.87 ± 2.32 b 3.54 ± 0.24 a 19.45 ± 1.52 b 9.58 ± 0.36 b 10.92 ± 0.83 b 17.16 ± 2.02 b R. stylosa 18.81 ± 0.90 c 3.06 ± 0.19 b 7.16 ± 0.99 c 8.73 ± 0.41 b 7.53 ± 0.49 c 11.08 ± 0.84 c Species . Stem height (cm) . Biomass (g) . ROL (μmol O2 d−1 g−1 DW root) . Concentrations of N in plant tissues (mg g−1) . Root . Stem . Leaf . A. marina 31.95 ± 1.65 a 2.94 ± 0.35 b 32.47 ± 2.39 a 15.70 ± 1.66 a 13.94 ± 0.76 a 23.80 ± 2.24 a K. obovata 23.87 ± 2.32 b 3.54 ± 0.24 a 19.45 ± 1.52 b 9.58 ± 0.36 b 10.92 ± 0.83 b 17.16 ± 2.02 b R. stylosa 18.81 ± 0.90 c 3.06 ± 0.19 b 7.16 ± 0.99 c 8.73 ± 0.41 b 7.53 ± 0.49 c 11.08 ± 0.84 c Open in new tab Table 3 Growth, ROL and concentrations of N in tissues of the three mangroves growing in rhizo-boxes. There were three relations for each analysis. Different letters in the same column indicated significant differences among mangroves species at P < 0.05. Species . Stem height (cm) . Biomass (g) . ROL (μmol O2 d−1 g−1 DW root) . Concentrations of N in plant tissues (mg g−1) . Root . Stem . Leaf . A. marina 31.95 ± 1.65 a 2.94 ± 0.35 b 32.47 ± 2.39 a 15.70 ± 1.66 a 13.94 ± 0.76 a 23.80 ± 2.24 a K. obovata 23.87 ± 2.32 b 3.54 ± 0.24 a 19.45 ± 1.52 b 9.58 ± 0.36 b 10.92 ± 0.83 b 17.16 ± 2.02 b R. stylosa 18.81 ± 0.90 c 3.06 ± 0.19 b 7.16 ± 0.99 c 8.73 ± 0.41 b 7.53 ± 0.49 c 11.08 ± 0.84 c Species . Stem height (cm) . Biomass (g) . ROL (μmol O2 d−1 g−1 DW root) . Concentrations of N in plant tissues (mg g−1) . Root . Stem . Leaf . A. marina 31.95 ± 1.65 a 2.94 ± 0.35 b 32.47 ± 2.39 a 15.70 ± 1.66 a 13.94 ± 0.76 a 23.80 ± 2.24 a K. obovata 23.87 ± 2.32 b 3.54 ± 0.24 a 19.45 ± 1.52 b 9.58 ± 0.36 b 10.92 ± 0.83 b 17.16 ± 2.02 b R. stylosa 18.81 ± 0.90 c 3.06 ± 0.19 b 7.16 ± 0.99 c 8.73 ± 0.41 b 7.53 ± 0.49 c 11.08 ± 0.84 c Open in new tab Before measurements, the microelectrodes were calibrated (the calibration solutions: 0.05–0.5 mM NH4+ or 0.05–0.5 mM NO3− in addition to the same compounds used in the NH4+ and NO3− measuring solution, respectively), and both the NH4+ and NO3− slopes were satisfactory (both NH4+ and NO3− Nernstian slopes were <53 mV per 10-fold concentration difference). The fluxes were measured by moving the microelectrode along the roots (5–35 μm from root surface). The background was detected in the measuring solution without roots. The microelectrodes with 2–4 μm apertures were manufactured and salinized with a backfilling solution and an ion-selective liquid cocktail (NH4+ electrode: # 09879, Sigma; NO3− electrode: # 7254, Sigma). The fluxes of NO3− and NH4+ were detected at apical (0.5 cm from root tip) and subapical (2 cm from root tip) root zones individually. For each species, six plants for NO3− and another six for NH4+ were analyzed. In addition, total N influxes (both NH4+ and NO3−) of the roots (apical roots, 0.5 cm from root tip) were also detected under a mixed N source with the same total N content (the measuring solutions contained 0.05 mM NH4NO3 instead of 0.1 mM NH4Cl and/or KNO3, respectively). There were also six replicates or each ion analysis. Statistical analysis The data were statistically analyzed by SPSS 13.0 and expressed as mean ± SD. Data on plant performances and soil properties were tested for their normality prior to one-way analysis of variance (ANOVA), and the least significant difference (LSD) was employed to indicate the differences among the data. All figures were created by Origin 8.0. Results The variations in soil properties, species zonation, root anatomy, ROL and leaf N in mangroves along a continuous tidal gradient Soil properties varied significantly among different sampling sites along tidal gradient (Table 1, Figure S1 available as Supplementary Data at Tree Physiology Online). With the decrease in altitude, soil salinity increased, however lower total organic carbon and N were observed in the sediments of seaward mangroves when compared to landward mangroves. Interestingly, seaward pioneer mangrove species (both adult and young trees) such as A. marina and A. corniculatum appeared to exhibit the highest concentrations of N in leaves despite growing under the worst nutrient conditions. On the contrary, landward mangrove species such as B. gymnorrhiza and R. stylosa possessed the lowest leaf N. Features of root anatomy and ROL also varied significantly among different mangrove species (Table 2). When compared to landward mangrove species, the species distributed in the seaward mangroves (such as A. marina and A. corniculatum) exhibited higher ROL rates. Higher values of root porosity were also found in the seaward mangrove species. As for the characteristics of lignification/suberization within the outer cell layers, the presences of lignification/suberization were more obvious in subapical roots (data of lignification/suberization in apical root regions were not shown). Seaward mangroves often showed a thin exodermis, whereas landward mangrove species exhibited a thick lignified/suberized exodermis. More importantly, some interesting relationships were observed among ROL, root anatomy, and leaf N in mangroves. ROL was positively related to root porosity (Figure 1a), but negatively related to the numbers of outer cell layers (Figure 1b). A positive relation was also found between ROL and leaf N (Figure 1c). Figure 1. Open in new tabDownload slide Potential relations among ROL, root anatomy and N uptake in mangroves. Means ± standard deviation (n = 12). ROL was found to be positively related to root porosity (a: Y = 0.64X + 7.62, R2 = 0.87, P < 0.05), but negatively related to outer cell layers (b: Y = −0.09X + 5.06, R2 = 0.99, P < 0.01) significant positive correlations were also found between ROL and leaf N in the field young seedlings (c: Y = 0.32X + 8.27, R2 = 0.90, P < 0.01). Figure 1. Open in new tabDownload slide Potential relations among ROL, root anatomy and N uptake in mangroves. Means ± standard deviation (n = 12). ROL was found to be positively related to root porosity (a: Y = 0.64X + 7.62, R2 = 0.87, P < 0.05), but negatively related to outer cell layers (b: Y = −0.09X + 5.06, R2 = 0.99, P < 0.01) significant positive correlations were also found between ROL and leaf N in the field young seedlings (c: Y = 0.32X + 8.27, R2 = 0.90, P < 0.01). Growth, root anatomy, ROL and concentrations of N in the tissues of the three selected mangroves grown in the rhizo-box Similar to the field experiment, the order of ROL was also A. marina > K. obovata > R. stylosa in the rhizo-box experiment (Table 3). Anatomical features of the three mangroves were also consistent with the field survey (Figure 2). A thin exodermis and less lignification/suberization was observed in A. marina, whereas R. stylosa exhibited a thick lignified/suberized exodermis. Figure 2. Open in new tabDownload slide Lignification and suberization in the roots (subapical root, about 2 cm from root tips) of the three selected mangroves. (a–c): Bar = 100 μm, sections of A. marina, K. obovata and R. stylosa, respectively, stained with phloroglucinol and hydrochloric acid to show lignification, red. (d–f): Bar = 100 μm, sections of A. marina, K. obovata and R. stylosa, respectively, stained with FY 088 and viewed with UV light to show suberization. Figure 2. Open in new tabDownload slide Lignification and suberization in the roots (subapical root, about 2 cm from root tips) of the three selected mangroves. (a–c): Bar = 100 μm, sections of A. marina, K. obovata and R. stylosa, respectively, stained with phloroglucinol and hydrochloric acid to show lignification, red. (d–f): Bar = 100 μm, sections of A. marina, K. obovata and R. stylosa, respectively, stained with FY 088 and viewed with UV light to show suberization. All the seedlings grew well in the rhizo-box. Lower stem height and less biomass were observed in R. stylosa. Compared to root and stem, higher N contents were observed in the leaves. In terms of the differences among species, the highest tissue N was observed in A. marina, whereas R. stylosa exhibited the lowest tissue N (Table 3). Microenvironment and N dynamics in the rhizosphere of the three selected mangroves with different ROL The data rhizosphere oxidation and data are illustrated in Figure 3. Coinciding with ROL, more efficient rhizosphere oxidation was found in A. marina (Figure 3b). Besides, obvious rhizosphere acidifications were found in all the three mangroves (Figure 3a). Figure 3. Open in new tabDownload slide Values of (a) pH and redox potential (Eh) (b) measured at different rhizosphere regions growing A. marina, K. obovata and R. stylosa. Means ± standard deviation (n = 3). Different letters indicated significant differences among soil regions with in each species at P < 0.05. Figure 3. Open in new tabDownload slide Values of (a) pH and redox potential (Eh) (b) measured at different rhizosphere regions growing A. marina, K. obovata and R. stylosa. Means ± standard deviation (n = 3). Different letters indicated significant differences among soil regions with in each species at P < 0.05. The concentrations of NO3− in the rhizosphere of A. marina were higher than those in K. obovata and R. stylosa (Figure 4b). However, significant difference in NH4+ was not observed in the rhizosphere among the three mangrove species studied (Figure 4a). Figure 4. Open in new tabDownload slide NH4+ (a) and NO3− (b) concentrations measured at different rhizosphere regions growing A. marina, K. obovata and R. stylosa. Means ± standard deviation (n = 3). Different letters indicated significant differences among species at P < 0.05. Figure 4. Open in new tabDownload slide NH4+ (a) and NO3− (b) concentrations measured at different rhizosphere regions growing A. marina, K. obovata and R. stylosa. Means ± standard deviation (n = 3). Different letters indicated significant differences among species at P < 0.05. The highest nitrification activities and nitrifiers (AOB and AOA) were observed in the rhizosphere, followed by near-rhizo and non-rhizo regions. In terms of the differences among the three mangrove species, rhizo-soil associated with A. marina consistently exhibited the highest nitrification activity coinciding with the highest gene copies in both AOB and AOA (Figure 5). Figure 5. Open in new tabDownload slide Nitrification activities (a), AOA (b) and AOB (c) gene copies in different rhizosphere regions growing A. marina, K. obovata and R. stylosa. Means ± standard deviation (n = 3). Different letters in the same soil region indicated significant differences among species within each soil region at P < 0.05. Figure 5. Open in new tabDownload slide Nitrification activities (a), AOA (b) and AOB (c) gene copies in different rhizosphere regions growing A. marina, K. obovata and R. stylosa. Means ± standard deviation (n = 3). Different letters in the same soil region indicated significant differences among species within each soil region at P < 0.05. Influxes of NO3− and NH4+ near the root surface of the three selected mangrove species The influxes of NO3− and NH4+ near the root surface of the three mangroves are shown in Figure 6. In addition to NH4+ influxes, substantial NO3− influxes were also observed in all three mangroves. Among the three mangroves studied, the highest NO3− and NH4+ influxes were observed in the roots of A. marina. In contrast, R. stylosa exhibited the lowest NO3− and NH4+ influxes. Figure 6. Open in new tabDownload slide Differences in net influxes of NH4+ (a) and NO3− (b) near root surface among the three selected mangroves. Means ± standard deviation, n = 6. Different letters indicated significant differences among species at P < 0.05. NH4+ measuring solution: 0.1 mM NH4Cl, 0.1 mM CaCl2 and 0.3 mM MES buffer, pH 5.5; NO3− measuring solution: 0.1 mM KNO3, 0.1 mM KCl, 0.1 mM CaCl2 and 0.3 mM MES buffer, pH 5.5. Figure 6. Open in new tabDownload slide Differences in net influxes of NH4+ (a) and NO3− (b) near root surface among the three selected mangroves. Means ± standard deviation, n = 6. Different letters indicated significant differences among species at P < 0.05. NH4+ measuring solution: 0.1 mM NH4Cl, 0.1 mM CaCl2 and 0.3 mM MES buffer, pH 5.5; NO3− measuring solution: 0.1 mM KNO3, 0.1 mM KCl, 0.1 mM CaCl2 and 0.3 mM MES buffer, pH 5.5. Additionally, a mixed N source (both NO3− and NH4+ were supplied simultaneously) rather than sole NH4+ or NO3− source was more favorable for total N acquisition in all the three mangroves studied (Figure S3 available as Supplementary Data at Tree Physiology Online). Discussion The differences in ROL and root anatomy in mangroves along tidal gradients Mangroves often exhibit a special sequential zonation coinciding with the changes of environmental parameters in the intertidal regions (Piou et al. 2006, Urrego et al. 2009). Tidal waterlogging is considered as an important factor that regulates the distribution of mangroves, since the dynamics of C/N in the sediments are strongly related to soil properties and hydrological conditions (Lovelock et al. 2005). In this study, lower Eh and less C and N were observed in the sediments of seaward mangroves (Table 1). Wang et al. (2019) have reported the importance of propagule dispersal in mangrove distribution. The differences in ROL and root anatomy in mangroves, as demonstrated in this study, may provide another reasonable explanation for mangrove zonation from the aspects of waterlogging tolerance and mangrove nutrition (Cheng et al. 2015, Loreti et al. 2016). In this study, higher root aeration (e.g., higher root porosity and lower lignification/suberization) was observed in the seaward mangrove species (e.g., A. marina and A. corniculatum) when compared to transitional and landward mangrove species (Table 2, Figure S1 available as Supplementary Data at Tree Physiology Online). The values of root porosity are expressed as the ratio of air space and the volume of the roots. Generally, roots with high porosity often possess developed aerenchyma. The formation of aerenchyma was reported repeatedly as an important adaptive strategy to waterlogging (He et al. 1996, Miyamoto et al. 2001, Sundgren et al. 2018). Along the pathway of O2 transportation within roots, there is a competition between longitudinal diffusion within the roots and transverse diffusion into the rhizosphere soils (Kotula et al. 2009, Soukup et al. 2007). Waterlogging tolerance of the plants may depend on the competing balance between O2 demands within roots and rhizosphere oxidation (Colmer 2003a, 2003b, Garthwaite et al. 2008). Such a special root structure with developed aerenchyma together with a thin lignified/suberized exodermis in seaward pioneer mangrove species may satisfy O2 demands within roots and sufficient ROL simultaneously (Cheng et al. 2014, Pi et al. 2009). Moreover, our present data (Figure 1) illustrated an interesting positive relation between ROL and leaf N in mangroves. Seaward pioneer species (e.g., such as A. marina and A. corniculatum), which possessed higher ROL, consistently exhibit higher leaf N even growing under poorer nutrient conditions (Table 1). The present data may partly clarify why pioneer mangroves (e.g., A. marina) are more suitable in nutrient-deficient foreshores. The importance of ROL and rhizosphere oxidation in mangrove nutrition The presence of NO3− is important for the plants growing under waterlogging (Kirk and Kronzucker 2005, Kronzucker et al. 2000, Raman et al. 1995). Flooded soils have a strong ability to dissipate NO3− through nitrate ammonification and denitrification, thus it used to be considered that wetland plants absorb little NO3−. However, in radiotracer N experiments, it was found that the rates of NO3− uptake by rice were comparable with those of NH4+ (Kronzucker et al. 1999, 2000). Shiau et al. (2017) and our present data of NMT data (Figure 6) also observed substantial NO3− uptake by the roots of mangroves. Additionally, all the three mangrove species exhibited higher N acquisitions (total NO3− and NH4+ influxes) in a mixed N source when compared the sole NO3− or NH4+ source (Figure S3 available as Supplementary Data at Tree Physiology Online). Mangrove sediments are often defined as anaerobic and NO3− limited. Higher amounts of NO3− in the rhizosphere of A. marina may benefit it in acquiring higher amounts of N from soils, leading to more N accumulation in plant tissues (Table 3, Figure 4). The optimized ratio of NO3−/NH4+ for mangrove plants needs to be further investigated. Higher NO3− in the rhizosphere of A. marina was strongly related to its efficient ROL and rhizosphere oxidation (Table 3, Figure 3). Nitrification is an O2-dependent biochemical process including the conversion of NH4+ into NO2−, and then in turn to NO3−. Ammonia oxidation, which is regulated by AOA and AOB, is considered as a rate-limiting step during nitrification. The present data from the rhizo-box experiment clearly illustrated that the abundances of nitrifiers in the rhizosphere were strongly correlated to rhizosphere oxidation. In all the three mangroves studied, higher nitrification activities and micronitrifiers (e.g., AOA and AOB) were observed in the rhizosphere when compared to near-rhizo and non-rhizo soils (Figure 5). In terms of the differences among the three species studied, A. marina, which possessed the highest ROL among the three mangroves studied, consistently exhibited the highest NO3−, nitrification, and AOA/AOB gene copies in the rhizosphere. As far as our team’s knowledge extends, this is the first attempt to evaluate the functions of ROL in nitrification in different mangrove species. It should be noted that the results relied on correlative evidence of a small number of species due to the limitation of species diversity in Gaoqiao, China. More detailed information focused on rhizosphere nitrification as affected by ROL (e.g., the assessment of the correlation between ROL and rhizosphere nitrification based on more species, and/or the comparison of rhizosphere nitrification in the wild and transgenic cultivars with different ROL) should be obtained. In addition to nitrification (conversion of NH4+ to NO3−), the ROL-induced aerobic microenvironment may also alleviate the loss of NH4+ driven by anammox (conversion of NH4+ to N2) (Chen and Gu 2017, Xiao et al. 2018). The issue above may partly explain why significant difference in NH4+ in the rhizosphere among the three mangroves was not observed (Figure 4a). Comprehensive and accurate determination of O2 dynamics and N transformation in the rhizosphere at a smaller microlevel would also be worth exploring. Nevertheless, obvious rhizosphere acidification, which may be caused by root exudates (Sun et al. 2016), was also observed in the present study. More detailed research focused on the correlations between rhizosphere effects and N dynamics in the rhizosphere should be conducted. The potential function of root anatomy on N nutrition in mangroves Generally, lignin and suberin deposition within the exodermis would contribute to forming an impermeable layer around the root surface, creating a barrier to ROL (Kotula et al. 2017, Pollard et al. 2008, Soukup et al. 2007). This impermeable barrier may protect plants by preventing excessive phytotoxins (e.g., Na+, Pb2+ and Zn2+) entering into the roots (Armstrong and Armstrong 2005, Cheng et al. 2010, 2012a, 2014, Krishnamurthy et al. 2014). However, such an lignified/suberized barrier may be not advantageous to the growth of mangroves under nutrient deficient conditions. In the present data, R. stylosa which possesses the thickest lignified/suberized exodermis consistently exhibited the lowest plant productivity and N acquisition (Tables 1–3). The lowest NH4+ and NO3− influxes were also observed in the roots of R. stylosa when compared to A. marina and K. obovata (Figure 6). This is a strategy that a thin exodermis with low lignification/suberization can be speculated to promote N uptake and translocation. In addition to low lignification/suberization, root cortical aerenchyma may also enhance N acquisition by plants under N deficient conditions (Jaramillo et al. 2013, Abiko and Obara 2014). In this study, positive correlations were observed among root porosity, ROL and leaf N (Figure 1). Extensive air space within the roots would reduce root respiration and the metabolic cost of soil exploration. Besides, cell decomposition during aerenchyma formation may also benefit nutrient reallocation within roots, which may particularly important for plants growing under N deficient conditions (Postma and Lynch 2011). Nevertheless, some other root anatomical features, such as root diameter, number of cortical layers and xylem arrangement, may also affect N uptake and translocation within the plants (Saengwilai et al. 2014). It should be noted that mangroves can grow under a wide range of salinity. Although the salinity (5‰) applied in this study appears to have little effect on root anatomy, ROL and N acquisition by mangroves when compared to non-saline condition, high salinity may affect root anatomy and N uptake by the plants (Patel et al. 2010, Sun et al. 2009, Zhang et al. 2014). The effects of Na+, Cl− and other soluble ions on NH4+ and NO3− influxes and nitrogen acquisition by mangroves are worthy of further investigation. Moreover, genomes for some mangrove species were sequenced recently (Lyu et al. 2018). The potential molecular mechanisms of aerenchyma formation (Rajhi et al. 2011, Yoo et al. 2015), lignin/suberin biosynthesis (Kulichikhin et al. 2014, Provost et al. 2016, Ranathunge et al. 2016), and as well as the connections and distinctions between these processes (Yamauchi et al. 2015) in the roots of mangroves under multiple abiotic stresses, would also be worth exploring. Conclusion An interesting positive correlation was observed between ROL and leaf N in mangroves along a continuous tidal gradient. Compared to transitional and landward mangroves, higher N contents were observed in the leaves of seaward pioneer mangroves. Greater leaf N in pioneer mangroves may be partly ascribed to their special root structure (e.g., high root porosity together with a thin lignified/suberized exodermis) that facilitates ROL from roots. The species A. marina, which possessed the highest ROL, consistently exhibited the highest NO3−, nitrification, and AOB/AOA gene copies in the rhizosphere. The results of NH4+ and NO3− influxes further showed that a thin exodermis with low lignification/suberization appeared to benefit NO3− and NH4+ influxes into the roots. In summary, the present study claimed a possible function of ROL on nitrogen nutrition in relation to N transformation and translocation at the root-soil interface. The implications of the present data would provide a better understanding of mangrove nutrition and field zonation distribution. Supplementary Data Supplementary data for this article are available at Tree Physiology Online. Acknowledgments We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. Funding This research was supported by the National Natural Science Foundation of China (Nos. 41676086, U1901211, 41430966), Science and Technology Basic Resources Investigation Program of China (2017FY100707), Science and Technology Project of Guangdong province (2016A020222011), Guangdong special branch plans young talent with scientific and technological innovation (2016TQ03Z985), Guangzhou Science and Technology Project (20171001013). Conflict of interest None declared. References Abiko T , Kotula L, Shiono K, Malik A, Colmer TD, Nakazono M ( 2012 ) Enhanced formation of aerenchyma and induction of a barrier to radial oxygen loss in adventitious roots of Zea nicaraguensis contribute to its waterlogging tolerance as compared with maize (Zea mays ssp. mays) . Plant Cell Environ 35 : 1618 – 1630 . Google Scholar Crossref Search ADS PubMed WorldCat Abiko T , Obara M ( 2014 ) Enhancement of porosity and aerenchyma formation in nitrogen-deficient rice roots . Plant Sci 215–216 : 76 – 83 . Google Scholar Crossref Search ADS PubMed WorldCat Alongi DM ( 2002 ) Present state and future of the world’s mangrove forests . Environ Conserv 29 : 331 – 349 . Google Scholar Crossref Search ADS WorldCat Armstrong J , Armstrong W ( 2005 ) Rice: sulfide-induced barriers to root radial oxygen loss, Fe2+ and water uptake, and lateral root emergence . Ann Bot 96 : 625 – 638 . Google Scholar Crossref Search ADS PubMed WorldCat Armstrong J , Armstrong W, Beckett PM ( 1992 ) Phragmites australis: ventuiri- and humidity-induced pressure flows enhance rhizome aeration and rhizosphere oxidation . New Phytol 120 : 197 – 207 . Google Scholar Crossref Search ADS WorldCat Armstrong W ( 1971 ) Radial oxygen losses from intact rice roots as affected by distance from apex, respiration and waterlogging . Plant Physiol 25 : 192 – 197 . Google Scholar Crossref Search ADS WorldCat Armstrong W , Beckett PM ( 1987 ) Internal aeration and the development of stelar anoxia in submerged. A multishelled mathematical modal combining axial diffusion of oxygen in the cortex with radial losses to the stele, the wall layers and the rhizosphere . New Phytol 105 : 221 – 245 . Google Scholar Crossref Search ADS WorldCat Begg CBM , Kirk GJD, Mackenzie AF, Neue HU ( 1994 ) Root-induced iron oxidation and changes in the lowland rice rhizosphere . New Phytol 128 : 469 – 477 . Google Scholar Crossref Search ADS WorldCat Chen J , Gu JD ( 2017 ) Faunal burrows alter the diversity, abundance, and structure of AOA, AOB, anammox and n-damo communities in coastal mangrove sediments . Microb Ecol 74 : 140 – 156 . Google Scholar Crossref Search ADS PubMed WorldCat Chen J , Zhou HC, Pan Y, Shyla FS, Tam NFY ( 2016 ) Effects of polybrominated diphenyl ethers and plant species on nitrification, denitrification and anammox in mangrove soils . Sci Total Environ 553 : 60 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat Cheng H , Chen DT, Tam NFY, Chen GZ, Li SY, Ye ZH ( 2012a ) Interactions among Fe2+, S2−, and Zn2+ tolerance, root anatomy and radial oxygen loss in mangrove plants . J Exp Bot 63 : 2619 – 2630 . Google Scholar Crossref Search ADS WorldCat Cheng H , Jiang ZY, Liu Y, Ye ZH, Wu ML, Sun CC, Sun FL, Fei J, Wang YS ( 2014 ) Metal (Pb, Zn and Cu) uptake and tolerance by mangroves in relation to root anatomy and lignification/suberization . Tree Physiol 34 : 646 – 656 . Google Scholar Crossref Search ADS PubMed WorldCat Cheng H , Liu Y, Tam NFY, Wang X, Li SY, Chen GZ, Ye ZH ( 2010 ) The role of radial oxygen loss and root anatomy on zinc uptake and tolerance in mangrove seedlings . Environ Pollut 158 : 1189 – 1196 . Google Scholar Crossref Search ADS PubMed WorldCat Cheng H , Wang YS, Fei J, Jiang ZY, Ye ZH ( 2015 ) Differences in root aeration, iron plaque formation and waterlogging tolerance in six mangroves along a continues tidal gradient . Ecotoxicology 242 : 1659 – 1667 . Google Scholar Crossref Search ADS WorldCat Cheng H , Wang YS, Ye ZH, Chen DT, Wang YT, Peng YL, Wang LY ( 2012b ) Influence of N deficiency and salinity on metal (Pb, Zn and Cu) accumulation and tolerance by Rhizophora stylosa in relation to root anatomy and permeability . Environ Pollut 164 : 110 – 117 . Google Scholar Crossref Search ADS WorldCat Clark DA , Brown S, Kicklighter DW, Chambers JQ, Thomlinson JR, Ni J, Holland EA ( 2001 ) Net primary production in tropical forests: an evaluation and synthesis of existing field data . Ecol Appl 11 : 371 – 384 . Google Scholar Crossref Search ADS WorldCat Colmer TD ( 2003a ) Aerenchyma and an inducible barrier to radial oxygen loss facilitate root aeration in upland, paddy and deep-water rice (Oryza sativa L.) . Ann Bot 91 : 301 – 309 . Google Scholar Crossref Search ADS WorldCat Colmer TD ( 2003b ) Long-distance transport of gases in plants: a perspective on internal aeration and radial loss from roots . Plant Cell Environ 26 : 17 – 36 . Google Scholar Crossref Search ADS WorldCat Colmer TD , Pedersen O ( 2008 ) Oxygen dynamics in submerged rice (Oryza sativa) . New Phytol 178 : 326 – 334 . Google Scholar Crossref Search ADS PubMed WorldCat Evans DE ( 2003 ) Aerenchyma formation . New Phytol 161 : 35 – 49 . Google Scholar Crossref Search ADS WorldCat Feller IC , McKee KL, Whigham DF, O’Neill JP ( 2003a ) Nitrogen vs. phosphorus limitation across an ecotonal gradient in a mangrove forest . Biogeochemistry 62 : 145 – 175 . Google Scholar Crossref Search ADS WorldCat Feller IC , Whigham DF, McKee KL, Lovelock CE ( 2003b ) Nitrogen limitation of growth and nutrient dynamics in a disturbed mangrove forest, Indian River lagoon, Florida . Oecologia 134 : 405 – 414 . Google Scholar Crossref Search ADS WorldCat Garthwaite AJ , Armstrong W, Colmer TD ( 2008 ) Assessment of O2 diffusivity across the barrier to radial O2 loss in adventitious roots of Hordeum marinum . New Phytol 179 : 405 – 416 . Google Scholar Crossref Search ADS PubMed WorldCat Gibberd MR , Colmer TD, Cocks PS ( 1999 ) Root porosity and oxygen movement in waterlogging-tolerant Trifolium tomentosum and -intolerant Trifolium glomeratum . Plant Cell Environ 22 : 1161 – 1168 . Google Scholar Crossref Search ADS WorldCat Hawkins BJ , Robbins S, Proter RB ( 2014 ) Nitrogen uptake over entire root systems of tree seedlings . Tree Physiol 34 : 334 – 342 . Google Scholar Crossref Search ADS PubMed WorldCat He CJ , Morgan PW, Drew MC ( 1996 ) Transduction of an ethylene signal is required for cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia . Plant Physiol 112 : 463 – 472 . Google Scholar Crossref Search ADS PubMed WorldCat Henriksen GH , Bloom AJ, Spanswick RM ( 1990 ) Measurement of net fluxes of ammonium and nitrate at the surface of barley roots using ion-selective microelectrodes . Plant Physiol 93 : 271 – 280 . Google Scholar Crossref Search ADS PubMed WorldCat Inoue T , Nohara S, Takagi H, Anzai Y ( 2011 ) Contrast of nitrogen contents around roots of mangrove plants . Plant and Soil 399 : 471 – 483 . Google Scholar Crossref Search ADS WorldCat Jaramillo RE , Nord EA, Chimungu JG, Brown KM, Lynch JP ( 2013 ) Root cortical burden influences drought tolerance in maize . Ann Bot 112 : 429 – 437 . Google Scholar Crossref Search ADS PubMed WorldCat Kirk GJD , Kronzucker HJ ( 2005 ) The potential for nitrification and nitrate uptake in the rhizosphere of wetland plants: a modeling study . Ann Bot 96 : 639 – 646 . Google Scholar Crossref Search ADS PubMed WorldCat Kludze HK , Delaune RD, Patrick WH ( 1993 ) Aerenchyma formation and methane and oxygen exchange in rice . Soil Soc Am J 51 : 368 – 391 . Google Scholar OpenURL Placeholder Text WorldCat Kotula L , Ranathunge K, Schreiber L, Steudle E ( 2009 ) Functional and chemical comparison of apoplastic barriers to radial oxygen loss in roots of rice (Oryza sativa L.) grown in aerated or deoxygenated solution . J Exp Bot 60 : 2155 – 2167 . Google Scholar Crossref Search ADS PubMed WorldCat Kotula L , Schreiber L, Colmer TD, Nakazono M ( 2017 ) Anatomical and biochemical characterisation of a barrier to radial O2 loss in adventitious roots of two contrasting Hordeum marinum accessions . Funct Plant Biol 44 : 845 – 857 . Google Scholar Crossref Search ADS PubMed WorldCat Krauss KW , Lovelock CE, Mckee KL, Lopez-Hoffman HL, Ewe SML, Sousa WP ( 2008 ) Environmental drivers in mangrove establishment and early development: a review . Aquat Bot 89 : 105 – 127 . Google Scholar Crossref Search ADS WorldCat Krishnamurthy P , Jyothi-Prakash PA, Qin L, He J, Lin QS, Loh CS, Kumar PP ( 2014 ) Role of hydrophobic barriers in salt exclusion of a mangrove plant Avicennia officinalis . Plant Cell Environ 37 : 1656 – 1671 . Google Scholar Crossref Search ADS PubMed WorldCat Kronzucker HJ , Glass ADM, Siddiqi MY, Kirk GJD ( 2000 ) Comparative kinetic analysis of ammonium and nitrate acquisition by tropical lowland rice: implications for rice cultivation and yield potential . New Phytol 145 : 471 – 476 . Google Scholar Crossref Search ADS WorldCat Kronzucker HJ , Siddiqi MY, Glass ADM, Kirk GJD ( 1999 ) Nitrate-ammonium synergism in rice: a subcellular flux analysis . Plant Physiol 119 : 1041 – 1046 . Google Scholar Crossref Search ADS PubMed WorldCat Kulichikhin K , Yamauchi T, Watanabe K, Nakazono M ( 2014 ) Biochemical and molecular characterization of rice (Oryza sativa L.) roots forming a barrier to radial oxygen loss . Plant Cell Environ 37 : 2406 – 2420 . Google Scholar PubMed OpenURL Placeholder Text WorldCat Li YL , Fan XR, Shen QR ( 2008 ) The relationship between rhizosphere nitrification and nitrogen-use efficiency in rice plants . Plant Cell Environ 31 : 73 – 85 . Google Scholar PubMed OpenURL Placeholder Text WorldCat Lin YM , Liu XW, Zhang H, Fan HQ, Lin GH ( 2010 ) Nutrient conservation strategies of a mangrove species Rhizophora stylosa under nutrient limitation . Plant and Soil 326 : 469 – 479 . Google Scholar Crossref Search ADS WorldCat Loreti E , Veen H, Perata P ( 2016 ) Plants responses to flooding stress . Curr Opin Plant Biol 33 : 64 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat Lovelock CE , Cahoon DR, Friess DA et al. ( 2015 ) The vulnerability of indo-Pacific mangrove forests to sea-level rise . Nature 526 : 559 – 563 . Google Scholar Crossref Search ADS PubMed WorldCat Lovelock CE , Feller IC, McKee KL, Thompson R ( 2005 ) Variation in mangrove forest structure and sediment characteristics in Bocas del Toro, Panama . Caribb J Sci 41 : 456 – 464 . Google Scholar OpenURL Placeholder Text WorldCat Lu HL , Yan CL, Liu JC ( 2007 ) Low-molecular-weight organic acids exuded by mangrove (Kandelia candel (L.) Druce) roots and their effect on cadmium species change in the rhizosphere . Environ Exp Bot 61 : 159 – 166 . Google Scholar Crossref Search ADS WorldCat Luo J , Li H, Liu TX, Polle A, Peng CH, Luo ZB ( 2013 ) Nitrogen metabolism of two contrasting poplar species during acclimation to limiting nitrogen availability . J Exp Bot 64 : 4207 – 4224 . Google Scholar Crossref Search ADS PubMed WorldCat Lyu HM , He ZW, Wu CI, Shi SH ( 2018 ) Convergent adaptive evolution in marginal environments: unloading transposable elements as a common strategy among mangrove genomes . New Phytol 217 : 428 – 438 . Google Scholar Crossref Search ADS PubMed WorldCat McDonald MP , Calwey NW, Colmer TD ( 2002 ) Similarity and diversity in adventitious root anatomy as related to root aeration among a range of wetland and dryland grass species . Plant Cell Environ 25 : 441 – 451 . Google Scholar Crossref Search ADS WorldCat Mei XQ , Yang Y, Tam NFY, Wang YW, Li L ( 2014 ) Role of root porosity, radial oxygen loss, Fe plaque formation on nutrient removal and tolerance of wetland plants to domestic wastewater . Water Res 50 : 147 – 159 . Google Scholar Crossref Search ADS PubMed WorldCat Miyamoto N , Steudle E, Hirasawa T, Lafitte R ( 2001 ) Hydraulic conductivity of rice roots . J Exp Bot 52 : 1835 – 1846 . Google Scholar Crossref Search ADS PubMed WorldCat Nielsen OI , Kristensen E, Macintosh DJ ( 2003 ) Impact of fiddler crabs (Uca spp.) on rates and pathways of benthic mineralization in deposited mangrove shrimp pond waste . J Exp Mar Boil Ecol 289 : 59 – 81 . Google Scholar Crossref Search ADS WorldCat Patel NT , Gupta A, Pandey AN ( 2010 ) Salinity tolerance of Avicennia marina (Forssk.) Vierh. From Gujarat coasts of India . Aquat Bot 93 : 9 – 16 . Google Scholar Crossref Search ADS WorldCat Peters EC , Gassman NJ, Firman JR, Richmond H, Power EA ( 1997 ) Ecotoxicology of tropical marina ecosystems . Environ Toxicol Chem 16 : 12 – 40 . Google Scholar Crossref Search ADS WorldCat Phukan UJ , Mishra S, Shukla RK ( 2016 ) Waterlogging and submergence stress: affects and acclimation . Crit Rev Biotechnol 36 : 956 – 966 . Google Scholar Crossref Search ADS PubMed WorldCat Pi N , Tam NFY, Wong MH ( 2010 ) Effects of wastewater discharge on Fe plaque on root surface and radial oxygen loss of mangrove roots . Environ Pollut 158 : 381 – 387 . Google Scholar Crossref Search ADS PubMed WorldCat Pi N , Tam NFY, Wu Y, Wong MH ( 2009 ) Root anatomy and spatial pattern of radial oxygen loss of eight true mangrove species . Aquat Bot 90 : 222 – 230 . Google Scholar Crossref Search ADS WorldCat Piou C , Feller IC, Berger U, Chi F ( 2006 ) Zonation patterns of Belizean offshore mangrove forests 41 years after a catastrophic hurricane . Biotropica 38 : 365 – 374 . Google Scholar Crossref Search ADS WorldCat Pollard M , Beisson F, Li YH, Ohlrogge JB ( 2008 ) Building lipid barriers: biosynthesis of cutin and suberin . Trends Plant Sci 13 : 236 – 246 . Google Scholar Crossref Search ADS PubMed WorldCat Ponnamperuma FN ( 1984 ) Effect of flooding on soils. In: Kozlowski T (ed) Flooding and Plant Growth . Academic Press , New York, USA , pp 9 – 45 . Google Scholar Crossref Search ADS Google Preview WorldCat COPAC Postma JA , Lynch JP ( 2011 ) Root cortical aerenchyma enhances the growth of maize on soils with suboptimal availability of nitrogen, phosphorus, and potassium . Plant Physiol 156 : 1190 – 1201 . Google Scholar Crossref Search ADS PubMed WorldCat Provost GL , Lesur I, Lalanne C, Silva CD, Labadie K, Aury JM, Leple JC, Plomion C ( 2016 ) Implication of the suberin pathway in adaptation to waterlogging and hypertrophied lenticels formation in pedunculate oak (Quercus robur L) . Tree Physiol 36 : 1330 – 1342 . Google Scholar PubMed OpenURL Placeholder Text WorldCat Rajhi I , Yamauchi T, Takahashi H et al. ( 2011 ) Identification of genes expressed in maize root cortical cells during lysigenous aerenchyma formation using laser microdissection and microarray analyses . New Phytol 190 : 351 – 368 . Google Scholar Crossref Search ADS PubMed WorldCat Raman DR , Spanswick RM, Walker LP ( 1995 ) The kinetics of nitrate uptake from lowing nutrient solutions by rice: influence of pretreatment and light . Bioresource Techn 53 : 125 – 132 . Google Scholar Crossref Search ADS WorldCat Ranathunge K , Schreiber L, Bi YM, Rothstein SJ ( 2016 ) Ammonium-induced architectural and anatomical changes with altered suberin and lignin levels significantly change water and solute permeabilities of rice (Oryza sativa L.) roots . Planta 243 : 231 – 249 . Google Scholar Crossref Search ADS PubMed WorldCat Reef R , Feller IC, Lovelock CE ( 2010 ) Nutrition of mangroves . Tree Physiol 30 : 1148 – 1160 . Google Scholar Crossref Search ADS PubMed WorldCat Reis CRG , Nardoto GB, Oliveira RS ( 2017 ) Global overview on nitrogen dynamics in mangrove sand consequences of increasing nitrogen availability for these systems . Plant and Soil 410 : 1 – 19 . Google Scholar Crossref Search ADS WorldCat Saengwilai P , Nord EA, Chimungu JG, Brown KM, Lynch JP ( 2014 ) Root cortical aerenchyma enhances nitrogen acquisition from low-nitrogen soils in maize . Plant Physiol 166 : 726 – 735 . Google Scholar Crossref Search ADS PubMed WorldCat Schreiber L , Franke R, Hartmann K ( 2005 ) Effect of NO3− deficiency and NaCl stress on suberin deposition rhizo- and hypodermal and endodermal cell walls of castor bean (Ricinus communis L.) roots . Plant and Soil 269 : 333 – 339 . Google Scholar Crossref Search ADS WorldCat Shiau YJ , Lee SC, Chen TH, Tian GL, Chiu CY ( 2017 ) Water salinity effects on growth and nitrogen assimilation rate of mangrove (Kandelia candel) seedlings . Aquat Bot 137 : 50 – 55 . Google Scholar Crossref Search ADS WorldCat Soukup A , Armstrong W, Schreiber L, Franke R, Votrubová O ( 2007 ) Apoplastic barriers to radial oxygen loss and solute penetration: a chemical and functional comparison of the exodermis of two wetland species, Phragmites australis and Glyceria maxima . New Phytol 173 : 264 – 278 . Google Scholar Crossref Search ADS PubMed WorldCat Stephen RC , Isaac RS, Dylan RB, Luciana MS, Michelle L, Christian J ( 2017 ) Mangrove sediments reveal records of development during the previous century (Coffs Creek estuary, Australia) . Mar Pollut Bull 122 : 441 – 445 . Google Scholar Crossref Search ADS PubMed WorldCat Sun J , Chen S, Dai S et al. ( 2009 ) NaCl-induced alternations of cellular and tissue ion fluxes in roots of salt-resistant and salt sensitive poplar species . Plant Physiol 149 : 1141 – 1153 . Google Scholar Crossref Search ADS PubMed WorldCat Sun L , Lu Y, Yu F, Kronzucker HJ, Shi W ( 2016 ) Biological nitrification inhibition by rice root exudates and its relationship with nitrogen-use efficiency . New Phytol 212 : 646 – 656 . Google Scholar Crossref Search ADS PubMed WorldCat Sundgren TK , Uhlen AK, Lillemo M, Briese C, Wojciechowski T ( 2018 ) Rapid seedling establishment and a narrow root stele promotes waterlogging . J Plant Physiol 227 : 45 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat Thomas R , Fang XX, Ranathunge K, Anderson TR, Peterson CA, Bernard A ( 2007 ) Soybean root suberin: anatomical distribution, chemical composition, and relationship to partial resistance to Phytophthora sojae . Plant Physiol 144 : 311 . Google Scholar Crossref Search ADS WorldCat Urrego LE , Polania J, Buitrago MF, Cuartas LF, Lema A ( 2009 ) Distribution of mangroves along environmental gradients on San Andres Island (Colobian Caribbean) . B Mar Sci 85 : 27 – 43 . Google Scholar OpenURL Placeholder Text WorldCat Visser ED , Colmer TD, Blom CWPM, Voesenk LACJ ( 2000 ) Change in growth, porosity, and radial oxygen loss from adventitious roots of selected mono- and dicotyledonous wetland species with contrasting types of aerenchyma . Plant Cell Environ 23 : 1237 – 1245 . Google Scholar Crossref Search ADS WorldCat Wang WQ , Li XF, Wang M ( 2019 ) Propagules dispersal determines mangrove zonation at intertidal and estuarine scales . Forests 10 : 245 . Google Scholar Crossref Search ADS WorldCat Wang YF , Gu JD ( 2013 ) Higher diversity of ammonia/ammonium-oxidizing prokaryotes in constructed freshwater wetland than natural coastal marina wetland . Appl Microbiol Biotechnol 97 : 7015 – 7033 . Google Scholar Crossref Search ADS PubMed WorldCat Xiao K , Wu JP, Li HL, Hong YG, Wilson AM, Jiao JJ, Shananan M ( 2018 ) Nitrogen fate in a subtropical mangrove swamp: potential association with seawater-groundwater exchange . Sci Total Environ 635 : 586 – 597 . Google Scholar Crossref Search ADS PubMed WorldCat Xu QT , Yang L, Zhou ZQ, Mei FZ, Qu LH, Zhou GS ( 2013 ) Process of aerenchyma formation and reactive oxygen species induced by waterlogging in wheat seminal roots . Plant and Soil 238 : 969 – 982 . Google Scholar OpenURL Placeholder Text WorldCat Yamauchi T , Colmer TD, Pedersen O, Nakazono M ( 2018 ) Regulation of root traits for internal aeration and tolerance to soil waterlogging-flooding stress . Plant Physiol 176 : 118 – 1130 . Google Scholar Crossref Search ADS WorldCat Yamauchi T , Shiono K, Nagano M et al. ( 2015 ) Ethylene biosynthesis is promoted by very-long-chain fatty acids during lysigenous aerenchyma formation in rice roots . Plant Physiol 169 : 180 – 193 . Google Scholar Crossref Search ADS PubMed WorldCat Ye Y , Tam NFY ( 2002 ) Growth and physiological responses of Kandelia candel and Bruguiera gymnorrhiza to livestock wastewater . Hydrologia 479 : 75 – 81 . Google Scholar OpenURL Placeholder Text WorldCat Ye Y , Tam NFY, Lu CY, Wong YS ( 2005 ) Effects of salinity on germination, seedling growth and physiology of three salt-secreting mangrove species . Aquat Bot 83 : 193 – 205 . Google Scholar Crossref Search ADS WorldCat Yoo YH , Choi HK, Jung KH ( 2015 ) Genome-wide identification and analysis of genes associated with lysigenous aerenchyma formation in rice roots . J Plant Biol 58 : 117 – 127 . Google Scholar Crossref Search ADS WorldCat Youssef T , Saenger P ( 1996 ) Anatomical adaptive strategies to flooding and rhizosphere oxidation in mangrove seedlings . Aust J Bot 44 : 297 – 313 . Google Scholar Crossref Search ADS WorldCat Zeier J , Goll A, Yokoyama M, Karahara I, Schreiber L ( 1999 ) Structure and chemical composition of endodermal and rhizodermal/hypodermal walls of several species . Plant Cell Environ 22 : 271 – 279 . Google Scholar Crossref Search ADS WorldCat Zhang CX , Meng S, Yiming L, Zhao Z ( 2014 ) Net NH4+ and NO3− fluxes, and expression of NH4+ and NO3− transporter genes in roots of Populus simonii after acclimation . Trees 28 : 1813 – 1821 . Google Scholar Crossref Search ADS WorldCat Zheng D , Han X, An Y, Guo H, Xia X, Yin W ( 2013 ) The nitrate transporter NRT2.1 functions in the ethylene response to nitrate deficiency in Arabidopsis . Plant Cell Environ 36 : 1328 – 1337 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permission@oup.com. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Radial oxygen loss is correlated with nitrogen nutrition in mangroves
JO - Tree Physiology
DO - 10.1093/treephys/tpaa089
DA - 2020-10-29
UR - https://www.deepdyve.com/lp/oxford-university-press/radial-oxygen-loss-is-correlated-with-nitrogen-nutrition-in-mangroves-fESoK0FeLE
SP - 1548
EP - 1560
VL - 40
IS - 11
DP - DeepDyve
ER -